help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelly, K. A.
Right arrow Articles by Gimble, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelly, K. A.
Right arrow Articles by Gimble, J. M.
Endocrinology Vol. 139, No. 4 2092-2101
Copyright © 1998 by The Endocrine Society


ARTICLES

Murine Bone Marrow Stromally Derived BMS2 Adipocytes Support Differentiation and Function of Osteoclast-Like Cells in Vitro1

Katherine A. Kelly2, Sakae Tanaka, Roland Baron and Jeffrey M. Gimble

Departments of Pathology (K.A.K., J.M.G.), Orthodontics (K.A.K.), and Surgery (J.M.G.), University of Oklahoma Health Science Center, Oklahoma City, Oklahoma 73109; Immunobiology and Cancer, Oklahoma Medical Research Foundation (K.A.K.), Oklahoma City, Oklahoma 73104; the Department of Orthopedic Surgery, University of Tokyo (S.T.), Tokyo 113, Japan; and the Department of Orthopedics and Cell Biology, Yale University School of Medicine (R.B.), New Haven, Connecticut 06510

Address all correspondence and requests for reprints to: Jeffrey M. Gimble, M.D., Ph.D., Department of Surgery, University of Oklahoma Health Sciences Center, P.O. Box 26901, Oklahoma City, Oklahoma 73190. E-mail: jeffrey-gimble{at}ouhsc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stromal cells are required for in vitro osteoclast differentiation and maturation. The murine bone marrow stromally derived BMS2 cell line exhibits adipocytic and osteoblastic features as well as the ability to support lymphopoiesis and myelopoiesis. This work examined the ability of the BMS2 cell in either the preadipocyte or adipocyte state to support the formation of osteoclast-like cells. BMS2 cells can be induced to undergo adipogenic differentiation in response to treatment with glucocorticoids or thiazolidinedione compounds. Primary bone marrow cells, enriched for hematopoietic progenitors and depleted of their adherent stromal and macrophage populations, were stimulated with vitamin D3 (vitamin D; 10-8 M) to undergo osteoclast differentiation and maturation when cocultured with BMS2 cells. In both preadipocyte and adipocyte-enriched BMS2 stromal layers, comparable numbers of tartrate-resistant acid phosphatase-positive osteoclast-like cells, characterized by their response to salmon calcitonin with an increase in cAMP and formation of resorption pits on bovine bone slices, were formed. The gene expression and protein levels of macrophage colony-stimulating factor produced by preadipocyte and adipocyte-rich BMS2 layers were comparable. However, adipocyte-rich stromal layers supported osteoclast-like cell formation longer in culture than preadipocytes, independent of the agent used to induce adipocyte differentiation. These studies demonstrate for the first time that fully differentiated adipocyte stromal cells can support osteoclast-like cell formation and function in vitro.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE ADIPOCYTES, osteoblasts, and hematopoietic supporting cells within the bone marrow derive from a single multipotent stromal progenitor (1). The functions of the osteoblast and hematopoietic supporting cells in this microenvironment are not controversial. However, the role of the adipocyte remains unclear. Some investigators suggest that adipocytes serve only in a passive role, occupying space no longer required for hematopoietic or osteogenic function (1, 2, 3, 4). Alternatively, it has been hypothesized that the bone marrow adipocyte is an active participant in hematopoietic and osteogenic events (1, 2, 3, 4, 5, 6, 7).

Stromal cells create the microenvironment required for hematopoiesis, producing the soluble and membrane-associated proteins and cytokines necessary for the growth and differentiation of osteoclasts and other blood cells (1, 3, 5, 7, 8). Among these, macrophage colony-stimulating factor (M-CSF) is one of the most important (9), as documented by the osteopetrotic (op/op) mouse model (9, 10, 11). The M-CSF gene in these animals is mutated, resulting in a nonfunctional protein and an inability of the stroma to support osteoclastogenesis (12). Stromal cell production of M-CSF can be increased by exposure to vitamin D (13), a hormone that promotes osteoclast progenitor formation (14, 15). In contrast, it has been reported that stromal cell adipogenesis is accompanied by reduced expression of M-CSF; this observation, however, is limited to a single cell line (16, 17). It is of interest that many of the stromal cell lines used to study osteoclast formation and function in vitro are of the undifferentiated stromal phenotype (8, 18, 19). The ability of stromal cells to continue to support osteoclastogenesis after undergoing adipocyte differentiation remains unexplored.

The murine bone marrow-derived cell line BMS2 is a reproducible in vitro model of a multipotent stromal stem cell (1, 20). In addition to exhibiting osteoblastic features, these cells are able to support lymphopoiesis and myelopoiesis in vitro (20, 21). Moreover, after exposure to glucocorticoids or thiazolidinediones, BMS2 cells undergo adipocyte differentiation (20, 22). The current work uses the BMS2 model to examine the ability of adipocyte-rich stromal cell layers to support osteoclast formation and function in vitro. The data show that in the presence of vitamin D, committed adipocytes create a microenvironment in which hematopoietic stem cells can differentiate into osteoclast-like cells, i.e. multinucleated, tartrate-resistant acid phosphatase (TRAP)-positive (TRAP+) cells that respond to calcitonin and are capable of resorbing bone.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
All reagents were obtained from Sigma Chemical Co. (St. Louis, MO) and Fisher Scientific (Dallas, TX) unless otherwise noted.

Cell culture
BMS2, a murine bone marrow stromal cell line (23), was originally obtained from Drs. C. Pietrangeli and P. W. Kincade (Immunology and Cancer, Oklahoma Medical Research Foundation) and maintained in modified DMEM (high glucose) supplemented with 10% (vol/vol) FBS (defined; HyClone, Logan, UT), 1 mM sodium pyruvate, 100 U penicillin/ml, 100 µg/ml streptomycin/ml, and 50 µM ß-mercaptoethanol (referred to as supplemented DMEM) at 37 C in 7% CO2. The BMS2 cells were passaged every 7 days.

BMS2 subclones were developed from the parental stromal cell line by limiting dilution cloning (24). Subclones were passaged and originally characterized based on the ability to form fat in response to hydrocortisone, methylisobutylxanthine (MIBX), and indomethacin as detected by flow cytometry (below). Subclones were maintained in the same manner as the parental BMS2 cells.

OP42, a murine splenic stromal cell line derived from osteopetrotic (op/op) mice by K. Medina and P. W. Kincade (Immunobiology and Cancer, Oklahoma Medical Research Foundation), was maintained in the same manner as BMS2 cells (25).

Primary nonadherent bone marrow cells
Female BALB/c mice were obtained from the breeding colony housed at the Laboratory Animal Resource Center of the Oklahoma Medical Research Foundation. At 6 weeks of age, mice were killed by carbon dioxide asphyxiation according to protocols approved by the institutional animal care and use committee. Femora and tibiae were harvested, and the whole bone marrow was flushed using supplemented DMEM in a 10-cc syringe and a 25-gauge needle. Suspended whole bone marrow was then eluted over a Sephadex G-10 (Pharmacia Biotech, Uppsala, Sweden) column to remove the adherent stromal population (26). The nonadherent hematopoietic precursor cells were collected in the eluant and washed, and the number of nucleated cells was counted after treatment with 0.3% acetic acid and trypan blue.

Adipogenic BMS2/nonadherent bone marrow cell cocultures were performed by growing stromal cells at a density of 1 x 104 cells/1.77 cm2 in 24-well plates (Costar, Corning, NY) with supplemented DMEM for 3 days. After 3 days in culture, adipogenic agents and/or 1{alpha},25-dihydroxyvitamin D3 (VD) were added to appropriate cultures from experimental days 3–6. The MHI cocktail consisted of 0.5 mM methylisobutylxanthine, 0.5 µM hydrocortisone, and 60 µM indomethacin. The thiazolidinediones BRL49653 and pioglitazone were diluted in dimethylsulfoxide and added in final concentrations of 5 and 25 µM, respectively (final concentrations of dimethylsulfoxide, <0.1%, vol/vol) in fresh supplemented DMEM. These compounds were supplied by Dr. D. Morris, GlaxoWellcome (Research Triangle Park, NC). On the sixth day of culture, primary nonadherent bone marrow cells (2 x 105 cells/1.77 cm2) were added to the stromal cells in fresh supplemented DMEM in the presence or absence of VD (10-8 M; provided by Dr. M. Uskokovic, Hoffmann-La Roche, Nutley, NJ). Cocultures were subsequently fed every 3 days by replacing the supplemented DMEM. The vitamin D concentrations were maintained throughout the course of the experiment. The total volume per well of the 24-well plate was maintained at 0.5 ml, and cultures were maintained at 37 C in 7% CO2 humidified air. (see Fig. 1Go) Cultures were harvested for TRAP staining, total RNA, total protein extracts, Nile red staining, and fluorescence-activated cell sorting (FACS) analysis.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Experimental design. Conditions for the coculture experiments are outlined. Individual wells on a 24-well plate were seeded with stromal cells on day 0 and nonadherent hematopoietic cells (G-10 cells) on day 6 in all studies. When present, cultures were exposed to MHI on day 3 and to VD on day 3 or 6. Once added, VD was maintained in the culture medium until the completion of the experiment.

 
BMS2:OP42/nonadherent bone marrow cell cocultures were performed with a constant number of stromal cells (total stromal cells kept constant at 104/1.77 cm2), but with varying proportions of BMS2 and OP42 cells. Stromal cells were plated 3 days before Sephadex G-10-passaged whole bone marrow cells were added (2.5 x 105/1.77 cm2) in the absence or presence of vitamin D and fed by replacing the supplemented DMEM every 3 days. When present, the vitamin D concentration was maintained at 10-8 M throughout the experiment.

RNA analysis
Cocultures were harvested for RNA following the modified method of Chomczynski and Sacchi (27), as previously described (28). Northern blots were run with approximately 10 µg total RNA/lane in a formaldehyde agarose gel, transferred to a MSI-NT nylon membrane (MSI, Westboro, MA), and UV cross-linked for 5 min with a UV transilluminator (UVP, San Gabriel, CA). Northern blots were prehybridized and hybridized with complementary DNA (cDNA) probes in 500 mM sodium phosphate (pH 7.2), 7% SDS, and 1 mM EDTA at 55 C overnight (29). cDNA probes were labeled by the random primer method, using [{alpha}-32P]deoxy-CTP (ICN, Irvine, CA) (30). After hybridization, blots were washed four times for 20 min each time in 40 mM NaHPO4 (pH 7.2), 1% SDS, and 1 mM EDTA at maximum stringency at 55 C, then exposed to autoradiographic film (Eastman Kodak, Rochester, NY) for 1–7 days at -70 C with an enhancing screen. The following cDNA probes were used; human interleukin-6 (637 bp; provided by Steve Clark, Genetics Institute, Cambridge, MA), TRAP (see below), murine M-CSF [3.9-kilobase (kb) insert; pGEM2MCSF10; culture collection no. CMCC 2760, Cetus Corp., Emeryville, CA], murine lipoprotein lipase (711 bp) (21), and actin (provided by B. Spiegelman, Dana Farber, Boston, MA).

Cloning of the TRAP cDNA
A murine-specific probe was cloned based on exons within the TRAP genomic DNA sequence (31). The following oligonucleotide primers were synthesized: -8 to +18 bp, ATTTGAGCTCGTGGTGTTCAGGGTCT; and 3044–3019, ATTTGAGCTCACAGATGGATTCATGGGTGGTG. PCRs were performed for 40 cycles at 94 C for 1 min, at 68 C for 2 min, and at 72 C for 4 min. The 1-kb TRAP PCR fragment was subcloned into the Bluescript SKII vector (Stratagene, San Diego, CA), and its identity was confirmed by dideoxy sequencing. The 1-kb SacI insert was used as a radiolabeled probe.

FACS
Cultures were resuspended in 0.25% trypsin-1 mM EDTA (Life Technologies, Grand Island, NY) and fixed with 0.35% (vol/vol) paraformaldehyde. Neutral lipids of adipocytes were stained by adding 88 ng/ml Nile red to the cell suspension, and the gold fluorescent emission was detected between 564–604 nm with a bandpass filter using a FACScan (Becton Dickinson, San Jose, CA) (28, 32).

TRAP staining
Cocultures were fixed with 0.5 ml 3.7% (vol/vol) formaldehyde in phosphate buffer solution for 5 min, dried for 30 sec with acetone-ethanol (50:50, vol/vol), and stained for 10 min with 10 mM sodium tartrate, 40 mM sodium acetate (pH 5.0), 0.1 mg/ml naphthol AS-MS phosphate (Sigma N-5000), and 0.6 mg/ml fast red violet LB salt (Sigma F-3381) (33, 34, 35). Stained cultures were rinsed in distilled water and stored under 50% glycerin. The numbers of TRAP+ cells with one to two or three or more nuclei were enumerated under light microscopy across the diameter of each well by an unbiased observer, unaware of the culture conditions under evaluation.

Western blot analysis
Conditioned medium or total cellular proteins were denatured in boiling lysis buffer (1% SDS-10 mM Tris), subjected to SDS-PAGE under reducing conditions, transferred to nitrocellulose membrane (Fisher Scientific, Pittsburgh, PA), and incubated with goat anti-CSF antibody at a final dilution of 1:10,000 (provided by Dr. E. R. Stanley, Department of Microbiology and Immunology, College of Medicine, Albert Einstein University, New York, NY) (36). Antibody-protein complexes were visualized with a horseradish peroxidase-coupled rabbit antigoat IgG and chemiluminescent reagents (ECL Western blotting detection reagents, Amersham International, Aylesbury, UK) using autoradiography (X-Omat film, Eastman Kodak, Rochester, NY).

Calcitonin receptor/cAMP assay
To measure the presence of calcitonin receptors expressed by TRAP+ cells, cocultures were grown as described above. On experimental day 12, culture medium was replaced with DMEM, 0.1% (vol/vol) BSA, and 1 mM MIBX for 15 min at 37 C. This medium was then replaced with DMEM, 0.1% BSA, 1 mM MIBX, and salmon calcitonin (10-8 M) (Sigma T-3660) for 10 min at 37 C. To harvest cAMP, assay medium was replaced with ice-cold 95% (vol/vol) ethanol, and the cultures were maintained at 4 C for 2 h. The ethanol extraction medium was transferred to a glass tube, and the culture plate was rinsed with ethanol-3 mM HCl and pooled with the ethanol extraction medium. The glass tubes were boiled until the ethanol extraction medium evaporated, and the contents were resuspended in 500 µl assay buffer (Biotrak cAMP enzyme immunoassay system, Amersham International). An enzyme-linked immunosorbent assay was performed using a 96-well assay plate that was coated with donkey antirabbit antibody, followed by rabbit anti-cAMP reagent and incubated with peroxidase-labeled cAMP standards or 100 µl of each diluted sample, according to the manufacturer’s instructions. Tetramethylbenzidine substrate was then added to the assay plate and incubated for 30 min before the reaction was stopped with 1 M sulfuric acid. The optical density was read at 450 nm on a microtiter plate reader (Microplate Reader MR600, Dynatech, Chantilly, VA). The amount of cAMP in each sample was calculated based on the standard curve of cAMP standards.

Resorption pit formation
Bovine bone slices were prepared from the cortical bone of femurs obtained from Mikkelson Beef (Oklahoma City, OK). Femurs were cut, and final bone slices were prepared to dimensions of approximately 0.5 cm2 and less than 0.5 mm thick. Bone slices were stored in 95% ethanol overnight, then rinsed and stored in sterile distilled water. Cocultures were grown as described above in the presence or absence of 10-8 M vitamin D, with the addition of the bone slice on day 0. At the end of culture (experimental day 12), the bone slices were removed and rinsed in 0.1% sodium hypochlorite solution to remove adherent cells. Bone slices were sputter coated with gold-palladium, and resorption pits were visualized on a scanning electron microscope (model JEOLJSM-880, JEOL, Peabody, MA). Scanning electron microscopy was performed at the Sam Noble Electron Microscopy Facility, University of Oklahoma (Norman, OK) with the assistance of Mr. William Chissoe III. Photographs were taken at x200 and x500 magnification.

Statistics
Data were analyzed using one- or two-way ANOVA and Student’s t test (Sigma Stat, Jandel Scientific, San Rafael, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preadipocyte cocultures
The initial experiments were designed to determine whether bone marrow-derived BMS2 preadipocytes are capable of supporting osteoclast differentiation in vitro. In the presence of vitamin D and BMS2 preadipocytes, TRAP+ cells formed after 6 days of coculture (Fig. 2Go). To determine whether the number of TRAP+ cells formed was proportionate to the number of BMS2 cells, OP42 stromal cells from the osteopetrotic op/op mouse were mixed with the BMS2 cells in coculture. The op/op stromal cells produce defective M-CSF protein, resulting in a failure to support osteoclast differentiation (12). In the experiments described in Fig. 2Go, the total number of stromal cells was kept constant (1 x 104 cells/1.77 cm2) while the percentages of BMS2 and OP42 were varied in a reciprocal manner (0–100%). A constant number of primary nonadherent bone marrow cells (2 x 105 cells/1.77 cm2) were added to the established stromal layer in the presence of vitamin D. TRAP+ cell numbers are expressed as a percentage relative to the number of TRAP+ cells formed in cultures composed of 100% BMS2 stromal cells in the presence of vitamin D (131 ± 22.6 cells with one or two nuclei and 196.3 ± 18.5 cells with three or more nuclei). No TRAP+ cells were observed in the absence of vitamin D. However, as the total percentage of BMS2 preadipocytes was decreased in the presence of vitamin D, the total number of TRAP+ cells also decreased in a parallel manner. This suggests that OP42 stromal cells did not release potent inhibitors of BMS2-supported TRAP+ cell formation. As expected, with only OP42 cells as support, no TRAP+ cells formed in the presence of vitamin D.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. BMS2:OP42 osteoclast coculture: TRAP analysis. The total number of stromal cells plated remained constant, with the percentage of BMS2 stromal cells decreasing from 100% to 0%, and the percentage of OP42 stromal cells increasing from 0% to 100%. Three days later, Sephadex G-10-passaged primary bone marrow cells were added to the stromal cell cultures in the presence of vitamin D3 (10-8 M). On experimental day 9, cocultures were fixed and stained for TRAP. The number of TRAP+ cells is expressed as a percentage of those in the cultures with 100% BMS2 support cells and reflect three experiments performed in quadruplicate.

 
The formation of TRAP+ cells is supported by adipocytes
Although it is established that uncommitted stromal cells and osteoblasts support osteoclastogenesis in vitro, it is not known whether fully differentiated adipocytes retain this capacity (18, 19, 37, 38). The next series of experiments asked whether BMS2 adipocytes continue to support TRAP+ cell differentiation in a manner equivalent to preadipocyte BMS2 cells. Initial studies quantified BMS2 adipogenesis by FACS analysis under the different culture conditions in the absence of nonadherent hematopoietic cells. No significant number of adipocytes formed in the absence of MHI cocktail (control, 0.7%; VD day 3, 1.5%; VD day 6, 3.0%) or with the concurrent addition of vitamin D with MHI (MHI + VD day 3; 1.4%). Adipocytes formed in the presence of MHI cocktail alone (MHI; 53.7%) and in the presence of MHI cocktail when vitamin D addition was delayed until experimental day 6 (MHI + VD day 6; 57.1%).

Next, the number of TRAP+ cells was determined in cocultures established under these same conditions (Fig. 3Go). No TRAP+ cells formed in the absence of vitamin D, independent of the presence of MHI induction (data not shown). Time-course studies determined that TRAP+ cell numbers reached maximal values (one or two nuclei per cell, 140–180; three or more nuclei, 40–140) on experimental day 12 (6 days in coculture) for all vitamin D-treated cocultures (Fig. 3AGo). The numbers of both one or two and more than three nucleated TRAP+ cells were significantly increased at later time points (days 18–24) in cultures containing adipocyte stromal layers (MHI + VD day 6) relative to those in preadipocyte stromal layers (VD day 3, MHI + VD day 3, and VD day 6). Photomicrographs of representative cultures stained for TRAP on day 12 are shown in Fig. 3BGo.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Parental BMS2-adipogenic coculture: TRAP time course. Stromal cells were plated on day 0, treated with adipogenic agents on day 3 in the presence or absence of VD, Sephadex G-10-passaged cells were added on day 6 in the presence or absence of VD, and cultures were stained for TRAP every 3 days. A, The numbers of one or two nuclei and three or more nuclei cells reported reflect data from three experiments performed in quadruplicate. The asterisks indicate P < 0.05 (*), P < 0.01 (**), and P < 0.001 (***) relative to the number of TRAP+ cells under the VD day 3 culture conditions. B, The photographs of the cocultures shown were taken on experimental day 12.

 
In time-course studies analyzed by FACS, we found that concurrent addition of vitamin D and the MHI cocktail on day 3 significantly reduced adipogenic differentiation by the BMS2 cells under coculture conditions (Fig. 4Go). In contrast, delayed addition of vitamin D until day 6 had no effect on adipogenesis, resulting in 58.9% adipocytes, similar to the MHI alone control (52.9%). Together, these data (Figs. 3Go and 4Go) indicate that bone marrow adipocytes support vitamin D-dependent TRAP+ cells as well as or better than fibroblast-like preadipocytes.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Parental BMS2-adipogenic coculture: FACS analysis. Adipogenic cultures were grown as described in Materials and Methods, fixed with paraformaldehyde, and stained with Nile red for FACS analysis. The number of adipocytes is expressed as a percentage of the total stromal cell population. Data reflect three experiments performed in quadruplicate.

 
M-CSF production in cocultures
M-CSF is a key cytokine in osteoclast formation. In some stromal lines, M-CSF levels have been reported to decrease with adipocyte differentiation (17). To examine changes in M-CSF expression that might occur with BMS2 adipogenesis, Northern and Western blot analyses were performed on adipogenic cocultures. M-CSF messenger RNA (mRNA) was expressed at comparable levels under all treatment conditions (Fig. 5AGo). cDNA probes to mouse TRAP gene and lipoprotein lipase (LPL) were also used to probe the coculture Northern blots. TRAP mRNA was only detected in vitamin D cocultures and correlated directly with the TRAP stain data. LPL gene expression, an early marker for adipogenesis, increased with MHI and MHI + VD day 6 treatments and correlated with the Nile red/FACS data. Northern blots were probed with a cDNA probe for actin to control for RNA loading.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 5. A, Parental BMS2-adipogenic coculture: Northern blot analysis. Total RNA was harvested from cocultures on experimental day 12 and made into Northern blots that were probed with the following cDNA probes: M-CSF, TRAP, LPL, and actin. B, Parental BMS2-adipogenic coculture: Western blot analysis. Cocultures were grown as described in Materials and Methods, and on experimental day 12, conditioned medium and total cell lysates were harvested and run on Western blot under reducing conditions. Antibodies to M-CSF (goat anti-CSF) and horseradish peroxidase-coupled rabbit antigoat IgG were used to visualize the antibody-protein complexes with chemiluminescent agents.

 
The effects of vitamin D and adipogenesis on M-CSF immunoreactive protein levels were examined on experimental days 9 and 12. Western blot analysis of cell lysate under reducing conditions showed relatively constant amounts of cell-associated M-CSF (Fig. 5BGo, bottom). Levels of secreted M-CSF decreased slightly with MHI treatment on both days 9 and 12. However, these minor changes were not accompanied by reduced TRAP+ cell numbers.

Effects of thiazolidinedione BRL on coculture
Stromal cell adipogenesis can be induced by alternative agents. Although the MHI cocktail uses the glucocorticoid receptor in its mechanism, the thiazolidinedione drugs act through the peroxisome proliferator-activated receptor, another steroid receptor-like transcription factor (39). To determine whether the type of adipogenic agent influenced the support of TRAP+ cells, BMS2 cells were treated with either MHI cocktail or BRL (5 µM) in the presence or absence of vitamin D (Table 1Go), as outlined in Fig. 1Go. TRAP+ cells formed in the presence of BRL-induced adipocytes in a similar pattern as that in MHI cocktail-induced adipogenic cocultures. This suggests that stromal adipocytes, independent of the mechanism leading to this common morphological phenotype, support osteoclastogenesis in a similar manner.


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of thiazolidinedione BRL on parental BMS2 coculture TRAP analysis

 
Osteoclast support by BMS2 subclone 24
The parental BMS2 cell achieved a maximum of 58% adipocytes in culture. Further experiments were performed with stromal cultures that achieved nearly confluent adipocyte layers. A subclone of the parental BMS2 line, subclone 24, was found to undergo over 80% adipogenesis in response to the MHI cocktail. The TRAP+ support function of subclone 24 was evaluated in coculture experiments. The temporal kinetics of support by adipogenic subclone 24 cocultures paralleled those observed in the parental BMS2 cell line (Fig. 6Go). In the presence of salmon calcitonin, the vitamin D-induced cocultures produced cAMP, consistent with the presence of calcitonin receptors on the surface of the TRAP+ cells (Fig. 7Go). Moreover, resorption pits were detected by electron microscopy on bovine bone slices in cocultures exhibiting TRAP+ cells (Fig. 8Go). In the absence of vitamin D, neither calcitonin-dependent cAMP production nor bone resorption pits were observed.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. BMS2 subclone 24-adipogenic coculture: TRAP time course. Adipogenic cocultures were grown as described in Materials and Methods with BMS2 subclone 24 as supporting stromal cells. Cultures were fixed and stained for TRAP every 3 days (days 12–24). The number of one or two or three or more nuclei TRAP+ cells reflect data from three experiments performed in quadruplicate.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. BMS2 subclone 24-adipogenic coculture: calcitonin receptor/cAMP analysis. Adipogenic cocultures were grown as described and on experimental day 12 were assayed for cAMP production in response to addition of salmon calcitonin (10-8 M). Salmon calcitonin was suspended in medium supplemented with 0.1% BSA and 1 mM MIBX for 10 min at 37 C. cAMP was recovered using 3 mM HCl in 95% ethanol at 4 C for 2 h and analyzed using the Amersham cAMP enzyme immunoassay system. Data are reported as cAMP measured per culture well of a 24-well plate. Asterisks indicate P <= 0.0001.

 


View larger version (87K):
[in this window]
[in a new window]
 
Figure 8. BMS2 subclone 24 coculture: resorption pits. Cocultures were grown in the presence or absence of vitamin D3 in the presence of bovine femoral bone slices. Bone slices were sputter coated with gold-palladium, visualized on an electron microscope, and photographed at x200 and x500 magnification.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It has been shown that myeloid precursor cells require the presence of stromal cells to undergo osteoclastogenesis (19). Of the stromal cell lines reported, many are preadipocytes in phenotype (19) and in the fibroblast-like state have been shown to support attachment and long term survival of myeloid cells (21, 37, 40). In addition to being a model for stromal cell adipogenesis and osteoblastogenesis, the BMS2 preadipocyte line can support lymphopoiesis and myelopoiesis (20, 21, 23). We now show that in the presence of vitamin D, BMS2-derived preadipocytes and adipocytes support multinucleated TRAP+ cells. These TRAP+ cells meet the criteria expected of osteoclasts, displaying functional calcitonin receptors and bone-resorbing capability.

M-CSF is essential for osteoclast differentiation (36). Proliferation of osteoclast precursors is dependent on M-CSF, but fusion events (38) and the bone-resorbing functions of mature osteoclasts (41) are not. In the osteopetrotic (op/op) mouse, a point mutation in the coding region of the CSF-1 gene results in the absence of functional M-CSF proteins (12). Consistent with this, we found that OP42 stromal cells, derived from the op/op mouse, failed to support osteoclastogenesis. However, in stromal cultures also containing BMS2 cells, we observed that OP42 cells did not release any active inhibitors of osteoclastogenesis.

The effect of adipocyte differentiation on M-CSF has not been clearly defined. With adipogenesis, constitutive expression of M-CSF decreases in H-1/A cells (17). In another cell line, CH310T1/2, there is no change in the rate of M-CSF mRNA expression with adipogenesis (42). In the current work, the BMS2 cell did not significantly alter its M-CSF expression with adipocyte differentiation. Indeed, BMS2 adipocytes supported TRAP+ cell numbers longer than their fibroblast-like counterparts. This may reflect their release of adipocyte-specific factors into the medium or within the extracellular matrix.

Adipocytes express a number of proteins that may contribute to the support of osteoclast-like cells. One example is the hormone leptin, which is uniquely expressed by adipocytes (43, 44). Recent studies have reported the presence of leptin receptors on hematopoietic stem cells and, in particular, on myeloid progenitors (45, 46). Leptin has been observed to bind the long form of its receptor, inducing proliferation of hematopoietic stem cells and differentiation and functional activation of macrophages (46). The leptin receptor is homologous to the interleukin-6 receptor and uses the Janus kinase/STAT (signal transducer and activator upon transcription) signal transduction pathway (46). As the interleukin-6 cytokine family has been implicated to play an important role in osteoclastogenesis, leptin may also have this capability. A second example is complement component C3, an acute phase protein that is induced during bone marrow stromal cell adipogenesis (47). Previous studies have identified soluble C3 as a bone marrow factor that enhances osteoclastogenesis in vitro and in vivo (48). In addition, adipocytes may release lipid-derived products, such as FFAs, PGs, or steroid compounds, that influence osteoclast differentiation.

Our studies determined that vitamin D inhibited adipogenesis in BMS2-derived cell lines after exposure to MHI. Sato and others have reported similar findings (49, 50). A more detailed description of this phenomenon will be the subject of a separate manuscript (51).

In summary, murine osteoclasts require the support of stromal cells during differentiation in the absence of exogenous cytokines. The current studies demonstrate that adipocytes can supply the essential stromally derived soluble and cell surface factors necessary for osteoclast differentiation and function in vitro. The period of TRAP+ multinucleated cell detection is extended in the presence of adipocytes compared with that in preadipocyte stromal cells. Indeed, the adipocyte may contribute unique factors to the hematopoietic microenvironment. Studies are underway using the BMS2 coculture model to further investigate this area.


    Acknowledgments
 
We thank P. W. Kincade, L. Thompson, M. R. Hill, N. L. Nadon, and C. Webb for helpful discussions; B. R. Rodriguez for technical assistance; and P. Anderson, J. Young, and J. Mowdy of OASIS for editorial and photographic assistance.


    Footnotes
 
1 This work was supported in part by NIDR Grant K15DE360 (to K.A.K.), NIH Grant DE-04724 (to R.B.), and NIH Grant CA-50898 (to J.M.G.) as well as the resources of the Oklahoma Medical Research Foundation. Back

2 This work was completed by K.A.K. in partial fulfillment of doctoral dissertation requirements for the Department of Pathology, University of Oklahoma Health Sciences Center. Back

Received October 21, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gimble JM, Robinson CE, Wu X, Kelly KA 1996 The function of adipocytes in the bone marrow stroma: an update. Bone 19:421–428[Medline]
  2. Beresford JN, Bennet JH, Devlin C, Leboy PS, Owen ME 1992 Evidence for an inverse relationship between the differentiation of adipocytic and osteoblastic cells in rat marrow stromal cell cultures. J Cell Sci 102:341–351[Abstract/Free Full Text]
  3. Tavassoli M 1984 Marrow adipose cells and hemopoiesis: an interpretative review. Exp Hematol 12:139–146[Medline]
  4. Tavassoli M 1989 Fatty involution of marrow and the role of adipose tissue in hemopoiesis. In: Tavassoli M (ed) Handbook of the Hemaopoietic Microenvironment. Humana Press, Clifton, pp 157–187
  5. Tavassoli M, Crosby WH 1970 Bone marrow histogenesis: a comparison of fatty and red marrow. Science 169:291–293[Abstract/Free Full Text]
  6. Tavassoli M, Maniatis A, Crosby WH 1974 Induction of sustained hemopoiesis in fatty marrow. Blood 43:33–38[Abstract/Free Full Text]
  7. Gimble JM 1990 The function of adipocytes in the bone marrow stroma. New Biol 2:304–312[Medline]
  8. Kodama H, Iizuka M, Tomiyama T, Yoshida K, Seki M, Suda T, Nishikawa S 1991 Response of newly established mouse myeloid leukemic cell lines t MC3T3–G2/PA6 preadipocytes and hematopoietic factors. Blood 77:49–54[Abstract/Free Full Text]
  9. Kodama H, Nose M, Niida S, Yamasaki A 1991 Essential role of macrophage colony-stimulating factor in the osteoclast differentiation supported by stromal cells. J Exp Med 173:1291–1294[Abstract/Free Full Text]
  10. Felix R, Cecchini MG, Hofstetter W, Elford PR, Stutzer A, Fleisch H 1990 Impairment of macrophage-stimulating factor production and lack of resident bone marrow macrophages in the osteopetrotic op/op mouse. J Bone Miner Res 5:781–789[Medline]
  11. Niato M, Hayashi S-I, Yoshida H, Nishikawa S-I, Shultz LD, Takahashi K 1991 Abnormal differentiation of tissue macrophage populations in "osteopetrosis" (op) mice defective in the production of macrophage colony-stimulating factor. Am J Pathol 139:657–667[Abstract]
  12. Yoshida H, Hayashi SI, Kunisada T, Ogawa M, Nishikawa S, Okamura H, Sudo T, Shultz LD, Nishikawa SI 1990 The murine mutation osteopetrosis is in the coding region of the macrophage colony-stimulating factor gene. Nature 345:442–444[CrossRef][Medline]
  13. Weir EC, Horowitz MC, Baron R, Centrella M, Kacinski BM, Insogna KL 1993 Macrophage colony-stimulating factor release and receptor expression in bone cells. J Bone Miner Res 8:1507–1518[Medline]
  14. Perkins SL, Kling SJ 1995 Local concentrations of macrophage colony-stimulating factor medicate osteoclast differentiation. Am J Physiol 268:E1024–E1030
  15. Perkins SL, Kling SJ, Ross FP, Teitelbaum TL 1995 1,25-Dihydroxyvitamin D3 stimulates differentiation of committed murine bone marrow-derived macrophage precursor cells. Endocrinology 136:5643–5650[Abstract]
  16. Nakamura M, Harigaya K, Watanabe Y 1985 Correlation between production of colony-stimulating activity (CSA) and adipose conversion in a murine marrow-derived preadipocyte line (H-1/A)1 (42097). Proc Soc Exp Biol Med 179:283–287[CrossRef][Medline]
  17. Umezawa A, Tachibana K, Harigaya K, Kusakari S, Kato S, Watanabe Y, Takano T 1991 Colony stimulating factor 1 expression is down regulated during adipocyte differentiation of H-1/A marrow stromal cells and induced by cachectin/tumor necrosis factor. Mol Cell Biol 11:920–927[Abstract/Free Full Text]
  18. Udagawa N, Takahashi N, Akatsu T, Sasaki T, Yamaguchi A, Kodama H, Martin TJ, Suda T 1989 The bone marrow-derived stromal cell lines MC3T3-Gw/PA6 and ST2 support osteoclast-like cell differentiation in cocultures with mouse spleen cells. Endocrinology 125:1805–1813[Abstract/Free Full Text]
  19. Udagawa N, Takahashi N, Akatsu T, Tanaka H, Sasaki T, Nishimhara T, Koga T, Martin TJ, Suda T 1990 Origin of osteoclasts: mature monocytes and macrophages are capable of differentiating in to osteoclasts under a suitable microenvironment prepared by bone marrow-derived stromal cells. Proc Natl Acad Sci USA 87:7260–7264[Abstract/Free Full Text]
  20. Gimble JM, Dorheim MA, Cheng Q, Medina K, Jones R, Koren E, Peitrangeli C, Kincade PW 1990 Adipogenesis in a murine bone marrow stromal cell line capable of supporting B lineage lymphocyte growth and proliferation: biochemical and molecular characterization. Eur J Immunol 20:379–387[Medline]
  21. Gimble JM, Youkhana K, Hua X, Bass H, Medina K, Sullivan M, Greenberger J, Wang C-S 1992 Adipogenesis in a myeloid supporting bone marrow stromal cell line. J Cell Biochem 50:78–82[CrossRef]
  22. Gimble JM, Robinson CE, Wu X, Kelly KA, Rodriquez BR, Kliewer SA, Lehmann JM, Morris DC 1996 Peroxisome proliferator-activated receptor {gamma} activation by thiazolidinediones induces adipogenesis in bone marrow stromal cells. Mol Pharmacol 50:1087–1094[Abstract]
  23. Pietrangeli CE, Hayashi S-I, Kincade PW 1988 Stromal cell lines which support lymphocyte growth: characterization, sensitivity to radiation and responsiveness to growth factors. Eur J Immunol 18:863–872[Medline]
  24. Bellows CG, Aubin JE 1989 Determination of numbers of osteoprogenitors present in isolated fetal rat calvaria cells in vitro. Dev Biol 133:8–17[CrossRef][Medline]
  25. Smithson G, Medina K, Ponting I, Kincade PW 1995 Estrogen suppresses stromal cell-dependent lymphopoiesis in culture. J Immunol 155:3409–3417[Abstract]
  26. Kurland JI, Kincade PW, Moore MAS 1977 Regulation of B-lymphocyte clonal proliferation by stimulatory and inhibitory macrophage-derived factors. J Exp Med 146:1420–1435[Abstract/Free Full Text]
  27. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  28. Dorheim M-A, Sullivan M, Dandapani V, Wu X, Hudson J, Segarini PR, Rosen DM, Aulthouse AL, Ginble JM 1993 Osteoblastic gene expression during adipogenesis in hematopoietic supporting murine bone marrow stromal cells. J Cell Physiol 154:317–328[CrossRef][Medline]
  29. Church G, Gilbert W 1984 Genomic sequencing. Proc Natl Acad Sci USA 81:1991–1995[Abstract/Free Full Text]
  30. Feinberg AP, Vogelstein B 1983 A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6–13[CrossRef][Medline]
  31. Cassady AI, King AG, Cross NCP, Hume DA 1993 Isolation and characterization of the genes encoding mouse and human type-5 acid phosphatase. Gene 130:201–207[CrossRef][Medline]
  32. Smyth MJ, Wharton W 1992 Differentiation of A31T6 proadipocytes to adipocytes: a flow cytometric analysis. Exp Cell Res 199:29–38[CrossRef][Medline]
  33. Burstone MS 1958 Histochemical demonstration of acid phosphatase with naphthol AS-phosphates. J Natl Cancer Inst 21:523–540
  34. Takahashi N, Yamana H, Yoshiki S, Roodman GD, Mundy GR, Jones SJ, Boyde A, Suda T 1988 Osteoclast-like cell formation and its regulation by osteotropic hormones in mouse bone marrow cultures. Endocrinology 122:1373–1382[Abstract/Free Full Text]
  35. Tanaka S, Takahashi N, Udagawa N, Tamura T, Akatsu T, Stanley ER, Kurokawa T, Suda T 1993 Macrophage colony-stimulating factor is indispensable for both proliferation and differentiation of osteclast progenitors. J Clin Invest 91:257–263
  36. Stanley ER 1985 The macrophage colony-stimulating factor, CSF-1. Methods Enzymol 116:564–587[Medline]
  37. Benayahu D, Peled A, Zipori D 1994 Myeloblastic cell line expresses osteoclastic properties following coculture with marrow stromal adipocytes. J Cell Biochem 56:374–384[CrossRef][Medline]
  38. Biskobing DM, Fan X, Rubin J 1995 Characterization of MCSF-induced proliferation and subsequent osteoclast formation in murine marrow culture. J Bone Miner Res 10:1025–1032[Medline]
  39. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1996 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  40. Deryugina EI, Muller-Sieburg CE 1993 Stromal cells in long-term cultures: keys to the elucidation of hematopoietic development? Crit Rev in Immunol 13:115–150[Medline]
  41. Antonioli Corboz V, Cecchini MG, Felix R, Fleisch H, Van der Pluijm G, Lowik CWGM 1992 Effect of macophage colony-stimulating factor on in vitro osteoclast generation and bone resorption. Endocrinology 130:437–442[Abstract/Free Full Text]
  42. Harrington MA, Falkenburg JHF, Daub R, Broxmeyer HE 1990 Effect of myogenic and adipogenic differentiation on expression of colony-stimulating factor genes. Mol Cell Biol 10:4948–4952[Abstract/Free Full Text]
  43. Maffei M, Fei H, Lee GH, Dani C, Leroy P, Zhang Y 1995 Increased expression in adipocytes of ob RNA in mice with lesions of the hypothalamus and with mutations at the db locus. Proc Natl Acad Sci USA 92:6957–6960[Abstract/Free Full Text]
  44. Zhang Y, Proneca R, Maffei M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 272:425–432
  45. Bennett BD, Solar GP, Yuan JQ, Mathias J, Thomas GR, Matthews W 1996 A role for leptin and its cognate receptor in hematopoiesis. Curr Biol 6:1170–1180[CrossRef][Medline]
  46. Gainsford T, Willson TA, Metcalf D, Handman E, McFarlane C, Ng A, Nicola NA, Alexander WS, Hilton DJ 1996 Leptin can induce prolieration, differentiation, and functional activation of hemopoietic cells. Proc Natl Acad Sci USA 93:14564–14568[Abstract/Free Full Text]
  47. Hill MR, Wu X, Sullivan M, King BO, Webb CF, Gimble JM 1996 Expression of acute phase proteins by bone marrow stromal cells. J Endotoxin Res 3:425–433[Abstract/Free Full Text]
  48. Sato T, Abe E, Jin CH, Hong MH, Katagiri T, Kinoshita T, Amizuka N, Ozawa H, Suda T 1993 The biological roles of the third component in osteoclast formation. Endocrinology 133:397–404[Abstract/Free Full Text]
  49. Sato M, Hiragun A 1988 Demonstration of 1{alpha},25-dihydroxyvitamin D3 receptor-like molecule in ST 13 and 3T3L1 preadipocytes and it inhibitory effects on preadipocyte differentiation. J Cell Physiol 135:545–550[CrossRef][Medline]
  50. Shionome M, Shinski T, Takahashi N, Hasegawa K, Suda T 1992 1{alpha},25-Dihydroxyvitamin D3 modulation in lipid metabolism in established bone marrow-derived stromal cells, MC3T3–G2/PA6. J Cell Biochem 48:424–430[CrossRef][Medline]
  51. Kelly KA, Gimble JM 1,25-Dihydroxy vitamin D3 inhibits adipocyte differentiation and gene expression in murine bone marrow stromal cell clones and primary cultures. Endocrinology, in press



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
S. Yang, W. Chen, P. Stashenko, and Y.-P. Li
Specificity of RGS10A as a key component in the RANKL signaling mechanism for osteoclast differentiation
J. Cell Sci., October 1, 2007; 120(19): 3362 - 3371.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. M. Schwab, S. Granholm, E. Persson, B. Wilkes, U. H. Lerner, and H. H. Conaway
Stimulation of Resorption in Cultured Mouse Calvarial Bones by Thiazolidinediones
Endocrinology, October 1, 2005; 146(10): 4349 - 4361.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. C. Manolagas
Birth and Death of Bone Cells: Basic Regulatory Mechanisms and Implications for the Pathogenesis and Treatment of Osteoporosis
Endocr. Rev., April 1, 2000; 21(2): 115 - 137.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
R. Okazaki, M. Toriumi, S. Fukumoto, M. Miyamoto, T. Fujita, K. Tanaka, and Y. Takeuchi
Thiazolidinediones Inhibit Osteoclast-Like Cell Formation and Bone Resorption in Vitro
Endocrinology, November 1, 1999; 140(11): 5060 - 5065.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelly, K. A.
Right arrow Articles by Gimble, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelly, K. A.
Right arrow Articles by Gimble, J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals