Endocrinology Vol. 139, No. 4 1883-1890
Copyright © 1998 by The Endocrine Society
Testicular Leukemia Inhibitory Factor (LIF) and LIF Receptor Mediate Phosphorylation of Signal Transducers and Activators of Transcription (STAT)-3 and STAT-1 and Induce c-fos Transcription and Activator Protein-1 Activation in Rat Sertoli But Not Germ Cells1
Shirzad Jenab and
Patricia L. Morris
Population Council (S.J., P.L.M.) and The Rockefeller
University (P.L.M.), New York, New York 10021
Address all correspondence and requests for reprints to: Patricia L. Morris, Center for Biomedical Research, Population Council and The Rockefeller University, 1230 York Avenue, New York, New York 10021.
 |
Abstract
|
|---|
Increasing amounts of evidence suggest noninflammatory roles for growth
factor and cytokines in development and differentiation. Leukemia
inhibitory factor (LIF) belongs to a gp130 pleiotropic family of growth
factors that has recently been shown to enhance the survival of rat
testicular gonocytes and Sertoli cells. In this study, we show the
expression of gp130 and LIF messenger RNAs (mRNAs) in the somatic (the
Sertoli and Leydig cells) and specific germ cells (spermatogonia,
pachytene, round, and elongated spermatids) of rodent testis,
suggestive of cell-specific LIF-mediated functions. LIF receptor mRNA
was demonstrated in rat somatic cells, rat elongating spermatids, and
all of the mouse germ cells. In addition, we characterized the effects
of LIF on the signal transducers and activators of transcription
(STAT)-3 and STAT-1, c-fos gene expression, and
activator protein-1 regulation in primary rat Sertoli cells.
Electrophoretic mobility shift assay and Western blot analysis
demonstrated that LIF translocates STAT-3 (and to a lesser extent
STAT-1) transcription factor(s) to the nucleus within 2 min of exposure
in a tyrosine but not serine/threonine phosphorylation-dependent
pathway. Quantitative solution hybridization analysis revealed a
transient increase in c-fos mRNA levels by 20-fold
following 3045 min of LIF treatment, an effect that was inhibited by
the tyrosine, as well as serine/threonine kinase inhibitors, genistein,
and H7. Subsequently, LIF treatment of the Sertoli cells increased
nuclear activator protein-1 binding proteins at 2 h after its
addition, an effect that was also sensitive to genistein and H7
pretreatments. In contrast, LIF treatment of primary rat germ cells did
not alter c-fos mRNA levels. Species specificity in the
expression of LIF receptor as well as ligand binding may play a role in
LIF signaling in these germ cells. Thus, using a primary Sertoli cell
model, we demonstrated that the testicular LIF signaling pathway is
contingent on the phosphorylation of latent transcription factors. Our
data are consistent with LIF-mediated signaling events involving both
somatic and germ cells during spermatogenesis.
 |
Introduction
|
|---|
LEUKEMIA inhibitory factor (LIF), a
multifunctional member of the gp130 cytokine family, is structurally
and functionally related to interleukin-6 (IL-6), oncostatin M, and
ciliary neurotrophic factor. These related cytokines bind to specific
cell surface receptors that are coupled to a common gp130 signal
transducing receptor component in diverse cell types and induce the
homodimerization of the gp130 protein with the IL-6 receptor chain (in
the case of IL-6) or heterodimerization of gp130 and the LIF receptor
component (in the case of LIF, ciliary neurotrophic factor, and
oncostatin M) (1, 2, 3, 4). In response to stimulation by these cytokines,
rapid intracellular tyrosine phosphorylation of the gp130 protein,
Janus kinase (JAK)1, JAK2, and TYK2 kinases occurs, which activates the
signal transducers and activators of transcription (STAT)-3/STAT-1
signal transduction pathway, and induces the differential
transcriptional regulation of responsive genes, including the immediate
early genes junB and c-fos (5, 6, 7, 8, 9).
Although the effects of cytokines have primarily been shown in
hematopoietic and hepatic cell lines, their presence and regulation in
various cell types is consistent with physiological functions in
noninflammatory conditions. LIF was originally shown to induce terminal
differentiation of the immortalized M1 myeloid leukemia cells to a
macrophage phenotype (10, 11). LIF is synthesized by a variety of cells
and has a broad range of biological activities, including stimulation
of acute-phase proteins in hepatocytes, hematopoietic cell development,
neuronal development, differentiation, inflammation, and pregnancy, as
well as embryo development (2, 12, 13, 14, 15, 16). In testes, although the
localization of LIF and its receptor (LIFR), to our knowledge, has not
yet been reported, the addition of LIF to cocultures enhances the
in vitro survival of both primary Sertoli cells and
proliferating gonocytes without affecting cell proliferation (17).
Studies from our laboratory have shown the expression and regulation of
IL-6 and its receptor in primary Sertoli and Leydig cells (18, 19).
Recently, we demonstrated that two testicular cytokines, IL-6 and
interferon (IFN)-
, differentially activate STAT-3 and STAT-1
transcription factors and induce c-fos gene expression in
Sertoli cells, findings consistent with the presence of a functional
cytokine-activated signal transduction pathway in the testis (20). In
the present study, we establish the expression of the messenger RNAs
(mRNAs) for LIF and its receptor chain components in both somatic and
germ cells and identify a mechanism for LIF regulation of testicular
STAT proteins, c-fos gene expression, and activator
protein-1 (AP-1) activation using primary Sertoli cells as a model
system.
 |
Materials and Methods
|
|---|
Primary testicular cell preparations
Specific rat somatic (adult and immature Sertoli and Leydig
cells) and various mouse and rat germ cells (spermatogonia, pachytene
spermatocytes, and round and elongated spermatids) were isolated as
described before (18, 19). Primary cultures of rat Sertoli cells were
isolated and purified from 18-day-old Sprague-Dawley rats (Charles
River, Kingston, NY) and incubated at 34 C at a density of 1 x
107 cells per 100-mm polystyrene dish in phenol red-,
serum-, and endotoxin-free DME/F-12 medium (Irvine Scientific, Santa
Ana, CA) as described previously (18, 19). The medium was supplemented
with 2.5 µg/ml bovine insulin (Sigma, St. Louis, MO), 1 µg/ml
transferrin (Calbiochem, La Jolla, CA), and 10 µg/ml bacitracin
(Sigma). On day 3 in vitro, following the addition of
specific factors, RNA or nuclear extracts were isolated at the
indicated times. Duplicate or triplicate culture dishes were used for
each drug treatment and were repeated at least once. The mean (±
SEM) of all the repeats were shown for RNA analysis.
Recombinant murine LIF (R & D Systems, Minneapolis, MN) was dissolved
in 0.1% BSA as a 200x (10 µg/ml) stock solution. Matched aliquots
of 0.1% BSA were used in control cultures.
Procedures involving the use of animals strictly followed the
Guidelines for the Care and Use of Laboratory Animals set forth by the
NIH.
Analysis of mRNA levels
Total RNA was extracted using the Trizol reagent (Life Sciences,
Gaithersburg, MD). Riboprobes were prepared from plasmids containing
complementary DNAs for rat c-fos (specific activity =
6.6 x 108 dpm/µg) and human 18S ribosomal RNA
(rRNA) (specific activity = 1.0 x 107 dpm/µg)
(21). For solution hybridization assays, duplicates of total RNA
extracts (2030 µg) were hybridized in 30 µl buffer (10
mM EDTA, 0.3 M NaCl, 0.5% SDS, and 10
mM N-Tris[hydroxymethyl)-
methyl-2-amino-ethanesulfonic acid, pH 7.4) containing
32P riboprobe, 150,000 dpm for the c-fos
riboprobe or 80,000 dpm for the 18S riboprobe, respectively, for 4
h at 75 C. After hybridization, 300 µl 0.3 M NaCl, 5
mM EDTA, 10 mM Tris-HCl, pH 7.4, containing 40
µg/ml ribonuclease (RNase) A and 2 µg/ml RNase T1 was added to each
tube, and the samples were incubated at 30 C for 1 h. The samples
were precipitated with 1 ml 5% TCA and 0.75% sodium pyrophosphate and
one drop of 0.5% BSA and were collected onto glass fiber filter paper
(Brandel, Gaithersburg, MD) using a 24-place cell harvester. The
filters were counted by liquid scintillation in 5 ml hydrofluor
scintillation solution (National Diagnostics, Manville, NJ). Comparison
was made with standard calibration curves to quantify the
c-fos mRNA transcript and the 18S rRNA levels.
c-fos mRNA levels were then normalized to the level of
control samples (1 pg/µg 18S rRNA). Northern blot analysis was
performed using 20 µg total RNA by the glyoxal method (20).
Oligonucleotide primers and RT-PCR amplification
Rat LIF primers were 5'-CAATGCCCTCTTTATTTCCTATTACACAGC-3' and
5'-GGGGACACAGGGCACATCCACATGGCCCAC-3' (16). These primers are derived
from exon 2 and exon 3 sequences and detect both splice variants of
LIF. Because rat LIF receptor sequences were not available, mouse LIF
receptor primers were designed: 5'-GAAAACTGTAAGGCGCTACA-3' and
5'-CCAAGTGTTTACATTGGC-3' (3, 22). These primers are from different
exons to eliminate detecting contaminating genomic DNAs. One microgram
total RNA was reversed transcribed using GeneAmp kit (Perkin-Elmer,
Norwalk, CT) according to manufacturers directions. Two microliters
of RT reaction products were used in a 50 µl PCR reaction that
contained 1.5 µCi [32P]deoxycytidine triphosphate (3000
Ci/mmol, Amersham, Arlington Heights, IL) to visualize the products.
PCR amplification of complementary DNAs for LIF receptor were done for
35 cycles at 1 min at 95 C, 1 min at 48 C, and 1 min at 72 C, whereas
for LIF, it was done for 35 cycles at 1 min at 95 C, 1 min at 55 C, and
1 min at 72 C. Ten microliters of PCR products were analyzed on a 5%
polyacrylamide gel and autoradiographed. The PCR products were
confirmed by sequencing analysis. RT-PCR products for LIFR from
immature Sertoli cells showed 79% and 86% homology when compared with
published LIFR sequences for human (emb X61615 HSLIFR H.
sapiens mRNA for leukemia inhibitory factor receptor) and mouse
(dbj D26177 MUSDFLR Mouse mRNA for D-factor/LIF receptor),
respectively. The following mouse primers were used to analyze gp130
mRNA:5'-GCAGCAGGTTTCAGATCACA-3' and 5'-CCCAGGTGTGACTTTGTCCT-3'. The
amplification of the S16 ribosomal gene was used as an internal control
with the following primers: 5'-AAGTCTTCGGACGCAAGAAA-3' and
5'-GACAAGACGAAGACCCGTT-3' (23).
Nuclear extract preparation, electrophoretic mobility shift assay
(EMSA), and Western analysis
Nuclear extracts were prepared from unstimulated or stimulated
Sertoli cells as described before (24, 25). The sequence of m67 oligo
is 5' CATTTCCCGTAAATCGTCGA 3' (26). The complementary oligos were
annealed in 100 mM Tris-HCl (pH 8.0) and 50 mM
MgCl2 over a period of 3 h. The AP-1 oligo was obtain
from Promega Corp. (Madison, WI). The oligos were end labeled with T4
polynucleotide kinase and [32-gamma]ATP. Nuclear extracts
(210 µg) were incubated in a final volume of 12 µl in 20
mM HEPES (7.9), 40 mM KCl, 1 mM
MgCl2, 0.1 mM EGTA, 0.5 mM
dithiothreitol, and 4% Ficoll for 20 min at room temperature with the
probe [150,000200,000 cpm, 1 ng for m67 and sis-inducible
element (SIE), and 50,000 cpm for AP-1]. Antisera to STAT-3 protein
(kindly provided by J. E. Darnell, Jr., Rockefeller University) were
preincubated for 10 min before addition of the probe. The reaction
products were fractionated on a 4% nondenaturing polyacrylamide gel
(acrylamide/bis, 29:1) in 0.25% Tris-borate-EDTA that was prerun for
30 min at room temperature. For Western analysis, 500 µg of nuclear
extracts were immunoprecipitated with antiphosphotyrosine-agarose
(Transduction Laboratories, Lexington, KY) for 2 h at 4 C and run
on a 7.5% SDS/PAGE, blotted to nitrocellulose membrane, and probed
with an anti-STAT-3 antiserum (1:1000). The bound antibodies were
detected using an epichemiluminescence kit (Amersham).
 |
Results
|
|---|
Distribution of gp130, LIFR, and LIF in freshly isolated testicular
cells
We used RT-PCR analyses to establish the distribution of gp130,
LIF, and LIFR mRNAs in different purified cell types of the testes,
including rat immature and adult somatic cells (Fig. 1
, lanes 47), rat germ cells (Fig. 1
, lanes 811), and mouse germ cells (Fig. 1
, lanes 1215). RT-PCR
analysis of total RNA using a primer set for gp130 signaling chain
detected its mRNA in both the somatic and specific germ cells (Fig. 1
, top panel). Because rat LIFR sequences are not available, we
designed two sets of primers using the published mouse LIF receptor
sequences. RT-PCR of total RNA from different cells showed that
although all of the somatic cells express the LIFR (Fig. 1
, LIF
receptor, middle panel, lanes 47), in elutriator-purified
germ cells from rat testis, LIFR mRNA was detected only in the
elongated spermatids. Figure 1
, middle panel, illustrates
that LIF mRNA is expressed in both the immature and adult somatic
cells, as well as all of the germ cells (lanes 411). Sequence
analysis of the RT-PCR products from immature Sertoli cells (lane 5)
confirmed that the PCR products were LIF and LIFR. Sequencing of the
RT-PCR products for LIFR from immature Sertoli cells showed 79% and
86% homology when compared with published LIFR sequences for human and
mouse, respectively. Similar to data with rat RNA samples, RT-PCR
analysis of freshly isolated mouse germ cells showed the presence of
gp130 and LIF mRNAs in all of the cells (Fig. 1
, lanes 1215). In
contrast to the findings using rat germ cell RNA, LIFR was readily
detected in mouse germ cell RNA extracts (Fig. 1
, lanes 1215).
Interestingly the highest relative amounts of LIFR were observed in
pachytene spermatocytes, which had a barely detectable signal for LIF
mRNA. A set of primers for an internal control, S16 mRNA, showed
comparable RNA levels in different cell preparations (Fig. 1
, bottom panel).

View larger version (77K):
[in this window]
[in a new window]
|
Figure 1. Distribution of gp130, LIF, and LIFR in different
testicular cells by RT-PCR. RT-PCR products from rat (lanes 111) and
mouse (lanes 1215) tissues were analyzed using primers for gp130
(top panel), LIFR and LIF (middle
panels), and S16 control primers (bottom panel).
For Sertoli and Leydig samples: a, adult; i, immature rats.
|
|
LIF activation of STAT-3 and STAT-1 proteins in immature Sertoli
cells
We selected m67, a synthetic high-affinity STAT binding
oligonucleotide that is derived from the c-fos SIE, to study
the activation of STAT DNA binding using nuclear extracts from primary
Sertoli cells treated with mouse LIF. Figure 2
illustrates that LIF rapidly induces
nuclear STAT-3 DNA binding as early as 2 min following its addition
(lane 2). An anti-STAT-3 antiserum supershifted this complex (lane 8),
and the addition of 5- or 10-fold unlabeled m67 oligo completely
abolished STAT-m67 interactions (lanes 9 and 10), indicating further
specificity of this DNA binding. LIF also activated some STAT-1 protein
to bind to the m67 oligo after 10 min of LIF treatment (lane 4), which
was supershifted with anti-STAT-1 antisera (data not shown).

View larger version (62K):
[in this window]
[in a new window]
|
Figure 2. Cytokine activation of STAT proteins. Sertoli
cells were treated on day 3 with vehicle (lane 1) or LIF (lanes 210)
for indicated times, and nuclear extracts prepared for EMSA using
m67 oligonucleotide as probe. In lane 8, a 1:100 dilution of
STAT-3 antiserum supershifted STAT-3-m67 complex, whereas addition of
5- or 10-fold unlabeled m67 diminished binding. *, Indicates shifted
STAT-3 protein.
|
|
LIF activation of STAT proteins requires tyrosine but not
serine/threonine phosphorylation
We recently demonstrated IL-6-mediated tyrosine and
serine/threonine phosphorylation events in Sertoli cells (20). In other
cell types, Western blot analyses revealed that during LIF stimulation
a secondary serine/threonine phosphorylation occurs rapidly after
primary tyrosine phosphorylation events (8, 27, 28). We next determined
the effects of genistein, a tyrosine kinase inhibitor, and H7, a
serine/threonine kinase inhibitor, on LIF stimulation of Sertoli cells
using EMSA (Fig. 3A
). EMSA in Fig. 3A
demonstrates that a 3-h preincubation of Sertoli cells with genistein
(100 µg/ml) before the addition of LIF for 2, 5, 10, or 15 min
inhibits STAT-3 DNA binding. In contrast, pretreatment with H7 had no
effect on this m67 oligonucleotide binding at these times, indicating
that tyrosine but not serine/threonine phosphorylation events are
required for LIF-mediated STAT-3 translocation to the nucleus and DNA
binding (Fig. 3A
, lanes 415). Genistein or H7 alone did not activate
STAT proteins (lanes 2 and 3). When these Sertoli cell nuclear extracts
were immunoprecipitated with antiphosphotyrosine antiserum, Western
blot analysis with anti-STAT-3 antiserum showed an immediate tyrosine
phosphorylation of STAT-3 protein induced by LIF, an effect that was
also inhibited by genistein (Fig. 3B
).

View larger version (52K):
[in this window]
[in a new window]
|
Figure 3. LIF activation of STAT-3 and STAT-1 proteins
requires tyrosine phosphorylation. A, Sertoli cells were treated on day
3 with vehicle (lane 1); genistein for 3 h (lane 2); H7 for 1
h (lane 3); LIF for 2, 5, 10, and 15 min (lanes 415); LIF plus
genistein (lanes 5, 8, 11, and 14); or LIF plus H7 (lanes 6, 9, 12, and
15), and nuclear extracts were used in EMSA with m67 oligonucleotide.
B, In a Western blot analysis, Sertoli cell nuclear extracts from LIF
time course were immunoprecipitated with phosphotyrosine, run on a
7.5% SDS/PAGE, and probed with anti-STAT-3 antiserum (1:1000). Bound
antibodies were detected by epichemiluminescence.
|
|
LIF induction of endogenous c-fos gene expression and AP-1 binding
through tyrosine and serine/threonine phosphorylation events
We used Northern blot analysis and a quantitative solution
hybridization assay to measure Sertoli c-fos mRNA levels
after LIF treatment. In Fig. 4A
a
representative Northern blot (top panel) and solution
hybridization (bottom panel) show that LIF rapidly and
transiently activated c-fos gene expression after 15 min of
treatment with maximal induction (20-fold) at 3045 min. Furthermore,
EMSA using Sertoli cell nuclear extracts showed increasing amounts of
AP-1 proteins bound to the AP-1 oligo after 2 h of LIF treatment
(Fig. 4B
, lane 3), whereas the addition of 5- or 10-fold unlabeled AP-1
oligonucleotide (lanes 5 and 6) reduced this DNA binding.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 4. Time course of activation of c-fos
transcription and AP-1 nuclear factors by LIF. Sertoli cells on day 3
were untreated (lane 1) or treated with LIF for indicated times. A,
Northern blot (top panel) and solution hybridization
(bottom panel) assays were used to measure
c-fos mRNA levels in total Sertoli RNA extracts. Mean
(± SEM) of c-fos mRNA level is normalized
to that of control cells at 0 time (open bar, 1 pg/µg
18S rRNA) is shown. B, EMSA was used to detect increasing AP-1 binding
to AP-1 oligo after 2 h (lane 3) or 6 h (lane 4) of LIF.
Lanes 5 and 6 show competition reactions with unlabeled AP-1 oligo
(5-fold and 10-fold, respectively).
|
|
Next we determined the LIF regulation of the c-fos
transcription in the presence or absence of genistein and H7. Figure 5A
shows that the LIF-induced increase in
steady state c-fos mRNA levels was diminished to 5-fold over
the basal levels by genistein, whereas H7 completely abolished LIF
induction of c-fos to that of control levels. To study the
effects of the kinase inhibitors on LIF induction of AP-1 proteins, we
next pretreated the Sertoli cells with genistein (100 µg/ml, 3
h) and/or H7 (100 µM, 1 h) followed by the addition
of LIF for 2 h. Figure 5B
illustrates that both genistein and H7
inhibit the induction of AP-1 protein binding to the AP-1
oligonucleotide subsequent to a 2-h LIF treatment (compare lane 4 to
lanes 57).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 5. Activation of c-fos gene expression
and AP-1 binding by LIF requires tyrosine and serine/threonine
phosphorylation. On day 3 of culture, primary Sertoli cells were
pretreated with genistein for 3 h, H7 for 1 h, LIF for 45 min
(A) or 2 h (B), LIF plus genistein, LIF plus H7, or LIF plus
genistein plus H7. A, Total RNA samples were subjected to solution
hybridization analysis for c-fos and 18S rRNA
transcripts and mean (± SEM) values of
c-fos mRNA levels were normalized to those of control
cells (Ct) (1 pg/µg 18s rRNA). *, **, Indicate significant changes
compared with control cells. B, EMSA using Sertoli nuclear extracts and
AP-1 oligo.
|
|
We next studied the c-fos mRNA levels after LIF treatment of
specific rat germ cells. Primary rat spermatogonia, pachytene
spermatocytes, and round and elongating spermatids were purified and
cultured for 4 h before addition of mouse LIF. In contrast to the
Sertoli cells, the germ cell c-fos mRNA levels did not
change after 45 min of LIF treatment (data not shown).
 |
Discussion
|
|---|
In this report we showed the presence of LIF, LIFR, and gp130
mRNAs in specific testicular cell types. Furthermore, we identified and
characterized an immediate intracellular signaling pathway for LIF in
the testis, using primary Sertoli cells to demonstrate STAT protein
phosphorylation and DNA binding, c-fos gene expression, and
AP-1 induction. Using a somatic cell model system, our studies
demonstrated that testicular LIF interacts with receptor chains in
target cells and has the potential to result in sequential
phosphorylation and translocation of latent cytoplasmic STAT-3 (and
some STAT-1) protein(s) to the nucleus (by 2 min), to increase
c-fos mRNA levels by 20-fold (by 30 min), and to increase
the amounts of AP-1 binding proteins (by 2 h). Although STAT-m67
interaction is genistein-sensitive, induction of c-fos
transcription and AP-1 activation is responsive to both genistein and
H7 inhibition.
In the testis, LIF exposure increases the survival of Sertoli cells and
proliferating gonocytes (17). Together with stem cell factor, LIF
treatment promotes survival and proliferation of mouse primordial germ
cells while inhibiting their apoptosis (29, 30). Our RT-PCR analyses of
gp130 and LIF mRNA show their expression both in immature and adult rat
somatic cells and specific rat and mouse germ cells. In contrast to
gp130 and LIF, LIFR mRNA is expressed in somatic cells with
comparatively small amounts in rat elongating spermatids. Taken
together with our findings on STAT-3 activation, LIF may therefore
function as an autocrine/paracrine factor regulating spermatogenesis
mediated by its effects on the Sertoli cells. Alternatively, although
we used two different sets of LIF receptor primers derived from the
mouse sequences, it is possible that the rat germ cells express a
different splice variant and/or sequence variations in LIFR mRNA that
is not detectable by our primers. Should rat germ cells produce LIFR
protein, they may represent a direct functional target for somatic
cell-produced LIF. Species specificity in the expression of LIFR as
well as ligand binding may play a role in LIF signaling in germ
cells.
LIF and the other members of the gp130 protein family have been shown,
in several established clonal cell lines, to induce in a sequential
fashion, a progressive tyrosine- and serine/threonine-dependent
phosphorylation of STAT-3 protein with both a primary tyrosine and a
secondary serine/threonine phosphorylation step (8, 27, 28). Although
both events induce nuclear translocation, the former induces in
vitro DNA binding activities, and the latter is correlated with
maximal transactivation and the formation of stable STAT-DNA complexes
(28). Our EMSA analysis of Sertoli cell nuclear extracts shows that
during 215 min LIF exposure, a time course when ongoing
phosphorylation of STAT-3 occurs, the tyrosine kinase inhibitor,
genistein, diminished the activation of STAT-3 and its interaction with
the m67 oligonucleotide. Although the serine/threonine kinase
inhibitor, H7, has been shown to selectively abolish binding of STAT-3
homodimers in a cell type-dependent manner (28), in primary Sertoli
cell nuclear extracts the high-affinity m67-STAT-3 (or -STAT-1)
complexes were not affected by H7. Because H7 did not cause a change in
the migration or the abundance of STAT-3 protein, at present it is
uncertain whether a secondary form of STAT-3 protein, due to the serine
phosphorylation that is observed in immortalized cell lines (8, 27, 28), also occurs in primary Sertoli cells.
Intracellular signaling by gp130-sharing cytokines is mediated by the
STAT protein(s), resulting in their induction and transcriptional
activation of several targeted immediate early genes (24, 31). Specific
DNA response elements have been mapped in c-fos and
junB promoter regions, which contain sequences derived from
the reported IFN-
activation site TTCCNNNAA and bind STAT proteins
in vitro (7, 31, 32). Transactivation of these genes appears
to depend on the STAT-DNA interactions and requires phosphorylation by
distinct protein kinases (7, 8, 20). junB gene expression is
distinctively induced in several hematopoietic and hepatic cell lines
in response to cytokines and growth factors and requires
phosphorylation of STAT proteins at specific tyrosine and serine
residues (8). In primary Sertoli cells, our data indicate that
testicular cytokines (such as LIF, IL-6, and IFN-
) differentially
activate STAT proteins to bind to the c-fos SIE and induce
immediate early gene expression at transcriptional levels. These
effects are also dependent on tyrosine and serine phosphorylation
pathways (this study and Refs. 20 and 32a). Several other members of
the STAT proteins, including STAT-1
, STAT-4, and STAT-5, contain a
conserved carboxy-terminal amino acid sequence (XPXSP) that contains
serine phosphorylation sites important for maximal transcriptional
activity (33). This C-terminal transactivation domain is missing in
STAT-1ß, and although STAT-1ß is shown to be tyrosine
phosphorylated and binds to DNA elements, it cannot restore IFN-
induction of U3A cells deficient in STAT-1
and STAT-1ß. Thus,
specific serine phosphorylation of STATs is obligatory for maximal
transactivation of responsive genes. Because other major signaling
pathways such as mitogen-activated protein, cAMP response element
binding protein, and protein kinase C are also regulated by increases
in serine kinase activities and may further enhance transactivation
(34, 35), it is possible that concomitant activation of these pathways
will modulate LIF-mediated gene expression in testicular cells.
Stimulation of the AP-1 family of transcription factors is a crucial
first step in response to various extracellular factors that play
important roles in signal transduction of cellular proliferation and
differentiation (36, 37). Increasing amounts of evidence suggest that
c-fos is directly involved in the regulation of testicular
function. FSH regulates the Sertoli cell functions that are mediated
through the c-fos, junB, and c-jun
messages (38, 39). In addition, a paracrine factor, PModS, secreted by
mesenchymal peritubular myoid cells, enhances the differentiation of
Sertoli cells mediated by c-fos (40). When primary Sertoli
cells are cultured on Matrigel (Becton Dickinson, Franklin Lakes, NJ)
in vitro, c-fos expression is increased, whereas
the addition of antisense oligonucleotides to c-fos, which
decreases c-fos protein, inhibited the attachment and spreading of the
cells (41). c-fos and junB genes contain a
bipartite DNA binding domain that consists of a basic leucine zipper
region. These proteins regulate target genes by binding as homo- or
heterodimers to the AP-1 elements (42). Furthermore, the regulation of
the c-fos gene itself by two factors, the AP-1 and the
ternary, has been shown to be mediated by serine phosphorylation events
(43, 44). Our data indicate that LIF increases AP-1 binding by two
pathways: first, the increase in c-fos transcription, which
in turn increases c-fos protein, and second, an increase in
phosphorylation of the existing AP-1 proteins by other signaling
pathways (such as protein kinase A) that increases the effectiveness of
latent AP-1 transcription factors. Because we show that tyrosine and
serine/threonine phosphorylation inhibitors reduce both LIF-activated
c-fos transcription and the level of AP-1 proteins, both of
these pathways may contribute to AP-1 activation.
These findings and other recent studies from our laboratory have shown
for the first time that IL-6, LIF, and their receptors are expressed in
different cells of the testes and, using a Sertoli cell culture model,
provide evidence that a functional testicular cytokine signaling
pathway exists in vivo (1820, 45). Thus, primary Sertoli
cultures are a valuable system for dissecting the molecular mechanisms
involved in the transduction of signals from the testicular receptor to
the regulatory elements of several responsive genes under
noninflammatory autocrine/paracrine states. Additional studies will be
needed to clarify the functional role of LIF, LIFR, and gp130 in germ
cell signaling. Our findings suggest that additional cofactors may be
required to facilitate LIF signaling within the tubules. Further
studies are currently in progress to analyze downstream genes whose
expressions are affected by testicular cytokines.
 |
Acknowledgments
|
|---|
We express our appreciation for the excellent primary testicular
cell preparations by Lyann Mitchell. We thank Dr. Meistrich (University
of Texas, Anderson Cancer Center) for advice on mouse germ cell
preparations, Dr. Masanori Kanzaki for helpful suggestions, and Arash
Akhavan for technical assistance. The c-fos riboprobe was
kindly provided by C.E. Inturrisi, Cornell University Medical College,
and the anti-STAT-3 antiserum by J. E. Darnell, Rockefeller University.
We are grateful for editorial assistance by Jean Schweis and
illustrations by Evan Read. DNA sequencing analysis was provided by The
Rockefeller University DNA Technology Center, which is supported in
part by NIH shared instrumentation grants.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grants RO1 HD-16149 and HD-29428 (to
P.L.M.). 
Received September 12, 1997.
 |
References
|
|---|
-
Bellido T, Stahl N, Farruggella TJ, Borba V,
Yancopoulos GD, Manolagas SC 1996 Detection of receptors for
interleukin-6, interleukin-11, leukemia inhibitory factor, oncostatin
M, and ciliary neurotrophic factor in bone marrow stromal/osteoblastic
cells. J Clin Invest 97:431437[Medline]
-
Ip NY, Nye SH, Boulton TG, Davis S, Taga T, Li Y,
Birren SJ, Yasukawa K, Kishimoto T, Anderson DJ, Stal N,
Yancopoulos GD 1991 CNTF and LIF act on neuronal cells via shared
signaling pathways that involve the IL-6 signal transducing receptor
component gp130. Cell 69:11211132
-
Gearing DP, Thut CJ, VandenBos T, Gimpel SD,
Delaney PB, King J, Price V, Cosman D, Beckmann MP 1991 Leukemia
inhibitory factor receptor is structurally related to the IL-6 signal
transducer, gp130. EMBO J 10:28392848[Medline]
-
Boulton TG, Stahl N, Yancopoulos GD 1994 Ciliary
neurotrophic factor/leukemia inhibitory factor/interleukin 6/oncostatin
M family of cytokines induces tyrosine phosphorylation of a common set
of proteins overlapping those induced by other cytokines and growth
factors. J Biol Chem 269:1164811655[Abstract/Free Full Text]
-
Nakajima K, Wall R 1991 Interleukin-6 signal
activating junB and TIS11 gene transcription in a B-cell hybridoma. Mol
Cell Biol 11:14091418[Abstract/Free Full Text]
-
Yuan J, Wegenka UM, Lutticken C, Buschmann J, Decker T,
Schindler C, Heinrich PC, Horn F 1994 The signaling pathways of
interleukin-6 and gamma interferon converge by the activation of
different transcription factors which bind to common responsive DNA
elements. Mol Cell Biol 14:16571668[Abstract/Free Full Text]
-
Coffer P, Lutticken C, van Puijenbroek A, Klop-de Jonge
M, Horn F, Kruijer W 1995 Transcriptional regulation of the jun B
promoter: analysis of STAT-mediated signal transduction. Oncogene 10:985994[Medline]
-
Lutticken C, Coffer P, Yuan J, Schwartz C, Caldenhoven
E, Schindler C, Kruijer W, Heinrich PC, Horn F 1995 Interleukin-6-induced serine phosphorylation of transcription factor
APRF: evidence for a role in interleukin-6 target gene induction. FEBS
Letters 360:137143[CrossRef][Medline]
-
Jacobson NG, Szabo SJ, Weber-Nordt RM, Zhong Z,
Schreiber RD, Darnell Jr JE, Murphy KM 1995 Interleukin 12
signaling in T helper type 1 (Th1) cells involve tyrosine
phosphorylation of signal transducer and activator of transcription
(Stat)3 and Stat4. J Exp Med 181:17551762[Abstract/Free Full Text]
-
Metcalf D, Nicola NA, Gearing DP 1990 Effects of
injected leukemia inhibitory factor (LIF) on hemopoietic and other
tissues in mice. Blood 76:5056[Abstract/Free Full Text]
-
Tomida M, Yamamoto-Yamagushi T, Homuzi M 1984 Purification of a factor inducing differentiation of mouse myeloid
leukemia M1 cells from conditioned medium of fibroblast L929 cells.
J Biol Chem 259:1097810982[Abstract/Free Full Text]
-
Lord KA, Abdollahi A, Thomas SM, DeMarco M, Brugge JS,
Hoffmann-Liebermann B, Liebermann DA 1991 Leukemia inhibitory
factor and interleukin-6 trigger the same immediate Early Response,
including tyrosine phosphorylation, upon induction of myeloid leukemia
differentiation. Mol Cell Biol 11:43714379[Abstract/Free Full Text]
-
Akita S, Webster J, Ren SG, Takino H, Said J, Zand O,
Melmed S 1995 Human and murine pituitary expression of leukemia
inhibitory factor. Novel intrapituitary regulation of
adrenocorticotropin hormone synthesis and secretion. J Clin Invest 95:12881298
-
Kojima K, Kanzaki H, Iwai M, Hatayama H, Fujimoto M,
Inoue T, Horie K, Nakayama H, Fujita J, Mori T 1994 Expression of
leukemia inhibitory factor in human endometrium and placenta. Biol
Reprod 50:882887[Abstract]
-
Rajan P, Stewart CL, Fink JS 1995 LIF-mediated
activation of STAT proteins after neuronal injury in vivo.
NeuroReport 6:22402244[Medline]
-
Yamamori T 1991 Localization of cholinergic
differentiation factor/leukemia inhibitory factor mRNA in the rat brain
and peripheral tissues. Proc Natl Acad Sci USA 88:72987302[Abstract/Free Full Text]
-
De Miguel M, De Boer-Brouwer M, Paniagua R, Van Den Hurk
R, De Rooij DG, Van Dissel-Emiliani FMF 1996 Leukemia inhibitory
factor and ciliary neurotropic factor promote the survival of Sertoli
cells and gonocytes in a coculture system. Endocrinology 137:18851893[Abstract]
-
Okuda Y, Sun X-R, Morris PL 1994 Interleukin-6
(IL-6) mRNAs expressed in Leydig and Sertoli cells are regulated by
cytokines, gonadotropins and neuropeptides. Endocrine J 2:617624
-
Okuda Y, Morris PL 1994 Identification of
interleukin-6 receptor (IL-6R) mRNA in isolated Sertoli and Leydig
cells: regulation by gonadotropin and interleukins in vitro.
Endocrine J 2:11631168
-
Jenab S, Morris PL 1997 Transcriptional regulation
of Sertoli cell immediate early genes by interleukin-6 and
interferon-
is mediated through phosphorylation of STAT-3 and STAT-1
proteins. Endocrinology 138:27402746[Abstract/Free Full Text]
-
Zhu YS, Inturrisi CE 1993 Metrazole induction of
c-fos and proenkephalin gene expression in the rat adrenal and
hippocampus: pharmacological characterization. Mol Brain Res 20:118124[Medline]
-
King A, Jokhi PP, Smith SK, Sharkey AM, Loke YW 1995 Screening for cytokine mRNA in human villous and extravillous
trophoblasts using the reverse-transcriptase polymerase chain reaction
(RT-PCR). Cytokine 7:364371[CrossRef][Medline]
-
Shan LX, Hardy DO, Catterall JF, Hardy MP 1995 Effects of luteinizing hormone (LH) and androgen on steady state levels
of messenger ribonucleic acid for LH receptors, androgen receptors, and
steroidogenic enzymes in rat Leydig cell progenitors in
vivo. Endocrinology 136:16861693[Abstract]
-
Sadowski HB, Shuai K, Darnell Jr JE, Gilman MZ 1993 A common nuclear signal transduction pathway activated by growth factor
and cytokine receptors. Science 261:17391744[Abstract/Free Full Text]
-
Zhong Z, Wen Z, Darnell Jr JE 1994 Stat3: a STAT
family member activated by tyrosine phosphorylation in response to
epidermal growth factor and interleukin-6. Science 264:9598[Abstract/Free Full Text]
-
Wagner BJ, Hayes TE, Hoban CJ, Cochran H 1990 The SIF binding element confers sis/PDGF inducibility onto
the c-fos promoter. EMBO J 9:44774484[Medline]
-
Boulton TG, Zhong Z, Wen Z, Darnell Jr JE, Stahl N,
Yancopoulos GD 1995 STAT3 activation by cytokines utilizing gp130
and related transducers involves a secondary modification requiring an
H7-sensitive kinase. Proc Natl Acad Sci USA 92:69156919[Abstract/Free Full Text]
-
Zhang X, Blenis J, Heng-Chun L, Schindler C, Chen-Kiang
S 1995 Requirement of serine phosphorylation for formation of
STAT-promoter complexes. Science 267:19901994[Abstract/Free Full Text]
-
Pesce M, Grazia Farrace M, Piacentini M, Dolci S, De
Felici M 1993 Stem cell factor and leukemia inhibitory factor
promote primordial germ cell survival by suppressing programmed cell
death (apoptosis). Development 118:10891094[Abstract]
-
Cheng L, Gearing DP, White LS, Compton DL, Schooley K,
Donovan PJ 1994 Role of leukemia inhibitory factor and its
receptor in mouse primordial germ cell growth. Development 120:31453153[Abstract]
-
Darnell Jr JE, Kerr IM, Stark GR 1994 jak-STAT
pathways and transcription activation in response to IFNs and other
extracellular signaling proteins. Science 264:14151420[Abstract/Free Full Text]
-
Ihle JN 1996 STATs: signal transducers and
activators of transcription. Cell 84:331334[CrossRef][Medline]
-
Jenab S, Morris PL 1996 differential activation of
signal transducer and activator of transcription (STAT)-3 and STAT-1
transcription factors and c-fos messenger ribonucleic acid
by interleukin-6 and interferon-
in Sertoli cells. Endocrinology 137:47384743[Abstract]
-
Wen Z, Zhong Z, Darnell Jr JE 1995 Maximal
activation of transcription by Stat1 and Stat3 requires both
tyrosine and serine phosphorylation. Cell 82:241250[CrossRef][Medline]
-
Karin M, Hunter T 1995 Transcriptional control by
protein phosphorylation: signal transmission from the cell surface to
the nucleus. Curr Biol 5:747757[CrossRef][Medline]
-
Chen-Kiang S, Hsu W, Natkunam Y, Zhang X 1993 Nuclear signaling by interleukin-6. Curr Opin Immunol 5:124128[CrossRef][Medline]
-
Muller R, Bravo R, Burckhardt J, Curran T 1986 Induction of c-fos gene and protein by growth factors
precedes activation of c-mycm. Nature 312:716720
-
Curran T, Franza Jr RB 1988 Fos and jun: the AP-1
connection. Cell 55:395397[CrossRef][Medline]
-
Hall SH, Joseph DR, French FS, Conti M 1988 Follicle-stimulating hormone induces transient expression of the
protooncogene c-fos in primary Sertoli cell cultures. Mol
Endocrinol 2:5561[Abstract]
-
Hamil KG, Conti M, Shimasaki S, Hall SH 1994 Follicle-stimulating hormone regulation of AP-1: inhibition of
c-jun and stimulation of jun B gene transcription
in the rat Sertoli cell. Mol Cell Endocrinology 99:269277[CrossRef][Medline]
-
Whaley PD, Chaudhary J, Cupp A, Skinner MK 1995 Role of specific response elements of the c-fos promoter and
involvement of intermediate transcription factor(s) in the induction of
Sertoli cell differentiation (transferrin promoter activation) by the
testicular paracrine factor PModS. Endocrinology 136:30463053[Abstract]
-
Papadopoulos V, Dym M 1994 Sertoli cell
differentiation on basement membrane is mediated by the c-fos
protooncogene. Proc Natl Acad Sci USA 91:70277031[Abstract/Free Full Text]
-
Gentz R, Rauscher III FJ, Abate C, Curran T 1989 Parallel association of fos and jun leucine zippers juxtapose to DNA
binding domains. Science 243:16951699[Abstract/Free Full Text]
-
Rivera VM, Miranti CK, Misra RP, Ginty DD, Chen RH,
Blenis J, Greenberg ME 1993 A growth factor-induced kinase
phosphorylates the serum response factor at a site that regulates its
DNA binding activity. Mol Cell Biol 13:62606266[Abstract/Free Full Text]
-
Karin M 1994 Signal transduction from the cell
surface to the nucleus through the phosphorylation of transcription
factors. Curr Opin Cell Biol 6:415419[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
T. M. Onorato, P. W. Brown, and P. L. Morris
Mono-(2-ethylhexyl) Phthalate Increases Spermatocyte Mitochondrial Peroxiredoxin 3 and Cyclooxygenase 2
J Androl,
May 1, 2008;
29(3):
293 - 303.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. DONG, S. A. JELINSKY, J. N. FINGER, D. S. JOHNSTON, G. S. KOPF, C. M. SOTTAS, M. P. HARDY, and R.-S. GE
Gene Expression During Development of Fetal and Adult Leydig Cells
Ann. N.Y. Acad. Sci.,
December 1, 2007;
1120(1):
16 - 35.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Magni, E. Dozio, M. Ruscica, H. Watanobe, A. Cariboni, R. Zaninetti, M. Motta, and R. Maggi
Leukemia Inhibitory Factor Induces the Chemomigration of Immortalized Gonadotropin-Releasing Hormone Neurons through the Independent Activation of the Janus Kinase/Signal Transducer and Activator of Transcription 3, Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase 1/2, and Phosphatidylinositol 3-Kinase/Akt Signaling Pathways
Mol. Endocrinol.,
May 1, 2007;
21(5):
1163 - 1174.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kanatsu-Shinohara, K. Inoue, N. Ogonuki, H. Miki, S. Yoshida, S. Toyokuni, J. Lee, A. Ogura, and T. Shinohara
Leukemia Inhibitory Factor Enhances Formation of Germ Cell Colonies in Neonatal Mouse Testis Culture
Biol Reprod,
January 1, 2007;
76(1):
55 - 62.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ishikawa and P. L. Morris
Interleukin-1{beta} Signals through a c-Jun N-Terminal Kinase-Dependent Inducible Nitric Oxide Synthase and Nitric Oxide Production Pathway in Sertoli Epithelial Cells
Endocrinology,
November 1, 2006;
147(11):
5424 - 5430.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Vigodner, T. Ishikawa, P. N. Schlegel, and P. L. Morris
SUMO-1, human male germ cell development, and the androgen receptor in the testis of men with normal and abnormal spermatogenesis
Am J Physiol Endocrinol Metab,
May 1, 2006;
290(5):
E1022 - E1033.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ishikawa, K. Hwang, D. Lazzarino, and P. L. Morris
Sertoli Cell Expression of Steroidogenic Acute Regulatory Protein-Related Lipid Transfer 1 and 5 Domain-Containing Proteins and Sterol Regulatory Element Binding Protein-1 Are Interleukin-1{beta} Regulated by Activation of c-Jun N-Terminal Kinase and Cyclooxygenase-2 and Cytokine Induction
Endocrinology,
December 1, 2005;
146(12):
5100 - 5111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Dorval-Coiffec, J.-G. Delcros, H. Hakovirta, J. Toppari, B. Jegou, and C. Piquet-Pellorce
Identification of the Leukemia Inhibitory Factor Cell Targets Within the Rat Testis
Biol Reprod,
March 1, 2005;
72(3):
602 - 611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Higashi, H. Kunimoto, S. Kaneko, T. Sasaki, M. Ishii, H. Kojima, and K. Nakajima
Cytoplasmic c-Fos induced by the YXXQ-derived STAT3 signal requires the co-operative MEK/ERK signal for its nuclear translocation
Genes Cells,
March 1, 2004;
9(3):
233 - 242.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Walch, E. Clavarino, and P. L. Morris
Prostaglandin (PG) FP and EP1 Receptors Mediate PGF2{alpha} and PGE2 Regulation of Interleukin-1{beta} Expression in Leydig Cell Progenitors
Endocrinology,
April 1, 2003;
144(4):
1284 - 1291.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. O. R. Borges, M. L. C. Abreu, C. S. Porto, and M. C. W. Avellar
Characterization of Muscarinic Acetylcholine Receptor in Rat Sertoli Cells
Endocrinology,
November 1, 2001;
142(11):
4701 - 4710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Mauduit, I. Goddard, V. Besset, E. Tabone, C. Rey, F. Gasnier, F. Dacheux, and M. Benahmed
Leukemia Inhibitory Factor Antagonizes Gonadotropin Induced-Testosterone Synthesis in Cultured Porcine Leydig Cells: Sites of Action
Endocrinology,
June 1, 2001;
142(6):
2509 - 2520.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Guo, P. L. Morris, and L. J. Gudas
Follicle-Stimulating Hormone and Leukemia Inhibitory Factor Regulate Sertoli Cell Retinol Metabolism
Endocrinology,
March 1, 2001;
142(3):
1024 - 1032.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kotaja, S. Aittomäki, O. Silvennoinen, J. J. Palvimo, and O. A. Jänne
ARIP3 (Androgen Receptor-Interacting Protein 3) and Other PIAS (Protein Inhibitor of Activated STAT) Proteins Differ in Their Ability to Modulate Steroid Receptor-Dependent Transcriptional Activation
Mol. Endocrinol.,
December 1, 2000;
14(12):
1986 - 2000.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J.-a. Tan, S. H. Hall, P. Petrusz, and F. S. French
Thyroid Receptor Activator Molecule, TRAM-1, Is an Androgen Receptor Coactivator
Endocrinology,
September 1, 2000;
141(9):
3440 - 3450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Auernhammer and S. Melmed
Leukemia-Inhibitory Factor--Neuroimmune Modulator of Endocrine Function
Endocr. Rev.,
June 1, 2000;
21(3):
313 - 345.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Piquet-Pellorce, I. Dorval-Coiffec, M.-D. Pham, and B. Jegou
Leukemia Inhibitory Factor Expression and Regulation within the Testis
Endocrinology,
March 1, 2000;
141(3):
1136 - 1141.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-a. Tan, S. H. Hall, K. G. Hamil, G. Grossman, P. Petrusz, J. Liao, K. Shuai, and F. S. French
Protein Inhibitor of Activated STAT-1 (Signal Transducer and Activator of Transcription-1) Is a Nuclear Receptor Coregulator Expressed in Human Testis
Mol. Endocrinol.,
January 1, 2000;
14(1):
14 - 26.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. Kumahara, T. Ebihara, and D. Saffen
Protein Kinase Inhibitor H7 Blocks the Induction of Immediate-Early Genes zif268 and c-fos by a Mechanism Unrelated to Inhibition of Protein Kinase C but Possibly Related to Inhibition of Phosphorylation of RNA Polymerase II
J. Biol. Chem.,
April 9, 1999;
274(15):
10430 - 10438.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Stephens, S. J. Lumpkin, and J. B. Fishman
Activation of Signal Transducers and Activators of Transcription 1 and 3 by Leukemia Inhibitory Factor, Oncostatin-M, and Interferon-gamma in Adipocytes
J. Biol. Chem.,
November 20, 1998;
273(47):
31408 - 31416.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kanzaki and P. L. Morris
Identification and Regulation of Testicular Interferon-{gamma} (IFN{gamma}) Receptor Subunits: IFN{gamma} Enhances Interferon Regulatory Factor-1 and Interleukin-1{beta} Converting Enzyme Expression
Endocrinology,
May 1, 1998;
139(5):
2636 - 2644.
[Abstract]
[Full Text]
[PDF]
|
 |
|
| This Article |
 |
 | |