help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jenab, S.
Right arrow Articles by Morris, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jenab, S.
Right arrow Articles by Morris, P. L.
Endocrinology Vol. 139, No. 4 1883-1890
Copyright © 1998 by The Endocrine Society


ARTICLES

Testicular Leukemia Inhibitory Factor (LIF) and LIF Receptor Mediate Phosphorylation of Signal Transducers and Activators of Transcription (STAT)-3 and STAT-1 and Induce c-fos Transcription and Activator Protein-1 Activation in Rat Sertoli But Not Germ Cells1

Shirzad Jenab and Patricia L. Morris

Population Council (S.J., P.L.M.) and The Rockefeller University (P.L.M.), New York, New York 10021

Address all correspondence and requests for reprints to: Patricia L. Morris, Center for Biomedical Research, Population Council and The Rockefeller University, 1230 York Avenue, New York, New York 10021.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Increasing amounts of evidence suggest noninflammatory roles for growth factor and cytokines in development and differentiation. Leukemia inhibitory factor (LIF) belongs to a gp130 pleiotropic family of growth factors that has recently been shown to enhance the survival of rat testicular gonocytes and Sertoli cells. In this study, we show the expression of gp130 and LIF messenger RNAs (mRNAs) in the somatic (the Sertoli and Leydig cells) and specific germ cells (spermatogonia, pachytene, round, and elongated spermatids) of rodent testis, suggestive of cell-specific LIF-mediated functions. LIF receptor mRNA was demonstrated in rat somatic cells, rat elongating spermatids, and all of the mouse germ cells. In addition, we characterized the effects of LIF on the signal transducers and activators of transcription (STAT)-3 and STAT-1, c-fos gene expression, and activator protein-1 regulation in primary rat Sertoli cells. Electrophoretic mobility shift assay and Western blot analysis demonstrated that LIF translocates STAT-3 (and to a lesser extent STAT-1) transcription factor(s) to the nucleus within 2 min of exposure in a tyrosine but not serine/threonine phosphorylation-dependent pathway. Quantitative solution hybridization analysis revealed a transient increase in c-fos mRNA levels by 20-fold following 30–45 min of LIF treatment, an effect that was inhibited by the tyrosine, as well as serine/threonine kinase inhibitors, genistein, and H7. Subsequently, LIF treatment of the Sertoli cells increased nuclear activator protein-1 binding proteins at 2 h after its addition, an effect that was also sensitive to genistein and H7 pretreatments. In contrast, LIF treatment of primary rat germ cells did not alter c-fos mRNA levels. Species specificity in the expression of LIF receptor as well as ligand binding may play a role in LIF signaling in these germ cells. Thus, using a primary Sertoli cell model, we demonstrated that the testicular LIF signaling pathway is contingent on the phosphorylation of latent transcription factors. Our data are consistent with LIF-mediated signaling events involving both somatic and germ cells during spermatogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LEUKEMIA inhibitory factor (LIF), a multifunctional member of the gp130 cytokine family, is structurally and functionally related to interleukin-6 (IL-6), oncostatin M, and ciliary neurotrophic factor. These related cytokines bind to specific cell surface receptors that are coupled to a common gp130 signal transducing receptor component in diverse cell types and induce the homodimerization of the gp130 protein with the IL-6 receptor chain (in the case of IL-6) or heterodimerization of gp130 and the LIF receptor component (in the case of LIF, ciliary neurotrophic factor, and oncostatin M) (1, 2, 3, 4). In response to stimulation by these cytokines, rapid intracellular tyrosine phosphorylation of the gp130 protein, Janus kinase (JAK)1, JAK2, and TYK2 kinases occurs, which activates the signal transducers and activators of transcription (STAT)-3/STAT-1 signal transduction pathway, and induces the differential transcriptional regulation of responsive genes, including the immediate early genes junB and c-fos (5, 6, 7, 8, 9).

Although the effects of cytokines have primarily been shown in hematopoietic and hepatic cell lines, their presence and regulation in various cell types is consistent with physiological functions in noninflammatory conditions. LIF was originally shown to induce terminal differentiation of the immortalized M1 myeloid leukemia cells to a macrophage phenotype (10, 11). LIF is synthesized by a variety of cells and has a broad range of biological activities, including stimulation of acute-phase proteins in hepatocytes, hematopoietic cell development, neuronal development, differentiation, inflammation, and pregnancy, as well as embryo development (2, 12, 13, 14, 15, 16). In testes, although the localization of LIF and its receptor (LIFR), to our knowledge, has not yet been reported, the addition of LIF to cocultures enhances the in vitro survival of both primary Sertoli cells and proliferating gonocytes without affecting cell proliferation (17).

Studies from our laboratory have shown the expression and regulation of IL-6 and its receptor in primary Sertoli and Leydig cells (18, 19). Recently, we demonstrated that two testicular cytokines, IL-6 and interferon (IFN)-{gamma}, differentially activate STAT-3 and STAT-1 transcription factors and induce c-fos gene expression in Sertoli cells, findings consistent with the presence of a functional cytokine-activated signal transduction pathway in the testis (20). In the present study, we establish the expression of the messenger RNAs (mRNAs) for LIF and its receptor chain components in both somatic and germ cells and identify a mechanism for LIF regulation of testicular STAT proteins, c-fos gene expression, and activator protein-1 (AP-1) activation using primary Sertoli cells as a model system.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Primary testicular cell preparations
Specific rat somatic (adult and immature Sertoli and Leydig cells) and various mouse and rat germ cells (spermatogonia, pachytene spermatocytes, and round and elongated spermatids) were isolated as described before (18, 19). Primary cultures of rat Sertoli cells were isolated and purified from 18-day-old Sprague-Dawley rats (Charles River, Kingston, NY) and incubated at 34 C at a density of 1 x 107 cells per 100-mm polystyrene dish in phenol red-, serum-, and endotoxin-free DME/F-12 medium (Irvine Scientific, Santa Ana, CA) as described previously (18, 19). The medium was supplemented with 2.5 µg/ml bovine insulin (Sigma, St. Louis, MO), 1 µg/ml transferrin (Calbiochem, La Jolla, CA), and 10 µg/ml bacitracin (Sigma). On day 3 in vitro, following the addition of specific factors, RNA or nuclear extracts were isolated at the indicated times. Duplicate or triplicate culture dishes were used for each drug treatment and were repeated at least once. The mean (± SEM) of all the repeats were shown for RNA analysis. Recombinant murine LIF (R & D Systems, Minneapolis, MN) was dissolved in 0.1% BSA as a 200x (10 µg/ml) stock solution. Matched aliquots of 0.1% BSA were used in control cultures.

Procedures involving the use of animals strictly followed the Guidelines for the Care and Use of Laboratory Animals set forth by the NIH.

Analysis of mRNA levels
Total RNA was extracted using the Trizol reagent (Life Sciences, Gaithersburg, MD). Riboprobes were prepared from plasmids containing complementary DNAs for rat c-fos (specific activity = 6.6 x 108 dpm/µg) and human 18S ribosomal RNA (rRNA) (specific activity = 1.0 x 107 dpm/µg) (21). For solution hybridization assays, duplicates of total RNA extracts (20–30 µg) were hybridized in 30 µl buffer (10 mM EDTA, 0.3 M NaCl, 0.5% SDS, and 10 mM N-Tris[hydroxymethyl)- methyl-2-amino-ethanesulfonic acid, pH 7.4) containing 32P riboprobe, 150,000 dpm for the c-fos riboprobe or 80,000 dpm for the 18S riboprobe, respectively, for 4 h at 75 C. After hybridization, 300 µl 0.3 M NaCl, 5 mM EDTA, 10 mM Tris-HCl, pH 7.4, containing 40 µg/ml ribonuclease (RNase) A and 2 µg/ml RNase T1 was added to each tube, and the samples were incubated at 30 C for 1 h. The samples were precipitated with 1 ml 5% TCA and 0.75% sodium pyrophosphate and one drop of 0.5% BSA and were collected onto glass fiber filter paper (Brandel, Gaithersburg, MD) using a 24-place cell harvester. The filters were counted by liquid scintillation in 5 ml hydrofluor scintillation solution (National Diagnostics, Manville, NJ). Comparison was made with standard calibration curves to quantify the c-fos mRNA transcript and the 18S rRNA levels. c-fos mRNA levels were then normalized to the level of control samples (1 pg/µg 18S rRNA). Northern blot analysis was performed using 20 µg total RNA by the glyoxal method (20).

Oligonucleotide primers and RT-PCR amplification
Rat LIF primers were 5'-CAATGCCCTCTTTATTTCCTATTACACAGC-3' and 5'-GGGGACACAGGGCACATCCACATGGCCCAC-3' (16). These primers are derived from exon 2 and exon 3 sequences and detect both splice variants of LIF. Because rat LIF receptor sequences were not available, mouse LIF receptor primers were designed: 5'-GAAAACTGTAAGGCGCTACA-3' and 5'-CCAAGTGTTTACATTGGC-3' (3, 22). These primers are from different exons to eliminate detecting contaminating genomic DNAs. One microgram total RNA was reversed transcribed using GeneAmp kit (Perkin-Elmer, Norwalk, CT) according to manufacturer’s directions. Two microliters of RT reaction products were used in a 50 µl PCR reaction that contained 1.5 µCi [32P]deoxycytidine triphosphate (3000 Ci/mmol, Amersham, Arlington Heights, IL) to visualize the products. PCR amplification of complementary DNAs for LIF receptor were done for 35 cycles at 1 min at 95 C, 1 min at 48 C, and 1 min at 72 C, whereas for LIF, it was done for 35 cycles at 1 min at 95 C, 1 min at 55 C, and 1 min at 72 C. Ten microliters of PCR products were analyzed on a 5% polyacrylamide gel and autoradiographed. The PCR products were confirmed by sequencing analysis. RT-PCR products for LIFR from immature Sertoli cells showed 79% and 86% homology when compared with published LIFR sequences for human (emb X61615 HSLIFR H. sapiens mRNA for leukemia inhibitory factor receptor) and mouse (dbj D26177 MUSDFLR Mouse mRNA for D-factor/LIF receptor), respectively. The following mouse primers were used to analyze gp130 mRNA:5'-GCAGCAGGTTTCAGATCACA-3' and 5'-CCCAGGTGTGACTTTGTCCT-3'. The amplification of the S16 ribosomal gene was used as an internal control with the following primers: 5'-AAGTCTTCGGACGCAAGAAA-3' and 5'-GACAAGACGAAGACCCGTT-3' (23).

Nuclear extract preparation, electrophoretic mobility shift assay (EMSA), and Western analysis
Nuclear extracts were prepared from unstimulated or stimulated Sertoli cells as described before (24, 25). The sequence of m67 oligo is 5' CATTTCCCGTAAATCGTCGA 3' (26). The complementary oligos were annealed in 100 mM Tris-HCl (pH 8.0) and 50 mM MgCl2 over a period of 3 h. The AP-1 oligo was obtain from Promega Corp. (Madison, WI). The oligos were end labeled with T4 polynucleotide kinase and [32-gamma]ATP. Nuclear extracts (2–10 µg) were incubated in a final volume of 12 µl in 20 mM HEPES (7.9), 40 mM KCl, 1 mM MgCl2, 0.1 mM EGTA, 0.5 mM dithiothreitol, and 4% Ficoll for 20 min at room temperature with the probe [150,000–200,000 cpm, 1 ng for m67 and sis-inducible element (SIE), and 50,000 cpm for AP-1]. Antisera to STAT-3 protein (kindly provided by J. E. Darnell, Jr., Rockefeller University) were preincubated for 10 min before addition of the probe. The reaction products were fractionated on a 4% nondenaturing polyacrylamide gel (acrylamide/bis, 29:1) in 0.25% Tris-borate-EDTA that was prerun for 30 min at room temperature. For Western analysis, 500 µg of nuclear extracts were immunoprecipitated with antiphosphotyrosine-agarose (Transduction Laboratories, Lexington, KY) for 2 h at 4 C and run on a 7.5% SDS/PAGE, blotted to nitrocellulose membrane, and probed with an anti-STAT-3 antiserum (1:1000). The bound antibodies were detected using an epichemiluminescence kit (Amersham).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Distribution of gp130, LIFR, and LIF in freshly isolated testicular cells
We used RT-PCR analyses to establish the distribution of gp130, LIF, and LIFR mRNAs in different purified cell types of the testes, including rat immature and adult somatic cells (Fig. 1Go, lanes 4–7), rat germ cells (Fig. 1Go, lanes 8–11), and mouse germ cells (Fig. 1Go, lanes 12–15). RT-PCR analysis of total RNA using a primer set for gp130 signaling chain detected its mRNA in both the somatic and specific germ cells (Fig. 1Go, top panel). Because rat LIFR sequences are not available, we designed two sets of primers using the published mouse LIF receptor sequences. RT-PCR of total RNA from different cells showed that although all of the somatic cells express the LIFR (Fig. 1Go, LIF receptor, middle panel, lanes 4–7), in elutriator-purified germ cells from rat testis, LIFR mRNA was detected only in the elongated spermatids. Figure 1Go, middle panel, illustrates that LIF mRNA is expressed in both the immature and adult somatic cells, as well as all of the germ cells (lanes 4–11). Sequence analysis of the RT-PCR products from immature Sertoli cells (lane 5) confirmed that the PCR products were LIF and LIFR. Sequencing of the RT-PCR products for LIFR from immature Sertoli cells showed 79% and 86% homology when compared with published LIFR sequences for human and mouse, respectively. Similar to data with rat RNA samples, RT-PCR analysis of freshly isolated mouse germ cells showed the presence of gp130 and LIF mRNAs in all of the cells (Fig. 1Go, lanes 12–15). In contrast to the findings using rat germ cell RNA, LIFR was readily detected in mouse germ cell RNA extracts (Fig. 1Go, lanes 12–15). Interestingly the highest relative amounts of LIFR were observed in pachytene spermatocytes, which had a barely detectable signal for LIF mRNA. A set of primers for an internal control, S16 mRNA, showed comparable RNA levels in different cell preparations (Fig. 1Go, bottom panel).



View larger version (77K):
[in this window]
[in a new window]
 
Figure 1. Distribution of gp130, LIF, and LIFR in different testicular cells by RT-PCR. RT-PCR products from rat (lanes 1–11) and mouse (lanes 12–15) tissues were analyzed using primers for gp130 (top panel), LIFR and LIF (middle panels), and S16 control primers (bottom panel). For Sertoli and Leydig samples: a, adult; i, immature rats.

 
LIF activation of STAT-3 and STAT-1 proteins in immature Sertoli cells
We selected m67, a synthetic high-affinity STAT binding oligonucleotide that is derived from the c-fos SIE, to study the activation of STAT DNA binding using nuclear extracts from primary Sertoli cells treated with mouse LIF. Figure 2Go illustrates that LIF rapidly induces nuclear STAT-3 DNA binding as early as 2 min following its addition (lane 2). An anti-STAT-3 antiserum supershifted this complex (lane 8), and the addition of 5- or 10-fold unlabeled m67 oligo completely abolished STAT-m67 interactions (lanes 9 and 10), indicating further specificity of this DNA binding. LIF also activated some STAT-1 protein to bind to the m67 oligo after 10 min of LIF treatment (lane 4), which was supershifted with anti-STAT-1 antisera (data not shown).



View larger version (62K):
[in this window]
[in a new window]
 
Figure 2. Cytokine activation of STAT proteins. Sertoli cells were treated on day 3 with vehicle (lane 1) or LIF (lanes 2–10) for indicated times, and nuclear extracts prepared for EMSA using m67 oligonucleotide as probe. In lane 8, a 1:100 dilution of STAT-3 antiserum supershifted STAT-3-m67 complex, whereas addition of 5- or 10-fold unlabeled m67 diminished binding. *, Indicates shifted STAT-3 protein.

 
LIF activation of STAT proteins requires tyrosine but not serine/threonine phosphorylation
We recently demonstrated IL-6-mediated tyrosine and serine/threonine phosphorylation events in Sertoli cells (20). In other cell types, Western blot analyses revealed that during LIF stimulation a secondary serine/threonine phosphorylation occurs rapidly after primary tyrosine phosphorylation events (8, 27, 28). We next determined the effects of genistein, a tyrosine kinase inhibitor, and H7, a serine/threonine kinase inhibitor, on LIF stimulation of Sertoli cells using EMSA (Fig. 3AGo). EMSA in Fig. 3AGo demonstrates that a 3-h preincubation of Sertoli cells with genistein (100 µg/ml) before the addition of LIF for 2, 5, 10, or 15 min inhibits STAT-3 DNA binding. In contrast, pretreatment with H7 had no effect on this m67 oligonucleotide binding at these times, indicating that tyrosine but not serine/threonine phosphorylation events are required for LIF-mediated STAT-3 translocation to the nucleus and DNA binding (Fig. 3AGo, lanes 4–15). Genistein or H7 alone did not activate STAT proteins (lanes 2 and 3). When these Sertoli cell nuclear extracts were immunoprecipitated with antiphosphotyrosine antiserum, Western blot analysis with anti-STAT-3 antiserum showed an immediate tyrosine phosphorylation of STAT-3 protein induced by LIF, an effect that was also inhibited by genistein (Fig. 3BGo).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 3. LIF activation of STAT-3 and STAT-1 proteins requires tyrosine phosphorylation. A, Sertoli cells were treated on day 3 with vehicle (lane 1); genistein for 3 h (lane 2); H7 for 1 h (lane 3); LIF for 2, 5, 10, and 15 min (lanes 4–15); LIF plus genistein (lanes 5, 8, 11, and 14); or LIF plus H7 (lanes 6, 9, 12, and 15), and nuclear extracts were used in EMSA with m67 oligonucleotide. B, In a Western blot analysis, Sertoli cell nuclear extracts from LIF time course were immunoprecipitated with phosphotyrosine, run on a 7.5% SDS/PAGE, and probed with anti-STAT-3 antiserum (1:1000). Bound antibodies were detected by epichemiluminescence.

 
LIF induction of endogenous c-fos gene expression and AP-1 binding through tyrosine and serine/threonine phosphorylation events
We used Northern blot analysis and a quantitative solution hybridization assay to measure Sertoli c-fos mRNA levels after LIF treatment. In Fig. 4AGo a representative Northern blot (top panel) and solution hybridization (bottom panel) show that LIF rapidly and transiently activated c-fos gene expression after 15 min of treatment with maximal induction (20-fold) at 30–45 min. Furthermore, EMSA using Sertoli cell nuclear extracts showed increasing amounts of AP-1 proteins bound to the AP-1 oligo after 2 h of LIF treatment (Fig. 4BGo, lane 3), whereas the addition of 5- or 10-fold unlabeled AP-1 oligonucleotide (lanes 5 and 6) reduced this DNA binding.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Time course of activation of c-fos transcription and AP-1 nuclear factors by LIF. Sertoli cells on day 3 were untreated (lane 1) or treated with LIF for indicated times. A, Northern blot (top panel) and solution hybridization (bottom panel) assays were used to measure c-fos mRNA levels in total Sertoli RNA extracts. Mean (± SEM) of c-fos mRNA level is normalized to that of control cells at 0 time (open bar, 1 pg/µg 18S rRNA) is shown. B, EMSA was used to detect increasing AP-1 binding to AP-1 oligo after 2 h (lane 3) or 6 h (lane 4) of LIF. Lanes 5 and 6 show competition reactions with unlabeled AP-1 oligo (5-fold and 10-fold, respectively).

 
Next we determined the LIF regulation of the c-fos transcription in the presence or absence of genistein and H7. Figure 5AGo shows that the LIF-induced increase in steady state c-fos mRNA levels was diminished to 5-fold over the basal levels by genistein, whereas H7 completely abolished LIF induction of c-fos to that of control levels. To study the effects of the kinase inhibitors on LIF induction of AP-1 proteins, we next pretreated the Sertoli cells with genistein (100 µg/ml, 3 h) and/or H7 (100 µM, 1 h) followed by the addition of LIF for 2 h. Figure 5BGo illustrates that both genistein and H7 inhibit the induction of AP-1 protein binding to the AP-1 oligonucleotide subsequent to a 2-h LIF treatment (compare lane 4 to lanes 5–7).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Activation of c-fos gene expression and AP-1 binding by LIF requires tyrosine and serine/threonine phosphorylation. On day 3 of culture, primary Sertoli cells were pretreated with genistein for 3 h, H7 for 1 h, LIF for 45 min (A) or 2 h (B), LIF plus genistein, LIF plus H7, or LIF plus genistein plus H7. A, Total RNA samples were subjected to solution hybridization analysis for c-fos and 18S rRNA transcripts and mean (± SEM) values of c-fos mRNA levels were normalized to those of control cells (Ct) (1 pg/µg 18s rRNA). *, **, Indicate significant changes compared with control cells. B, EMSA using Sertoli nuclear extracts and AP-1 oligo.

 
We next studied the c-fos mRNA levels after LIF treatment of specific rat germ cells. Primary rat spermatogonia, pachytene spermatocytes, and round and elongating spermatids were purified and cultured for 4 h before addition of mouse LIF. In contrast to the Sertoli cells, the germ cell c-fos mRNA levels did not change after 45 min of LIF treatment (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report we showed the presence of LIF, LIFR, and gp130 mRNAs in specific testicular cell types. Furthermore, we identified and characterized an immediate intracellular signaling pathway for LIF in the testis, using primary Sertoli cells to demonstrate STAT protein phosphorylation and DNA binding, c-fos gene expression, and AP-1 induction. Using a somatic cell model system, our studies demonstrated that testicular LIF interacts with receptor chains in target cells and has the potential to result in sequential phosphorylation and translocation of latent cytoplasmic STAT-3 (and some STAT-1) protein(s) to the nucleus (by 2 min), to increase c-fos mRNA levels by 20-fold (by 30 min), and to increase the amounts of AP-1 binding proteins (by 2 h). Although STAT-m67 interaction is genistein-sensitive, induction of c-fos transcription and AP-1 activation is responsive to both genistein and H7 inhibition.

In the testis, LIF exposure increases the survival of Sertoli cells and proliferating gonocytes (17). Together with stem cell factor, LIF treatment promotes survival and proliferation of mouse primordial germ cells while inhibiting their apoptosis (29, 30). Our RT-PCR analyses of gp130 and LIF mRNA show their expression both in immature and adult rat somatic cells and specific rat and mouse germ cells. In contrast to gp130 and LIF, LIFR mRNA is expressed in somatic cells with comparatively small amounts in rat elongating spermatids. Taken together with our findings on STAT-3 activation, LIF may therefore function as an autocrine/paracrine factor regulating spermatogenesis mediated by its effects on the Sertoli cells. Alternatively, although we used two different sets of LIF receptor primers derived from the mouse sequences, it is possible that the rat germ cells express a different splice variant and/or sequence variations in LIFR mRNA that is not detectable by our primers. Should rat germ cells produce LIFR protein, they may represent a direct functional target for somatic cell-produced LIF. Species specificity in the expression of LIFR as well as ligand binding may play a role in LIF signaling in germ cells.

LIF and the other members of the gp130 protein family have been shown, in several established clonal cell lines, to induce in a sequential fashion, a progressive tyrosine- and serine/threonine-dependent phosphorylation of STAT-3 protein with both a primary tyrosine and a secondary serine/threonine phosphorylation step (8, 27, 28). Although both events induce nuclear translocation, the former induces in vitro DNA binding activities, and the latter is correlated with maximal transactivation and the formation of stable STAT-DNA complexes (28). Our EMSA analysis of Sertoli cell nuclear extracts shows that during 2–15 min LIF exposure, a time course when ongoing phosphorylation of STAT-3 occurs, the tyrosine kinase inhibitor, genistein, diminished the activation of STAT-3 and its interaction with the m67 oligonucleotide. Although the serine/threonine kinase inhibitor, H7, has been shown to selectively abolish binding of STAT-3 homodimers in a cell type-dependent manner (28), in primary Sertoli cell nuclear extracts the high-affinity m67-STAT-3 (or -STAT-1) complexes were not affected by H7. Because H7 did not cause a change in the migration or the abundance of STAT-3 protein, at present it is uncertain whether a secondary form of STAT-3 protein, due to the serine phosphorylation that is observed in immortalized cell lines (8, 27, 28), also occurs in primary Sertoli cells.

Intracellular signaling by gp130-sharing cytokines is mediated by the STAT protein(s), resulting in their induction and transcriptional activation of several targeted immediate early genes (24, 31). Specific DNA response elements have been mapped in c-fos and junB promoter regions, which contain sequences derived from the reported IFN-{gamma} activation site TTCCNNNAA and bind STAT proteins in vitro (7, 31, 32). Transactivation of these genes appears to depend on the STAT-DNA interactions and requires phosphorylation by distinct protein kinases (7, 8, 20). junB gene expression is distinctively induced in several hematopoietic and hepatic cell lines in response to cytokines and growth factors and requires phosphorylation of STAT proteins at specific tyrosine and serine residues (8). In primary Sertoli cells, our data indicate that testicular cytokines (such as LIF, IL-6, and IFN-{gamma}) differentially activate STAT proteins to bind to the c-fos SIE and induce immediate early gene expression at transcriptional levels. These effects are also dependent on tyrosine and serine phosphorylation pathways (this study and Refs. 20 and 32a). Several other members of the STAT proteins, including STAT-1{alpha}, STAT-4, and STAT-5, contain a conserved carboxy-terminal amino acid sequence (XPXSP) that contains serine phosphorylation sites important for maximal transcriptional activity (33). This C-terminal transactivation domain is missing in STAT-1ß, and although STAT-1ß is shown to be tyrosine phosphorylated and binds to DNA elements, it cannot restore IFN-{gamma} induction of U3A cells deficient in STAT-1{alpha} and STAT-1ß. Thus, specific serine phosphorylation of STATs is obligatory for maximal transactivation of responsive genes. Because other major signaling pathways such as mitogen-activated protein, cAMP response element binding protein, and protein kinase C are also regulated by increases in serine kinase activities and may further enhance transactivation (34, 35), it is possible that concomitant activation of these pathways will modulate LIF-mediated gene expression in testicular cells.

Stimulation of the AP-1 family of transcription factors is a crucial first step in response to various extracellular factors that play important roles in signal transduction of cellular proliferation and differentiation (36, 37). Increasing amounts of evidence suggest that c-fos is directly involved in the regulation of testicular function. FSH regulates the Sertoli cell functions that are mediated through the c-fos, junB, and c-jun messages (38, 39). In addition, a paracrine factor, PModS, secreted by mesenchymal peritubular myoid cells, enhances the differentiation of Sertoli cells mediated by c-fos (40). When primary Sertoli cells are cultured on Matrigel (Becton Dickinson, Franklin Lakes, NJ) in vitro, c-fos expression is increased, whereas the addition of antisense oligonucleotides to c-fos, which decreases c-fos protein, inhibited the attachment and spreading of the cells (41). c-fos and junB genes contain a bipartite DNA binding domain that consists of a basic leucine zipper region. These proteins regulate target genes by binding as homo- or heterodimers to the AP-1 elements (42). Furthermore, the regulation of the c-fos gene itself by two factors, the AP-1 and the ternary, has been shown to be mediated by serine phosphorylation events (43, 44). Our data indicate that LIF increases AP-1 binding by two pathways: first, the increase in c-fos transcription, which in turn increases c-fos protein, and second, an increase in phosphorylation of the existing AP-1 proteins by other signaling pathways (such as protein kinase A) that increases the effectiveness of latent AP-1 transcription factors. Because we show that tyrosine and serine/threonine phosphorylation inhibitors reduce both LIF-activated c-fos transcription and the level of AP-1 proteins, both of these pathways may contribute to AP-1 activation.

These findings and other recent studies from our laboratory have shown for the first time that IL-6, LIF, and their receptors are expressed in different cells of the testes and, using a Sertoli cell culture model, provide evidence that a functional testicular cytokine signaling pathway exists in vivo (18–20, 45). Thus, primary Sertoli cultures are a valuable system for dissecting the molecular mechanisms involved in the transduction of signals from the testicular receptor to the regulatory elements of several responsive genes under noninflammatory autocrine/paracrine states. Additional studies will be needed to clarify the functional role of LIF, LIFR, and gp130 in germ cell signaling. Our findings suggest that additional cofactors may be required to facilitate LIF signaling within the tubules. Further studies are currently in progress to analyze downstream genes whose expressions are affected by testicular cytokines.


    Acknowledgments
 
We express our appreciation for the excellent primary testicular cell preparations by Lyann Mitchell. We thank Dr. Meistrich (University of Texas, Anderson Cancer Center) for advice on mouse germ cell preparations, Dr. Masanori Kanzaki for helpful suggestions, and Arash Akhavan for technical assistance. The c-fos riboprobe was kindly provided by C.E. Inturrisi, Cornell University Medical College, and the anti-STAT-3 antiserum by J. E. Darnell, Rockefeller University. We are grateful for editorial assistance by Jean Schweis and illustrations by Evan Read. DNA sequencing analysis was provided by The Rockefeller University DNA Technology Center, which is supported in part by NIH shared instrumentation grants.


    Footnotes
 
1 This work was supported by NIH Grants RO1 HD-16149 and HD-29428 (to P.L.M.). Back

Received September 12, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bellido T, Stahl N, Farruggella TJ, Borba V, Yancopoulos GD, Manolagas SC 1996 Detection of receptors for interleukin-6, interleukin-11, leukemia inhibitory factor, oncostatin M, and ciliary neurotrophic factor in bone marrow stromal/osteoblastic cells. J Clin Invest 97:431–437[Medline]
  2. Ip NY, Nye SH, Boulton TG, Davis S, Taga T, Li Y, Birren SJ, Yasukawa K, Kishimoto T, Anderson DJ, Stal N, Yancopoulos GD 1991 CNTF and LIF act on neuronal cells via shared signaling pathways that involve the IL-6 signal transducing receptor component gp130. Cell 69:1121–1132
  3. Gearing DP, Thut CJ, VandenBos T, Gimpel SD, Delaney PB, King J, Price V, Cosman D, Beckmann MP 1991 Leukemia inhibitory factor receptor is structurally related to the IL-6 signal transducer, gp130. EMBO J 10:2839–2848[Medline]
  4. Boulton TG, Stahl N, Yancopoulos GD 1994 Ciliary neurotrophic factor/leukemia inhibitory factor/interleukin 6/oncostatin M family of cytokines induces tyrosine phosphorylation of a common set of proteins overlapping those induced by other cytokines and growth factors. J Biol Chem 269:11648–11655[Abstract/Free Full Text]
  5. Nakajima K, Wall R 1991 Interleukin-6 signal activating junB and TIS11 gene transcription in a B-cell hybridoma. Mol Cell Biol 11:1409–1418[Abstract/Free Full Text]
  6. Yuan J, Wegenka UM, Lutticken C, Buschmann J, Decker T, Schindler C, Heinrich PC, Horn F 1994 The signaling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements. Mol Cell Biol 14:1657–1668[Abstract/Free Full Text]
  7. Coffer P, Lutticken C, van Puijenbroek A, Klop-de Jonge M, Horn F, Kruijer W 1995 Transcriptional regulation of the jun B promoter: analysis of STAT-mediated signal transduction. Oncogene 10:985–994[Medline]
  8. Lutticken C, Coffer P, Yuan J, Schwartz C, Caldenhoven E, Schindler C, Kruijer W, Heinrich PC, Horn F 1995 Interleukin-6-induced serine phosphorylation of transcription factor APRF: evidence for a role in interleukin-6 target gene induction. FEBS Letters 360:137–143[CrossRef][Medline]
  9. Jacobson NG, Szabo SJ, Weber-Nordt RM, Zhong Z, Schreiber RD, Darnell Jr JE, Murphy KM 1995 Interleukin 12 signaling in T helper type 1 (Th1) cells involve tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J Exp Med 181:1755–1762[Abstract/Free Full Text]
  10. Metcalf D, Nicola NA, Gearing DP 1990 Effects of injected leukemia inhibitory factor (LIF) on hemopoietic and other tissues in mice. Blood 76:50–56[Abstract/Free Full Text]
  11. Tomida M, Yamamoto-Yamagushi T, Homuzi M 1984 Purification of a factor inducing differentiation of mouse myeloid leukemia M1 cells from conditioned medium of fibroblast L929 cells. J Biol Chem 259:10978–10982[Abstract/Free Full Text]
  12. Lord KA, Abdollahi A, Thomas SM, DeMarco M, Brugge JS, Hoffmann-Liebermann B, Liebermann DA 1991 Leukemia inhibitory factor and interleukin-6 trigger the same immediate Early Response, including tyrosine phosphorylation, upon induction of myeloid leukemia differentiation. Mol Cell Biol 11:4371–4379[Abstract/Free Full Text]
  13. Akita S, Webster J, Ren SG, Takino H, Said J, Zand O, Melmed S 1995 Human and murine pituitary expression of leukemia inhibitory factor. Novel intrapituitary regulation of adrenocorticotropin hormone synthesis and secretion. J Clin Invest 95:1288–1298
  14. Kojima K, Kanzaki H, Iwai M, Hatayama H, Fujimoto M, Inoue T, Horie K, Nakayama H, Fujita J, Mori T 1994 Expression of leukemia inhibitory factor in human endometrium and placenta. Biol Reprod 50:882–887[Abstract]
  15. Rajan P, Stewart CL, Fink JS 1995 LIF-mediated activation of STAT proteins after neuronal injury in vivo. NeuroReport 6:2240–2244[Medline]
  16. Yamamori T 1991 Localization of cholinergic differentiation factor/leukemia inhibitory factor mRNA in the rat brain and peripheral tissues. Proc Natl Acad Sci USA 88:7298–7302[Abstract/Free Full Text]
  17. De Miguel M, De Boer-Brouwer M, Paniagua R, Van Den Hurk R, De Rooij DG, Van Dissel-Emiliani FMF 1996 Leukemia inhibitory factor and ciliary neurotropic factor promote the survival of Sertoli cells and gonocytes in a coculture system. Endocrinology 137:1885–1893[Abstract]
  18. Okuda Y, Sun X-R, Morris PL 1994 Interleukin-6 (IL-6) mRNAs expressed in Leydig and Sertoli cells are regulated by cytokines, gonadotropins and neuropeptides. Endocrine J 2:617–624
  19. Okuda Y, Morris PL 1994 Identification of interleukin-6 receptor (IL-6R) mRNA in isolated Sertoli and Leydig cells: regulation by gonadotropin and interleukins in vitro. Endocrine J 2:1163–1168
  20. Jenab S, Morris PL 1997 Transcriptional regulation of Sertoli cell immediate early genes by interleukin-6 and interferon-{gamma} is mediated through phosphorylation of STAT-3 and STAT-1 proteins. Endocrinology 138:2740–2746[Abstract/Free Full Text]
  21. Zhu YS, Inturrisi CE 1993 Metrazole induction of c-fos and proenkephalin gene expression in the rat adrenal and hippocampus: pharmacological characterization. Mol Brain Res 20:118–124[Medline]
  22. King A, Jokhi PP, Smith SK, Sharkey AM, Loke YW 1995 Screening for cytokine mRNA in human villous and extravillous trophoblasts using the reverse-transcriptase polymerase chain reaction (RT-PCR). Cytokine 7:364–371[CrossRef][Medline]
  23. Shan LX, Hardy DO, Catterall JF, Hardy MP 1995 Effects of luteinizing hormone (LH) and androgen on steady state levels of messenger ribonucleic acid for LH receptors, androgen receptors, and steroidogenic enzymes in rat Leydig cell progenitors in vivo. Endocrinology 136:1686–1693[Abstract]
  24. Sadowski HB, Shuai K, Darnell Jr JE, Gilman MZ 1993 A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science 261:1739–1744[Abstract/Free Full Text]
  25. Zhong Z, Wen Z, Darnell Jr JE 1994 Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264:95–98[Abstract/Free Full Text]
  26. Wagner BJ, Hayes TE, Hoban CJ, Cochran H 1990 The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO J 9:4477–4484[Medline]
  27. Boulton TG, Zhong Z, Wen Z, Darnell Jr JE, Stahl N, Yancopoulos GD 1995 STAT3 activation by cytokines utilizing gp130 and related transducers involves a secondary modification requiring an H7-sensitive kinase. Proc Natl Acad Sci USA 92:6915–6919[Abstract/Free Full Text]
  28. Zhang X, Blenis J, Heng-Chun L, Schindler C, Chen-Kiang S 1995 Requirement of serine phosphorylation for formation of STAT-promoter complexes. Science 267:1990–1994[Abstract/Free Full Text]
  29. Pesce M, Grazia Farrace M, Piacentini M, Dolci S, De Felici M 1993 Stem cell factor and leukemia inhibitory factor promote primordial germ cell survival by suppressing programmed cell death (apoptosis). Development 118:1089–1094[Abstract]
  30. Cheng L, Gearing DP, White LS, Compton DL, Schooley K, Donovan PJ 1994 Role of leukemia inhibitory factor and its receptor in mouse primordial germ cell growth. Development 120:3145–3153[Abstract]
  31. Darnell Jr JE, Kerr IM, Stark GR 1994 jak-STAT pathways and transcription activation in response to IFNs and other extracellular signaling proteins. Science 264:1415–1420[Abstract/Free Full Text]
  32. Ihle JN 1996 STATs: signal transducers and activators of transcription. Cell 84:331–334[CrossRef][Medline]
  33. Jenab S, Morris PL 1996 differential activation of signal transducer and activator of transcription (STAT)-3 and STAT-1 transcription factors and c-fos messenger ribonucleic acid by interleukin-6 and interferon-{gamma} in Sertoli cells. Endocrinology 137:4738–4743[Abstract]
  34. Wen Z, Zhong Z, Darnell Jr JE 1995 Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:241–250[CrossRef][Medline]
  35. Karin M, Hunter T 1995 Transcriptional control by protein phosphorylation: signal transmission from the cell surface to the nucleus. Curr Biol 5:747–757[CrossRef][Medline]
  36. Chen-Kiang S, Hsu W, Natkunam Y, Zhang X 1993 Nuclear signaling by interleukin-6. Curr Opin Immunol 5:124–128[CrossRef][Medline]
  37. Muller R, Bravo R, Burckhardt J, Curran T 1986 Induction of c-fos gene and protein by growth factors precedes activation of c-mycm. Nature 312:716–720
  38. Curran T, Franza Jr RB 1988 Fos and jun: the AP-1 connection. Cell 55:395–397[CrossRef][Medline]
  39. Hall SH, Joseph DR, French FS, Conti M 1988 Follicle-stimulating hormone induces transient expression of the protooncogene c-fos in primary Sertoli cell cultures. Mol Endocrinol 2:55–61[Abstract]
  40. Hamil KG, Conti M, Shimasaki S, Hall SH 1994 Follicle-stimulating hormone regulation of AP-1: inhibition of c-jun and stimulation of jun B gene transcription in the rat Sertoli cell. Mol Cell Endocrinology 99:269–277[CrossRef][Medline]
  41. Whaley PD, Chaudhary J, Cupp A, Skinner MK 1995 Role of specific response elements of the c-fos promoter and involvement of intermediate transcription factor(s) in the induction of Sertoli cell differentiation (transferrin promoter activation) by the testicular paracrine factor PModS. Endocrinology 136:3046–3053[Abstract]
  42. Papadopoulos V, Dym M 1994 Sertoli cell differentiation on basement membrane is mediated by the c-fos protooncogene. Proc Natl Acad Sci USA 91:7027–7031[Abstract/Free Full Text]
  43. Gentz R, Rauscher III FJ, Abate C, Curran T 1989 Parallel association of fos and jun leucine zippers juxtapose to DNA binding domains. Science 243:1695–1699[Abstract/Free Full Text]
  44. Rivera VM, Miranti CK, Misra RP, Ginty DD, Chen RH, Blenis J, Greenberg ME 1993 A growth factor-induced kinase phosphorylates the serum response factor at a site that regulates its DNA binding activity. Mol Cell Biol 13:6260–6266[Abstract/Free Full Text]
  45. Karin M 1994 Signal transduction from the cell surface to the nucleus through the phosphorylation of transcription factors. Curr Opin Cell Biol 6:415–419[CrossRef][Medline]



This article has been cited by other articles:


Home page
J AndrolHome page
T. M. Onorato, P. W. Brown, and P. L. Morris
Mono-(2-ethylhexyl) Phthalate Increases Spermatocyte Mitochondrial Peroxiredoxin 3 and Cyclooxygenase 2
J Androl, May 1, 2008; 29(3): 293 - 303.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
L. DONG, S. A. JELINSKY, J. N. FINGER, D. S. JOHNSTON, G. S. KOPF, C. M. SOTTAS, M. P. HARDY, and R.-S. GE
Gene Expression During Development of Fetal and Adult Leydig Cells
Ann. N.Y. Acad. Sci., December 1, 2007; 1120(1): 16 - 35.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. Magni, E. Dozio, M. Ruscica, H. Watanobe, A. Cariboni, R. Zaninetti, M. Motta, and R. Maggi
Leukemia Inhibitory Factor Induces the Chemomigration of Immortalized Gonadotropin-Releasing Hormone Neurons through the Independent Activation of the Janus Kinase/Signal Transducer and Activator of Transcription 3, Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase 1/2, and Phosphatidylinositol 3-Kinase/Akt Signaling Pathways
Mol. Endocrinol., May 1, 2007; 21(5): 1163 - 1174.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Kanatsu-Shinohara, K. Inoue, N. Ogonuki, H. Miki, S. Yoshida, S. Toyokuni, J. Lee, A. Ogura, and T. Shinohara
Leukemia Inhibitory Factor Enhances Formation of Germ Cell Colonies in Neonatal Mouse Testis Culture
Biol Reprod, January 1, 2007; 76(1): 55 - 62.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Ishikawa and P. L. Morris
Interleukin-1{beta} Signals through a c-Jun N-Terminal Kinase-Dependent Inducible Nitric Oxide Synthase and Nitric Oxide Production Pathway in Sertoli Epithelial Cells
Endocrinology, November 1, 2006; 147(11): 5424 - 5430.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Vigodner, T. Ishikawa, P. N. Schlegel, and P. L. Morris
SUMO-1, human male germ cell development, and the androgen receptor in the testis of men with normal and abnormal spermatogenesis
Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E1022 - E1033.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Ishikawa, K. Hwang, D. Lazzarino, and P. L. Morris
Sertoli Cell Expression of Steroidogenic Acute Regulatory Protein-Related Lipid Transfer 1 and 5 Domain-Containing Proteins and Sterol Regulatory Element Binding Protein-1 Are Interleukin-1{beta} Regulated by Activation of c-Jun N-Terminal Kinase and Cyclooxygenase-2 and Cytokine Induction
Endocrinology, December 1, 2005; 146(12): 5100 - 5111.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
I. Dorval-Coiffec, J.-G. Delcros, H. Hakovirta, J. Toppari, B. Jegou, and C. Piquet-Pellorce
Identification of the Leukemia Inhibitory Factor Cell Targets Within the Rat Testis
Biol Reprod, March 1, 2005; 72(3): 602 - 611.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
N. Higashi, H. Kunimoto, S. Kaneko, T. Sasaki, M. Ishii, H. Kojima, and K. Nakajima
Cytoplasmic c-Fos induced by the YXXQ-derived STAT3 signal requires the co-operative MEK/ERK signal for its nuclear translocation
Genes Cells, March 1, 2004; 9(3): 233 - 242.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Walch, E. Clavarino, and P. L. Morris
Prostaglandin (PG) FP and EP1 Receptors Mediate PGF2{alpha} and PGE2 Regulation of Interleukin-1{beta} Expression in Leydig Cell Progenitors
Endocrinology, April 1, 2003; 144(4): 1284 - 1291.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. O. R. Borges, M. L. C. Abreu, C. S. Porto, and M. C. W. Avellar
Characterization of Muscarinic Acetylcholine Receptor in Rat Sertoli Cells
Endocrinology, November 1, 2001; 142(11): 4701 - 4710.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Mauduit, I. Goddard, V. Besset, E. Tabone, C. Rey, F. Gasnier, F. Dacheux, and M. Benahmed
Leukemia Inhibitory Factor Antagonizes Gonadotropin Induced-Testosterone Synthesis in Cultured Porcine Leydig Cells: Sites of Action
Endocrinology, June 1, 2001; 142(6): 2509 - 2520.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Guo, P. L. Morris, and L. J. Gudas
Follicle-Stimulating Hormone and Leukemia Inhibitory Factor Regulate Sertoli Cell Retinol Metabolism
Endocrinology, March 1, 2001; 142(3): 1024 - 1032.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Kotaja, S. Aittomäki, O. Silvennoinen, J. J. Palvimo, and O. A. Jänne
ARIP3 (Androgen Receptor-Interacting Protein 3) and Other PIAS (Protein Inhibitor of Activated STAT) Proteins Differ in Their Ability to Modulate Steroid Receptor-Dependent Transcriptional Activation
Mol. Endocrinol., December 1, 2000; 14(12): 1986 - 2000.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
J.-a. Tan, S. H. Hall, P. Petrusz, and F. S. French
Thyroid Receptor Activator Molecule, TRAM-1, Is an Androgen Receptor Coactivator
Endocrinology, September 1, 2000; 141(9): 3440 - 3450.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. J. Auernhammer and S. Melmed
Leukemia-Inhibitory Factor--Neuroimmune Modulator of Endocrine Function
Endocr. Rev., June 1, 2000; 21(3): 313 - 345.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
C. Piquet-Pellorce, I. Dorval-Coiffec, M.-D. Pham, and B. Jegou
Leukemia Inhibitory Factor Expression and Regulation within the Testis
Endocrinology, March 1, 2000; 141(3): 1136 - 1141.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-a. Tan, S. H. Hall, K. G. Hamil, G. Grossman, P. Petrusz, J. Liao, K. Shuai, and F. S. French
Protein Inhibitor of Activated STAT-1 (Signal Transducer and Activator of Transcription-1) Is a Nuclear Receptor Coregulator Expressed in Human Testis
Mol. Endocrinol., January 1, 2000; 14(1): 14 - 26.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. Kumahara, T. Ebihara, and D. Saffen
Protein Kinase Inhibitor H7 Blocks the Induction of Immediate-Early Genes zif268 and c-fos by a Mechanism Unrelated to Inhibition of Protein Kinase C but Possibly Related to Inhibition of Phosphorylation of RNA Polymerase II
J. Biol. Chem., April 9, 1999; 274(15): 10430 - 10438.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Stephens, S. J. Lumpkin, and J. B. Fishman
Activation of Signal Transducers and Activators of Transcription 1 and 3 by Leukemia Inhibitory Factor, Oncostatin-M, and Interferon-gamma in Adipocytes
J. Biol. Chem., November 20, 1998; 273(47): 31408 - 31416.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Kanzaki and P. L. Morris
Identification and Regulation of Testicular Interferon-{gamma} (IFN{gamma}) Receptor Subunits: IFN{gamma} Enhances Interferon Regulatory Factor-1 and Interleukin-1{beta} Converting Enzyme Expression
Endocrinology, May 1, 1998; 139(5): 2636 - 2644.
[Abstract] [Full Text] [PDF]


This Article