Endocrinology Vol. 139, No. 4 2092-2101
Copyright © 1998 by The Endocrine Society
Murine Bone Marrow Stromally Derived BMS2 Adipocytes Support Differentiation and Function of Osteoclast-Like Cells in Vitro1
Katherine A. Kelly2,
Sakae Tanaka,
Roland Baron and
Jeffrey M. Gimble
Departments of Pathology (K.A.K., J.M.G.), Orthodontics (K.A.K.),
and Surgery (J.M.G.), University of Oklahoma Health Science Center,
Oklahoma City, Oklahoma 73109; Immunobiology and Cancer, Oklahoma
Medical Research Foundation (K.A.K.), Oklahoma City, Oklahoma 73104;
the Department of Orthopedic Surgery, University of Tokyo (S.T.), Tokyo
113, Japan; and the Department of Orthopedics and Cell Biology, Yale
University School of Medicine (R.B.), New Haven, Connecticut
06510
Address all correspondence and requests for reprints to: Jeffrey M. Gimble, M.D., Ph.D., Department of Surgery, University of Oklahoma Health Sciences Center, P.O. Box 26901, Oklahoma City, Oklahoma 73190. E-mail: jeffrey-gimble{at}ouhsc.edu
 |
Abstract
|
|---|
Stromal cells are required for in vitro osteoclast
differentiation and maturation. The murine bone marrow stromally
derived BMS2 cell line exhibits adipocytic and osteoblastic features as
well as the ability to support lymphopoiesis and myelopoiesis. This
work examined the ability of the BMS2 cell in either the preadipocyte
or adipocyte state to support the formation of osteoclast-like cells.
BMS2 cells can be induced to undergo adipogenic differentiation in
response to treatment with glucocorticoids or thiazolidinedione
compounds. Primary bone marrow cells, enriched for hematopoietic
progenitors and depleted of their adherent stromal and macrophage
populations, were stimulated with vitamin D3 (vitamin D;
10-8 M) to undergo osteoclast differentiation
and maturation when cocultured with BMS2 cells. In both preadipocyte
and adipocyte-enriched BMS2 stromal layers, comparable numbers of
tartrate-resistant acid phosphatase-positive osteoclast-like cells,
characterized by their response to salmon calcitonin with an increase
in cAMP and formation of resorption pits on bovine bone slices, were
formed. The gene expression and protein levels of macrophage
colony-stimulating factor produced by preadipocyte and adipocyte-rich
BMS2 layers were comparable. However, adipocyte-rich stromal layers
supported osteoclast-like cell formation longer in culture than
preadipocytes, independent of the agent used to induce adipocyte
differentiation. These studies demonstrate for the first time that
fully differentiated adipocyte stromal cells can support
osteoclast-like cell formation and function in vitro.
 |
Introduction
|
|---|
THE ADIPOCYTES, osteoblasts, and
hematopoietic supporting cells within the bone marrow derive from a
single multipotent stromal progenitor (1). The functions of the
osteoblast and hematopoietic supporting cells in this microenvironment
are not controversial. However, the role of the adipocyte remains
unclear. Some investigators suggest that adipocytes serve only in a
passive role, occupying space no longer required for hematopoietic or
osteogenic function (1, 2, 3, 4). Alternatively, it has been hypothesized
that the bone marrow adipocyte is an active participant in
hematopoietic and osteogenic events (1, 2, 3, 4, 5, 6, 7).
Stromal cells create the microenvironment required for hematopoiesis,
producing the soluble and membrane-associated proteins and cytokines
necessary for the growth and differentiation of osteoclasts and other
blood cells (1, 3, 5, 7, 8). Among these, macrophage colony-stimulating
factor (M-CSF) is one of the most important (9), as documented by the
osteopetrotic (op/op) mouse model (9, 10, 11). The M-CSF gene in
these animals is mutated, resulting in a nonfunctional protein and an
inability of the stroma to support osteoclastogenesis (12). Stromal
cell production of M-CSF can be increased by exposure to vitamin D
(13), a hormone that promotes osteoclast progenitor formation (14, 15).
In contrast, it has been reported that stromal cell adipogenesis is
accompanied by reduced expression of M-CSF; this observation, however,
is limited to a single cell line (16, 17). It is of interest that many
of the stromal cell lines used to study osteoclast formation and
function in vitro are of the undifferentiated stromal
phenotype (8, 18, 19). The ability of stromal cells to continue to
support osteoclastogenesis after undergoing adipocyte differentiation
remains unexplored.
The murine bone marrow-derived cell line BMS2 is a reproducible
in vitro model of a multipotent stromal stem cell (1, 20).
In addition to exhibiting osteoblastic features, these cells are able
to support lymphopoiesis and myelopoiesis in vitro (20, 21).
Moreover, after exposure to glucocorticoids or thiazolidinediones, BMS2
cells undergo adipocyte differentiation (20, 22). The current work uses
the BMS2 model to examine the ability of adipocyte-rich stromal cell
layers to support osteoclast formation and function in
vitro. The data show that in the presence of vitamin D, committed
adipocytes create a microenvironment in which hematopoietic stem cells
can differentiate into osteoclast-like cells, i.e.
multinucleated, tartrate-resistant acid phosphatase (TRAP)-positive
(TRAP+) cells that respond to calcitonin and are capable of
resorbing bone.
 |
Materials and Methods
|
|---|
All reagents were obtained from Sigma Chemical Co. (St. Louis,
MO) and Fisher Scientific (Dallas, TX) unless otherwise noted.
Cell culture
BMS2, a murine bone marrow stromal cell line (23), was
originally obtained from Drs. C. Pietrangeli and P. W. Kincade
(Immunology and Cancer, Oklahoma Medical Research Foundation) and
maintained in modified DMEM (high glucose) supplemented with 10%
(vol/vol) FBS (defined; HyClone, Logan, UT), 1 mM sodium
pyruvate, 100 U penicillin/ml, 100 µg/ml streptomycin/ml, and 50
µM ß-mercaptoethanol (referred to as supplemented DMEM)
at 37 C in 7% CO2. The BMS2 cells were passaged every 7
days.
BMS2 subclones were developed from the parental stromal cell line by
limiting dilution cloning (24). Subclones were passaged and originally
characterized based on the ability to form fat in response to
hydrocortisone, methylisobutylxanthine (MIBX), and indomethacin as
detected by flow cytometry (below). Subclones were maintained in the
same manner as the parental BMS2 cells.
OP42, a murine splenic stromal cell line derived from osteopetrotic
(op/op) mice by K. Medina and P. W. Kincade
(Immunobiology and Cancer, Oklahoma Medical Research Foundation), was
maintained in the same manner as BMS2 cells (25).
Primary nonadherent bone marrow cells
Female BALB/c mice were obtained from the breeding colony housed
at the Laboratory Animal Resource Center of the Oklahoma Medical
Research Foundation. At 6 weeks of age, mice were killed by carbon
dioxide asphyxiation according to protocols approved by the
institutional animal care and use committee. Femora and tibiae were
harvested, and the whole bone marrow was flushed using supplemented
DMEM in a 10-cc syringe and a 25-gauge needle. Suspended whole bone
marrow was then eluted over a Sephadex G-10 (Pharmacia Biotech,
Uppsala, Sweden) column to remove the adherent stromal population (26).
The nonadherent hematopoietic precursor cells were collected in the
eluant and washed, and the number of nucleated cells was counted after
treatment with 0.3% acetic acid and trypan blue.
Adipogenic BMS2/nonadherent bone marrow cell cocultures were performed
by growing stromal cells at a density of 1 x 104
cells/1.77 cm2 in 24-well plates (Costar, Corning, NY) with
supplemented DMEM for 3 days. After 3 days in culture, adipogenic
agents and/or 1
,25-dihydroxyvitamin D3 (VD) were added
to appropriate cultures from experimental days 36. The MHI cocktail
consisted of 0.5 mM methylisobutylxanthine, 0.5
µM hydrocortisone, and 60 µM indomethacin.
The thiazolidinediones BRL49653 and pioglitazone were diluted in
dimethylsulfoxide and added in final concentrations of 5 and 25
µM, respectively (final concentrations of
dimethylsulfoxide, <0.1%, vol/vol) in fresh supplemented DMEM. These
compounds were supplied by Dr. D. Morris, GlaxoWellcome (Research
Triangle Park, NC). On the sixth day of culture, primary nonadherent
bone marrow cells (2 x 105 cells/1.77
cm2) were added to the stromal cells in fresh supplemented
DMEM in the presence or absence of VD (10-8 M;
provided by Dr. M. Uskokovic, Hoffmann-La Roche, Nutley, NJ).
Cocultures were subsequently fed every 3 days by replacing the
supplemented DMEM. The vitamin D concentrations were maintained
throughout the course of the experiment. The total volume per well of
the 24-well plate was maintained at 0.5 ml, and cultures were
maintained at 37 C in 7% CO2 humidified air. (see Fig. 1
) Cultures were harvested for TRAP
staining, total RNA, total protein extracts, Nile red staining, and
fluorescence-activated cell sorting (FACS) analysis.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1. Experimental design. Conditions for the coculture
experiments are outlined. Individual wells on a 24-well plate were
seeded with stromal cells on day 0 and nonadherent hematopoietic cells
(G-10 cells) on day 6 in all studies. When present, cultures were
exposed to MHI on day 3 and to VD on day 3 or 6. Once added, VD was
maintained in the culture medium until the completion of the
experiment.
|
|
BMS2:OP42/nonadherent bone marrow cell cocultures were performed with a
constant number of stromal cells (total stromal cells kept constant at
104/1.77 cm2), but with varying proportions of
BMS2 and OP42 cells. Stromal cells were plated 3 days before Sephadex
G-10-passaged whole bone marrow cells were added (2.5 x
105/1.77 cm2) in the absence or presence of
vitamin D and fed by replacing the supplemented DMEM every 3 days. When
present, the vitamin D concentration was maintained at
10-8 M throughout the experiment.
RNA analysis
Cocultures were harvested for RNA following the modified method
of Chomczynski and Sacchi (27), as previously described (28). Northern
blots were run with approximately 10 µg total RNA/lane in a
formaldehyde agarose gel, transferred to a MSI-NT nylon membrane (MSI,
Westboro, MA), and UV cross-linked for 5 min with a UV transilluminator
(UVP, San Gabriel, CA). Northern blots were prehybridized and
hybridized with complementary DNA (cDNA) probes in 500 mM
sodium phosphate (pH 7.2), 7% SDS, and 1 mM EDTA at 55 C
overnight (29). cDNA probes were labeled by the random primer method,
using [
-32P]deoxy-CTP (ICN, Irvine, CA) (30). After
hybridization, blots were washed four times for 20 min each time in 40
mM NaHPO4 (pH 7.2), 1% SDS, and 1
mM EDTA at maximum stringency at 55 C, then exposed to
autoradiographic film (Eastman Kodak, Rochester, NY) for 17 days at
-70 C with an enhancing screen. The following cDNA probes were used;
human interleukin-6 (637 bp; provided by Steve Clark, Genetics
Institute, Cambridge, MA), TRAP (see below), murine M-CSF
[3.9-kilobase (kb) insert; pGEM2MCSF10; culture collection no. CMCC
2760, Cetus Corp., Emeryville, CA], murine lipoprotein lipase (711 bp)
(21), and actin (provided by B. Spiegelman, Dana Farber, Boston,
MA).
Cloning of the TRAP cDNA
A murine-specific probe was cloned based on exons within the
TRAP genomic DNA sequence (31). The following oligonucleotide primers
were synthesized: -8 to +18 bp, ATTTGAGCTCGTGGTGTTCAGGGTCT; and
30443019, ATTTGAGCTCACAGATGGATTCATGGGTGGTG. PCRs were performed for
40 cycles at 94 C for 1 min, at 68 C for 2 min, and at 72 C for 4 min.
The 1-kb TRAP PCR fragment was subcloned into the Bluescript SKII
vector (Stratagene, San Diego, CA), and its identity was confirmed by
dideoxy sequencing. The 1-kb SacI insert was used as a
radiolabeled probe.
FACS
Cultures were resuspended in 0.25% trypsin-1 mM
EDTA (Life Technologies, Grand Island, NY) and fixed with 0.35%
(vol/vol) paraformaldehyde. Neutral lipids of adipocytes were stained
by adding 88 ng/ml Nile red to the cell suspension, and the gold
fluorescent emission was detected between 564604 nm with a bandpass
filter using a FACScan (Becton Dickinson, San Jose, CA) (28, 32).
TRAP staining
Cocultures were fixed with 0.5 ml 3.7% (vol/vol) formaldehyde
in phosphate buffer solution for 5 min, dried for 30 sec with
acetone-ethanol (50:50, vol/vol), and stained for 10 min with 10
mM sodium tartrate, 40 mM sodium acetate (pH
5.0), 0.1 mg/ml naphthol AS-MS phosphate (Sigma N-5000), and 0.6 mg/ml
fast red violet LB salt (Sigma F-3381) (33, 34, 35). Stained cultures were
rinsed in distilled water and stored under 50% glycerin. The numbers
of TRAP+ cells with one to two or three or more nuclei were
enumerated under light microscopy across the diameter of each well by
an unbiased observer, unaware of the culture conditions under
evaluation.
Western blot analysis
Conditioned medium or total cellular proteins were denatured in
boiling lysis buffer (1% SDS-10 mM Tris), subjected to
SDS-PAGE under reducing conditions, transferred to nitrocellulose
membrane (Fisher Scientific, Pittsburgh, PA), and incubated with goat
anti-CSF antibody at a final dilution of 1:10,000 (provided by Dr.
E. R. Stanley, Department of Microbiology and Immunology, College
of Medicine, Albert Einstein University, New York, NY) (36).
Antibody-protein complexes were visualized with a horseradish
peroxidase-coupled rabbit antigoat IgG and chemiluminescent reagents
(ECL Western blotting detection reagents, Amersham International,
Aylesbury, UK) using autoradiography (X-Omat film, Eastman Kodak,
Rochester, NY).
Calcitonin receptor/cAMP assay
To measure the presence of calcitonin receptors expressed by
TRAP+ cells, cocultures were grown as described above. On
experimental day 12, culture medium was replaced with DMEM, 0.1%
(vol/vol) BSA, and 1 mM MIBX for 15 min at 37 C. This
medium was then replaced with DMEM, 0.1% BSA, 1 mM MIBX,
and salmon calcitonin (10-8 M) (Sigma T-3660)
for 10 min at 37 C. To harvest cAMP, assay medium was replaced with
ice-cold 95% (vol/vol) ethanol, and the cultures were maintained at 4
C for 2 h. The ethanol extraction medium was transferred to a
glass tube, and the culture plate was rinsed with ethanol-3
mM HCl and pooled with the ethanol extraction medium. The
glass tubes were boiled until the ethanol extraction medium evaporated,
and the contents were resuspended in 500 µl assay buffer (Biotrak
cAMP enzyme immunoassay system, Amersham International). An
enzyme-linked immunosorbent assay was performed using a 96-well assay
plate that was coated with donkey antirabbit antibody, followed by
rabbit anti-cAMP reagent and incubated with peroxidase-labeled cAMP
standards or 100 µl of each diluted sample, according to the
manufacturers instructions. Tetramethylbenzidine substrate was then
added to the assay plate and incubated for 30 min before the reaction
was stopped with 1 M sulfuric acid. The optical density was
read at 450 nm on a microtiter plate reader (Microplate Reader MR600,
Dynatech, Chantilly, VA). The amount of cAMP in each sample was
calculated based on the standard curve of cAMP standards.
Resorption pit formation
Bovine bone slices were prepared from the cortical bone of
femurs obtained from Mikkelson Beef (Oklahoma City, OK). Femurs were
cut, and final bone slices were prepared to dimensions of approximately
0.5 cm2 and less than 0.5 mm thick. Bone slices were stored
in 95% ethanol overnight, then rinsed and stored in sterile distilled
water. Cocultures were grown as described above in the presence or
absence of 10-8 M vitamin D, with the addition
of the bone slice on day 0. At the end of culture (experimental day
12), the bone slices were removed and rinsed in 0.1% sodium
hypochlorite solution to remove adherent cells. Bone slices were
sputter coated with gold-palladium, and resorption pits were visualized
on a scanning electron microscope (model JEOLJSM-880, JEOL, Peabody,
MA). Scanning electron microscopy was performed at the Sam Noble
Electron Microscopy Facility, University of Oklahoma (Norman, OK) with
the assistance of Mr. William Chissoe III. Photographs were taken at
x200 and x500 magnification.
Statistics
Data were analyzed using one- or two-way ANOVA and Students
t test (Sigma Stat, Jandel Scientific, San Rafael, CA).
 |
Results
|
|---|
Preadipocyte cocultures
The initial experiments were designed to determine whether bone
marrow-derived BMS2 preadipocytes are capable of supporting osteoclast
differentiation in vitro. In the presence of vitamin D and
BMS2 preadipocytes, TRAP+ cells formed after 6 days of
coculture (Fig. 2
). To determine whether
the number of TRAP+ cells formed was proportionate to the
number of BMS2 cells, OP42 stromal cells from the osteopetrotic
op/op mouse were mixed with the BMS2 cells in coculture.
The op/op stromal cells produce defective M-CSF protein,
resulting in a failure to support osteoclast differentiation (12). In
the experiments described in Fig. 2
, the total number of stromal cells
was kept constant (1 x 104 cells/1.77
cm2) while the percentages of BMS2 and OP42 were varied in
a reciprocal manner (0100%). A constant number of primary
nonadherent bone marrow cells (2 x 105 cells/1.77
cm2) were added to the established stromal layer in the
presence of vitamin D. TRAP+ cell numbers are expressed as
a percentage relative to the number of TRAP+ cells formed
in cultures composed of 100% BMS2 stromal cells in the presence of
vitamin D (131 ± 22.6 cells with one or two nuclei and 196.3
± 18.5 cells with three or more nuclei). No TRAP+ cells
were observed in the absence of vitamin D. However, as the total
percentage of BMS2 preadipocytes was decreased in the presence of
vitamin D, the total number of TRAP+ cells also decreased
in a parallel manner. This suggests that OP42 stromal cells did not
release potent inhibitors of BMS2-supported TRAP+ cell
formation. As expected, with only OP42 cells as support, no
TRAP+ cells formed in the presence of vitamin D.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 2. BMS2:OP42 osteoclast coculture: TRAP analysis. The
total number of stromal cells plated remained constant, with the
percentage of BMS2 stromal cells decreasing from 100% to 0%, and the
percentage of OP42 stromal cells increasing from 0% to 100%. Three
days later, Sephadex G-10-passaged primary bone marrow cells were added
to the stromal cell cultures in the presence of vitamin D3
(10-8 M). On experimental day 9, cocultures
were fixed and stained for TRAP. The number of TRAP+ cells
is expressed as a percentage of those in the cultures with 100% BMS2
support cells and reflect three experiments performed in
quadruplicate.
|
|
The formation of TRAP+ cells is supported
by adipocytes
Although it is established that uncommitted stromal cells and
osteoblasts support osteoclastogenesis in vitro, it is not
known whether fully differentiated adipocytes retain this capacity (18, 19, 37, 38). The next series of experiments asked whether BMS2
adipocytes continue to support TRAP+ cell differentiation
in a manner equivalent to preadipocyte BMS2 cells. Initial studies
quantified BMS2 adipogenesis by FACS analysis under the different
culture conditions in the absence of nonadherent hematopoietic cells.
No significant number of adipocytes formed in the absence of MHI
cocktail (control, 0.7%; VD day 3, 1.5%; VD day 6, 3.0%) or with the
concurrent addition of vitamin D with MHI (MHI + VD day 3; 1.4%).
Adipocytes formed in the presence of MHI cocktail alone (MHI; 53.7%)
and in the presence of MHI cocktail when vitamin D addition was delayed
until experimental day 6 (MHI + VD day 6; 57.1%).
Next, the number of TRAP+ cells was determined in
cocultures established under these same conditions (Fig. 3
). No TRAP+ cells formed in
the absence of vitamin D, independent of the presence of MHI induction
(data not shown). Time-course studies determined that TRAP+
cell numbers reached maximal values (one or two nuclei per cell,
140180; three or more nuclei, 40140) on experimental day 12 (6 days
in coculture) for all vitamin D-treated cocultures (Fig. 3A
). The
numbers of both one or two and more than three nucleated
TRAP+ cells were significantly increased at later time
points (days 1824) in cultures containing adipocyte stromal layers
(MHI + VD day 6) relative to those in preadipocyte stromal layers (VD
day 3, MHI + VD day 3, and VD day 6). Photomicrographs of
representative cultures stained for TRAP on day 12 are shown in Fig. 3B
.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 3. Parental BMS2-adipogenic coculture: TRAP time
course. Stromal cells were plated on day 0, treated with adipogenic
agents on day 3 in the presence or absence of VD, Sephadex
G-10-passaged cells were added on day 6 in the presence or absence of
VD, and cultures were stained for TRAP every 3 days. A, The numbers of
one or two nuclei and three or more nuclei cells reported reflect data
from three experiments performed in quadruplicate. The
asterisks indicate P < 0.05 (*),
P < 0.01 (**), and P < 0.001
(***) relative to the number of TRAP+ cells under the VD
day 3 culture conditions. B, The photographs of the cocultures shown
were taken on experimental day 12.
|
|
In time-course studies analyzed by FACS, we found that concurrent
addition of vitamin D and the MHI cocktail on day 3 significantly
reduced adipogenic differentiation by the BMS2 cells under coculture
conditions (Fig. 4
). In contrast, delayed
addition of vitamin D until day 6 had no effect on adipogenesis,
resulting in 58.9% adipocytes, similar to the MHI alone control
(52.9%). Together, these data (Figs. 3
and 4
) indicate that bone
marrow adipocytes support vitamin D-dependent TRAP+ cells
as well as or better than fibroblast-like preadipocytes.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4. Parental BMS2-adipogenic coculture: FACS analysis.
Adipogenic cultures were grown as described in Materials and
Methods, fixed with paraformaldehyde, and stained with Nile red
for FACS analysis. The number of adipocytes is expressed as a
percentage of the total stromal cell population. Data reflect three
experiments performed in quadruplicate.
|
|
M-CSF production in cocultures
M-CSF is a key cytokine in osteoclast formation. In some stromal
lines, M-CSF levels have been reported to decrease with adipocyte
differentiation (17). To examine changes in M-CSF expression that might
occur with BMS2 adipogenesis, Northern and Western blot analyses were
performed on adipogenic cocultures. M-CSF messenger RNA (mRNA) was
expressed at comparable levels under all treatment conditions (Fig. 5A
). cDNA probes to mouse TRAP gene and
lipoprotein lipase (LPL) were also used to probe the coculture Northern
blots. TRAP mRNA was only detected in vitamin D cocultures and
correlated directly with the TRAP stain data. LPL gene expression, an
early marker for adipogenesis, increased with MHI and MHI + VD day 6
treatments and correlated with the Nile red/FACS data. Northern blots
were probed with a cDNA probe for actin to control for RNA loading.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 5. A, Parental BMS2-adipogenic coculture: Northern
blot analysis. Total RNA was harvested from cocultures on experimental
day 12 and made into Northern blots that were probed with the
following cDNA probes: M-CSF, TRAP, LPL, and actin. B, Parental
BMS2-adipogenic coculture: Western blot analysis. Cocultures were grown
as described in Materials and Methods, and on
experimental day 12, conditioned medium and total cell lysates were
harvested and run on Western blot under reducing conditions. Antibodies
to M-CSF (goat anti-CSF) and horseradish peroxidase-coupled rabbit
antigoat IgG were used to visualize the antibody-protein
complexes with chemiluminescent agents.
|
|
The effects of vitamin D and adipogenesis on M-CSF immunoreactive
protein levels were examined on experimental days 9 and 12. Western
blot analysis of cell lysate under reducing conditions showed
relatively constant amounts of cell-associated M-CSF (Fig. 5B
, bottom). Levels of secreted M-CSF decreased slightly with
MHI treatment on both days 9 and 12. However, these minor changes were
not accompanied by reduced TRAP+ cell numbers.
Effects of thiazolidinedione BRL on coculture
Stromal cell adipogenesis can be induced by alternative agents.
Although the MHI cocktail uses the glucocorticoid receptor in its
mechanism, the thiazolidinedione drugs act through the peroxisome
proliferator-activated receptor, another steroid receptor-like
transcription factor (39). To determine whether the type of adipogenic
agent influenced the support of TRAP+ cells, BMS2 cells
were treated with either MHI cocktail or BRL (5 µM) in
the presence or absence of vitamin D (Table 1
), as outlined in Fig. 1
.
TRAP+ cells formed in the presence of BRL-induced
adipocytes in a similar pattern as that in MHI cocktail-induced
adipogenic cocultures. This suggests that stromal adipocytes,
independent of the mechanism leading to this common morphological
phenotype, support osteoclastogenesis in a similar manner.
Osteoclast support by BMS2 subclone 24
The parental BMS2 cell achieved a maximum of 58% adipocytes in
culture. Further experiments were performed with stromal cultures that
achieved nearly confluent adipocyte layers. A subclone of the parental
BMS2 line, subclone 24, was found to undergo over 80% adipogenesis in
response to the MHI cocktail. The TRAP+ support function of
subclone 24 was evaluated in coculture experiments. The temporal
kinetics of support by adipogenic subclone 24 cocultures paralleled
those observed in the parental BMS2 cell line (Fig. 6
). In the presence of salmon calcitonin,
the vitamin D-induced cocultures produced cAMP, consistent with the
presence of calcitonin receptors on the surface of the
TRAP+ cells (Fig. 7
).
Moreover, resorption pits were detected by electron microscopy on
bovine bone slices in cocultures exhibiting TRAP+ cells
(Fig. 8
). In the absence of vitamin D,
neither calcitonin-dependent cAMP production nor bone resorption pits
were observed.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 6. BMS2 subclone 24-adipogenic coculture: TRAP time
course. Adipogenic cocultures were grown as described in
Materials and Methods with BMS2 subclone 24 as
supporting stromal cells. Cultures were fixed and stained for TRAP
every 3 days (days 1224). The number of one or two or three or more
nuclei TRAP+ cells reflect data from three experiments
performed in quadruplicate.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Figure 7. BMS2 subclone 24-adipogenic coculture: calcitonin
receptor/cAMP analysis. Adipogenic cocultures were grown as described
and on experimental day 12 were assayed for cAMP production in response
to addition of salmon calcitonin (10-8 M).
Salmon calcitonin was suspended in medium supplemented with 0.1% BSA
and 1 mM MIBX for 10 min at 37 C. cAMP was recovered using
3 mM HCl in 95% ethanol at 4 C for 2 h and analyzed
using the Amersham cAMP enzyme immunoassay system. Data are reported as
cAMP measured per culture well of a 24-well plate.
Asterisks indicate P 0.0001.
|
|

View larger version (87K):
[in this window]
[in a new window]
|
Figure 8. BMS2 subclone 24 coculture: resorption pits.
Cocultures were grown in the presence or absence of vitamin
D3 in the presence of bovine femoral bone slices. Bone
slices were sputter coated with gold-palladium, visualized on an
electron microscope, and photographed at x200 and x500
magnification.
|
|
 |
Discussion
|
|---|
It has been shown that myeloid precursor cells require the
presence of stromal cells to undergo osteoclastogenesis (19). Of the
stromal cell lines reported, many are preadipocytes in phenotype (19)
and in the fibroblast-like state have been shown to support attachment
and long term survival of myeloid cells (21, 37, 40). In addition to
being a model for stromal cell adipogenesis and osteoblastogenesis, the
BMS2 preadipocyte line can support lymphopoiesis and myelopoiesis (20, 21, 23). We now show that in the presence of vitamin D, BMS2-derived
preadipocytes and adipocytes support multinucleated TRAP+
cells. These TRAP+ cells meet the criteria expected of
osteoclasts, displaying functional calcitonin receptors and
bone-resorbing capability.
M-CSF is essential for osteoclast differentiation (36). Proliferation
of osteoclast precursors is dependent on M-CSF, but fusion events (38)
and the bone-resorbing functions of mature osteoclasts (41) are not. In
the osteopetrotic (op/op) mouse, a point mutation in the
coding region of the CSF-1 gene results in the absence of functional
M-CSF proteins (12). Consistent with this, we found that OP42 stromal
cells, derived from the op/op mouse, failed to support
osteoclastogenesis. However, in stromal cultures also containing BMS2
cells, we observed that OP42 cells did not release any active
inhibitors of osteoclastogenesis.
The effect of adipocyte differentiation on M-CSF has not been clearly
defined. With adipogenesis, constitutive expression of M-CSF decreases
in H-1/A cells (17). In another cell line, CH310T1/2, there is no
change in the rate of M-CSF mRNA expression with adipogenesis (42). In
the current work, the BMS2 cell did not significantly alter its M-CSF
expression with adipocyte differentiation. Indeed, BMS2 adipocytes
supported TRAP+ cell numbers longer than their
fibroblast-like counterparts. This may reflect their release of
adipocyte-specific factors into the medium or within the extracellular
matrix.
Adipocytes express a number of proteins that may contribute to the
support of osteoclast-like cells. One example is the hormone leptin,
which is uniquely expressed by adipocytes (43, 44). Recent studies have
reported the presence of leptin receptors on hematopoietic stem cells
and, in particular, on myeloid progenitors (45, 46). Leptin has been
observed to bind the long form of its receptor, inducing proliferation
of hematopoietic stem cells and differentiation and functional
activation of macrophages (46). The leptin receptor is homologous to
the interleukin-6 receptor and uses the Janus kinase/STAT (signal
transducer and activator upon transcription) signal transduction
pathway (46). As the interleukin-6 cytokine family has been implicated
to play an important role in osteoclastogenesis, leptin may also have
this capability. A second example is complement component C3, an acute
phase protein that is induced during bone marrow stromal cell
adipogenesis (47). Previous studies have identified soluble C3 as a
bone marrow factor that enhances osteoclastogenesis in vitro
and in vivo (48). In addition, adipocytes may release
lipid-derived products, such as FFAs, PGs, or steroid compounds, that
influence osteoclast differentiation.
Our studies determined that vitamin D inhibited adipogenesis in
BMS2-derived cell lines after exposure to MHI. Sato and others have
reported similar findings (49, 50). A more detailed description of this
phenomenon will be the subject of a separate manuscript (51).
In summary, murine osteoclasts require the support of stromal cells
during differentiation in the absence of exogenous cytokines. The
current studies demonstrate that adipocytes can supply the essential
stromally derived soluble and cell surface factors necessary for
osteoclast differentiation and function in vitro. The period
of TRAP+ multinucleated cell detection is extended in the
presence of adipocytes compared with that in preadipocyte stromal
cells. Indeed, the adipocyte may contribute unique factors to the
hematopoietic microenvironment. Studies are underway using the BMS2
coculture model to further investigate this area.
 |
Acknowledgments
|
|---|
We thank P. W. Kincade, L. Thompson, M. R. Hill,
N. L. Nadon, and C. Webb for helpful discussions; B. R.
Rodriguez for technical assistance; and P. Anderson, J. Young, and J.
Mowdy of OASIS for editorial and photographic assistance.
 |
Footnotes
|
|---|
1 This work was supported in part by NIDR Grant K15DE360 (to K.A.K.),
NIH Grant DE-04724 (to R.B.), and NIH Grant CA-50898 (to J.M.G.) as
well as the resources of the Oklahoma Medical Research Foundation. 
2 This work was completed by K.A.K. in partial fulfillment of doctoral
dissertation requirements for the Department of Pathology, University
of Oklahoma Health Sciences Center. 
Received October 21, 1997.
 |
References
|
|---|
-
Gimble JM, Robinson CE, Wu X, Kelly KA 1996 The function of adipocytes in the bone marrow stroma: an update. Bone 19:421428[Medline]
-
Beresford JN, Bennet JH, Devlin C, Leboy PS, Owen
ME 1992 Evidence for an inverse relationship between the
differentiation of adipocytic and osteoblastic cells in rat marrow
stromal cell cultures. J Cell Sci 102:341351[Abstract/Free Full Text]
-
Tavassoli M 1984 Marrow adipose cells and
hemopoiesis: an interpretative review. Exp Hematol 12:139146[Medline]
-
Tavassoli M 1989 Fatty involution of marrow and
the role of adipose tissue in hemopoiesis. In: Tavassoli M (ed)
Handbook of the Hemaopoietic Microenvironment. Humana Press, Clifton,
pp 157187
-
Tavassoli M, Crosby WH 1970 Bone marrow
histogenesis: a comparison of fatty and red marrow. Science 169:291293[Abstract/Free Full Text]
-
Tavassoli M, Maniatis A, Crosby WH 1974 Induction
of sustained hemopoiesis in fatty marrow. Blood 43:3338[Abstract/Free Full Text]
-
Gimble JM 1990 The function of adipocytes in the
bone marrow stroma. New Biol 2:304312[Medline]
-
Kodama H, Iizuka M, Tomiyama T, Yoshida K, Seki M, Suda
T, Nishikawa S 1991 Response of newly established mouse myeloid
leukemic cell lines t MC3T3G2/PA6 preadipocytes and hematopoietic
factors. Blood 77:4954[Abstract/Free Full Text]
-
Kodama H, Nose M, Niida S, Yamasaki A 1991 Essential role of macrophage colony-stimulating factor in the
osteoclast differentiation supported by stromal cells. J Exp Med 173:12911294[Abstract/Free Full Text]
-
Felix R, Cecchini MG, Hofstetter W, Elford PR, Stutzer
A, Fleisch H 1990 Impairment of macrophage-stimulating factor
production and lack of resident bone marrow macrophages in the
osteopetrotic op/op mouse. J Bone Miner Res 5:781789[Medline]
-
Niato M, Hayashi S-I, Yoshida H, Nishikawa S-I, Shultz
LD, Takahashi K 1991 Abnormal differentiation of tissue macrophage
populations in "osteopetrosis" (op) mice defective in the
production of macrophage colony-stimulating factor. Am J Pathol 139:657667[Abstract]
-
Yoshida H, Hayashi SI, Kunisada T, Ogawa M, Nishikawa S,
Okamura H, Sudo T, Shultz LD, Nishikawa SI 1990 The murine
mutation osteopetrosis is in the coding region of the macrophage
colony-stimulating factor gene. Nature 345:442444[CrossRef][Medline]
-
Weir EC, Horowitz MC, Baron R, Centrella M, Kacinski BM,
Insogna KL 1993 Macrophage colony-stimulating factor release and
receptor expression in bone cells. J Bone Miner Res 8:15071518[Medline]
-
Perkins SL, Kling SJ 1995 Local concentrations of
macrophage colony-stimulating factor medicate osteoclast
differentiation. Am J Physiol 268:E1024E1030
-
Perkins SL, Kling SJ, Ross FP, Teitelbaum TL 1995 1,25-Dihydroxyvitamin D3 stimulates differentiation of
committed murine bone marrow-derived macrophage precursor cells.
Endocrinology 136:56435650[Abstract]
-
Nakamura M, Harigaya K, Watanabe Y 1985 Correlation
between production of colony-stimulating activity (CSA) and adipose
conversion in a murine marrow-derived preadipocyte line
(H-1/A)1 (42097). Proc Soc Exp Biol Med 179:283287[CrossRef][Medline]
-
Umezawa A, Tachibana K, Harigaya K, Kusakari S, Kato S,
Watanabe Y, Takano T 1991 Colony stimulating factor 1 expression
is down regulated during adipocyte differentiation of H-1/A marrow
stromal cells and induced by cachectin/tumor necrosis factor. Mol Cell
Biol 11:920927[Abstract/Free Full Text]
-
Udagawa N, Takahashi N, Akatsu T, Sasaki T, Yamaguchi A,
Kodama H, Martin TJ, Suda T 1989 The bone marrow-derived stromal
cell lines MC3T3-Gw/PA6 and ST2 support osteoclast-like cell
differentiation in cocultures with mouse spleen cells. Endocrinology 125:18051813[Abstract/Free Full Text]
-
Udagawa N, Takahashi N, Akatsu T, Tanaka H, Sasaki T,
Nishimhara T, Koga T, Martin TJ, Suda T 1990 Origin of
osteoclasts: mature monocytes and macrophages are capable of
differentiating in to osteoclasts under a suitable microenvironment
prepared by bone marrow-derived stromal cells. Proc Natl Acad Sci USA 87:72607264[Abstract/Free Full Text]
-
Gimble JM, Dorheim MA, Cheng Q, Medina K, Jones R, Koren
E, Peitrangeli C, Kincade PW 1990 Adipogenesis in a murine bone
marrow stromal cell line capable of supporting B lineage lymphocyte
growth and proliferation: biochemical and molecular characterization.
Eur J Immunol 20:379387[Medline]
-
Gimble JM, Youkhana K, Hua X, Bass H, Medina K, Sullivan
M, Greenberger J, Wang C-S 1992 Adipogenesis in a myeloid
supporting bone marrow stromal cell line. J Cell Biochem 50:7882[CrossRef]
-
Gimble JM, Robinson CE, Wu X, Kelly KA, Rodriquez BR,
Kliewer SA, Lehmann JM, Morris DC 1996 Peroxisome
proliferator-activated receptor
activation by thiazolidinediones
induces adipogenesis in bone marrow stromal cells. Mol Pharmacol 50:10871094[Abstract]
-
Pietrangeli CE, Hayashi S-I, Kincade PW 1988 Stromal cell lines which support lymphocyte growth: characterization,
sensitivity to radiation and responsiveness to growth factors. Eur
J Immunol 18:863872[Medline]
-
Bellows CG, Aubin JE 1989 Determination of numbers
of osteoprogenitors present in isolated fetal rat calvaria cells
in vitro. Dev Biol 133:817[CrossRef][Medline]
-
Smithson G, Medina K, Ponting I, Kincade PW 1995 Estrogen suppresses stromal cell-dependent lymphopoiesis in culture.
J Immunol 155:34093417[Abstract]
-
Kurland JI, Kincade PW, Moore MAS 1977 Regulation
of B-lymphocyte clonal proliferation by stimulatory and inhibitory
macrophage-derived factors. J Exp Med 146:14201435[Abstract/Free Full Text]
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acid guanidium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162:156159[Medline]
-
Dorheim M-A, Sullivan M, Dandapani V, Wu X, Hudson J,
Segarini PR, Rosen DM, Aulthouse AL, Ginble JM 1993 Osteoblastic
gene expression during adipogenesis in hematopoietic supporting murine
bone marrow stromal cells. J Cell Physiol 154:317328[CrossRef][Medline]
-
Church G, Gilbert W 1984 Genomic sequencing. Proc
Natl Acad Sci USA 81:19911995[Abstract/Free Full Text]
-
Feinberg AP, Vogelstein B 1983 A technique for
radiolabeling DNA restriction endonuclease fragments to high specific
activity. Anal Biochem 132:613[CrossRef][Medline]
-
Cassady AI, King AG, Cross NCP, Hume DA 1993 Isolation and characterization of the genes encoding mouse and human
type-5 acid phosphatase. Gene 130:201207[CrossRef][Medline]
-
Smyth MJ, Wharton W 1992 Differentiation of A31T6
proadipocytes to adipocytes: a flow cytometric analysis. Exp Cell Res 199:2938[CrossRef][Medline]
-
Burstone MS 1958 Histochemical demonstration of
acid phosphatase with naphthol AS-phosphates. J Natl Cancer Inst 21:523540
-
Takahashi N, Yamana H, Yoshiki S, Roodman GD, Mundy GR,
Jones SJ, Boyde A, Suda T 1988 Osteoclast-like cell formation and
its regulation by osteotropic hormones in mouse bone marrow cultures.
Endocrinology 122:13731382[Abstract/Free Full Text]
-
Tanaka S, Takahashi N, Udagawa N, Tamura T, Akatsu T,
Stanley ER, Kurokawa T, Suda T 1993 Macrophage colony-stimulating
factor is indispensable for both proliferation and differentiation of
osteclast progenitors. J Clin Invest 91:257263
-
Stanley ER 1985 The macrophage colony-stimulating
factor, CSF-1. Methods Enzymol 116:564587[Medline]
-
Benayahu D, Peled A, Zipori D 1994 Myeloblastic
cell line expresses osteoclastic properties following coculture with
marrow stromal adipocytes. J Cell Biochem 56:374384[CrossRef][Medline]
-
Biskobing DM, Fan X, Rubin J 1995 Characterization
of MCSF-induced proliferation and subsequent osteoclast formation in
murine marrow culture. J Bone Miner Res 10:10251032[Medline]
-
Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO,
Willson TM, Kliewer SA 1996 An antidiabetic thiazolidinedione is a
high affinity ligand for peroxisome proliferator-activated receptor
(PPAR
). J Biol Chem 270:1295312956[Abstract/Free Full Text]
-
Deryugina EI, Muller-Sieburg CE 1993 Stromal cells
in long-term cultures: keys to the elucidation of hematopoietic
development? Crit Rev in Immunol 13:115150[Medline]
-
Antonioli Corboz V, Cecchini MG, Felix R, Fleisch H, Van
der Pluijm G, Lowik CWGM 1992 Effect of macophage
colony-stimulating factor on in vitro osteoclast generation
and bone resorption. Endocrinology 130:437442[Abstract/Free Full Text]
-
Harrington MA, Falkenburg JHF, Daub R, Broxmeyer HE 1990 Effect of myogenic and adipogenic differentiation on expression of
colony-stimulating factor genes. Mol Cell Biol 10:49484952[Abstract/Free Full Text]
-
Maffei M, Fei H, Lee GH, Dani C, Leroy P, Zhang Y 1995 Increased expression in adipocytes of ob RNA in mice
with lesions of the hypothalamus and with mutations at the
db locus. Proc Natl Acad Sci USA 92:69576960[Abstract/Free Full Text]
-
Zhang Y, Proneca R, Maffei M, Barone M, Leopold L,
Friedman JM 1994 Positional cloning of the mouse obese
gene and its human homologue. Nature 272:425432
-
Bennett BD, Solar GP, Yuan JQ, Mathias J, Thomas GR,
Matthews W 1996 A role for leptin and its cognate receptor in
hematopoiesis. Curr Biol 6:11701180[CrossRef][Medline]
-
Gainsford T, Willson TA, Metcalf D, Handman E, McFarlane
C, Ng A, Nicola NA, Alexander WS, Hilton DJ 1996 Leptin can induce
prolieration, differentiation, and functional activation of hemopoietic
cells. Proc Natl Acad Sci USA 93:1456414568[Abstract/Free Full Text]
-
Hill MR, Wu X, Sullivan M, King BO, Webb CF, Gimble
JM 1996 Expression of acute phase proteins by bone marrow stromal
cells. J Endotoxin Res 3:425433
-
Sato T, Abe E, Jin CH, Hong MH, Katagiri T, Kinoshita T,
Amizuka N, Ozawa H, Suda T 1993 The biological roles of the third
component in osteoclast formation. Endocrinology 133:397404[Abstract/Free Full Text]
-
Sato M, Hiragun A 1988 Demonstration of
1
,25-dihydroxyvitamin D3 receptor-like molecule in ST 13
and 3T3L1 preadipocytes and it inhibitory effects on preadipocyte
differentiation. J Cell Physiol 135:545550[CrossRef][Medline]
-
Shionome M, Shinski T, Takahashi N, Hasegawa K,
Suda T 1992 1
,25-Dihydroxyvitamin D3
modulation in lipid metabolism in established bone marrow-derived
stromal cells, MC3T3G2/PA6. J Cell Biochem 48:424430[CrossRef][Medline]
-
Kelly KA, Gimble JM 1,25-Dihydroxy vitamin
D3 inhibits adipocyte differentiation and gene expression
in murine bone marrow stromal cell clones and primary cultures.
Endocrinology, in press
This article has been cited by other articles:

|
 |

|
 |
 
S. Yang, W. Chen, P. Stashenko, and Y.-P. Li
Specificity of RGS10A as a key component in the RANKL signaling mechanism for osteoclast differentiation
J. Cell Sci.,
October 1, 2007;
120(19):
3362 - 3371.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Schwab, S. Granholm, E. Persson, B. Wilkes, U. H. Lerner, and H. H. Conaway
Stimulation of Resorption in Cultured Mouse Calvarial Bones by Thiazolidinediones
Endocrinology,
October 1, 2005;
146(10):
4349 - 4361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Manolagas
Birth and Death of Bone Cells: Basic Regulatory Mechanisms and Implications for the Pathogenesis and Treatment of Osteoporosis
Endocr. Rev.,
April 1, 2000;
21(2):
115 - 137.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. Okazaki, M. Toriumi, S. Fukumoto, M. Miyamoto, T. Fujita, K. Tanaka, and Y. Takeuchi
Thiazolidinediones Inhibit Osteoclast-Like Cell Formation and Bone Resorption in Vitro
Endocrinology,
November 1, 1999;
140(11):
5060 - 5065.
[Abstract]
[Full Text]
|
 |
|