Endocrinology Vol. 139, No. 4 1815-1824
Copyright © 1998 by The Endocrine Society
Desensitization of the Growth Hormone-Induced Janus Kinase 2 (Jak 2)/Signal Transducer and Activator of Transcription 5 (Stat5)-Signaling Pathway Requires Protein Synthesis and Phospholipase C1
Leandro Fernández,
Amilcar Flores-Morales,
Olivier Lahuna,
Daniel Sliva,
Gunnar Norstedt,
Lars-Arne Haldosén2,
Agneta Mode and
Jan-Åke Gustafsson
Department of Medical Nutrition, Karolinska Institute, Novum, S-141
86 Huddinge, Sweden
Address all correspondence and requests for reprints to: Agneta Mode, Department of Medical Nutrition, Karolinska Institute, Huddinge University Hospital, Novum, S-141 86 Huddinge, Sweden. E-mail:
Agneta.Mode{at}mednut.ki.se
 |
Abstract
|
|---|
Signal transducers and activators of transcription (Stat) proteins are
latent cytoplasmic transcription factors that are tyrosine
phosphorylated by Janus kinases (Jak) in response to GH and other
cytokines. GH activates Stat5 by a mechanism that involves tyrosine
phosphorylation and nuclear translocation. However, the mechanisms that
turn off the GH-activated Jak2/Stat5 pathway are unknown. Continuous
exposure to GH of BRL-4 cells, a rat hepatoma cell line stably
transfected with rat GH receptor, induces a rapid but transient
activation of Jak2 and Stat5. GH-induced Stat5 DNA-binding activity was
detected after 2 min and reached a maximum at 10 min. Continued
exposure to GH resulted in a desensitization characterized by 1) a
rapid decrease in Stat5 DNA-binding activity. The rate of decrease of
activity was rapid up to 1 h of GH treatment, and the remaining
activity declined slowly thereafter. The activity of Stat5 present
after 5 h is still higher than the control levels and almost
1020% with respect to maximal activity at 10 min; and 2) the
inability of further GH treatment to reinduce activation of Stat5. In
contrast, with transient exposures of BRL-4 cells to GH, Stat5
DNA-binding activity could repeatedly be induced. GH-induced Jak2 and
Stat5 activities were independent of ongoing protein synthesis.
However, Jak2 tyrosine phosphorylation and Stat5 DNA-binding activity
were prolonged for at least 4 h in the presence of cycloheximide,
which suggests that the maintenance of desensitization requires ongoing
protein synthesis. Furthermore, inhibition of protein synthesis
potentiated GH-induced transcriptional activity in BRL-4 cells
transiently transfected with SPIGLE1CAT, a reporter plasmid activated
by Stat5. GH-induced Jak2 and Stat5 activation were not affected by
D609 or mepacrine, both inhibitors of phospholipase C. However, in the
presence of D609 and mepacrine, GH maintained prolonged Jak2 and Stat5
activation. Transactivation of SPIGLE1 by GH was potentiated by
mepacrine and D609 but not by the phospholipase A2
inhibitor AACOCF3. Thus, a regulatory circuit of GH-induced
transcription through the Jak2/Stat5-signaling pathway includes a
prompt GH-induced activation of Jak2/Stat5 followed by a negative
regulatory response; ongoing protein synthesis and intracellular
signaling pathways, where phospholipase C activity is involved, play a
critical role to desensitize the GH-activated Jak2/Stat5-signaling
pathway.
 |
Introduction
|
|---|
GH is involved in the regulation of a broad
range of physiological processes including somatic growth, development,
and intermediary metabolism (1). The actions of GH at the cellular
level include direct mitogenic effects (2), insulin-like and
insulin-antagonizing metabolic effects (3), as well as gene- regulatory
actions (4, 5). In all species GH is secreted episodically and in
rodents there is a marked sex difference in the pulsatility (6). In
male rats GH is secreted in episodic bursts at 3- to 4-h intervals with
low or undetectable levels between peaks. In female rats the secretion
is more frequent, and the base line levels are higher than in males,
resulting in a continuous presence of GH in the circulation that is in
contrast to the intermittent presence seen in males. The pattern of GH
exposure has dramatic effects on GH-regulated events in adipose tissue
and in the liver. As an example, the expression of GH-regulated
cytochrome P450 enzymes in the liver is sex differentiated (5).
All effects of GH are initiated by the binding of GH to its receptor,
which belongs to the cytokine/hematopoietin receptor superfamily (7).
Despite the lack of intrinsic tyrosine kinase activity of these
receptors, their activation induces intracellular tyrosyl
phosphorylation events. Current evidence demonstrates that many of
these receptors activate tyrosine kinases of the Janus kinase (Jak)
family (8, 9). GH has been shown to predominantly activate Jak2 (10).
Upon GH binding to its receptor, Jak2 associates with the receptor,
leading to autophosphorylation of the kinase and phosphorylation of the
intracellular domain of the receptor. Subsequent to Jak2 activation,
several intracellular substrates, including transcription factors of
the signal transducer and activator of transcription (Stat) family,
become phosphorylated (11).
The Stat proteins are latent, cytoplasmic transcription factors that,
upon phosphorylation, dimerize and translocate to the nucleus where
they bind to
-interferon (IFN)-activated sequence (GAS)-like
elements (GLEs) in target genes (12). Stat1, -3, and -5 have been shown
to be tyrosyl phosphorylated in response to GH (13). Stat1 and Stat3
bind as homo- and heterodimers to a regulatory element in the
c-fos gene termed SIE (sis-inducible element) and have been
implicated in GH activation of c-fos transcription (14).
Stat5/MGF (mammary gland factor) was first found to be involved in the
PRL activation of ß-casein gene expression (15). Recently, Stat5 has
been shown to be involved in the GH regulation of the liver-specific
serine protease inhibitor 2.1 (SPI 2.1) gene (16).
However, in addition to GH activation of Jak/Stat pathways in which
specific tyrosyl phosphorylation of Stat1, -3, and -5 occurs in
response to GH, we and others have demonstrated that several
alternative signaling pathways are triggered by the activated GH
receptor. For instance, GH has been shown to activate mitogen-activated
protein kinase (2, 17) and to induce tyrosine phosphorylation of Shc
and the association of Shc with Grb2 (18), which suggests Ras-dependent
modes of signaling that may be linked to the Jak/Stat pathway. GH
signals are also transduced via voltage-dependent Ca2+
channels, phospholipase C (PLC), protein kinase C (PKC), insulin
receptor substrate 1 (IRS-1), and cytosolic phospholipase A
(cPLA2) ( Ref. 11 and references therein). Cross-talk
between the Jak/Stat and other signaling pathways has recently been
described; serine phosphorylation of Stat1 and Stat3, presumably by
activation of mitogen-activated protein kinase, can enhance IFN
/ß
and IFN
induction of early response genes (19); and serine/threonine
kinases are potent regulators of interleukin (IL)-2-induced Stat5
activity (20). GH stimulation of both serine and tyrosine
phosphorylation of Stat1, -3, and -5 in vivo has been
described (13). In addition, the serine-threonine protein kinase A and
intracellular Ca2+ might act as negative modulators of
Jak/Stat signaling (21, 22). Furthermore, cross-talk is likely to be an
important factor in determining signaling specificity (23).
To date, little is known about the mechanisms that turn off Jak/Stat
activation. Thus, it is not clear whether specific ligand-induced
phosphatases are responsible for the rapid disappearance of activated
Stats observed in vivo or whether this is the result of
constitutive phosphatase activity or the result of protein degradation.
The kinetics of Stat activation and subsequent target gene activation
are also poorly understood. However, the observation that the kinetics
of activation of the Stat containing acute-phase response factor
DNA-binding complex by INF
and interleukin (IL)-6, respectively, are
different indicates that this aspect could be important (19). Recently,
it has been reported that different subpopulations of activated Stat5
that appear in response to IL-2-stimulated T cells have different
kinetics of activation and deactivation (20).
The present study focuses on potential molecular mechanisms for the
transient pattern of Stat activation by GH. We found that while the
GH-induced activation of Stat5 does not require ongoing protein
synthesis, the subsequent desensitization does. A labile or inducible
factor is responsible for Stat5 desensitization, and intracellular
signaling pathways involving PLC play a critical role in the turning
off mechanism. Moreover, desensitization of Stat5 activation seems to
occur at the level of the GH receptor (GHR)-Jak2 complex. These
observations could have implications for models of GH-regulated
transcriptional activation through the Jak/Stat pathway.
 |
Materials and Methods
|
|---|
Materials
Recombinant human GH (hGH) was kindly provided by Pharmacia
(Stockholm, Sweden) from which protein A-Sepharose was also purchased.
[14C]Chloramphenicol (25 mCi/mmol) and reagents for the
enhanced chemiluminescence (ECL) method were from Amersham
(Arlington Heights, IL). Butyryl coenzyme A, mepacrine (MEP),
cycloheximide (CHX), and sodium vanadate were obtained from Sigma (St.
Louis, MO). Xhantogenate tricyclodecan-9-yl (D609), U73122
[(1-(6-((17ß-3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-14-pyrrole-2,5-dione)],
and AACOCF3 (arachidonyltrifluoromethyl ketone) were from
Calbiochem-Novabiochem (La Jolla, CA).
Cell culture
Buffalo rat liver cells stably transfected with the rat GH
receptor complementary DNA (cDNA), designated BRL-4 cells and
previously shown to respond to hGH (24), were cultured in DMEM
supplemented with 10% FCS and 50 U/ml penicillin/50 U/ml streptomycin.
The cells were maintained in a humidified incubator with 5%
CO2 at 37 C. Cell culture reagents were obtained from Life
Technologies (Gaithersburg, MD). Treatment of the cells with hGH and/or
inhibitors is specified in the figure legends and in
Results. All experiments were performed at least three
times.
Immunoprecipitation and Western blot analysis
BRL-4 cells grown to near confluency in 100-mm culture dishes
were serum starved for 24 h before treatment. Thereafter, cells
were washed three times with ice-cold PBS and lysed in 1 ml of RIPA
buffer (50 mM Tris-HCl, pH 7.4, 1% Triton X-100, 150
mM NaCl, 5 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride (PMSF), 1 mM
Na3VO4, 10 mM NaF, 1 µg/ml of
aprotinin, leupeptin, and pepstatin). Immunoprecipitation of BRL-4 cell
RIPA extracts was performed using the monoclonal antiphosphotyrosine
antibody PY20 (Transduction Laboratories, Lexington, KY) as previously
described (25). Protein A-Sepharose 4B (Pharmacia) was used to adsorb
immunocomplexes that were extensively washed with RIPA buffer
containing 0.1% Triton X-100, boiled in Laemmli buffer, and resolved
on 7.5% SDS-PAGE. Aliquots from cleared RIPA lysates containing 60
µg protein were mixed with an equal volume of Laemmli buffer and
subjected to electrophoresis on 7.5% SDS-PAGE. Separated proteins were
electroblotted to polyvinylidene difluoride membranes (Millipore,
Bedford, MA). Membranes were blocked for 1 h with 3% skim milk
powder in TBS (20 mM Tris-HCl, 150 mM NaCl, pH
7) and washed twice for 5 min in TBS. Western blotting was performed
with anti-Jak2 antibody, directed against murine Jak2 (UpState
Biotechnology, Lake Placid, NY) or monoclonal anti-Stat5 antibody
(Transduction Laboratories). Primary antibodies were diluted 1:1000 in
TBS with 1% skim milk powder, and membranes were incubated for 1
h at room temperature. After two 10-min washes in TBS, binding of
primary antibodies was visualized using horseradish
peroxidase-conjugated secondary antibodies (Sigma), diluted 1:5000 in
TBS with 1% skim milk powder, and the ECL method (Amersham) following
the manufacturers protocol.
Preparation of nuclear extracts
BRL-4 cells were grown as described. At 90% confluency the
cells were serum starved for 24 h before the addition of
inhibitors and/or hGH. After treatment, the cells were washed twice
with cold PBS, and nuclear extracts were prepared essentially as
described by Dignam et al. (26). In brief, the cells from
100-mm diameter dishes were collected by centrifugation, resuspended in
hypotonic buffer (10 mM Tris-HCl, pH 7.4, 10 mM
NaCl, 6 mM MgCl2, 1 mM
dithiothreitol (DTT), 0.4 mM PMSF, 10 mM NaF, 1
mM Na3VO4, 1 µg/ml of pepstatin,
aprotinin and leupeptin) equal to approximately 3 times the packed cell
volume and incubated on ice for 10 min. The cells were lysed with 20
strokes in a Dounce homogenizer (pestle B), and the nuclei were
collected by centrifugation and resuspended in 3 volumes of high-salt
buffer (20 mM HEPES, pH 7.9, 420 mM NaCl, 20%
glycerol, 1.5 mM MgCl2, 0.2 mM
EDTA, 0.2 mM PMSF, 1 mM DTT, 1 mM
Na3VO4, 10 mM NaF, and protein
synthesis inhibitors as above). After 30 min at 4 C, the pellets were
removed by centrifugation, and supernatants containing the nuclear
proteins were aliquoted and stored at -70 C. The protein concentration
of the extracts was measured using the Bradford assay (Bio-Rad,
Richmond, CA) with BSA as standard (27).
Oligonucleotides and reporter construct
Double-stranded oligonucleotides SPIGLE1, TGTTCTGAGAAATA (28),
and Sp1 CTAGAATGAAGGGCGGGGACAGTTG (29), were used as probes in gel
electrophoretic mobility shift assay (GEMSA). The double-stranded
oligonucleotide containing three tandem SPI.GLE1 repeats,
CTAGTGTTCTGAGAAATGAACGGTTCTGAGAAAGTACA-GGTTCTGAGAAAT
(the core sequence is underlined), was ligated into the
XbaI site of pBLCAT2, a reporter plasmid containing a
thymidine kinase minimal promoter adjacent to the chloramphenicol
acetyltransferase (CAT) cDNA (30).
GEMSA
GEMSA was performed according to standard protocols. The binding
reactions were performed by preincubating 8 µg nuclear extract with 2
µg poly(deoxyinosinic-deoxycytidylic)acid in 20 µl buffer
containing 20% Ficoll, 60 mM HEPES, pH 7.9, 20
mM Tris, pH 7.9, 0.5 mM EDTA, and 5
mM DTT for 10 min at room temperature.
32P-End-labeled double-stranded SPIGLE1 or Sp1 probe was
added, and the mixture was incubated for 10 min at room temperature.
The samples were electrophoresed on 4.5% nondenaturing polyacrylamide
gels in 0.25 x TBE (1 x TBE; 0.09 M
Tris-borate, 2 mM EDTA) at 150 V at room temperature. To
identify the contribution of Stat proteins to the SPIGLE1
protein-binding pattern, the binding reaction was carried out in the
presence of specific antibodies against human Stat1, rat Stat3 (Santa
Cruz Biotechnology, Santa Cruz, CA), sheep Stat5 (16), or preimmune
serum during 30 min at room temperature before the addition of the
radiolabeled probe. The radioactive pattern was visualized by
autoradiography and quantitated by PhosphorImager scanning (Fuji,
Stamford, CT).
Cell transfection and chloramphenicol acetyl transferase
assay
BRL-4 cells were grown to 70% confluency in 60-mm dishes and
washed once with PBS before transfection. Transfections were carried
out in serum-free DMEM with DOTAP (Boehringer Mannheim, Mannheim,
Germany) according to the manufacturers instructions using 3 µg
CsCl density gradient-purified plasmid DNA/dish. Following treatment,
the cells were washed with PBS and scraped into 0.25 M
Tris-HCl, pH 8. After three rounds of freeze-thaw lysis and heat
treatment at 65 C for 10 min, the extracts were centrifuged to remove
cell debris and then assayed for chloramphenicol acetyl transferase
activity (31). Thirty micrograms of protein were incubated with 3 µl
[14C]chloramphenicol and 25 µg butyryl coenzyme A for
3 h at 37 C. Butyrylated chloramphenicol was extracted with xylene
and detected using a Wallac (Gaithersburg, MD) scintillation
counter.
 |
Results
|
|---|
GH induction of Stat DNA- binding activity is transient and
desensitized by prolonged GH treatment
GEMSA performed with oligonucleotides comprising a GAS element
consensus TTCNNNGAA motif have been extensively used to characterize
DNA-binding activities of Stat family proteins (12). To gain insight
into the molecular basis of the GH signaling through the Jak/Stat
pathway, we first characterized the kinetics of GH-induced Stat
DNA-binding activity. Serum-starved BRL-4 cells were exposed to 50
nM GH for various times and then assessed for Stat
DNA-binding activity using the SPIGLE1 or ß-casein (data not shown)
probes in GEMSA. The data in Fig. 1A
show
that GH activates two SPIGLE1-binding species that were identified as
Stat5 and Stat1 by using specific antibodies in supershift analysis.
The GH induction of Stat5 and Stat1 DNA-binding activities was evident
after 2 min of hormone treatment and reached a maximum after 10 min
(Fig. 1B
). Quantification of the time course experiment showed that
within 1 h the DNA-binding capacity of Stat1 and Stat5 had
declined to levels of about 1020% of maximal activities (Fig. 1C
).
The Stat1- and Stat5-binding activities remained at this level for at
least 8 h. Further addition of GH to the cells during this time
period did not result in reinduction of Stat DNA-binding activity (data
not shown and Fig. 2
below). In
dose-response experiments (Fig. 1D
) the EC50 value for the
GH activation of Stat5 DNA-binding activity was about 1 nM,
whereas that for Stat1 DNA-binding activity was 10-fold higher.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 1. Activation and desensitization of Stat DNA-binding
activities by GH in BRL-4 cells. A, Nuclear extracts prepared from
BRL-4 cells treated with hGH (50 nM) for 10 min were
analyzed for binding to 32P-labeled SPIGLE1 with GEMSA.
Binding reactions were carried out in the presence of buffer only (lane
1), preimmune serum (lane 2), or antibodies against Stat1 (lane 3),
Stat3 (lane 4), or Stat5 (lane 5). The arrows A and B
indicate the complexes formed, and SS indicates supershifted complex.
B, GEMSA of the SPIGLE1 probe performed with nuclear extracts from
cells untreated (UT) or treated with hGH for the indicated times, 2 min
to 8 h. C, Relative quantification of Stat5 ( ) and Stat1 ()
DNA-binding activities detected in panel B. D, Dose-response of
hGH-induced DNA-binding activity to the SPIGLE1 probe analyzed with
GEMSA.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
Figure 2. Resensitization of GH-stimulated Stat5 and Stat1
DNA-binding activities. BRL-4 cells were either untreated (UT) or
treated with hGH (50 nM). At the indicated time points the
cells received a second addition of GH and were harvested 10 min later
(upper panel). In the lower panel, the
cells were thoroughly washed after the first GH surge, which lasted for
10 min, and then incubated in the absence of GH until the second 10-min
pulse after which they were harvested. Nuclear extracts were prepared
and DNA-binding activity to the SPIGLE1 probe was analyzed by GEMSA.
|
|
In view of these results we decided to examine whether the cells could
be resensitized to GH stimulation of Stat5 and Stat1 DNA-binding
activities. This was assessed by treating serum-starved BRL-4 cells
with 50 nM GH for 10 min, after which the cells were
thoroughly washed at 37 C to remove the hormone, and after different
times the ability of the cells to respond to an additional surge of GH
was investigated. For comparative purposes, one set of cells was not
washed after the first GH surge. In these cells no response to a second
pulse of GH was achieved (Fig. 2
, upper panel). Thus, a
short half-life of GH in the cellular system cannot explain the
transient Stat activation. As shown in Fig. 2
(lower panel),
1 h after removal of the hormone a second addition of GH was able
to stimulate Stat5- and Stat1-binding activities again (compare 30
min vs. 60 min in upper and lower
panel). The Stat5 response was fully restored 5 h after
removal of the first GH stimulation, whereas the resensitization of the
Stat1 response seemed to require a longer hormone-free period. This
time difference could indicate that different mechanisms are involved
in the desensitization and/or reactivation of Stat1 and Stat5 by
GH.
Inhibition of protein synthesis prolongs the GH-stimulated Stat5
and Stat1 DNA-binding activities
That Stat activation depends on posttranslational mechanisms
involving tyrosine and serine phosphorylation is clear. However, little
is known about the mechanisms involved in the subsequent
desensitization and resensitization of the Jak/Stat pathway. To address
the molecular basis for the rapid deactivation and the time-dependent
desensitization of GH-induced Stat DNA binding activation we
investigated the effect of the protein synthesis inhibitor CHX on the
time course of GH-stimulated Stat activation. The presence of CHX did
not interfere with the rapid GH activation of Stat5 and Stat1
DNA-binding activities (Fig. 3A
). In deep
contrast to the binding activities detected in cells treated with GH
alone, the presence of CHX maintained the Stat-binding activities at
high levels for at least 4 h. In the presence of GH and CHX,
Stat5-binding activity was about 8-fold higher than in the control
nuclear extracts (GH without CHX), and that of Stat1 was 30-fold higher
when measured 4 h after GH addition. CHX did not induce Stat5
DNA-binding activity by itself whereas Stat1-binding activity was
slightly induced by CHX alone. The amount of Stat5 protein did not show
any significant change as measured by Western blot (Fig. 3B
). The shift
in mobility of the lower Stat5 immunoreactive band, probably due to
phosphorylation, was clearly seen in all extracts from cells treated
with GH plus CHX but only in the 10-min extract from cells treated with
GH alone. The effect of CHX on GH-induced Stat DNA-binding activity
appeared specific since binding of proteins from the same nuclear
extracts to the unrelated oligonucleotide Sp1 was unaffected (Fig. 3C
).
Thus, the GH-activated Stat5 and Stat1 are either deactivated by
processes involving protein synthesis or the arrested protein synthesis
allows sustained activation.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 3. Inhibition of protein synthesis prevents
desensitization of GH- stimulated Stat5 and Stat1 DNA-binding
activities. BRL-4 cells cultured in the absence or presence of CHX (2
µg/ml) were stimulated or not with GH (50 nM) for the
indicated times. CHX treatment was initiated 3 h before GH
treatment. A, Nuclear extracts were prepared and DNA-binding activity
to the SPIGLE1 probe was analyzed by GEMSA. B, Whole cellular extracts
were prepared and analyzed for Stat5 protein by Western blotting; 60
µg protein were applied in each lane. C, GEMSA of the nuclear
extracts using the Sp1 probe.
|
|
Inhibition of protein synthesis prevents dephosphorylation of
GH-induced, tyrosine-phosphorylated Jak2
It was only in GH-stimulated cells that CHX was able to
sustain activation of Stat5 and Stat1. This could involve continuous
triggering of Stat activation by GH bound to the GHR/Jak2 complex. We,
therefore, explored whether prolonged GH-induced Stat5 DNA-binding
activity was associated with a parallel prolonged activation of Jak2.
Jak2 tyrosine phosphorylation was significant after 10 min after GH
treatment of BRL-4 cells both in the presence and absence of CHX (Fig. 4
, upper panel). While a rapid
decline in Jak2 tyrosine phosphorylation was observed in cells treated
with GH alone (upper panel), the presence of CHX maintained
Jak2 tyrosine phosphorylation for at least 4 h (upper
panel). This effect was strictly dependent on the presence of GH
since CHX did not induce Jak2 tyrosine phosphorylation alone. Analysis
by Western blotting of whole cellular extracts with anti-Jak2
antibodies did nor reveal any significant changes in Jak2 protein
amount (Fig. 4
, lower panel). These results indicate that
the transient Stat5 activation upon continuous exposure to GH is due to
a regulatory protein that works at the level of Jak2 activity rather
than at the level of dephosphorylation of activated Stat molecules.
This may involve an effect on the interaction between Jak2 and the GHR.
The regulatory protein could be a constitutive rapidly turning over
protein that is activated by GH or it could be a GH- induced
protein.

View larger version (59K):
[in this window]
[in a new window]
|
Figure 4. Inhibition of protein synthesis prevents
desensitization of GH-induced Jak2 tyrosine phosphorylation. Whole
cellular extracts obtained from cells treated as described in Fig. 3
were subjected to immunoprecipitation with antiphosphotyrosine
antibodies (upper panel) or not (lower
panel). The immunoprecipitate and the whole cellular extracts
were analyzed for Jak2 immunoreactivity by Western blotting.
|
|
Inhibition of protein synthesis potentiates GH-induced
transactivation
It was felt important to determine whether the CHX-induced
prolongation of Stat DNA-binding activity had a functional correlation.
Therefore, the SPIGLE1 element fused to a minimal thymidine kinase
promoter in front of the chloramphenicol acetyltransferase reporter
gene, SPIGLE1-CAT, was transiently transfected into BRL-4 cells, and
the effect of GH stimulation on CAT activity, with or without a
transient exposure to CHX, was determined. The protocol used was as
described by Subramaniam et al. (32). The cells were
pretreated or not with CHX (2 µg/ml) for 3 h before the addition
of GH. After 4 h of GH treatment the medium was changed, and the
cells were incubated for an additional 4 h in the presence of GH
alone. Control cells received no GH. Cell extracts were prepared and
assayed for CAT activity. As shown in Fig. 5
, GH induced the CAT activity 10-fold in
cells transiently exposed to CHX but only 4-fold in cells not exposed
to CHX. Activity of the enhancerless thymidine kinase promoter
(pBLCAT2) was not affected by GH, and CHX treatment caused at most a
2-fold increase in activity. Thus, Stat-mediated transcriptional
activation is enhanced by protein synthesis inhibition and correlates
with GH-induced prolonged Jak2 tyrosine phosphorylation and Stat
DNA-binding activity detected in the presence of CHX.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 5. Inhibition of protein synthesis potentiates
GH-induced transactivation. BRL-4 cells were transfected with
SPIGLE1CAT or pBLCAT2. After transfection the cells were treated or not
with CHX (2 µg/ml) for 3 h, after which GH (50 nM)
was added, and the cells were incubated for an additional 4 h.
Thereafter, the medium was changed to CHX-free medium containing GH or
not, and 4 h later the cells were harvested. Cell extracts were
prepared and analyzed for CAT activity. The CAT activities are
expressed as disintegrations per min/µg protein, and the mean ±
SD of triplicate cultures is shown.
|
|
Inhibitors of PLC prevent desensitization of GH-stimulated Stat5
and Stat1 DNA-binding activities
From the results above, one can envision that the activity of the
regulatory protein attenuated by protein synthesis inhibition and
responsible for the desensitization is dependent on GH-signaling
events. Among the vast array of signals triggered by GH, phospholipid
metabolism has been implicated in effects dependent on continuous GH
exposure (33). Therefore, the effects of modulators of phospholipid
metabolism on Stat DNA-binding activities were investigated. Treatment
of BRL-4 cells with 20 µM MEP, an inhibitor of both PLC
and PLA2 activities (34), prevented the decrease of Stat5
and Stat1 DNA-binding activities to the SPIGLE1 probe observed with GH
treatment alone (Fig. 6
). GH-induced
Stat5 activity at 4 h was 6-fold higher than in control cells (GH
without MEP), and that of Stat1 was about 20-fold higher. However, MEP
also affected the GH activation of Stat5 DNA binding, which was reduced
by 40% at 10 min. No effect of MEP on Stat5 DNA-binding activity was
detected in the absence of GH, but a significant increase of Stat1 was
consistently observed. MEP had no effect on DNA-binding activity of
nuclear proteins to the Sp1 probe (data not shown). These results
suggest that treatment of the MEP cells, probably through inhibition of
PLC and/or PLA2 activities, leads to prolonged Stat
activation.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 6. MEP prolongs GH-stimulated Stat DNA-binding
activity. Nuclear extracts were prepared from BRL-4 cells treated with
hGH (50 nM) for various times in the presence or absence of
MEP (20 µM). MEP was added 2 h before initiation of
the GH treatment. GEMSA of the extracts was performed using the SPIGLE1
probe.
|
|
To determine whether PLC- and/or PLA2-dependent
signals are involved in the desensitization of Stat DNA-binding
activity, more specific inhibitors than MEP were used. D609, a specific
inhibitor of phosphatidylcholine-PLC (35), did not abrogate the GH
activation of Stat5 and Stat1 but prevented the desensitization (Fig. 7A
). GH-induced Stat5 DNA-binding
activity at 4 h was 4- to 5-fold higher in the presence than in
the absence of D609, and the activity of Stat1 was at least 10-fold
higher. The effect of 10 µM U73122, an inhibitor of
phosphatidylinositide-PLC activity (36), had a less pronounced effect
(Fig. 7B
), and no effect was seen with the specific cPLA2
inhibitor AACOCF3 (37) (Fig. 7C
) on either the Stat5 or the
Stat1 GH activation/deactivation time course. Neither of these drugs
affected DNA-binding activity to the Sp1 probe (data not shown). These
results suggest that PLC activation is a proximal step in the signal
transduction pathway involved in turning off the Stat-signaling
pathway.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 7. Inhibitors of PLC prevent desensitization of
GH-stimulated DNA-binding activity. Nuclear extracts were prepared from
BRL-4 cells treated with hGH (50 nM) for various times in
the presence or absence of various concentrations of D609 (A), U73122
(B), or AACOCF3 (C). The phospholipase inhibitors or
appropriate vehicle were added 1 h before initiation of the GH
treatment. GEMSA of the extracts was performed using the SPIGLE1 probe.
DMSO, Dimethylsulfoxide.
|
|
Inhibitors of PLC maintain GH-induced Jak2 tyrosine
phosphorylation
Next we evaluated whether inhibition of PLC activity also
maintained Jak2 phosphorylation. Figure 8
(upper panel) shows that the presence of PLC inhibitors, MEP
and D609, did not interfere with the rapid GH activation of Jak2 and
that the time course of Jak2 phosphorylation was significantly
prolonged in their presence. The PLC inhibitors did not induce Jak2
tyrosine phosphorylation in the absence of GH. Western blot analysis of
whole cellular extracts with the Jak2 antibody did not reveal any
significant changes in the amount of Jak2 protein (Fig. 8
, lower
panel). The correlation between prolonged activation of Jak2 and
Stat DNA-binding activity by GH in the presence of PLC inhibitors
indicates that the transient Stat activation is caused by GH signaling
via the Jak2 and a PLC pathway and that the site of interplay could be
at the Jak2-GHR complex.

View larger version (62K):
[in this window]
[in a new window]
|
Figure 8. Inhibitors of PLC prevent desensitization of
GH-stimulated Jak2 tyrosine phosphorylation. Whole cellular extracts
obtained from cells treated with GH in the presence or absence of MEP
(20 µM) or D609 (50 µg/ml) were subjected to
immunoprecipitation with antiphosphotyrosine antibodies (upper
panel) or not (lower panel). The
immunoprecipitate and the whole cellular extracts were analyzed for
Jak2 immunoreactivity by Western blotting. The phospholipase inhibitors
or appropriate vehicle was added 3 h before initiation of the GH
treatment.
|
|
GH-induced transactivation is potentiated by PLC inhibitors
BRL-4 cells were transiently transfected with the SPIGLE1CAT
construct and were pretreated with the PLC inhibitors MEP (20
µM), D609 (50 µg/ml), or U73122 (10 µM)
for 1 h before the addition of GH (50 nM). Four hours
later the medium was changed, and the cells were incubated for an
additional 4 h in the presence of GH alone. Control cells received
no GH. Cell extracts were prepared, and equal amounts of total protein
were assayed for CAT activity. As shown in Fig. 9
, GH-induced CAT activity was
significantly higher in cells transiently exposed to PLC inhibitors
than in cells not exposed to them. The fold inductions over control
cells were 7.2, 3.4, and 5 for D609, U73122, and MEP, respectively, and
that of GH alone was 3.5-fold. Thus, Stat-mediated transcriptional
activation is enhanced by the PLC inhibitors MEP and D609 and is
clearly correlated with the prolonged GH-induced Jak2 tyrosine
phosphorylation and Stat DNA-binding activity demonstrated in the
presence of these drugs.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 9. GH-induced transactivation is potentiated by
phospholipase inhibitors. BRL-4 cells were transfected with SPIGLE1CAT
or pBLCAT2. After transfection the cells were treated or not with MEP
(20 µM), D609 (50 µg/ml), or U73122 (10
µM) for 1 h, at which time GH (50 nM)
was added and the cells were incubated for an additional 4 h.
Thereafter, the medium was changed to inhibitor-free medium containing
GH or not, and 4 h later the cells were harvested. Cell extracts
were prepared and analyzed for CAT activity. The CAT activities are
expressed as disintegrations per min/µg protein, and the mean ±
SD of triplicate cultures is shown.
|
|
 |
Discussion
|
|---|
When cells are continuously exposed to cytokines, a rapid but
transient activation of Jak/Stat pathways occurs. One obvious function
of transient activation is to prevent generation of constitutive
signals that could disrupt normal cell behavior. It has been shown that
Stat5, Stat1, and Stat3 DNA- binding activities are induced by GH in
liver (13). Here we show that GH induces a rapid but transient
activation of Jak2 and of Stat5 and -1 DNA-binding activities in the
liver-derived cell line BRL-4. The observation that the GH-stimulated
activation of Stat5 occurs rapidly and is unaffected by the presence of
either translational or transcriptional (data not shown) inhibitors is
consistent with the previously demonstrated posttranslational mode of
regulation of Stat factors (8). In contrast to the desensitization of
Stat5 and Stat1 activation seen upon continuous GH exposure, transient
exposures of BRL-4 cells to GH allowed repeated stimulation of Stat5
binding to the SPIGLE1 DNA-response element. Interestingly, it has
previously been shown that intermittent plasma GH pulses in
vivo, characteristic of male rodents, trigger rapid and repeated
tyrosine phosphorylation and nuclear translocation of liver Stat5,
while continuous plasma GH levels, characteristic of female rodents,
leads to desensitization of this tyrosine phosphorylation pathway (38).
Stat5 has been proposed to play a key role in transcriptional
activation of genes induced by the male GH-secretory pattern, and it
was recently shown that particularly the Stat5b isoform is responsive
to the temporal pattern of GH exposure (39).
A cellular response to GH that could contribute to the transient Stat
activation could be down-regulation of cell surface GH receptors (40).
By CHX treatment of adipose cells, it has been demonstrated that GHR
numbers on the cell surface and the GH effect are markedly dependent on
protein synthesis (41). Another possibility is that ubiquitin-dependent
proteolysis is involved in the negative regulation of Jak/Stat
pathways. Activated Stat1 protein has been shown to be negatively
regulated by the ubiquitin-proteasome pathway (42). Furthermore, IL-6,
in addition to activating Stat3 and Stat5, activates a wild-type
p53-induced gene product into a Stat-masking factor in a
proteasome-dependent step (43). However, we found that while the
GH-induced activation of Jak2/Stat5 does not require ongoing protein
synthesis, the subsequent desensitization did. Furthermore,
GH-dependent Stat activation was sustained in cells treated with CHX,
and the protein levels of Stat5 were unaffected; therefore, it is less
likely that ligand-induced down-regulation of the receptor or
proteolysis of the Stat protein explains the rapid desensitization of
the Jak2/Stat 5-signaling pathway.
Constitutive or growth factor-regulated phosphoprotein phosphatases
(PTP) have been suggested in the deactivation of Jak/Stat pathways
(44); however, the mechanisms underlying the rapid desensitization of
Stat DNA-binding activation are not known. This could involve direct
dephosphorylation by GH-activated PTPs of Stat5, deactivation of the
Jak2/Stat5 pathway by dephosphorylation of the tyrosine
phosphate-docking site(s) for Stat5 on the GH receptor-Jak2 complex, or
dephosphorylation of regulatory tyrosines on Jak2. In fact, during the
course of this study evidence has been presented that the protein
tyrosine phosphatase SHP-1 is associated with Jak2 in FDP-C1 cells
exposed to GH (45). Inhibition of protein synthesis may appear to
activate kinases by attenuating the corresponding phosphatase,
especially if the phosphatase is labile and therefore requires
translation to maintain its levels. Interestingly, it has been reported
that protein synthesis inhibitors prolong the activation of
extracellular regulated kinases, but only after the kinases have been
switched on; translational arrest by itself does not activate
extracellular regulated kinases (46). The CHX-sensitive regulatory
protein responsible for the desensitization might be synthesized
de novo in response to GH and, thus, not expressed in the
presence of synthesis inhibitors. Alternatively, the down-regulatory
protein may be constitutively expressed but rapidly turning over and
may, therefore, become depleted when the synthesis machinery is shut
off. If the latter is the case, the role of GH in the desensitization
process would be activation of the regulatory protein. At present, we
cannot distinguish between the two mechanisms; however, as discussed
below, a PLC- dependent activation pathway of the desensitization is
implicated. Since continuous GH exposure of BRL-4 cells induced a rapid
but transient activation, not only of Stat5 but also of Jak2 tyrosine
phosphorylation, and since arrested protein synthesis maintained Jak2
tyrosine phosphorylation, it is plausible that the regulatory protein,
i.e. the protein turning off the signaling, exerts its
effect at the level of the Jak2-GH receptor complex.
Interestingly, GH-induced desensitization of Jak2 has been observed in
cultured IM-9 cells (47), and growth factor activation of the PTPs
SH-PTP1 and SH-PTP2 has been demonstrated (48). The tyrosine
phosphatase PTP 1D has been proposed to participate in inhibition of
IL-6-induced Jak/Stat signaling, probably by dephosphorylating Jak1
kinase, a proximal kinase in signaling pathways activated by several
cytokines (44). Another regulatory protein of cytokine signaling is the
recently described SH2 domain-containing protein CIS, a
cytokine-induced, immediate-early gene product (49). It has been
proposed that the CIS protein via its SH2 domain binds to the
activated, tyrosine-phosphorylated receptor and thereby blocks further
signaling. CIS is rapidly degraded, and one may hypothesize that CIS
could be the protein synthesis-dependent desensitization signal of GH.
Since GH-induced Jak2 phosphorylation in the BRL-4 cells was maintained
in the presence of CHX, it is plausible that a CIS-like protein could
act in the same way as postulated for IL-2 and -3,
granulocyte-macrophage colony-stimulating factor, and erythropoietin.
It has also been speculated, however, that CIS could be a scavenger of
tyrosine-phosphorylated proteins. Investigation of GH regulation of
CIS-like proteins may help to resolve a possible role for such proteins
in desensitization of GH-induced Jak2/Stat5 signaling.
It has also been demonstrated that cAMP and the calcium ionophore
ionomycin can interrupt the IL-6-induced Jak1/Stat pathway (22). Our
results with inhibitors of phospholipid metabolism suggest that
products derived from PLC activity could regulate protein(s) involved
in Jak2/Stat5 deactivation. We observed that GH maintained long-term
activation of Stat5 DNA-binding activity in the presence of the PLC
inhibitors MEP and D609, but not in the presence of the specific
PLA2 inhibitor AACOCF3. The PLC inhibitors also
maintained tyrosine phosphorylation of Jak2. This suggests that PLC
inhibitors maintain prolonged Stat5 activity through inhibition of a
protein(s) involved in the desensitization at the level of the Jak2-GHR
complex, rather than by increasing dephosphorylation of Stat5. This is
compatible with the action of a CIS-like protein. Alternatively, a
PLC-activated phosphatase could be involved. GH is known to activate
phospholipase activity, leading to diacylglycerol formation and
subsequent PKC activation (11). Protein kinase modulations of
phosphatase activities have been described (50), and it is not
inconceivable that a labile phosphatase activated by a PLC-mediated
mechanism is the turning off protein. To test this possibility, we are
currently investigating the effects of modulators of PKC activity on
the Jak2/Stat5-signaling pathway. Furthermore, the present results
indicate that a phosphatidylcholine-PLC is involved, but further
experiments are needed to unravel which isoform of PLC is activated by
GH and which class of phospholipids constitutes the substrate.
In summary, it is clearly established from many studies that there is a
protein synthesis-independent transient activation of Jak2 tyrosine
phosphorylation and Stat5 DNA-binding activity. Here we have shown that
the activation is followed by a protein synthesis-sensitive
deactivation/desensitization. Although it is likely that phosphatases
deactivate Stat5 molecules to turn off the signal, our data indicate
that the desensitization is exerted at the level of the Jak2-GH
receptor complex. Furthermore, it is implicated that the regulatory
protein, being the cause of desensitization, is activated by
PLC-dependent mechanisms triggered by GH. The functional effects on
SPIGLE1CAT transactivation suggest that PLC-derived signals have an
important relevance for GH-regulated gene transcription via the
Jak/Stat signaling pathway.
 |
Acknowledgments
|
|---|
Susanne Muller kindly provided the Sp1 probe.
 |
Footnotes
|
|---|
1 This study was supported by grants from the Swedish Medical Research
Council (No. 13X-2819) and the Novo Nordisk Foundation. 
2 Supported by a grant from Direcciòn General de Universidades
e Investigacion del Gobierno de Canarias and Fundaci/cn
Universitaria de Las Palmas. 
Received September 3, 1997.
 |
References
|
|---|
-
Isaksson OG, Edén S, Jansson JO 1985 Mode of action of pituitary growth hormone on target cells. Annu Rev
Physiol 47:483499[CrossRef][Medline]
-
Möller C, Hansson A, Ernberg B, Lobie PE,
Norstedt G 1992 Growth hormone induction of tyrosine
phosphorylation and activation of mitogen activated protein kinases in
cells transfected with rat GH receptor cDNA. J Biol Chem 267:2340323408[Abstract/Free Full Text]
-
Davidson MB 1987 Effect of growth hormone on
carbohydrate and lipid metabolism. Endocr Rev 8:115131[Abstract/Free Full Text]
-
Horseman ND, Yu-Lee L-Y 1994 Transcriptional
regulation by the helix bundle peptide hormones: growth hormone,
prolactin and hematopoietic cytokines. Endocr Rev 15:627649[Abstract/Free Full Text]
-
Legraverend C, Mode A, Westin S, Ström A, Eguchi
H, Zaphiropoulos PG, Gustafsson J-Å 1992 Transcriptional
regulation of rat P-450 2C gene subfamily members by the
sexually-dimorphic pattern of growth hormone secretion. Mol Endocrinol 6:259266[Abstract/Free Full Text]
-
Edén S 1979 Age- and sex-related differences
in episodic growth hormone secretion in the rat. Endocrinology 105:555560[Abstract/Free Full Text]
-
Kelly PA, Djiane J, Postel VM, Edery M 1991 The
prolactin/growth hormone receptor family. Endocr Rev 12:23551[Abstract/Free Full Text]
-
Darnell JJ, Kerr IM, Stark GR 1994 Jak-STAT
pathways and transcriptional activation in response to IFNs and other
extracellular signaling proteins. Science 264:141521[Abstract/Free Full Text]
-
Schindler C, Darnell JE 1995 Transcriptional
responses to polypeptide ligands: the JAK-STAT pathway. Annu Rev
Biochem 64:621651[Medline]
-
Argetsinger LS, Campbell GS, Yang X, Witthuhn BA,
Silvennoinen O, Ihle JN, Carter-Su C 1993 Identification of JAK2
as a growth hormone receptor-associated tyrosine kinase. Cell 74:23744[CrossRef][Medline]
-
Carter-Su C, Schwartz J, Smit LS 1996 Molecular
mechanism of growth hormone action. Annu Rev Physiol 58:187207[CrossRef][Medline]
-
Ihle JN 1996 Signal transducers and activators of
transcription. Cell 84:331334[CrossRef][Medline]
-
Ram PA, Park S-H, Choi HK, Waxman DJ 1996 Growth
hormone activation of Stat 1, Stat 3 and Stat 5 in rat liver. J
Biol Chem 271:59295940[Abstract/Free Full Text]
-
Meyer DJ, Campbell GS, Cochran BH, Argetsinger LS,
Larner AC, Finbloom DS, Carter-Su C, Schwartz J 1994 Growth
hormone induces a DNA binding factor related to the
interferon-stimulated 91-kDa transcription factor. J Biol Chem 269:47014704[Abstract/Free Full Text]
-
Wakao H, Gouilleux F, Groner B 1994 Mammary gland
factor (MGF) is a novel member of the cytokine regulated transcription
factor gene family and confers the prolactin response. EMBO J 13:21822191[Medline]
-
Wood TJJ, Sliva D, Lobie PE, Pircher TJ, Gouilleux F,
Wakao H, Gustafsson J- Å, Groner B, Norstedt G, Haldosén
L-A 1995 Mediation of growth hormone- dependent transcriptional
activation by mammary gland factor/Stat5. J Biol Chem 270:94489453[Abstract/Free Full Text]
-
Gronowski AM, Rotwein P 1994 Rapid changes in
nuclear protein tyrosine phosphorylation after growth hormone treatment
in vivo. J Biol Chem 269:78747878[Abstract/Free Full Text]
-
VanderKuur JA, Allevato G, Billestrup N, Norstedt G,
Carter-Su C 1995 Growth hormone-promoted tyrosyl phosphorylation
of SHC proteins and SHC association with Grb2. J Biol Chem 270:75877593[Abstract/Free Full Text]
-
Wen Z, Zhong Z, Darnell Jr JE 1995 Maximal
activation of transcription by Stat1 and Stat3 requires both tyrosine
and serine phosphorylation. Cell 82:241250[CrossRef][Medline]
-
Beading C, Ng J, Babbage JW, Cantrell DA 1996 Interleukin-2 activation of STAT5 requires the convergent action of
tyrosine kinases and a serine/threonine kinase pathway distinct from
the Raf1/ERK2 MAP kinase pathway. EMBO J 15:19021913[Medline]
-
David M, Petricoin ER, Larner AC 1996 Activation of
protein kinase A inhibits interferon induction of the Jak/Stat pathway
in U266 cells. J Biol Chem 271:45854588[Abstract/Free Full Text]
-
Sengupta TK, Schmitt EM, Ivashkiv LB 1996 Inhibition of cytokines and Jak-Stat activation by distinct signalling
pathways. Proc Natl Acad Sci USA 93:94999504[Abstract/Free Full Text]
-
Argetsinger LS, Carter-Su C 1996 Mechanism of
signaling by growth hormone receptor. Physiol Rev 76:10891107[Abstract/Free Full Text]
-
Francis SM, Enerbäck S, Möller C, Enberg B,
Norstedt G 1993 A novel in vitro model for studying
signal transduction and gene regulation via the growth hormone
receptor. Mol Endocrinol 7:9728[Abstract/Free Full Text]
-
Silvennoinen O, Schindler C, Schlessinger J, Levy
DE 1993 Ras-independent growth factor signaling by transcription
factor tyrosine ohosphorylation. Science 261:17361738[Abstract/Free Full Text]
-
Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nucleic Acids Res 11:14751489[Abstract/Free Full Text]
-
Bradford MM 1976 A rapid and sensitive method for
the quantitation of proteins utilizing the principle of dye binding.
Anal Biochem 72:248254[CrossRef][Medline]
-
Sliva D, Wood TJJ, Schindler C, Lobie PE, Norstedt
G 1994 Growth hormone specifically regulates serine protease
inhibitor gene transcription via gamma-activated sequence-like DNA
elements. J Biol Chem 269:2620826214[Abstract/Free Full Text]
-
Müller S, Sideras P, Smith CI, Xanthopoulos
KG 1996 Cell specific expression of human Brutons
agammaglobulinemia tyrosine kinase gene (Btk) is regulated by Sp 1- and
Sp-1/PU. 1-family members. Oncogene 13:19551964[Medline]
-
Luckow B, Schütz G 1987 CAT constructions
with multiple unique restriction sites for the functional analysis of
eukaryotic promoters and regulatory elements. Nucleic Acids Res 15:5490[Free Full Text]
-
Seed B, Sheen JY 1988 A simple phase-extraction
assay for chloramphenicol acyltransferase activity. Gene 67:271277[CrossRef][Medline]
-
Subramaniam M, Schmidt LJ, Crutchfield CE, Getz MJ 1989 Negative regulation of serum-responsive enhancer elements. Nature 340:6466[CrossRef][Medline]
-
Tollet P, Hamberg M, Gustafsson J-Å, Mode A 1995 Growth hormone signaling leading to CYP2C12 gene expression in rat
hepatocytes involves phospholipase A2. J Biol Chem 270:1256912577[Abstract/Free Full Text]
-
Blackwell GJ, Flower RJ 1983 Inhibition of
phospholipase. Br Med Bull 39:2604[Free Full Text]
-
Schütze S, Potthoff K, Machleidt T, Berkovic D,
Wiegman K, Krönke M 1992 TNF activates NF-kB by
phosphatidylcholine-specific phospholipase C-induced acidic
sphingomyelin breakdown. Cell 71:765776[CrossRef][Medline]
-
Bleasdale JE, Bundy GL, Bunting S, Fitzpatrick FA, Huff
RM, Sun FF, Pike JE 1989 Inhibition of phospholipase C-dependent
processes by U-73122, Raven Press, New York
-
Street IP, Lin H-K, Laliberté F, Ghomashchi F,
Wang Z, Perrier H, Tremblay NM, Huang Z, Weech PK, Gelb MH 1993 Slow- and tight-binding inhibitors of the 85-kDa human phospholipase
A2. Biochemistry 32:59355940[CrossRef][Medline]
-
Waxman DJ, Ram PA, Park SH, Choi HK 1995 Intermittent plasma growth hormone triggers tyrosine phosphorylation
and nuclear translocation of a liver- expressed, Stat 5-related DNA
binding protein. Proposed role as an intracellular regulator of
male-specific liver gene transcription. J Biol Chem 270:1326213270[Abstract/Free Full Text]
-
Subramanian A, Teixeira J, Wang J, Gil G 1995 A
STAT factor mediates the sexually dimorphic regulation of hepatic
cytochrome P450 3A10/lithocholic acid 6 beta-hydroxylase gene
expression by growth hormone. Mol Cell Biol 15:46724682[Abstract]
-
Roupas P, Herrington AC 1988 Intracellular
processing of growth hormone receptors by adipocytes in primary
culture. Mol Cell Endocrinol 57:9399[CrossRef][Medline]
-
Gorin E, Goodman HM 1985 Turnover of the growth
hormone receptor in rat adipocytes. Endocrinology 116:467475
-
Kim TK, Maniatis T 1996 Regulation of
interferon-g-activated Stat 1 by the ubiquitin-proteasome pathway.
Science 273:17171719[Abstract/Free Full Text]
-
Rayanade RJ, Patel K, Ndubuisi M, Sharma S, Omura S,
Etlinger JD, Pine R, Sehgal PB 1997 Proteasome- and p53-dependent
masking of signal transducer and activator of transcription (STAT)
factors. J Biol Chem 272:46594662[Abstract/Free Full Text]
-
Haspel RL, Salditt-Georgieff M, Darnell Jr JE 1996 The rapid inactivation of nuclear tyrosine phosphorylated Stat1 depends
upon a protein tyrosine phosphatase. EMBO J 15:62626268[Medline]
-
Hackett RH, Wang Y-D, Sweitzer S, Feldman G, Wood WI,
Larner AC 1997 Mapping of a cytoplasmic domain of the human growth
hormone receptor that regulates rates of inactivation of Jak2 and Stat
proteins. J Biol Chem 272:1112811132[Abstract/Free Full Text]
-
Guan KL 1994 The mitogen activated protein kinase
signal transduction pathway: from the cell surface to the nucleus. Cell
Signalling 6:581589[CrossRef][Medline]
-
Silva CM, Lu H, Weber MJ, Thorner MO 1994 Differential tyrosine phosphorylation of JAK1, JAK2 and STAT1 by growth
hormone and interferon- gamma in IM-9 cells. J Biol Chem 269:2753227539[Abstract/Free Full Text]
-
Ihle JN, Witthuhn BA, Quelle FW, Yamamoto K,
Silvennoinen O 1995 Signalling through the hematopoietic cytokine
receptors. Annu Rev Immunol 13:363398
-
Yoshimura A, Okhubo T, Kiguchi T, Jenkins JA, Gilbert
DJ, Copeland NG, Hara T, Miyajima A 1995 A novel
cytokine-inducible gene CIS encodes an SH2-containing protein that
binds to tyrosine-phosphorylated interleukin 3 and erythropoietin
receptors. EMBO J 14:28162826[Medline]
-
Petricoin E, David M, Igarashi K, Benjamin C, Ling L,
Goelz S, Finbloom DS, Larner AC 1996 Inhibition of alpha
interferon but not gamma interferon signal transduction by phorbol
esters is mediated by a tyrosine phosphatase. Mol Cell Biol 16:14191424[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
R. D. Meyer, E. V. Laz, T. Su, and D. J. Waxman
Male-Specific Hepatic Bcl6: Growth Hormone-Induced Block of Transcription Elongation in Females and Binding to Target Genes Inversely Coordinated with STAT5
Mol. Endocrinol.,
November 1, 2009;
23(11):
1914 - 1926.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. V. Laz, A. Sugathan, and D. J. Waxman
Dynamic in Vivo Binding of STAT5 to Growth Hormone-Regulated Genes in Intact Rat Liver. Sex-Specific Binding at Low- But Not High-Affinity STAT5 Sites
Mol. Endocrinol.,
August 1, 2009;
23(8):
1242 - 1254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Waxman and M. G. Holloway
Sex Differences in the Expression of Hepatic Drug Metabolizing Enzymes
Mol. Pharmacol.,
August 1, 2009;
76(2):
215 - 228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wei, S. Puzhko, M. Wabitsch, and C. G. Goodyer
Transcriptional Regulation of the Human Growth Hormone Receptor (hGHR) Gene V2 Promoter by Transcriptional Activators and Repressor
Mol. Endocrinol.,
March 1, 2009;
23(3):
373 - 387.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. H. Elsasser, C.-J. Li, T. J. Caperna, S. Kahl, and W. F. Schmidt
Growth Hormone (GH)-Associated Nitration of Janus Kinase-2 at the 1007Y-1008Y Epitope Impedes Phosphorylation at This Site: Mechanism for and Impact of a GH, AKT, and Nitric Oxide Synthase Axis on GH Signal Transduction
Endocrinology,
August 1, 2007;
148(8):
3792 - 3802.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. M. Vidal, R. Merino, E. Rico-Bautista, L. Fernandez-Perez, D. J. Chia, J. Woelfle, M. Ono, B. Lenhard, G. Norstedt, P. Rotwein, et al.
In Vivo Transcript Profiling and Phylogenetic Analysis Identifies Suppressor of Cytokine Signaling 2 as a Direct Signal Transducer and Activator of Transcription 5b Target in Liver
Mol. Endocrinol.,
January 1, 2007;
21(1):
293 - 311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Waxman and C. O'Connor
Growth Hormone Regulation of Sex-Dependent Liver Gene Expression
Mol. Endocrinol.,
November 1, 2006;
20(11):
2613 - 2629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Flores-Morales, C. J. Greenhalgh, G. Norstedt, and E. Rico-Bautista
Negative Regulation of Growth Hormone Receptor Signaling
Mol. Endocrinol.,
February 1, 2006;
20(2):
241 - 253.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-C. Leung, G. Johannsson, G. M. Leong, and K. K. Y. Ho
Estrogen Regulation of Growth Hormone Action
Endocr. Rev.,
October 1, 2004;
25(5):
693 - 721.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. G. Miquet, A. I. Sotelo, A. Bartke, and D. Turyn
Suppression of Growth Hormone (GH) Janus Tyrosine Kinase 2/Signal Transducer and Activator of Transcription 5 Signaling Pathway in Transgenic Mice Overexpressing Bovine GH
Endocrinology,
June 1, 2004;
145(6):
2824 - 2832.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Du, G. P. Frick, L.-R. Tai, A. Yoshimura, and H. M. Goodman
Interaction of the Growth Hormone Receptor with Cytokine-Induced Src Homology Domain 2 Protein in Rat Adipocytes
Endocrinology,
March 1, 2003;
144(3):
868 - 876.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Graichen, J. Sandstedt, E. L. K. Goh, O. G. P. Isaksson, J. Tornell, and P. E. Lobie
The Growth Hormone-binding Protein Is a Location-dependent Cytokine Receptor Transcriptional Enhancer
J. Biol. Chem.,
February 14, 2003;
278(8):
6346 - 6354.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Helander, J.-A. Gustafsson, and A. Mode
Possible Involvement of Truncated Signal Transducer and Activator of Transcription-5 in the GH Pattern-Dependent Regulation of CYP2C12 Gene Expression in Rat Liver
Mol. Endocrinol.,
July 1, 2002;
16(7):
1598 - 1611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Gonzalez, J. G. Miquet, A. I. Sotelo, A. Bartke, and D. Turyn
Cytokine-Inducible SH2 Protein Up-Regulation Is Associated with Desensitization of GH Signaling in GHRH-Transgenic Mice
Endocrinology,
February 1, 2002;
143(2):
386 - 394.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. S. Tannenbaum, H. K. Choi, W. Gurd, and D. J. Waxman
Temporal Relationship Between the Sexually Dimorphic Spontaneous GH Secretory Profiles and Hepatic STAT5 Activity
Endocrinology,
November 1, 2001;
142(11):
4599 - 4606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Flores-Morales, L. Fernandez, E. Rico-Bautista, A. Umana, C. Negrin, J.-G. Zhang, and G. Norstedt
Endoplasmic Reticulum Stress Prolongs GH-Induced Janus Kinase (JAK2)/Signal Transducer and Activator of Transcription (STAT5) Signaling Pathway
Mol. Endocrinol.,
September 1, 2001;
15(9):
1471 - 1483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Lahuna, M. Rastegar, D. Maiter, J.-P. Thissen, F. P. Lemaigre, and G. G. Rousseau
Involvement of STAT5 (Signal Transducer and Activator of Transcription 5) and HNF-4 (Hepatocyte Nuclear Factor 4) in the Transcriptional Control of the hnf6 Gene by Growth Hormone
Mol. Endocrinol.,
February 1, 2000;
14(2):
285 - 294.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Sasaki, Y. Takahashi, K. Nakayama, and T. Kamataki
Cooperative Regulation of CYP2C12 Gene Expression by STAT5 and Liver-specific Factors in Female Rats
J. Biol. Chem.,
December 24, 1999;
274(52):
37117 - 37124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Ram and D. J. Waxman
SOCS/CIS Protein Inhibition of Growth Hormone-stimulated STAT5 Signaling by Multiple Mechanisms
J. Biol. Chem.,
December 10, 1999;
274(50):
35553 - 35561.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Tollet-Egnell, A. Flores-Morales, A. Stavréus-Evers, L. Sahlin, and G. Norstedt
Growth Hormone Regulation of SOCS-2, SOCS-3, and CIS Messenger Ribonucleic Acid Expression in the Rat
Endocrinology,
August 1, 1999;
140(8):
3693 - 3704.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. L. K. Goh, T. Zhu, S. Yakar, D. LeRoith, and P. E. Lobie
CrkII Participation in the Cellular Effects of Growth Hormone and Insulin-like Growth Factor-1. PHOSPHATIDYLINOSITOL-3 KINASE DEPENDENT AND INDEPENDENT EFFECTS
J. Biol. Chem.,
June 2, 2000;
275(23):
17683 - 17692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Ram and D. J. Waxman
Role of the Cytokine-inducible SH2 Protein CIS in Desensitization of STAT5b Signaling by Continuous Growth Hormone
J. Biol. Chem.,
December 8, 2000;
275(50):
39487 - 39496.
[Abstract]
[Full Text]
[PDF]
|
 |
|