| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Population Council (S.J., P.L.M.) and The Rockefeller University (P.L.M.), New York, New York 10021
Address all correspondence and requests for reprints to: Patricia L. Morris, Center for Biomedical Research, Population Council and The Rockefeller University, 1230 York Avenue, New York, New York 10021.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although the effects of cytokines have primarily been shown in hematopoietic and hepatic cell lines, their presence and regulation in various cell types is consistent with physiological functions in noninflammatory conditions. LIF was originally shown to induce terminal differentiation of the immortalized M1 myeloid leukemia cells to a macrophage phenotype (10, 11). LIF is synthesized by a variety of cells and has a broad range of biological activities, including stimulation of acute-phase proteins in hepatocytes, hematopoietic cell development, neuronal development, differentiation, inflammation, and pregnancy, as well as embryo development (2, 12, 13, 14, 15, 16). In testes, although the localization of LIF and its receptor (LIFR), to our knowledge, has not yet been reported, the addition of LIF to cocultures enhances the in vitro survival of both primary Sertoli cells and proliferating gonocytes without affecting cell proliferation (17).
Studies from our laboratory have shown the expression and regulation of
IL-6 and its receptor in primary Sertoli and Leydig cells (18, 19).
Recently, we demonstrated that two testicular cytokines, IL-6 and
interferon (IFN)-
, differentially activate STAT-3 and STAT-1
transcription factors and induce c-fos gene expression in
Sertoli cells, findings consistent with the presence of a functional
cytokine-activated signal transduction pathway in the testis (20). In
the present study, we establish the expression of the messenger RNAs
(mRNAs) for LIF and its receptor chain components in both somatic and
germ cells and identify a mechanism for LIF regulation of testicular
STAT proteins, c-fos gene expression, and activator
protein-1 (AP-1) activation using primary Sertoli cells as a model
system.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Procedures involving the use of animals strictly followed the Guidelines for the Care and Use of Laboratory Animals set forth by the NIH.
Analysis of mRNA levels
Total RNA was extracted using the Trizol reagent (Life Sciences,
Gaithersburg, MD). Riboprobes were prepared from plasmids containing
complementary DNAs for rat c-fos (specific activity =
6.6 x 108 dpm/µg) and human 18S ribosomal RNA
(rRNA) (specific activity = 1.0 x 107 dpm/µg)
(21). For solution hybridization assays, duplicates of total RNA
extracts (20–30 µg) were hybridized in 30 µl buffer (10
mM EDTA, 0.3 M NaCl, 0.5% SDS, and 10
mM N-Tris[hydroxymethyl)-
methyl-2-amino-ethanesulfonic acid, pH 7.4) containing
32P riboprobe, 150,000 dpm for the c-fos
riboprobe or 80,000 dpm for the 18S riboprobe, respectively, for 4
h at 75 C. After hybridization, 300 µl 0.3 M NaCl, 5
mM EDTA, 10 mM Tris-HCl, pH 7.4, containing 40
µg/ml ribonuclease (RNase) A and 2 µg/ml RNase T1 was added to each
tube, and the samples were incubated at 30 C for 1 h. The samples
were precipitated with 1 ml 5% TCA and 0.75% sodium pyrophosphate and
one drop of 0.5% BSA and were collected onto glass fiber filter paper
(Brandel, Gaithersburg, MD) using a 24-place cell harvester. The
filters were counted by liquid scintillation in 5 ml hydrofluor
scintillation solution (National Diagnostics, Manville, NJ). Comparison
was made with standard calibration curves to quantify the
c-fos mRNA transcript and the 18S rRNA levels.
c-fos mRNA levels were then normalized to the level of
control samples (1 pg/µg 18S rRNA). Northern blot analysis was
performed using 20 µg total RNA by the glyoxal method (20).
Oligonucleotide primers and RT-PCR amplification
Rat LIF primers were 5'-CAATGCCCTCTTTATTTCCTATTACACAGC-3' and
5'-GGGGACACAGGGCACATCCACATGGCCCAC-3' (16). These primers are derived
from exon 2 and exon 3 sequences and detect both splice variants of
LIF. Because rat LIF receptor sequences were not available, mouse LIF
receptor primers were designed: 5'-GAAAACTGTAAGGCGCTACA-3' and
5'-CCAAGTGTTTACATTGGC-3' (3, 22). These primers are from different
exons to eliminate detecting contaminating genomic DNAs. One microgram
total RNA was reversed transcribed using GeneAmp kit (Perkin-Elmer,
Norwalk, CT) according to manufacturer’s directions. Two microliters
of RT reaction products were used in a 50 µl PCR reaction that
contained 1.5 µCi [32P]deoxycytidine triphosphate (3000
Ci/mmol, Amersham, Arlington Heights, IL) to visualize the products.
PCR amplification of complementary DNAs for LIF receptor were done for
35 cycles at 1 min at 95 C, 1 min at 48 C, and 1 min at 72 C, whereas
for LIF, it was done for 35 cycles at 1 min at 95 C, 1 min at 55 C, and
1 min at 72 C. Ten microliters of PCR products were analyzed on a 5%
polyacrylamide gel and autoradiographed. The PCR products were
confirmed by sequencing analysis. RT-PCR products for LIFR from
immature Sertoli cells showed 79% and 86% homology when compared with
published LIFR sequences for human (emb X61615 HSLIFR H.
sapiens mRNA for leukemia inhibitory factor receptor) and mouse
(dbj D26177 MUSDFLR Mouse mRNA for D-factor/LIF receptor),
respectively. The following mouse primers were used to analyze gp130
mRNA:5'-GCAGCAGGTTTCAGATCACA-3' and 5'-CCCAGGTGTGACTTTGTCCT-3'. The
amplification of the S16 ribosomal gene was used as an internal control
with the following primers: 5'-AAGTCTTCGGACGCAAGAAA-3' and
5'-GACAAGACGAAGACCCGTT-3' (23).
Nuclear extract preparation, electrophoretic mobility shift assay
(EMSA), and Western analysis
Nuclear extracts were prepared from unstimulated or stimulated
Sertoli cells as described before (24, 25). The sequence of m67 oligo
is 5' CATTTCCCGTAAATCGTCGA 3' (26). The complementary oligos were
annealed in 100 mM Tris-HCl (pH 8.0) and 50 mM
MgCl2 over a period of 3 h. The AP-1 oligo was obtain
from Promega Corp. (Madison, WI). The oligos were end labeled with T4
polynucleotide kinase and [32-gamma]ATP. Nuclear extracts
(2–10 µg) were incubated in a final volume of 12 µl in 20
mM HEPES (7.9), 40 mM KCl, 1 mM
MgCl2, 0.1 mM EGTA, 0.5 mM
dithiothreitol, and 4% Ficoll for 20 min at room temperature with the
probe [150,000–200,000 cpm, 1 ng for m67 and sis-inducible
element (SIE), and 50,000 cpm for AP-1]. Antisera to STAT-3 protein
(kindly provided by J. E. Darnell, Jr., Rockefeller University) were
preincubated for 10 min before addition of the probe. The reaction
products were fractionated on a 4% nondenaturing polyacrylamide gel
(acrylamide/bis, 29:1) in 0.25% Tris-borate-EDTA that was prerun for
30 min at room temperature. For Western analysis, 500 µg of nuclear
extracts were immunoprecipitated with antiphosphotyrosine-agarose
(Transduction Laboratories, Lexington, KY) for 2 h at 4 C and run
on a 7.5% SDS/PAGE, blotted to nitrocellulose membrane, and probed
with an anti-STAT-3 antiserum (1:1000). The bound antibodies were
detected using an epichemiluminescence kit (Amersham).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, lanes 4–7), rat germ cells (Fig. 1, lanes 8–11), and mouse germ cells (Fig. 1, lanes 12–15). RT-PCR
analysis of total RNA using a primer set for gp130 signaling chain
detected its mRNA in both the somatic and specific germ cells (Fig. 1, top panel). Because rat LIFR sequences are not available, we
designed two sets of primers using the published mouse LIF receptor
sequences. RT-PCR of total RNA from different cells showed that
although all of the somatic cells express the LIFR (Fig. 1, LIF
receptor, middle panel, lanes 4–7), in elutriator-purified
germ cells from rat testis, LIFR mRNA was detected only in the
elongated spermatids. Figure 1, middle panel, illustrates
that LIF mRNA is expressed in both the immature and adult somatic
cells, as well as all of the germ cells (lanes 4–11). Sequence
analysis of the RT-PCR products from immature Sertoli cells (lane 5)
confirmed that the PCR products were LIF and LIFR. Sequencing of the
RT-PCR products for LIFR from immature Sertoli cells showed 79% and
86% homology when compared with published LIFR sequences for human and
mouse, respectively. Similar to data with rat RNA samples, RT-PCR
analysis of freshly isolated mouse germ cells showed the presence of
gp130 and LIF mRNAs in all of the cells (Fig. 1, lanes 12–15). In
contrast to the findings using rat germ cell RNA, LIFR was readily
detected in mouse germ cell RNA extracts (Fig. 1, lanes 12–15).
Interestingly the highest relative amounts of LIFR were observed in
pachytene spermatocytes, which had a barely detectable signal for LIF
mRNA. A set of primers for an internal control, S16 mRNA, showed
comparable RNA levels in different cell preparations (Fig. 1, bottom panel).
|
illustrates that LIF rapidly induces
nuclear STAT-3 DNA binding as early as 2 min following its addition
(lane 2). An anti-STAT-3 antiserum supershifted this complex (lane 8),
and the addition of 5- or 10-fold unlabeled m67 oligo completely
abolished STAT-m67 interactions (lanes 9 and 10), indicating further
specificity of this DNA binding. LIF also activated some STAT-1 protein
to bind to the m67 oligo after 10 min of LIF treatment (lane 4), which
was supershifted with anti-STAT-1 antisera (data not shown).
|
). EMSA in Fig. 3A
demonstrates that a 3-h preincubation of Sertoli cells with genistein
(100 µg/ml) before the addition of LIF for 2, 5, 10, or 15 min
inhibits STAT-3 DNA binding. In contrast, pretreatment with H7 had no
effect on this m67 oligonucleotide binding at these times, indicating
that tyrosine but not serine/threonine phosphorylation events are
required for LIF-mediated STAT-3 translocation to the nucleus and DNA
binding (Fig. 3A, lanes 4–15). Genistein or H7 alone did not activate
STAT proteins (lanes 2 and 3). When these Sertoli cell nuclear extracts
were immunoprecipitated with antiphosphotyrosine antiserum, Western
blot analysis with anti-STAT-3 antiserum showed an immediate tyrosine
phosphorylation of STAT-3 protein induced by LIF, an effect that was
also inhibited by genistein (Fig. 3B).
|
a
representative Northern blot (top panel) and solution
hybridization (bottom panel) show that LIF rapidly and
transiently activated c-fos gene expression after 15 min of
treatment with maximal induction (20-fold) at 30–45 min. Furthermore,
EMSA using Sertoli cell nuclear extracts showed increasing amounts of
AP-1 proteins bound to the AP-1 oligo after 2 h of LIF treatment
(Fig. 4B, lane 3), whereas the addition of 5- or 10-fold unlabeled AP-1
oligonucleotide (lanes 5 and 6) reduced this DNA binding.
|
shows that the LIF-induced increase in
steady state c-fos mRNA levels was diminished to 5-fold over
the basal levels by genistein, whereas H7 completely abolished LIF
induction of c-fos to that of control levels. To study the
effects of the kinase inhibitors on LIF induction of AP-1 proteins, we
next pretreated the Sertoli cells with genistein (100 µg/ml, 3
h) and/or H7 (100 µM, 1 h) followed by the addition
of LIF for 2 h. Figure 5B illustrates that both genistein and H7
inhibit the induction of AP-1 protein binding to the AP-1
oligonucleotide subsequent to a 2-h LIF treatment (compare lane 4 to
lanes 5–7).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the testis, LIF exposure increases the survival of Sertoli cells and proliferating gonocytes (17). Together with stem cell factor, LIF treatment promotes survival and proliferation of mouse primordial germ cells while inhibiting their apoptosis (29, 30). Our RT-PCR analyses of gp130 and LIF mRNA show their expression both in immature and adult rat somatic cells and specific rat and mouse germ cells. In contrast to gp130 and LIF, LIFR mRNA is expressed in somatic cells with comparatively small amounts in rat elongating spermatids. Taken together with our findings on STAT-3 activation, LIF may therefore function as an autocrine/paracrine factor regulating spermatogenesis mediated by its effects on the Sertoli cells. Alternatively, although we used two different sets of LIF receptor primers derived from the mouse sequences, it is possible that the rat germ cells express a different splice variant and/or sequence variations in LIFR mRNA that is not detectable by our primers. Should rat germ cells produce LIFR protein, they may represent a direct functional target for somatic cell-produced LIF. Species specificity in the expression of LIFR as well as ligand binding may play a role in LIF signaling in germ cells.
LIF and the other members of the gp130 protein family have been shown, in several established clonal cell lines, to induce in a sequential fashion, a progressive tyrosine- and serine/threonine-dependent phosphorylation of STAT-3 protein with both a primary tyrosine and a secondary serine/threonine phosphorylation step (8, 27, 28). Although both events induce nuclear translocation, the former induces in vitro DNA binding activities, and the latter is correlated with maximal transactivation and the formation of stable STAT-DNA complexes (28). Our EMSA analysis of Sertoli cell nuclear extracts shows that during 2–15 min LIF exposure, a time course when ongoing phosphorylation of STAT-3 occurs, the tyrosine kinase inhibitor, genistein, diminished the activation of STAT-3 and its interaction with the m67 oligonucleotide. Although the serine/threonine kinase inhibitor, H7, has been shown to selectively abolish binding of STAT-3 homodimers in a cell type-dependent manner (28), in primary Sertoli cell nuclear extracts the high-affinity m67-STAT-3 (or -STAT-1) complexes were not affected by H7. Because H7 did not cause a change in the migration or the abundance of STAT-3 protein, at present it is uncertain whether a secondary form of STAT-3 protein, due to the serine phosphorylation that is observed in immortalized cell lines (8, 27, 28), also occurs in primary Sertoli cells.
Intracellular signaling by gp130-sharing cytokines is mediated by the
STAT protein(s), resulting in their induction and transcriptional
activation of several targeted immediate early genes (24, 31). Specific
DNA response elements have been mapped in c-fos and
junB promoter regions, which contain sequences derived from
the reported IFN- activation site TTCCNNNAA and bind STAT proteins
in vitro (7, 31, 32). Transactivation of these genes appears
to depend on the STAT-DNA interactions and requires phosphorylation by
distinct protein kinases (7, 8, 20). junB gene expression is
distinctively induced in several hematopoietic and hepatic cell lines
in response to cytokines and growth factors and requires
phosphorylation of STAT proteins at specific tyrosine and serine
residues (8). In primary Sertoli cells, our data indicate that
testicular cytokines (such as LIF, IL-6, and IFN-) differentially
activate STAT proteins to bind to the c-fos SIE and induce
immediate early gene expression at transcriptional levels. These
effects are also dependent on tyrosine and serine phosphorylation
pathways (this study and Refs. 20 and 32a). Several other members of
the STAT proteins, including STAT-1
, STAT-4, and STAT-5, contain a
conserved carboxy-terminal amino acid sequence (XPXSP) that contains
serine phosphorylation sites important for maximal transcriptional
activity (33). This C-terminal transactivation domain is missing in
STAT-1ß, and although STAT-1ß is shown to be tyrosine
phosphorylated and binds to DNA elements, it cannot restore IFN-
induction of U3A cells deficient in STAT-1 and STAT-1ß. Thus,
specific serine phosphorylation of STATs is obligatory for maximal
transactivation of responsive genes. Because other major signaling
pathways such as mitogen-activated protein, cAMP response element
binding protein, and protein kinase C are also regulated by increases
in serine kinase activities and may further enhance transactivation
(34, 35), it is possible that concomitant activation of these pathways
will modulate LIF-mediated gene expression in testicular cells.
Stimulation of the AP-1 family of transcription factors is a crucial first step in response to various extracellular factors that play important roles in signal transduction of cellular proliferation and differentiation (36, 37). Increasing amounts of evidence suggest that c-fos is directly involved in the regulation of testicular function. FSH regulates the Sertoli cell functions that are mediated through the c-fos, junB, and c-jun messages (38, 39). In addition, a paracrine factor, PModS, secreted by mesenchymal peritubular myoid cells, enhances the differentiation of Sertoli cells mediated by c-fos (40). When primary Sertoli cells are cultured on Matrigel (Becton Dickinson, Franklin Lakes, NJ) in vitro, c-fos expression is increased, whereas the addition of antisense oligonucleotides to c-fos, which decreases c-fos protein, inhibited the attachment and spreading of the cells (41). c-fos and junB genes contain a bipartite DNA binding domain that consists of a basic leucine zipper region. These proteins regulate target genes by binding as homo- or heterodimers to the AP-1 elements (42). Furthermore, the regulation of the c-fos gene itself by two factors, the AP-1 and the ternary, has been shown to be mediated by serine phosphorylation events (43, 44). Our data indicate that LIF increases AP-1 binding by two pathways: first, the increase in c-fos transcription, which in turn increases c-fos protein, and second, an increase in phosphorylation of the existing AP-1 proteins by other signaling pathways (such as protein kinase A) that increases the effectiveness of latent AP-1 transcription factors. Because we show that tyrosine and serine/threonine phosphorylation inhibitors reduce both LIF-activated c-fos transcription and the level of AP-1 proteins, both of these pathways may contribute to AP-1 activation.
These findings and other recent studies from our laboratory have shown for the first time that IL-6, LIF, and their receptors are expressed in different cells of the testes and, using a Sertoli cell culture model, provide evidence that a functional testicular cytokine signaling pathway exists in vivo (18–20, 45). Thus, primary Sertoli cultures are a valuable system for dissecting the molecular mechanisms involved in the transduction of signals from the testicular receptor to the regulatory elements of several responsive genes under noninflammatory autocrine/paracrine states. Additional studies will be needed to clarify the functional role of LIF, LIFR, and gp130 in germ cell signaling. Our findings suggest that additional cofactors may be required to facilitate LIF signaling within the tubules. Further studies are currently in progress to analyze downstream genes whose expressions are affected by testicular cytokines.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received September 12, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is mediated through phosphorylation of STAT-3 and STAT-1
proteins. Endocrinology 138:2740–2746 in Sertoli cells. Endocrinology 137:4738–4743[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  T. M. Onorato, P. W. Brown, and P. L. Morris Mono-(2-ethylhexyl) Phthalate Increases Spermatocyte Mitochondrial Peroxiredoxin 3 and Cyclooxygenase 2 J Androl, May 1, 2008; 29(3): 293 - 303. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Magni, E. Dozio, M. Ruscica, H. Watanobe, A. Cariboni, R. Zaninetti, M. Motta, and R. Maggi Leukemia Inhibitory Factor Induces the Chemomigration of Immortalized Gonadotropin-Releasing Hormone Neurons through the Independent Activation of the Janus Kinase/Signal Transducer and Activator of Transcription 3, Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase 1/2, and Phosphatidylinositol 3-Kinase/Akt Signaling Pathways Mol. Endocrinol., May 1, 2007; 21(5): 1163 - 1174. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kanatsu-Shinohara, K. Inoue, N. Ogonuki, H. Miki, S. Yoshida, S. Toyokuni, J. Lee, A. Ogura, and T. Shinohara Leukemia Inhibitory Factor Enhances Formation of Germ Cell Colonies in Neonatal Mouse Testis Culture Biol Reprod, January 1, 2007; 76(1): 55 - 62. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ishikawa and P. L. Morris Interleukin-1{beta} Signals through a c-Jun N-Terminal Kinase-Dependent Inducible Nitric Oxide Synthase and Nitric Oxide Production Pathway in Sertoli Epithelial Cells Endocrinology, November 1, 2006; 147(11): 5424 - 5430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Vigodner, T. Ishikawa, P. N. Schlegel, and P. L. Morris SUMO-1, human male germ cell development, and the androgen receptor in the testis of men with normal and abnormal spermatogenesis Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E1022 - E1033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ishikawa, K. Hwang, D. Lazzarino, and P. L. Morris Sertoli Cell Expression of Steroidogenic Acute Regulatory Protein-Related Lipid Transfer 1 and 5 Domain-Containing Proteins and Sterol Regulatory Element Binding Protein-1 Are Interleukin-1{beta} Regulated by Activation of c-Jun N-Terminal Kinase and Cyclooxygenase-2 and Cytokine Induction Endocrinology, December 1, 2005; 146(12): 5100 - 5111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Dorval-Coiffec, J.-G. Delcros, H. Hakovirta, J. Toppari, B. Jegou, and C. Piquet-Pellorce Identification of the Leukemia Inhibitory Factor Cell Targets Within the Rat Testis Biol Reprod, March 1, 2005; 72(3): 602 - 611. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Higashi, H. Kunimoto, S. Kaneko, T. Sasaki, M. Ishii, H. Kojima, and K. Nakajima Cytoplasmic c-Fos induced by the YXXQ-derived STAT3 signal requires the co-operative MEK/ERK signal for its nuclear translocation Genes Cells, March 1, 2004; 9(3): 233 - 242. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Walch, E. Clavarino, and P. L. Morris Prostaglandin (PG) FP and EP1 Receptors Mediate PGF2{alpha} and PGE2 Regulation of Interleukin-1{beta} Expression in Leydig Cell Progenitors Endocrinology, April 1, 2003; 144(4): 1284 - 1291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. O. R. Borges, M. L. C. Abreu, C. S. Porto, and M. C. W. Avellar Characterization of Muscarinic Acetylcholine Receptor in Rat Sertoli Cells Endocrinology, November 1, 2001; 142(11): 4701 - 4710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Mauduit, I. Goddard, V. Besset, E. Tabone, C. Rey, F. Gasnier, F. Dacheux, and M. Benahmed Leukemia Inhibitory Factor Antagonizes Gonadotropin Induced-Testosterone Synthesis in Cultured Porcine Leydig Cells: Sites of Action Endocrinology, June 1, 2001; 142(6): 2509 - 2520. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Guo, P. L. Morris, and L. J. Gudas Follicle-Stimulating Hormone and Leukemia Inhibitory Factor Regulate Sertoli Cell Retinol Metabolism Endocrinology, March 1, 2001; 142(3): 1024 - 1032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kotaja, S. Aittomäki, O. Silvennoinen, J. J. Palvimo, and O. A. Jänne ARIP3 (Androgen Receptor-Interacting Protein 3) and Other PIAS (Protein Inhibitor of Activated STAT) Proteins Differ in Their Ability to Modulate Steroid Receptor-Dependent Transcriptional Activation Mol. Endocrinol., December 1, 2000; 14(12): 1986 - 2000. [Abstract] [Full Text]
|
|
|
|
|
|
J.-a. Tan, S. H. Hall, P. Petrusz, and F. S. French Thyroid Receptor Activator Molecule, TRAM-1, Is an Androgen Receptor Coactivator Endocrinology, September 1, 2000; 141(9): 3440 - 3450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Auernhammer and S. Melmed Leukemia-Inhibitory Factor--Neuroimmune Modulator of Endocrine Function Endocr. Rev., June 1, 2000; 21(3): 313 - 345. [Abstract] [Full Text]
|
|
|
|
|
|
C. Piquet-Pellorce, I. Dorval-Coiffec, M.-D. Pham, and B. Jegou Leukemia Inhibitory Factor Expression and Regulation within the Testis Endocrinology, March 1, 2000; 141(3): 1136 - 1141. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-a. Tan, S. H. Hall, K. G. Hamil, G. Grossman, P. Petrusz, J. Liao, K. Shuai, and F. S. French Protein Inhibitor of Activated STAT-1 (Signal Transducer and Activator of Transcription-1) Is a Nuclear Receptor Coregulator Expressed in Human Testis Mol. Endocrinol., January 1, 2000; 14(1): 14 - 26. [Abstract] [Full Text]
|
|
|
|
 |
|
 E. Kumahara, T. Ebihara, and D. Saffen Protein Kinase Inhibitor H7 Blocks the Induction of Immediate-Early Genes zif268 and c-fos by a Mechanism Unrelated to Inhibition of Protein Kinase C but Possibly Related to Inhibition of Phosphorylation of RNA Polymerase II J. Biol. Chem., April 9, 1999; 274(15): 10430 - 10438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Stephens, S. J. Lumpkin, and J. B. Fishman Activation of Signal Transducers and Activators of Transcription 1 and 3 by Leukemia Inhibitory Factor, Oncostatin-M, and Interferon-gamma in Adipocytes J. Biol. Chem., November 20, 1998; 273(47): 31408 - 31416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kanzaki and P. L. Morris Identification and Regulation of Testicular Interferon-{gamma} (IFN{gamma}) Receptor Subunits: IFN{gamma} Enhances Interferon Regulatory Factor-1 and Interleukin-1{beta} Converting Enzyme Expression Endocrinology, May 1, 1998; 139(5): 2636 - 2644. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
