| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Centre National de la Recherche Scientifique URA 1461, Université Paris V, Hôpital Necker (M.T., F.H.-D., M.D., J.-M.P.); and Service de Biochemie, Hôpital St. Joseph (D.C.), Paris, France; and Faculty of Medicine, INIBIOLP, Universidad Nacional de la Plata (R.G.), La Plata, Argentina
Address all correspondence and requests for reprints to: Dr. Mark Throsby, CNRS URA 1461, Université Paris V, Hôpital Necker, 161 rue de Sévres, 75743 Paris Cedex 15, France. E-mail: throsby{at}necker.fr
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The endocrine pancreatic hormones are a group of four polypeptides produced by different cell types that together constitute the islets of Langerhans (8). Insulin, which is synthesized by ß-cells, maintains metabolic homeostasis by regulating cellular uptake of glucose. Glucagon, somatostatin, and pancreatic polypeptide, each synthesized by a distinct cell type, modulate insulin secretion, among other functions (8). A striking feature of insulin expression is its almost complete restriction to ß-cells of the islet in normal mammals (9). Apart from the ß-cell, insulin has only been detected in the fetal yolk sac and transiently in the fetal brain (10, 11). It is for this reason that the rat insulin promoter is used in many transgenic models to direct site-specific synthesis of transgenes (12, 13, 14, 15, 16, 17). Surprisingly, in several transgenic models specifically designed to investigate mechanisms of peripheral tolerance, a very low expression of the constructs was detected in the thymus, suggesting that the insulin promoter is active outside the pancreas (12, 17). Further analysis with RT-PCR for several pancreatic endocrine and exocrine hormones revealed low, but detectable, expression for all but carboxypeptidase A and amylase (12). More recently, in humans, low preproinsulin (ppIns) expression has been reported in both fetal and infant thymuses (18, 19). Here we confirm the murine thymus as a site of pancreatic hormone synthesis and identify both dendritic cells and macrophages as capable of their expression.
| Materials and Methods |
|---|
|
|
|---|
Monoclonal antibodies (mAbs)
The mAbs used for depletion were anti-CD4 (clone GK1.5),
anti-CD8 (clone 53.6.7), anti-B220 (clone RA3-6B2), anti-Mac-1 (clone
M1/70), and anti-Gr1 (clone RB6-8C5). For immunofluorescent staining
and sorting the mAbs were anti-Thy-1.2 biotinylated (clone 30H-12;
pan-thymocyte marker) (20), anti-CD11c (clone N418; dendritic cell
marker) (21), and anti-F4/80 (pan-macrophage marker) (22); all were
fluorescein isothiocyanate conjugated. Biotinylated Abs were labeled
with streptavidin-conjugated phycoerythrin (Caltag Laboratories, South
San Francisco, CA).
Isolation of low buoyant density cells
To enrich the stromal elements of the thymus, a previously
described density cut separation procedure was used with few
modifications (23, 24). Media were adjusted to be isoosmotic with mouse
serum. Metrizamide (grade II; Sigma Chemical Co., Saint Quentin
Fallavier, France) was prepared at a concentration of 0.308
M and diluted to a density of 1.071 g/cm3 with
PBS-EDTA as previously described (23).
Thymuses were removed from 2-week-old C57BL/6 mice and washed three times in PBS. Tissues were cut into very small pieces with sharp scissors and digested in 7.5 ml isoosmotic RPMI 1640 supplemented with 25 mM HEPES, 2% FCS, 1 mg/ml collagenase, and 20 ng/ml deoxyribonuclease (DNase) for 25 min at room with agitation. EDTA (0.099 M) was added to the digest, and the incubation was continued for 5 min. Undigested fragments were removed by passage through gauze. Cold FCS, supplemented with 0.099 M EDTA, was layered underneath the digest, and cells were recovered by centrifugation at 500 x g for 7 min. Supernatant was removed, and the cell pellet was dispersed in 7 ml metrizamide by vortexing. Metrizamide (5 ml) was layered underneath, and PBS supplemented with 5 mM EDTA was layered on top; cells were centrifuged at 1700 x g for 10 min. Buoyant density cells were taken from the upper interface, diluted 5-fold with PBS supplemented with 5% FCS-EDTA and 5 mM EDTA (PBS-FCS-EDTA), and centrifuged. Pelleted cells were diluted and recovered for comparison. Both cell suspensions were resuspended in PBS-FCS-EDTA on ice for cell counting and determination of viability. Occasionally, mechanically dispersed cells were used in place of enzyme-digested preparations for metrizamide separation.
Immunomagnetic bead depletion
To remove contaminating thymocytes, B cells, and granulocytes,
low buoyant density cells were subjected to depletion by incubation
with rat mAbs then antirat mAb-conjugated magnetic beads. Cell
suspensions were incubated with a mixture of pretitrated rat mAbs for
20 min at 4 C; the mixture typically contained antibodies against CD4
(T cells), B220 (B cells), and Gr1 (granulocytes). In some experiments,
a carefully titrated amount of Mac-1 antiserum was added to cells
destined for sorting by N418 (dendritic), or alternatively, anti-CD8
antiserum was added to cells sorted by F4/80 (macrophages). After
washing, the cells were incubated as a concentrated slurry with antirat
Ig-coated magnetic beads at a ratio of 3:1 beads/cell, gently rotating
the mixture for 15 min at 4 C. The slurry was diluted, and coated cells
were removed by applying a Dynal magnet twice (Dynal Corp., Chantilly,
VA). The depleted population was either extracted directly or stained
for sorting.
Immunofluorescent staining and flow cytometry
Cell preparations were preincubated with an Fc receptor
antiserum at 4 C for 20 min to diminish nonspecific binding. Then they
were incubated with a fluorescein-conjugated mAb against F4/80, a
hamster mAb against CD11c, or a biotinylated mAb against Thy-1.2 using
PBS-FCS-EDTA as a diluent for 30 min at 4 C. Biotinylated Abs were
labeled with streptavidin-conjugated phycoerythrin. Sorting was
performed with a FACS Vantage cell sorter, and single parameter
analysis was performed with a FACScan (Becton Dickinson Co., Mountain
View, CA). Forward light scatter gates were set to exclude dead cells
and debris.
Messenger RNA (mRNA) isolation
Total RNA was isolated from mouse tissues and cell preparations
using a proprietary modification of the single step extraction method
described by Chomczynski and Sacchi (25). Briefly, animals were rapidly
killed by cervical dislocation, and tissues were removed as quickly as
possible and placed in 1 ml Trizol (Life Technologies, Cergy Pontoise,
France)/100 mg tissue. Tissues were homogenized for 0.51.0 min with a
Polytron homogenizer (Brinkmann Instruments, Westbury, NY). Cells in
suspension were spun down, resuspended in 1 ml Trizol/1 x
106 cells, and lysed by passage through a 21-gauge needle.
Adherent cells were lysed directly on the plate. After separation in
the presence of chloroform, the aqueous phase was precipitated with an
equal volume of isopropyl alcohol. Samples were resuspended, treated
with proteinase K (100 µg/ml) for 15 min at 50 C in the presence of
1% SDS and 10 mM EDTA, phenol/chloroform extracted, and
further subjected to DNase treatment to remove contaminating genomic
DNA. Digestion was carried out with ribonuclease-free RQ1 DNase I (50
U/ml; Promega, Charbonnieres, France) for 30 min at 37 C in Tris-EDTA,
pH 8.0, containing 10 mM MgCl2, 5
mM dithiothreitol, and 500 U/ml RNasin (Promega). After a
final phenol/chloroform extraction, samples were resuspended in sterile
ribonuclease-free water at a concentration of 1 µg/µl after the
addition of RNasin (500 U/ml). The integrity of RNA was assessed by
inspection of 28S and 18S band intensities after agarose gel
electrophoresis. Special care was taken not to cross-contaminate
dissection and homogenization equipment; before handling each tissue,
both were washed with 0.2 M NaOH, sterile water (three
times), and alcohol.
RT-PCR analysis
RT was performed on 3 µg total RNA in the presence of 1
mM deoxy (d)-NTP, 50 mM Tris-HCl (pH 8.3), 75
mM KCl, 5 mM MgCl2, 500 U/ml
RNasin, 500 U/ml avian reverse transcriptase (AMV; Promega), and 10
mM random hexamer primers. Tubes were incubated for 10 min
at 25 C and for 90 min at 42 C, and the reaction was terminated with a
5-min incubation at 95 C followed by cooling on ice. Each reaction was
diluted 5-fold and stored at -20 C before PCR amplification.
For semiquantitative PCR, a series of 4-fold dilutions of complementary DNA (cDNA) was prepared in distilled H2O and amplified in 50-µl reactions using 10 µl of the diluted cDNA as template mixed with 40 µl PCR mix [20 mM Tris-HCl (pH 8.4); 50 mM KCl; 1.0 mM MgCl2; 200 µM dATP, dCTP, dGTP, and dTTP (Pharmacia, Saint-Quentin-Yvelines, France); 1 µM of each primer; and 1.5 U Taq DNA polymerase (Life Technologies); all given as the final concentration]. Mineral oil (50 µl) was added to each tube, and amplification was carried out under standard thermal cycling conditions; a single denaturing step at 94 C/2 min was followed by the chosen number of cycles of the profile 94 C for 45 sec, 60 C for 45 sec, 72 C for 1 min, and a final extension step at 72 C for 7 min. The primers for the pancreatic genes (26), actin (27), and ß2-microglobulin (ß2m) (28) have been described previously. Cycle numbers used for each primer pair were adjusted to ensure linear amplification. Reaction products were separated on 0.5 x TBE (0.13 M Tris base, 80 mM boric acid, and 0.25 mM EDTA)-1.8% agarose gels containing 100 ng/ml ethidium bromide. PCR products were visualized under short wave UV light, captured with a CCD camera (Ikegami Tsushinki, Tokyo, Japan, and digitally printed with a video copy processor (Mitsubishi, Tokyo, Japan). For analysis, photographs were scanned at high resolution, and the integrated density of the bands was calculated using Scan Analysis (Biosoft, Cambridge, UK).
For autoradiography, gels were denatured and transferred to positively
charged nylon membranes under vacuum for 2 h. The nucleic acid was
stabilized on the membrane by UV cross-linking and immersed in
prehybridization buffer [6 x SSC, 10 mM
Na2PO4 (pH 6.8), 1 mM EDTA (pH 8),
0.5% SDS, 100 µg/ml single stranded DNA, and 0.1% nonfat dried
milk] for 1 h at 68 C. A 30-bp oligonucleotide
(CAGCAAGCAGGTTATTGTTTCAACATGGCC), specific for the insulin PCR product
and spanning the first intron of the insulin gene (to exclude genomic
DNA contamination), was labeled at the 5'-end with
[
-32P]ATP by T4 polynuclease kinase. Unincorporated
nucleotide was removed by alcohol precipitation. Thirty nanograms per
ml probe were added to the prehybridization buffer, and the
hybridization was continued overnight. The gel was washed in 5 x
SSC at room temperature for 10 min, at 42 C for 10 min, at 47 C for 10
min, and at 52 C for 10 min. The nylon membrane was then exposed to
autoradiographic film at -70 C.
RIA
Immunoreactive (ir-) insulin was assayed by a Bi-Insulin RIA kit
(ERIA Diagnostics Pasteur, Paris, France) using rat insulin (Novo
Nordisk, France) as standard. Thymic cells separated by density
gradient were washed twice in PBS and resuspended in 1 M
acetic acid and 100 µg/ml PMSF (Sigma). Cells were sonicated
immediately and then centrifuged for 30 min at 16,000 x
g. The supernatant was recovered, frozen, and lyophilized.
Samples and standards were resuspended for assay in
insulin-depleted human serum by activated charcoal filtration. The
detection limit of the assay was 15 pmol/liter, and the molar
cross-reactivity with proinsulin was approximately 60%.
Statistical analysis
The ratio of pancreatic hormone expression to actin expression
(as determined from OD measurements of ethidium bromide-stained gels)
is expressed as the mean ± SEM of three separate
experiments. Data were analyzed by ANOVA, followed by Duncans
multiple range test for individual differences with a P
< 0.05 or P < 0.01 level of significance.
| Results |
|---|
|
|
|---|
|
|
|
The identity of the amplified product from the enriched population of
buoyant density cells was confirmed by restriction digest with the
endonuclease AvaI that produced the expected band at 272 bp
(Fig. 2c
, lane 1). Note that in the control lane two bands were
observed (lane 2, white arrows); the primers for insulin
were degenerate for the two insulin genes found in the mouse,
generating products of 348 and 355 bp for the insulin I gene and the
insulin II gene, respectively. The presence of the two bands, visible
here due to the greater gel resolution of PAGE, suggests that both
genes are transcribed in the thymus.
The same total RNA extracts were amplified for pGlu, pSom, pPP, and
ppIns with a different degenerate primer pair (Fig. 3
). Expression was detectable for each
hormone even at the highest dilution of cDNA. No band was detected for
any hormone in RT-PCR samples that had been processed with the omission
of RT (data not shown).
|
Pancreatic hormone expression in cells purified by sorting
To further define the identity of hormone-expressing cells, the
enriched cell population was depleted of residual lymphocytes using
antibodies against cell surface markers, CD4 (T cells), B220 (B cells),
and Gr1 (granulocytes), indirectly conjugated with magnetic beads. Two
populations were prepared, one that also included an antibody for CD8,
which is expressed on mouse thymic dendritic cells and a subpopulation
of T cells, but not on macrophages, and one with an antibody against
Mac-1, which is strongly expressed on macrophages. Cells from the first
group (depleted of dendritic cells) were separated based on reactivity
to the cell surface marker F4/80 (pan macrophage marker), and cells
from the second group (depleted of macrophages) were separated with
CD11c (dendritic cell marker). After cell sorting, serial dilutions of
the cells from each gate were extracted immediately for total RNA as
described in Materials and Methods. The experiment was
repeated three times; a representative experiment is presented in Fig. 4
.
|
Expression for ppIns was not detected in the F4/80 gates after ethidium
bromide staining; however, a faint band was present in cells gated for
N418. The gel was transferred to a membrane and hybridized with a 30-bp
oligonucleotide specific for an internal sequence in the PCR product.
The resulting autoradiography clearly shows ppIns expression in 3
x 104 cells sorted for the dendritic cell marker N418
(lane 11). The relative expression of ppIns compared with thymic
extracts appears to be 10-fold higher than that of the other hormones;
however, autoradiography is more sensitive and is probably more
quantitative than ethidium bromide staining; thus, the relative
expression of the other hormones may be underestimated. Faint bands
were also observed in lanes representing 1.5 x 105
cells before and after sorting for macrophages (lanes 5 and 6,
respectively); however, in contrast to cells depleted of macrophages
and sorted for N418 (lanes 10 and 11, respectively), there was no
enrichment in expression after sorting for F4/80. Likewise, a faint
band for pSom and pPP was observed in N418-gated cells. The
significance of this expression is unclear; however, no expression for
any pancreatic endocrine hormone was observed in 2 x
105 cells gated for cells expressing high levels of Thy-1.2
(lane 17), an F4/80 negative gate (lane 18), or a serial dilution of
viable N418-negative cells (lanes 1416). As a further control, the
expression of insulin (Fig. 5
) and the
other pancreatic hormones was tested in five well characterized
cortical (1.4C18 and 1.2C1) and medullary (2.3, 3.10, and 1C6) thymic
epithelial cell lines (29), in cells from deoxyguanosine-treated thymic
explants, which consist primarily of epithelial cells and some
fibroblasts, and in thioglycolate-elicited peritoneal macrophages, and
splenic macrophages, no expression for any of the pancreatic hormones
was detected by RT-PCR.
|
| Discussion |
|---|
|
|
|---|
The level of ppIns expression measured in the thymus is between 45 orders of magnitude lower than that in the pancreas. This makes it highly unlikely that insulin of thymic origin would influence the circulating level of the hormone. Like ppIns, there are several orders of magnitude difference in the expression of pGlu and pSom, but the level of pPP is far closer to that of pancreatic expression. This probably reflects the small number of cells positive for the pancreatic polypeptide in the pancreas (<1%) (8).
In contrast to previous reports (12) we did not observe in the murine thymus a difference in pancreatic endocrine hormone expression with age in young animals. However, at 20 weeks of age, expression of all hormones was diminished. This was particularly true of insulin, and may result from thymic involution that occurs with aging and involves a reduction in the number of bone marrow-derived cells in the tissue.
Expression of all transcripts was enriched in a low buoyant density fraction of thymic cells, in which macrophages and dendritic cells are concentrated from the overwhelming majority of thymocytes and in which epithelial cells were not included. However, from this population of cells, only those selected by FACS sorting for reactivity to the cell surface marker N418 demonstrated expression of ppIns. The expression was observed in 3 x 104 cells, which represents less than 0.05% of the total thymic population, demonstrating a significant enrichment of transcript expression, but still below what might be expected if all dendritic cells constitutively synthesized the protein. This might be an artifact of the cell isolation and sorting procedure, which, although carried out at 4 C, still requires many steps and around 67 h to complete, and/or might represent a very low basal rate of transcriptional activity.
Importantly, we were able to demonstrate, by RIA, the presence of ir-insulin in the same population of cells that specifically expressed ppIns mRNA in the thymus. The amount detected, although above the level of sensitivity of the assay, was very low. However, as the antiserum used in the assay recognizes epitopes on both insulin and proinsulin, it is not possible to determine the concentration or identity of the hormone exactly. Unfortunately, immunohistochemical studies on cryostat or paraffin-embedded sections to locate the site of ir-proinsulin/insulin production in situ were unsuccessful (data not shown). In the human thymus, ir-insulin levels are reported to be 104- to 105-fold lower than those in the pancreas (18, 19), consistent with our findings in the mouse. In these studies, the level of ir-proinsulin was 4-fold greater than that of ir-insulin, and the researchers concluded that proinsulin was probably the major translational product, as the levels of ir-insulin detected were in the range of control tissues and thus likely to be circulating, rather than endogenously produced, hormone.
Surprisingly, when tested for the expression of the three other hormones, F4/80-sorted cells demonstrated a specific band for each one. The level of expression relative to that in the serially diluted, age-matched thymus tissue included as a positive control was roughly similar for all of these hormones, in contrast to observations in the pancreas. This finding probably indicates that a similar number of cells is responsible for hormone synthesis. Whether the same cell synthesizes all hormones cannot be determined in the present study. The faint bands observed for pSom and pPP in the N418-gated extracts and the presence of autoradiographic signal for ppIns in F4/80-gated cells are unlikely to be the result of inadvertent contamination, as the cell populations included as controls and processed in parallel were all negative. Thus, the possibility that both cell types might produce multiple hormones cannot be excluded.
The macrophage belongs to the heterogeneous myeloid lineage of cells whose members are present in most tissues of the body and in the circulation (22, 30). The anatomical, morphological, and functional characteristics of these cells vary greatly and depend on the environment in which they seed. In the thymus, macrophages have two major functional roles: phagocytosis of apoptotic lymphocytes (immature T cells that are unable to develop further) and, to a lesser extent, antigen presentation to developing lymphocytes (31, 32). Dendritic cells are also present throughout the body, where they are critical in displaying antigen to initiate immune responses (24, 33). In the thymus, dendritic cells are derived from early lymphocyte progenitors (34). Thus, it is interesting to note that hormone expression was not present in any other tissue investigated, whether lymphoid or nonlymphoid. This suggests either that the specific thymic microenvironment modulates pancreatic hormone expression or that tissue-specific subpopulations of cells are responsible for their expression.
It is unexpected that insulin expression would be found in a different population of cells from that of the other pancreatic endocrine hormones. Of particular interest are the functional differences between these two cell types. The dendritic cell has a far greater potential to present antigen in the thymus for selection purposes (32, 34). Insulin has been identified as a potential autoantigen in type I diabetes. Thus, any alteration in the expression of insulin in these cells could influence the ability of the thymus to select against the generation of autoreactive T cells for insulin-derived peptides. The implication of this finding in the spontaneous model of type I diabetes, the NOD (nonobese diabetic) mouse, is now being explored.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received September 12, 1997.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. S. Wong, L. Khai Siew, G. Scott, I. J. Thomas, S. Chapman, C. Viret, and L. Wen Activation of Insulin-Reactive CD8 T-Cells for Development of Autoimmune Diabetes Diabetes, May 1, 2009; 58(5): 1156 - 1164. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Perchellet, T. Brabb, and J. M. Goverman Crosspresentation by nonhematopoietic and direct presentation by hematopoietic cells induce central tolerance to myelin basic protein PNAS, September 16, 2008; 105(37): 14040 - 14045. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Carl Jr., J.-Q. Liu, P. S. Joshi, H. Y. El-Omrani, L. Yin, X. Zheng, C. C. Whitacre, Y. Liu, and X.-F. Bai Autoreactive T Cells Escape Clonal Deletion in the Thymus by a CD24-Dependent Pathway J. Immunol., July 1, 2008; 181(1): 320 - 328. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Narendran, A. M. Neale, B. H. Lee, K. Ngui, R. J. Steptoe, G. Morahan, O. Madsen, J. A. Dromey, K. P. Jensen, and L. C. Harrison Proinsulin is encoded by an RNA splice variant in human blood myeloid cells PNAS, October 31, 2006; 103(44): 16430 - 16435. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Faideau, C. Lotton, B. Lucas, I. Tardivel, J. F. Elliott, C. Boitard, and J.-C. Carel Tolerance to Proinsulin-2 Is Due to Radioresistant Thymic Cells J. Immunol., July 1, 2006; 177(1): 53 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chen, J.-h. Ding, R. Bekeredjian, B.-z. Yang, R. V. Shohet, S. A. Johnston, H. E. Hohmeier, C. B. Newgard, and P. A. Grayburn Efficient gene delivery to pancreatic islets with ultrasonic microbubble destruction technology PNAS, May 30, 2006; 103(22): 8469 - 8474. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Terashima, H. Kojima, M. Fujimiya, K. Matsumura, J. Oi, M. Hara, A. Kashiwagi, H. Kimura, H. Yasuda, and L. Chan From The Cover: The fusion of bone-marrow-derived proinsulin-expressing cells with nerve cells underlies diabetic neuropathy PNAS, August 30, 2005; 102(35): 12525 - 12530. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Garcia, K. R. Prabakar, J. Diez, Z. A. Cao, G. Allende, M. Zeller, R. Dogra, A. Mendez, E. Rosenkranz, U. Dahl, et al. Dendritic Cells in Human Thymus and Periphery Display a Proinsulin Epitope in a Transcription-Dependent, Capture-Independent Fashion J. Immunol., August 15, 2005; 175(4): 2111 - 2122. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aquila, M. Gentile, E. Middea, S. Catalano, and S. Ando Autocrine Regulation of Insulin Secretion in Human Ejaculated Spermatozoa Endocrinology, February 1, 2005; 146(2): 552 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Rindi, M. Civallero, M. E. Candusso, A. Marchetti, C. Klersy, R. Nano, and A. B. Leiter Sudden Onset of Colitis After Ablation of Secretin-Expressing Lymphocytes in Transgenic Mice Experimental Biology and Medicine, September 1, 2004; 229(8): 826 - 834. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Chentoufi, M. Palumbo, and C. Polychronakos Proinsulin Expression by Hassall's Corpuscles in the Mouse Thymus Diabetes, February 1, 2004; 53(2): 354 - 359. [Abstract] [Full Text] |
||||
![]() |
B. Faideau, J.-P. Briand, C. Lotton, I. Tardivel, P. Halbout, J. Jami, J. F. Elliott, P. Krief, S. Muller, C. Boitard, et al. Expression of Preproinsulin-2 Gene Shapes the Immune Response to Preproinsulin in Normal Mice J. Immunol., January 1, 2004; 172(1): 25 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Moriyama, N. Abiru, J. Paronen, K. Sikora, E. Liu, D. Miao, D. Devendra, J. Beilke, R. Gianani, R. G. Gill, et al. Evidence for a primary islet autoantigen (preproinsulin 1) for insulitis and diabetes in the nonobese diabetic mouse PNAS, September 2, 2003; 100(18): 10376 - 10381. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dubois-Lafforgue, L. Mogenet, K. Thebault, J. Jami, P. Krief, and C. Boitard Proinsulin 2 Knockout NOD Mice: A Model for Genetic Variation of Insulin Gene Expression in Type 1 Diabetes Diabetes, December 1, 2002; 51(90003): S489 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zheng, J.-X. Gao, H. Zhang, T. L. Geiger, Y. Liu, and P. Zheng Clonal Deletion of Simian Virus 40 Large T Antigen-Specific T Cells in the Transgenic Adenocarcinoma of Mouse Prostate Mice: An Important Role for Clonal Deletion in Shaping the Repertoire of T Cells Specific for Antigens Overexpressed in Solid Tumors J. Immunol., November 1, 2002; 169(9): 4761 - 4769. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Halbout, J.-P. Briand, C. Becourt, S. Muller, and C. Boitard T Cell Response to Preproinsulin I and II in the Nonobese Diabetic Mouse J. Immunol., September 1, 2002; 169(5): 2436 - 2443. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chen, I. Bergerot, J. F. Elliott, L. C. Harrison, N. Abiru, G. S. Eisenbarth, and T. L. Delovitch Evidence That a Peptide Spanning the B-C Junction of Proinsulin Is an Early Autoantigen Epitope in the Pathogenesis of Type 1 Diabetes J. Immunol., November 1, 2001; 167(9): 4926 - 4935. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ferone, R. Pivonello, P. M. Van Hagen, M. Waaijers, J. Zuijderwijk, A. Colao, G. Lombardi, A. J. J. C. Bogers, S. W. J. Lamberts, and L. J. Hofland Age-related decrease of somatostatin receptor number in the normal human thymus Am J Physiol Endocrinol Metab, October 1, 2000; 279(4): E791 - E798. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Savino and M. Dardenne Neuroendocrine Control of Thymus Physiology Endocr. Rev., August 1, 2000; 21(4): 412 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Kecha, F. Brilot, H. Martens, N. Franchimont, C. Renard, R. Greimers, M.-P. Defresne, R. Winkler, and V. Geenen Involvement of Insulin-Like Growth Factors in Early T Cell Development: A Study Using Fetal Thymic Organ Cultures Endocrinology, March 1, 2000; 141(3): 1209 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Marie, A. Wakkach, A.-M. Coudray, E. Chastre, S. Berrih-Aknin, and C. Gespach Functional Expression of Receptors for Calcitonin Gene-Related Peptide, Calcitonin, and Vasoactive Intestinal Peptide in the Human Thymus and Thymomas from Myasthenia Gravis Patients J. Immunol., February 15, 1999; 162(4): 2103 - 2112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Freitas, S. R. Dalmau, and W. Savino Epidermal Growth Factor (EGF) Modulates Fetal Thymocyte Growth and Differentiation: Partial Reversal by Insulin, Mimicking by Specific Inhibitors of EGF Receptor Tyrosine Kinase Activity, and Differential Expression of CD45 Phosphatase Isotypes J. Immunol., October 1, 1998; 161(7): 3384 - 3392. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |