help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shah, P.
Right arrow Articles by Duckworth, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shah, P.
Right arrow Articles by Duckworth, M. L.
Endocrinology Vol. 139, No. 3 967-973
Copyright © 1998 by The Endocrine Society

ARTICLES

Rat Placental Lactogen II Gene: Characterization of Gene Structure and Placental-Specific Expression1

Paresh Shah, Yuxiang Sun, Claude Szpirer and Mary Lynn Duckworth

Department of Physiology (P.S., Y.S., M.L.D.), University of Manitoba, Winnipeg, R3E 3J7, Manitoba, Canada; Departement de Biologie Moléculaire (C.S.), Université Libre de Bruxelles, B-1640 Rhode-St-Genese, Belgium

Address all correspondence and requests for reprints to: Mary Lynn Duckworth, Department of Physiology, University of Manitoba, Faculty of Medicine, 730 William Avenue, Winnipeg, R3E 3J7, Manitoba, Canada. E-mail: mdckwth{at}cc.umanitoba.ca


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Rat placental lactogen II (rPLII) was the first described member of the rat PRL-like placental gene family in which nine novel proteins have now been identified. In this article, we present data on the isolation and characterization of the rPLII gene. Two genomic clones, GC I (18.5 kb) and GC II (9.4 kb), were isolated from an EMBL3 Sprague-Dawley rat liver genomic DNA library. GC I, which was used for further analysis, contains the entire coding region and extensive 5' and 3' flanking information. The rPLII gene, estimated to be 5.4 kb in size, has the same five-exon and four-intron structure and identical intron/exon splice sites and types as the rPRL gene. A major transcription start site 58 bp upstream of the initiator methionine codon and several minor sites 1–3 bp 5' and 3' of this site were identified by primer extension of day 18 placental messenger RNA. The rPLII gene has been localized to chromosome 17, using a series of hybrid cell lines derived from mouse hepatoma cells (MWTG3) and adult rat hepatocytes; this is the same chromosome designation as the PRL gene itself and other cloned placental members of this gene family. Luciferase reporter constructs containing 5' flanking DNA sequences were tested in transient transfection assays in the rat choriocarcinoma cell line, Rcho, and the rat pituitary GC cell line. Both a 4.5- and 3-kb 5' flanking sequence supported luciferase expression in the Rcho but not the GC cells. A 765-bp fragment showed no activity in either cell type. Transient transgenic mice, generated with the 3-kb 5' rPLII/luciferase construct, expressed varying amounts of luciferase expression in the placenta.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE developing rat placenta is a rich source of novel members of the PRL family of hormones. To date, nine new proteins have been identified and characterized that are expressed during pregnancy in a developmentally specific manner in the fetal placenta and in some cases, maternal decidua (1, 2, 3, 4, 5, 6, 7, 8, 9, 10). These proteins were originally classified as members of the PRL gene family on the basis of the similarity of their deduced primary sequences to PRL. It has been speculated that this gene family has arisen through gene duplication events at the PRL locus. Recently the intron/exon structures of two of these rat placental genes, rat PRL (rPRL)-like protein C variant (rPLP-Cv) (10) and decidual/trophoblast PRL-related protein (d/tPRP) (11), have been reported that demonstrate the relatedness of their genomic structure to that of PRL. In this article, we present data on the intron/exon structure of the rat placental lactogen II (rPLII) gene, the original member of these rat placental proteins to be cloned (3), that show that it also has a marked similarity to the PRL gene. We also provide evidence that rPLII is located on the same chromosome as PRL, further supporting the theory that these placental genes are located in a large gene locus similar to that identified for the human placental lactogen-GH gene family. Using transfection assays and transient transgenic mouse experiments, we demonstrate that sequences in the 5' flanking region of the rPLII gene have an important role in placental cell-specific expression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
Some restriction enzymes, Klenow DNA polymerase, T4 DNA ligase, were from Pharmacia (Baie d’Urfé, Québec, Canada); FBS, RPMI-1640 medium, DMEM, sodium pyruvate, HEPES, penicillin/streptomycin, trypsin/EDTA, NUNC culture dishes and flasks, agarose, some restriction enzymes and NACS columns were from Gibco/BRL (Burlington, Ontario, Canada); NCTC-135 medium was from Sigma-Aldrich (Oakville, Ontario, Canada); nick-translation DNA labeling kits and Sequenase kits were from Amersham (Oakville, Ontario, Canada); luciferase assays kits and reporter lysis buffer were from Promega (Madison, WI); Nitroplus membrane, guanidine isothiocyanate, and general laboratory chemicals were from Fisher-Scientific (Nepean, Ontario, Canada) and VWR Scientific (Toronto, Ontario, Canada); [32P]dCTP [35S]dATP were from Mandel Scientific (Guelph, Ontario, Canada); and Bio-Rad protein assay reagent was from Bio-Rad Labs (Mississauga, Ontario, Canada).

Cell lines
The rat choriocarcinoma Rcho cell line (12) was kindly provided by Drs. A. Verstuyf and M. Vandeputte, Rega Institute for Medical Research, Catholic University of Louvain, Louvain, Belgium. The rat pituitary GC cell line (13) was a gift from Dr. P. A. Cattini (Department of Physiology, University of Manitoba, Winnipeg, Canada).

Clones and vectors
The rPLII cDNA clones were as described in Duckworth et al. (3). Other vectors and clones were generously provided as follows: luciferase vector pXP2 (14), a cytomegalovirus promoter/luciferase construct (CMVp.luc), by Dr. R. J. Matusik (Department of Urologic Surgery, Vanderbilt University, Nashville, TN); and a cytomegalovirus promoter/chloramphenicol transacetylase (CAT) construct (pcDNA3.cat), by Dr. R. P. C. Shiu (Department of Physiology, University of Manitoba, Winnipeg, Canada).

Isolation and characterization of rPLII-{lambda} genomic clones
Greater than 106 plaques from an adult male rat liver genomic library constructed in the {lambda} vector EMBL3 (a gift from Dr. M. Crerar, York University, Toronto, Canada) were screened using the rPLII cDNA clone, pRP52A (3). The genomic DNA had been partially digested with Sau3A and cloned into the BamHI site of the vector. Plaques were grown on the Escherichia coli strain, WA803, and blotted onto nitrocellulose filters using standard procedures (15). Hybridizations were carried out as previously described (3). Two positive clones, designated GC I and GC II, were identified, and the plaques purified to homogeneity through three successive rounds of screening. Phage DNA was isolated from liquid cultures (15), and the clones were digested with SalI; each clone was released as a single fragment from the {lambda} arms.

Further restriction enzyme digests were carried out as indicated to generate restriction enzyme maps. Digests were blotted and hybridized with pRP 52A as well as with rPLII cDNA subclones that contained only 5' or 3' sequences to determine the locations of exons and the extent of flanking sequences.

Fragments from regions that hybridized to the cDNA clones were subcloned into M13 mp18 or mp19 (16) for sequencing to determine intron/exon boundaries and to identify 5' and 3' flanking sequences. Sequencing was carried out by the dideoxy chain termination method (17) using a Sequenase kit (Amersham) and [35S]dATP. A PvuII fragment containing 5' flanking information was also subcloned and sequenced.

Identification of transcription start site
A synthetic oligonucleotide complementary to nucleotides 28–48 in the rPLII coding region (5' CATAAGGAGTGTCCCAGAGAA 3') was end-labeled using [32P{gamma}]ATP and T4 polynucleotide kinase (18). Primer extension was carried out as described previously (7). Products were separated on a 6% polyacrylamide/urea gel. Markers were HinfI and HpaII cut pAT153 end-labeled with Klenow DNA polymerase.

Chromosomal localization of rPII gene
DNA from a series of hybrid cell lines, derived from the fusion of mouse hepatoma cells (BWTG3) and adult rat hepatocytes (19), were used to determine the chromosomal localization of the rPLII gene. The various lines contain different complements of rat chromosomes in addition to the mouse chromosomes. These hybrids have been used previously to assign rPRL and GH (20) as well as other rPRL-like placental genes (8, 9, 10, 11, 21, 22). Genomic DNA from each cell line was digested with HindIII, separated on 0.8% agarose gels, and analyzed for the presence of the rPLII gene by Southern blot hybridization to the pRP52A clone (23). HindIII digestion provides two diagnostic fragments that allow differentiation of the rat and mouse PLII (mPLII) genes.

rPLII 5' flanking constructs
A 5' PvuII fragment from position -765 to +64 was cloned into the SmaI site of pBluescript SK (Stratagene, La Jolla, CA) in a 3' to 5' orientation to form the clone designated -765rPLIIpBsp. This fragment was excised using a HindIII/BamHI digest and ligated into the HindIII/BglII digested luciferase vector pXP2 (14) to give the clone designated -765rPLIIp.Luc.

The rPLII genomic GC I clone was digested with HindIII/EcoRV to produce a fragment containing 5' flanking information from approximately -4500 to -118. This fragment was ligated to HindIII/EcoRV digested -765rPLIIpBsp to produce -4.5rPLIIpBsp. The 4.5-kb fragment was excised by HindIII/BamHI digestion and cloned into HindIII/BglII cut pXP2 to produce -4.5rPLIIp.Luc. This luciferase reporter clone contains 5' genomic information from approximately -4500 to +64.

A SacI/BamHI fragment from -4.5rPLIIpBsp was cloned into SacI/BglII cut pXP2 to form -3.0 rPLIIp.Luc, which contains rPLII 5' information from approximately -3000 to +64.

All fragments were isolated by electroporation after separation on agarose gels. All new constructs were sequenced across the ligation sites to confirm orientation and correct ligations.

Cell culture and transient transfection assays
The Rcho cells were grown routinely on RPMI-1640 medium containing HEPES buffer, supplemented with heat-inactivated 20% FBS, 1 mM sodium pyruvate, 50 µM ß-mercaptoethanol, 50 U/ml streptomycin, and 50 µg/ml penicillin. Medium was changed every other day, and cells were split before confluency, every 3 days, using trypsin/EDTA.

Monolayer rat pituitary GC cells were grown in DMEM as described in Cattini and Eberhardt (24).

The Rcho cells were transfected using the calcium phosphate method essentially as described in Vuille et al. (25). Transfections were routinely carried out in 10-cm dishes using 10 µg test plasmids and 1 µg CMVp.cat for determining transfection efficiency. Cells were transfected at day 14 after plating, when the cultures contained large numbers of giant cells and were expressing rPLII mRNA (26).

The rat anterior pituitary GC cells were grown to 40–50% confluency and transfected as described in Nickel et al. (27).

Cell extracts were prepared as previously described except that reporter lysis buffer (Promega) was used (25). Luciferase assays were carried out immediately after lysate preparation using a Promega Luciferase Assay kit according to manufacturer’s instructions. Activity was measured in relative light units using a TROPIX luminometer. The CAT activity was measured by the two-phase fluor diffusion assay (27). To standardize for variations in plasmid uptake, all luciferase activities were normalized to the CAT assay data for the same sample. Protein determinations were carried out using Bio-Rad protein assay reagent according to the manufacturer’s protocol. Standardized luciferase activity is expressed in relative light units per milligram protein.

Statistical significance was established using an unpaired student’s t test analyzed in the SigmaStat program.

Transient transgenic mouse analysis of rPLII 5' flanking DNA
A fragment containing the 3-kb 5' flanking rPLII/luciferase sequences was excised from the clone -3.0 rPLII.pluc by a SacI/PstI digestion; the fragment was isolated from an agarose gel followed by electroelution and further purified on a NACS column (Gibco/BRL). Insert at a concentration of 3 ng/µl was injected into the pronucleus of one cell CD1 mouse embryos according to standard protocols (28). Injected embryos were replaced into the oviducts of day 1 pseudopregnant CD1 females. The females were killed on days 14–16 of pregnancy, and the fetuses and placentas were collected for analysis.

Fetal/placental tissue was analyzed for the presence of the transgene using Southern blot hybridization (23). Ten micrograms of DNA from an individual fetus or placenta was digested with EcoRV, electrophoresed on a 0.8% agarose gel, and blotted onto Nitroplus membrane. The insert from -3.0 rPLII.pluc was labeled with [32P]deoxycytidine triphosphate and hybridized to the blots using standard conditions (15). An internal EcoRV fragment that crosses the rPLII 5' and luciferase boundary produces a diagnostic 2-kb band for the identification of transgenic animals (data not shown).

Tissue extracts were made from all placentas and separately from head, thorax, and abdominal regions of transgenic fetuses. Several nontransgenic fetuses were also tested as negative controls. Forty to sixty milligrams of tissue were extracted in 250 µl 0.1 M Tris pH 7.8/0.1% Triton buffer using a 1-ml glass tissue homogenizer. Cell debris was removed by centrifugation, and luciferase assays were carried out as described for cell cultures. All procedures involving animals were carried out according to protocols approved by the Animal Care Committee, University of Manitoba.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
rPLII gene structure
The two rPLII clones, GC I and GC II, were released as single fragments by digestion with SalI. A restriction enzyme map of the GC I clone, indicating the locations of the five exons, is summarized in Fig. 1Go. The GC I clone is approximately 18.5 kb in length and contains the entire rPLII coding region as well as 5' and 3' flanking information. The GC II clone is approximately 9.4 kb in length; this clone is missing the first two exons and a portion of exon 3 but contains more 3' flanking information than GC I (data not shown). An EcoRI digests divides the GC I clone into five fragments: an approximately 4-kb EcoRI fragment contains the first three exons, a 1.5-kb fragment contains the 5' half of exon 4, a 2.5-kb fragment contains the 3' half of exon 4 and exon 5. The estimated size of the rPLII gene on the basis of these data are 5.4 kb, which places it between rat GH (rGH) (2.1 kb) (29) and rPRL (10.5 kb) (30, 31) in size.



View larger version (9K):
[in this window]
[in a new window]
  		Figure 1. Restriction enzyme map of rPLII genomic clone, GC I. Scale is given in kilobases. Five exons are represented by black boxes; intron D, which contains Alu repetitive sequences, is shown as a hatched box. SalI sites at either end of clone flank {lambda} EMBL3 cloning cassette. A 9.4-kb GC II clone, which is not illustrated, begins within intron C and contains approximately 2 kb more 3' flanking information than GC I. Restriction enzyme sites are designated as follows: E, EcoRI; H, HindIII; S, SacI; Pv, PvuII; ERV, EcoRV; P, PstI.

 
Features of the rPLII gene are illustrated in Fig. 2Go. All intron/exon boundaries show the consensus GT and AG splice sequences (32). The junction between exon 1 and intron A is of the type 1 class, splitting a serine codon between the first and second nucleotide (33). All other splice junctions are of type 0, falling between codons. The type 1 splice junction at the first intron/exon boundary is characteristic of all members of the rGH-rPRL family of genes, for which information is available (10, 11, 30, 34, and this study). The complete sequence is given for intron B; other intron sizes have been estimated from restriction enzyme digest and sequence information.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 2. Features of rPLII gene. Transcribed regions of gene are shown in uppercase letters; translated sequences are indicated in single letter codes, and amino acids are numbered from start of secreted form of protein. 5' and 3' flanking and intron sequences are shown in lowercase letters. Transcription start site as determined by primer extension is indicated by a bent arrow. Position of oligonucleotide that was used for primer extension is indicated by heavy black line and arrowhead. Putative TATA box is shown in open box. Sizes of introns are estimated from sequence determination and restriction enzyme digests. Entire sequence of intron B is given. Italicized sequence in 5' flanking region denotes a sequence that has homology to microsatellite sequences (35). Two putative polyadenylation signal sequences that were previously identified in cDNA sequence are underlined (3).

 
The autoradiograph of the products synthesized from the primer extension of day 18 rat placental mRNA are shown in Fig. 3Go. There is one major start site 58 nucleotides upstream of the initiator methionine codon, with a group of minor start sites one to three bases immediately 5' and 3' of this nucleotide. The primary transcription initiation start site is indicated by an arrow in Fig. 2Go. A consensus TATA sequence (tatatat) is located 30 nucleotides upstream of this site.



View larger version (51K):
[in this window]
[in a new window]
  		Figure 3. Primer extension determination of rPLII transcription start site. An end-labeled oligonucleotide complementary to nucleotides 28–48 in rPLII coding sequence was used to extend day 18 rat placental mRNA. cDNA products were separated on a 6% polyacrylamide/urea sequencing gel. Lanes 1 and 2 are HinfI and HpaII end-labeled pAT153 size markers, respectively. Lanes 3 and 5 show primer-extended placental mRNA products. Lane 4 is a control reaction with yeast transfer RNA. A prominent band is seen at 106 nucleotides, with other minor bands one to three nucleotides 5' and 3'of this position. This band represents a major start site 58 nucleotides 5' of initiator methionine codon.

 
The 5' flanking region contains a highly repetitive region of DNA that consists of four GATA sequences flanked by ten (5') and twelve (3') GA repeats, which are reminiscent of microsatellite DNA sequences (35). In addition, exon D contains repetitive DNA sequences that hybridize to the BLUR 8 human Alu short interspersed repetitive element (SINE) family of DNA sequences (36) (data not shown). This intron in the rPRL gene has also been reported to contain repetitive Alu elements (30).

Chromosomal assignment of rPLII gene
DNAs from a series of mouse/rat somatic cell hybrid lines that contain different complements of rat chromosomes were digested with HindIII and analyzed for the presence of the rPLII gene by the hybridization of Southern blots to an rPLII cDNA clone. The HindIII digestion gave a characteristic pattern that distinguished between the rat and mouse PLII genes (data not shown). A summary of the results is shown in Table 1Go. Only chromosome 17 showed no discordancies, which is consistent with the localization of the rPLII gene to this chromosome. The rPRL, rPLI, rPLIv, rPLP-C, rPLP-Cv, and d/trPRP genes have previously been localized to chromosome 17 using these cell hybrid lines (8, 9, 10, 11, 21, 22). We have unpublished data that also show localization of the rPLP-A and rPLP-B genes to chromosome 17.


View this table:
[in this window]
[in a new window]
  		Table 1. Chromosomal assignment of rPLII gene

 
Placental cell-specific expression of rPLII gene
A series of constructs were made that contained varying amounts of rPLII 5' flanking sequences upstream of the luciferase reporter gene in the vector, pXP2 (14). All rPLII 5' flanking fragments end with the PvuII site at +64 between the second and third codon. Transfection assays were carried out in the rat trophoblast cell line, Rcho (12), and the rat pituitary cell line, GC, which expresses rPRL and rGH (13) but not rPLII. The results are shown in Fig. 4Go. Constructs containing a 4.5-kb HindIII/PvuII and a 3-kb SacI/PvuII fragment express luciferase at similar levels in the Rcho cell line. The construct containing the 5' PvuII fragment from -765 to +64 showed essentially no luciferase activity above the vector background in Rcho cells. None of the 5' flanking constructs expressed in GC cells. These experiments suggest that sequences between -765 and approximately -3000 are important in the placental-specific expression of rPLII. Studies are currently underway to identify the specific sequences involved in this regulation.



View larger version (14K):
[in this window]
[in a new window]
  		Figure 4. Hybrid rPLII/luciferase expression in Rcho and GC cells. Luciferase reporter constructs containing varying amounts of rPLII 5' flanking DNA were constructed as described and transiently transfected into differentiated rat placental Rcho or rat pituitary GC cultures and assayed for luciferase activity. All 5' flanking constructs begin at nucleotide +64; -p.Luc denotes promoterless vector, pXP2; N-T Cells denotes nontransfected cells. Promoter activity is expressed as light units per milligrams protein (mean ± SEM). All values are corrected for plasmid uptake as described in Materials and Methods. Results are from four separate experiments (n = 12 for each construct; n = 6 for nontransfected cells). Statistical significance (*, P < 0.05) was established by an unpaired Student’s t test.

 
To test whether sequences within the 3-kb 5' flanking fragment were sufficient to target reporter gene expression specifically to the placenta, the -3.0 rPLIIpluc construct was tested in a transient transgenic mouse assay. Pronuclei of one cell mouse embryos were injected with this insert, and placenta and fetal tissues were collected at days 14–16 and tested for expression of the luciferase reporter gene. Nine placenta out of 45 were transgenic, and all had varying amounts of luciferase activity. The results are summarized in Table 2Go. Matched fetuses for transgenic placenta in general showed no activity or only very low luciferase activity. In two fetuses, however, all three body regions showed luciferase activity; in one of these animals expression levels were at least an order of magnitude higher than placenta. There appeared to be no correlation between level of expression and copy number as estimated from Southern blots (data not shown). There also appeared to be no correlation between level of expression in the placenta, and whether expression was detected in the fetus.


View this table:
[in this window]
[in a new window]
  		Table 2. Luciferase activity in transgenic placentas and fetuses

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The data presented in this article are consistent with, and strengthen considerably, the hypothesis that the rPLII gene has arisen as a result of gene duplication events at the PRL locus. The rPLII gene has the same five-exon and four-intron structure found in rPRL and GH, with intron/exon boundaries occurring at comparable locations within the coding region. This structure is very similar to that reported for the rat PLP-Cv and d/tPRP genes (10, 11) but lacks the extra small exon and intron found in those genes. The types of individual splice sites are the same as the rPRL (30, 34), rPLP-Cv (10), and d/tPRP (11) genes and the mPLII gene (37). The first intron/exon boundary is a class I type, falling between the first and second nucleotide of a serine codon; all other splice sites come between codons (class 0) (34).

We estimate the total size of the rPLII gene to be 5.4 kb, which is smaller than PRL (10.5 kb) but larger than the rGH gene (2.1 kb). It is more similar in size to the rPLP-Cv gene, which we estimate from published data to be approximately 7 kb (10). The differences among these genes is due largely to the sizes (and in the case of rPLP-Cv, the number) of introns.

Our data demonstrate that the rPLII gene is located on chromosome 17, the same chromosome as the PRL gene and the other placental members of the PRL family that have been cloned. It is interesting to note that intron D of the rPLII gene, like the rPRL gene, also contains Alu-like repetitive sequences. The conservation of detailed gene structure and chromosome location are powerful evidence for the evolution of rPLII and these other placental PRL-like genes from an ancestral PRL gene. The recent localization of the rPRL gene more precisely to 17p12 (37) is an important beginning to our understanding of the structure of what is likely to be a large gene locus.

A comparison of the rPLII and mPLII genes shows a striking similarity. The intron/exon boundaries occur at equivalent locations within the coding region, and the transcription start sites are located at almost identical locations in the 5' flanking sequence. No information is available on the sizes of the introns in the mPLII gene. A comparison of 5' flanking rPLII sequence with the published mPLII sequence (38) also shows a remarkable sequence conservation between these two species (Fig. 5Go).



View larger version (51K):
[in this window]
[in a new window]
  		Figure 5. A comparison of 5' flanking sequences of rPLII and mPLII genes. rPLII 5' flanking sequence was compared with published 5' flanking sequence of mPLII gene (37) using MacVector program (Oxford Molecular Group, Oxford, UK). Lowercase letters in mouse sequence indicate a difference in nucleotide at that position. Extra nucleotides in mouse sequence are shown above line; deleted bases are shown by a dash. TATA box sequences are underlined, and major transcription start sites are shown in bold and marked as +1. Nucleotide numbers are shown for rPLII.

 
The first 765 nucleotides of the 5' flanking region of the rPLII gene do not appear to be sufficient to direct placental cell expression of the luciferase reporter gene. Sequences between -765 and -3000 are, however, able to confer placental-specific expression in the Rcho cell line as seen from our transfection assays. Our transient transgenic mouse studies suggest that sequences within this 3-kb fragment are also sufficient to direct placental expression in transgenic mice. All transgenic placenta expressed the reporter transgene, although the level of expression varied considerably. Luciferase activity did not appear to correlate with transgene copy number and may relate more to insertion site. Ectopic expression is observed in some of the transgenic fetuses, suggesting that further regulatory sequences may be required for full correct developmental expression of rPLII. The 5' flanking region used to generate these mice is similar to the one in the mPLII gene, which has been reported to direct expression of a SV40 large T antigen to the placenta in transgenic mice (38). Studies are underway to identify the specific DNA sequences that are important in the developmental expression of the rPLII gene.

In spite of the sequence and structural similarities, the placental members of the rPRL gene family are not simply duplicated copies of the PRL gene itself. They have evolved not only within the coding regions of the genes themselves but also within the regulatory elements that allow them to be expressed exclusively during pregnancy in the placenta or maternal decidua according to very precise individual developmental patterns. Two mysteries remain to be solved about this large gene family: the functions of the individual proteins and their specific developmental regulation. Detailed knowledge of the structure of the individual genes may provide important clues to and tools for understanding why and how such a complex gene family has developed in rodents.


   Acknowledgments
 
We thank Ms. Agnes Fresnoza for her excellent technical assistance in making and analyzing the transgenic mice.


   Footnotes
 
1 This work was supported by grants from the Medical Research Council of Canada and the Manitoba Health Research Council. Sequences reported in this manuscript have been deposited in the GenBank database (accession numbers AF026294-AF026298) Back

Received September 29, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Robertson MC, Croze F, Schroedter IC, Friesen HG 1990 Molecular cloning and expression of rat placental lactogen-I complementary deoxyribonucleic acid. Endocrinology 127:702–710[Abstract]
  2. Faria TN, Deb S, Kwok SCM, Talamantes F, Soares MJ 1990 Ontogeny of placental lactogen-I and placental lactogen-II in the developing rat placenta. Dev Biol 141:279–291[CrossRef][Medline]
  3. Duckworth ML, Kirk KL, Friesen HG 1986 Isolation and identification of a cDNA clone of rat placental lactogen II. J Biol Chem 261:10871–10878[Abstract/Free Full Text]
  4. Robertson MC, Schroedter IC, Friesen HG 1991 Molecular cloning and expression of rat placental lactogen-Iv, a variant of rPL-I present in late pregnant rat placenta. Endocrinology 129:2746–2756[Abstract]
  5. Deb S, Faria TN, Roby KF, Larsen D, Kwok SCM, Talamantes F, Soares MJ 1991 Identification and characterization of a new member of the prolactin family, placental lactogen-I variant. J Biol Chem 266:1605–1610[Abstract/Free Full Text]
  6. Duckworth ML, Peden LM, Friesen HG 1986 Isolation of a novel prolactin-like cDNA clone from developing rat placenta. J Biol Chem 261:10879–10884[Abstract/Free Full Text]
  7. Duckworth ML, Peden LM, Friesen HG 1988 A third prolactin-like protein expressed by the developing rat placenta: complementary deoxyribonucleic acid sequence and partial structure of the gene. Mol Endocrinol 2:912–920[Abstract]
  8. Deb S, Roby KF, Faria TN, Szpirer C, Levan G, Kwok SCM, Soares MJ 1991 Molecular cloning and characterization of prolactin-like protein-C complementary deoxyribonucleic acid. J Biol Chem 266:23027–23032[Abstract/Free Full Text]
  9. Roby KF, Deb S, Gibori G, Szpirer C, Levan G, Kwok SCM, Soares MJ 1993 Decidual prolactin-related protein. Identification, molecular cloning, and characterization. J Biol Chem 268:3136–3142[Abstract/Free Full Text]
  10. Dai G, Liu B, Szpirer C, Levan G, Kwok SCM, Soares MJ 1996 Prolactin-like protein-C variant: complementary deoxyribonucleic acid, unique six exon gene structure and trophoblast cell-specific expression. Endocrinology 137:5009–5019[Abstract]
  11. Orwig K, Dai G, Rasmussen CA, Soares MJ 1997 Decidual/trophoblast prolactin-related protein: characterization of gene structure and cell-specific expression. Endocrinology 138:2491–2500[Abstract/Free Full Text]
  12. Verstuyf A, Sobis H, Goebels J, Fonteyn E, Cassiman JJ, Vandeputte M 1990 Establishment and characterization of a continuous in vitro line from a rat choriocarcinoma. Int J Cancer 45:752–756[Medline]
  13. Billis WM, Delidow BC, White BA 1992 Posttranslational regulation of prolactin (PRL) gene expression in PRL-deficient pituitary tumor cells. Mol Endocrinol 6:1277–1284[Abstract]
  14. Nordeen SK 1988 Luciferase reporter vectors for analysis of promoters and enhancers. BioTechniques 6:454–457[Medline]
  15. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, pp 76–85, 320–321
  16. Yanisch-Perron C, Vieira J, Messing J 1985 Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13 mp18 and pUC19 vectors. Gene 33:103–109[CrossRef][Medline]
  17. Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  18. Maxam A, Gilbert W 1980 Sequencing end-labelled DNA with base-specific chemical cleavages. Methods Enzymol 65:499–560[Medline]
  19. Szpirer J, Levan G, Thorn M, Szpirer C 1984 Gene mapping in the rat by mouse-rat somatic cell hybridization: synteny of the albumin and alpha-fetoprotein genes and assignment to chromosome 14. Cytogenet Cell Genet 38:142–149[Medline]
  20. Cooke NE, Szpirer C, Levan G 1986 The related genes encoding growth hormone and prolactin have been dispersed to chromosomes 10 and 17 in the rat. Endocrinology 119:2451–2454[Abstract]
  21. Dai G, Imagawa W, Liu B, Szpirer C, Levan G, Kwok SCM, Soares MJ 1996 Rcho-1 trophoblast cell placental lactogens: complementary DNAs, heterologous expression and biological activities. Endocrinology 137:5020–5027[Abstract]
  22. Cohick CB, Dai G, Xu L, Deb S, Kamei T, Levan G, Szpirer C, Szpirer J, Kwok SCM, Soares MJ 1996 Placental lactogen-I variant utilizes the prolactin receptor signaling pathway. Mol Cell Endocrinol 116:49–58[CrossRef][Medline]
  23. Southern EM 1975 Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503–517[CrossRef][Medline]
  24. Cattini PA, Eberhardt NL 1987 Regulated expression of chimaeric genes containing the 5' flanking regions of human growth hormone-related genes in transiently transfected rat anterior pituitary tumour cells. Nucleic Acids Res 15:1297–1309[Abstract/Free Full Text]
  25. Vuille J-C, Cattini PA, Bock ME, Verstuyf A, Schroedter IC, Duckworth ML, Friesen HG 1993 Rat prolactin-like protein A partial gene and promoter structure: promoter activity in placental and pituitary cells. Mol Cell Biol 96:91–98
  26. Duckworth ML, Robertson MC, Schroedter IC, Szpirer C, Friesen HG 1993 Molecular genetics and biology of the rat placental prolactin family. In: Soares MJ, Handwerger S, Talamantes F (eds) Trophoblast Cells: Pathways for Maternal-Embryonic Communication. Springer-Verlag, New York, pp 169–190
  27. Nickel BE, Kardami E, Cattini PA 1990 Differential expression of human placental growth-hormone variant and chorionic somatomammotropin in culture. Biochem J 267:653–658[Medline]
  28. Hogan B, Beddington R, Costantini F, Lacy E 1994 Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, pp 219–248
  29. Barta A, Richards RI, Baxter JD, Shine J 1981 Primary structure and evolution of rat growth hormone gene. Proc Natl Acad Sci USA 78:4867–4871[Abstract/Free Full Text]
  30. Cooke NE, Baxter JD 1982 Structural analysis of the prolactin gene suggests a separate origin for its 5' end. Nature 297:603–606[CrossRef][Medline]
  31. Gubbins EJ, Maurer RA, Lagrimini M, Erwin CR, Donelson JE 1980 Structure of the rat prolactin gene. J Biol Chem 255:8655–8662[Abstract/Free Full Text]
  32. Breathnach R, Benoist C, O’Hare K, Gannon F, Chambon P 1978 Ovalbumin gene: evidence for a leader sequence in mRNA and DNA sequences at exon-intron boundaries. Proc Natl Acad Sci USA 75:4853–4857[Abstract/Free Full Text]
  33. Sharp PA 1981 Speculations on RNA splicing. Cell 23:643–646[CrossRef][Medline]
  34. Maurer RA, Erwin CR, Donelson JD 1981 Analysis of 5' flanking sequences and intron-exon boundaries of the rat prolactin gene. J Biol Chem 256:10524–10528[Free Full Text]
  35. Cornall RJ, Aitman TJ, Hearne CM, Todd JA 1991 The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics 10:874–881[CrossRef][Medline]
  36. Rubin CM, Houck CM, Deininger PL, Friedmann T, Schmid CW 1980 Partial nucleotide sequence of the 300-nucleotide interspersed repeated human DNA sequence. Nature 284:372–374[CrossRef][Medline]
  37. Szpirer C, Klinga-Levan K, Stahl F, Szpirer J 1997 Report on chromosome 17. Rat Genome 3:172–178
  38. Shida MM, Jackson-Grusby LL, Ross SR, Linzer DIH 1992 Placental-specific expression from the mouse placental lactogen II gene promoter. Proc Natl Acad Sci USA 89:3864–3868[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
A. Ozturk, L. J. Donald, L. Li, H. W. Duckworth, and M. L. Duckworth
Proteomic Identification of AP2{gamma} as a Rat Placental Lactogen II Trophoblast Cell-Specific Enhancer Binding Protein
Endocrinology, September 1, 2006; 147(9): 4319 - 4329.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Ozturk, A. Fresnoza, A. Savoie, H. W. Duckworth, and M. L. Duckworth
Defining Regulatory Regions in the Rat Prolactin Gene Family Locus Using a Large P1 Genomic Clone
Endocrinology, November 1, 2003; 144(11): 4742 - 4754.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
M. A. Serrano, R. I. R. Macias, M. Vallejo, O. Briz, A. Bravo, M. J. Pascual, M. V. St-Pierre, B. Stieger, P. J. Meier, and J. J. G. Marin
Effect of Ursodeoxycholic Acid on the Impairment Induced by Maternal Cholestasis in the Rat Placenta-Maternal Liver Tandem Excretory Pathway
J. Pharmacol. Exp. Ther., May 1, 2003; 305(2): 515 - 524.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. O. Wiemers, L.-j. Shao, R. Ain, G. Dai, and M. J. Soares
The Mouse Prolactin Gene Family Locus
Endocrinology, January 1, 2003; 144(1): 313 - 325.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
G. Dai, M. W. Wolfe, and M. J. Soares
Distinct Regulatory Regions from the Prolactin-Like Protein C Variant Promoter Direct Trophoblast Giant Cell Versus Spongiotrophoblast Cell-Specific Expression
Endocrinology, October 1, 1999; 140(10): 4691 - 4698.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
K. E. Orwig and M. J. Soares
Transcriptional Activation of the Decidual/Trophoblast Prolactin-Related Protein Gene
Endocrinology, September 1, 1999; 140(9): 4032 - 4039.
[Abstract] [Full Text]

Home page
 Mol. Endocrinol.Home page
Y. Sun and M. L. Duckworth
Identification of a Placental-Specific Enhancer in the Rat Placental Lactogen II Gene That Contains Binding Sites for Members of the Ets and AP-1 (Activator Protein 1) Families of Transcription Factors
Mol. Endocrinol., March 1, 1999; 13(3): 385 - 399.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
G. Dai, B. M. Chapman, B. Liu, K. E. Orwig, D. Wang, R. A. White, B. Preuett, and M. J. Soares
A New Member of the Mouse Prolactin (PRL)-Like Protein-C Subfamily, PRL-Like Protein-C{alpha}: Structure and Expression
Endocrinology, December 1, 1998; 139(12): 5157 - 5163.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shah, P.
Right arrow Articles by Duckworth, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shah, P.
Right arrow Articles by Duckworth, M. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals