help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heymes, C.
Right arrow Articles by Samuel, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heymes, C.
Right arrow Articles by Samuel, J.-L.
Endocrinology Vol. 139, No. 5 2579-2587
Copyright © 1998 by The Endocrine Society


ARTICLES

Cardiac Senescence Is Associated with Enhanced Expression of Angiotensin II Receptor Subtypes1

Christophe Heymes, Jean-Sébastien Silvestre, Catherine Llorens-Cortes, Françoise Marotte, Brigitte Chevalier, Bernard I. Levy, Bernard Swynghedauw and Jane-Lise Samuel

INSERM U127 (C.H., J.-S.S., F.M., B.C., B.S., J.-L.S.), INSERM U141 (B.I.L.), IFR Circulation, Hôpital Lariboisière, 75475 Paris Cedex 10, France, INSERM U36 (C.L.-C.), Collège de France, 75475 Paris Cedex 5, France

Address all correspondence and requests for reprints to: Dr. Jane-Lise Samuel, INSERM U127, IFR Circulation, Hôpital Lariboisière, 41 bd de la Chapelle, 75475 Paris Cedex 10, France.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent studies have pointed out the differential role of angiotensin II (Ang II) receptor subtypes, AT1 and AT2, in cardiac hypertrophy and fibrosis during pathological cardiac growth. Because senescence is characterized by an important cardiovascular remodeling, we examined the age-related expression of cardiac Ang II receptors in rats.

AT1 and AT2 receptor subtype messenger RNA (mRNA) levels were quantitated by RT-PCR. In parallel, specific Ang II densities were determined in competition binding experiments using specific antagonists. AT1a and AT1b mRNA levels were markedly up-regulated (5.6-fold) in the left ventricle of 24-month-old rats compared with 3-month-old rats, but not in the right ventricle. In contrast, AT2 gene expression was increased in both ventricles of senescent rats (4.2- and 2.8-fold in the left and right ventricles, respectively). Similarly, AT1 and AT2 gene expression was increased 2.3- and 2-fold, respectively, in freshly isolated cardiomyocytes from aged rats. Furthermore, AT1 and AT2 specific binding was increased in the aged left ventricular myocardium.

Even though the mechanistic pathway of this up-regulation of Ang II receptor subtype gene expression might be intrinsic to developmental gene reprogramming, the up-regulation of AT1 mRNA accumulation in the left ventricle during aging could also be secondary to age-related hemodynamic changes, whereas increased AT2 gene expression in both ventricles may depend upon hormonal and humoral factors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ANGIOTENSIN II (Ang II), the main effector peptide of the renin-angiotensin system (RAS), plays an important regulatory role in the cardiovascular system via diverse mechanisms, including vasoconstriction, stimulation of aldosterone production, facilitation of adrenergic release, and effects in growth response. Over the past decade, data have supported the existence of an Ang II-producing pathway in various tissues, including the kidney and blood vessels (1, 2). In the heart, the presence of angiotensinogen (ANG), renin, and angiotensin-converting enzyme (ACE) suggests local intracardiac synthesis of Ang II (3, 4). Ang II receptor subtypes have also been characterized in cardiac tissue. At least two main receptor subtypes, AT1 and AT2, have been identified using receptor subtype-specific antagonists (5). Furthermore, two AT1 receptor subtypes, encoded by two different genes (AT1a and AT1b), have been isolated in rat and mouse. They present high homologous sequences, similar binding and functional characteristics (6, 7, 8, 9). In the rat heart, levels of both AT1 and AT2 receptor expression are increased during the neonatal period and decrease with maturation (10, 11).

Though the favorable effects of ACE inhibition on cardiac function have generally been attributed to afterload reduction, many lines of evidence also suggest a pivotal role for the intracardiac Ang II-forming pathway in mediating cardiac hypertrophy and fibrosis (12, 13, 14). Moreover, recent studies have suggested a direct role for Ang II via its specific receptors. Indeed, Ang II promotes a growth response in cultured vascular smooth muscle cells (15), cardiomyocytes, and fibroblasts (16). Ang II also stimulates collagen synthesis in cardiac fibroblasts (17) and vascular smooth muscle cells (18). To date, most of the well-known cardiovascular functions of Ang II are mediated via the AT1 receptor, whereas there is little information regarding the physiological role of AT2 receptor. Enhanced Ang II receptor subtype expression has been demonstrated in cardiovascular diseases involving cardiovascular remodeling, but the expression of Ang II receptor subtypes has not been investigated in the aging heart (19, 20).

Senescence is associated with marked changes in cardiac structure and morphology such as cardiomyocyte loss, hypertrophy of the remaining cells, and the development of fibrosis (21, 22). These changes may account for the functional characteristics of the senescent myocardium: namely, impaired myocardial perfusion (23), altered diastolic compliance (21), and arrhythmias (24). Vascular structure is also modified, and aging is associated with increased arterial wall stiffness, as shown by a significant decrease in systemic and local arterial compliance and an increase in aortic impedance (21, 25), which may induce mild left ventricular hypertrophy. Interestingly, there is now evidence that senescence is associated with increased cardiac ANG and ACE gene expression, suggesting increased cardiac Ang II synthesis, whereas plasma RAS activity is largely depressed (26).

The present study was thus undertaken to determine the expression of cardiac AT1 and AT2 receptor subtypes in the right and left ventricles of aged rats, at messenger RNA (mRNA) and protein level. The data demonstrate that AT1a and AT1b mRNA levels markedly increase in the left ventricle, whereas AT2 gene expression is up-regulated in both ventricles. To assess cellular expression precisely, we investigated Ang II receptor subtype gene expression in freshly isolated left ventricular cardiomyocytes. Ang II type 1 and type 2 receptor mRNA levels were increased in freshly isolated cardiomyocytes of aged rats compared with cardiomyocytes of young adult rats. Finally, the density of AT1 and AT2 receptors was homogeneously increased in the left ventricular myocardium of aged hearts.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental protocol
This study was conducted in accordance with the institutional guidelines and those formulated by the European Community for the use of experimental animals (L358–86/609/EEC). Two groups (3-month-old rats, n = 6; 24-month-old rats, n = 6) of male Wistar rats (Iffa Credo, Lyon, France) were fed ad libitum and drank tap water. At the time the rats were killed, systolic blood pressure was measured using the plethysmographic tail-cuff method. Measurements of angiotensin I and aldosterone concentrations were conducted with RIA kits (kits SB-REN-2 and SB-ALDO-2, ERIA Diagnostics Pasteur, Marnes La Coquette, France). PRA was measured by RIA of the angiotensin I produced by incubation of plasma at 37 C for 1 h. Levels of corticosterone were also determined in duplicate by RIA using rabbit polyclonal antibody, as previously described (27).

The hearts were removed, and transverse sections of heart were embedded in mounting medium and frozen in liquid nitrogen-cooled isopentane. Left and right ventricles (LV, RV) were then separated from the remainder of the heart, and all samples were stored at -70 C until use.

Collagen morphometry
Transverse myocardial sections (5 µm thick) were stained with collagen-specific Sirius red stain (0.5% in saturated picric acid). Sections were studied blindly by a single examiner. Each field was digitized on a Macintosh Performa 5320 by a gray level camera (Hamamatsu) mounted on a light microscope (Leica) at 100x magnification, and collagen was quantified using image-analysis software (OPTILAB, Graftek, Mirmank, France).

RNA extraction
Total RNA was extracted according to the method of Chomczynski and Sacchi (28). Purified RNA was dissolved in water and the concentration measured by absorbance at 260 nm. The yields of total RNA extracted from LV and RV were similar and unchanged in senescent rats (data not shown). The quality of RNA was confirmed by ethidium bromide staining in 1% agarose gel. Quantitative RT-PCR was then performed for Ang II receptor subtype gene expression. Slot blot were also performed for quantification of ACE mRNA levels.

Isolation of cardiac myocytes
Left ventricular myocytes were isolated by the procedure of Dubus et al. (29). Briefly, the hearts of young adult and aged rats were cannulated through the aorta on a Langendorff apparatus, and perfused at 37 C for 3 min with a modified Krebs solution (10 mM HEPES buffer, pH 7.4, 35 mM NaCl, 10 mM glucose, 134 mM sucrose, 16 mM Na2HPO4, 25 mM NaHCO3, 4.75 mM KCl, 1.19 mM KH2PO4), then for 30 min with the same buffer supplemented with 1 mg/ml collagenase (EC 3.4.24.3., Boehringer, Mannheim) and 5 mg/ml of purified BSA (fraction V, Miles Laboratories) at a rate of 2 ml/min. Perfusion pressure was 60 mmHg. After perfusion, the LV was gently dissociated with forceps in Hepes buffer, and the resultant suspension filtered through a nylon mesh (500 µm) and centrifuged for 4 min at 50 x g. Cells were washed and sedimented twice in HEPES buffer to purify the myocytes. The fraction contained 90–95% myocytes, as assessed by microscopic observation of the cells. Total myocyte RNA was extracted according to the trizol reagent protocol (Life Technologies, Cergy Pontoise, France), and the quality of RNA was confirmed by ethidium bromide staining in 1% agarose gel.

Slot blot analysis of ACE mRNA accumulation
For quantification of ACE mRNA levels, slot blot hybridization analyses were performed on total RNA from left and right ventricles and on fragments of mRNA prepared by synthesizing the sense RNA strand from the ACE plasmid vectors. Samples were formaldehyde-denatured and then serially diluted in 20 x SSC (pH 7.0) and blotted to nylon filters (Hybond-N, Amersham, France). Six different concentrations of total RNA (20, 17.5, 15, 12.5, 10, 7.5 µg and 6.4, 4.8, 3.2, 2.4, 1.2, 0.8 µg for the LV and RV) and six amounts of in vitro synthesized ACE mRNA (20, 17.5, 15, 12.5, 10, 7.5 pg) were studied.

The ACE complementary DNA (cDNA) was labeled by the random priming method (Multiprime DNA labeling system, Amersham) with (a-32P)dCTP (3,000 Ci/mmol) to a specific activity of 1–1.5 x 109 cpm/µg DNA. The membranes were prehybridized overnight at 42 C in a buffer containing 50% deionized formamide, 5 x Denhardt’s solution, 5 x SSC, 50 mM Na phosphate, pH 6.8, 0.1% SDS, and 250 µg/ml sonicated denaturated herring sperm DNA and hybridized in the same buffer containing labeled probes. For hybridization, 32P-labeled ACE cDNA probe was added to a final concentration of 1–1.8 x 106 cpm/ml. After hybridization, blots were washed in 0.5 x SSC, 0.1% SDS three times for 15 min at room temperature, and twice for 15 min at 60 C. Autoradiograms generated by slot blots were scanned with a microdensitometer. The background was set to zero for each autoradiograph. Regression lines were calculated from integral values obtained by scanning the serial concentrations of each sample. The relative signals of the specific mRNA were estimated from the slope of the regression line. Experiments with synthetic mRNAs as a standard were carried out under conditions described above. One picogram of the 381 bases synthetic ACE mRNA fragment corresponds to 11.3 pg of the 4300 bases ACE mRNA (4300/381 = 11.3).

Quantitative RT-PCR of Ang II receptor subtypes
Oligonucleotides used for RT-PCR. For AT1, the antisense primer was 5'GCACAATCGCCATAATTATCC3' (extending from base 719 to base 739 of the coding sequence), and the sense primer was 5'CACCTATGTAAGATCGCTTC3' (extending from base 295 to base 314 of the coding sequence), giving a DNA fragment of 444 bp. For AT2, the antisense primer was 5'ACCACTGAGCATATTTCTCGGG3' (extending from base 600 to base 622 of the coding sequence) and the sense primer was 5'TGAGTCCGCATTTAACTGC3' (extending from base 86 to base 105 of the coding sequence), giving a DNA fragment of 536 bp. The oligonucleotides were synthesized by Bioprobe Systems (Montreuil, France).

Internal standard preparation. Quantification of AT1 and AT2 mRNAs was performed in the presence of a defined concentration of specific RNA mutant as an internal standard.

For AT1, an internal standard was synthesized by in vitro transcription of the plasmid Bsd AT1a [a kind gift from Dr. C. Llorens-Cortes (30)] containing the entire coding sequence of the rat AT1a (nucleotides -182 to 1935), except for a 63-nucleotide deletion (nucleotides 502 to 564) containing the EcoRI restriction site. This results in a 384-bp amplification product. The deleted AT1a RNA was obtained using T7 RNA polymerase after linearization with SalI. The transcription reaction was performed in the presence of labeled UTP as a precursor and the concentration of the transcript was determined after measurement of the radioactivity incorporated into RNA product.

For AT2, the PCR product was subcloned into a pCRTMII-vector (TA Cloning Kit, Invitrogen). The AT2 PCR product was then linearized with HpaI and ligated with the 69-bp insert (a PvuI/ScaI fragment of pBluescript II SK phagemid), resulting in a 605-bp amplification product. The internal standard AT2 RNA was obtained using T7 RNA polymerase after the template had been linearised with HindIII. The transcription reaction was performed in the presence of labeled UTP as a precursor and the concentration of the transcript was determined after measurement of the radioactivity incorporated into RNA product.

Quantitative RT-PCR protocol. Total RNA was reverse-transcribed with a fixed amount of the specific synthetic RNA and 200 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies) for 90 min at 39 C. The reaction was performed in 20 µl of a mixture containing 0.4 µM of the reverse primer, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 2.5 mM dNTP, 10 mM DTT, and 50 U RNase inhibitor (Promega, Charbonnières, France). The reaction was stopped by heating samples for 10 min at 70 C. For PCR amplification, the resulting cDNA was amplified using 2.5 U Taq DNA polymerase (Boehringer, Meylan, France) and 80 nM primers in 50 µl of 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 2 mM MgCl2, 0.5 mM dNTP, 2 mM DTT and 0.01% gelatine. Thirty amplification cycles were undertaken as follows: denaturation at 95 C for 1 min, annealing at 54 C and 53 C for AT1 and AT2 respectively for 1 min, and extension at 72 C for 1 min 30 sec. To quantify AT1 and AT2 mRNA levels, a trace amount of (32P)-dCTP was included in the PCR reaction, and the number of C residues present in each fragment was taken into account for further quantification (AT1a = 117, AT1b = 113, AT1 internal standard = 105, AT2 = 105, AT2 internal standard = 123). After PCR amplification, the PCR products were digested by EcoRI to distinguish the AT1a from the AT1b subtype. The PCR products were then separated on a 5% polyacrylamide gel, and radioactive signals were analyzed using a computer based imaging system (Fuji Bas 1000, Fuji Medical Systems, Clichy, France).

Quantitative autoradiography of AT1 and AT2
Transverse ventricular sections (20 µm thick) were cut on a cryostat, and thaw mounted on gelatin coated glass slides. Ang II binding sites were labeled with (125I-Sar1-Ile8)-Ang II (NEN; iodinated by DuPont; specific activity 2200 Ci/mmol) as previously described (31). Briefly, consecutive sections were preincubated for 30 min at 22 C in 10 mM sodium phosphate buffer (pH 7.4) containing 120 mM NaCl, 5 mM Na2EDTA, 0.2% proteinase-free BSA (Sigma Chemical Co., Saint Quentin Fallavier, France) and 0.005% bacitracin (Sigma) to remove endogenous bound ligand. Sections were incubated for 120 min at room temperature in fresh buffer containing either 2 nM (125I-Sar1-Ile8)-Ang II to determine the total number of angiotensin II receptors, 0.5 nM (125I-Sar1-Ile8)-Ang II in the presence of the AT1 antagonist losartan (10-5 M, Dupont) to identify AT2 receptors or AT2 antagonist PD 123319 (10-5 M, provided by IdRS, Surcones, France) to identify the AT1 receptors. Nonspecific binding was determined in the presence of unlabeled Ang II (5 µM; Sigma). After incubation, sections were washed four times for 1 min in fresh Tris-HCl buffer 50 mM (pH 7.4, 4 C) and once in water at 4 C for 30 sec. Slides were first exposed to Fuji Bas 1000 screens (Fuji Medical Systems, Clichy, France) for further quantification and then to (3H)-hyperfilm in x-ray cassettes. A series of 20 µm autoradiographic 125I- labeled microscales (Amersham, Courtaboeuf, France) was included in each cassette. After a 4-week exposure period, films were developed for 4 min in D19 Kodak (Rochester, NY) developer, washed for 15 sec in 0.6% acetic acid, and fixed for 4 min with Kodak rapid fixer. The radioactive signals were analyzed using a computer-based imaging system (Fuji Bas 1000). Optical densities of the autoradiograms were determined by computerized densitometry and expressed as fmol/mg of protein by comparison with a calibration curve constructed from the 125I-labeled standards. The quantification of Ang II receptor subtype densities was performed on the left ventricle, which represent the majority of the section surface.

Statistics
Statistical significance was estimated between two groups using one-way ANOVA and group-to-group comparison using the Student’s t test. The test was considered significant for P < 0.05. The values presented are mean ± SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Physiological data
The mean systolic blood pressure value in the senescent group (145 ± 3 mmHg) was similar to that of the young adult rats (149 ± 3 mmHg). Left ventricular weight (LVW) and right ventricular weight (RVW) were significantly increased in aged rats. The LVW/RVW ratio remained stable in aged rats, whereas the LVW/BW and RVW/BW ratios were diminished, due to marked increase in the body weight (BW) with age (Table 1Go). Both the renin activity and angiotensin I concentration were significantly reduced, as previously described (25). The aldosterone concentration remained unchanged, and the plasma cortisol level increased in senescent rats (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Physiological data

 
Histological studies
The interstitial space was markedly enlarged in ventricular equatorial sections of 24-month old rats compared with the 3-month old controls (Fig. 1AGo), as previously described (23). Sirius red staining revealed an increase in myocardial fibrosis (i.e. the ratio of total collagen surface area to total ventricular surface area, expressed as a percentage) in the aged group relative to controls. Senescent rat heart was characterized by an increase in interstitial connective tissue surrounding individual myocytes. There was also a large increase in perivascular fibrosis. Quantification displayed a 3-fold increase in interstitial fibrosis in both LV and RV (P < 0.005) of aged rats, as compared with young adult rats (Fig. 1BGo).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. Photomicrographs of cardiac sections from young adult and aged rats stained with Sirius red (A). Collagen fibers appear in black, and myocytes and intramyocardial vessels in white. Interstitial and perivascular fibrosis were greatly increased in the myocardium of 24-month old rats. Data are mean ± SEM of six separate experiments. **, P < 0.005 (B).

 
Ang II receptor subtype mRNA accumulation
Validity of the RT-PCR method. To quantify the AT1 and AT2 transcripts by RT-PCR amplification, the target mRNA was coamplified with a specific internal standard. The number of amplification cycles was chosen within the exponential phase. Figure 2Go, A and B, shows that the amplification rate was exponential between 25 and 31 cycles for AT1 and AT2 cardiac mRNA as well as their specific internal standard. All experiments were therefore performed at 30 cycles because this was in the exponential phase and the radioactive signal was strongly detected.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Linearity of amplification conditions for AT1 mRNA (A) and AT2 mRNA (B). Total RNA from rat ventricles (500 ng, {circ}) and internal RT-PCR standard RNA (10,000 molecules, {blacksquare}) were coamplified for a varying number of PCR cycles. Panels C and D demonstrate the lack of competition between endogenous AT1 mRNA, AT2 mRNA and their specific internal standards. Different amounts of total RNA ({circ}) were reverse-transcribed and amplified by PCR for 30 cycles in the presence of a fixed amount of internal standard RNA (10,000 molecules, {blacksquare}).

 
The amplification efficiency was 97% for both AT1 and AT2. In Fig. 2Go, A and B, the slopes of the curves are identical, demonstrating that the RT-PCR amplification efficiency was the same for each Ang II receptor subtype and its specific internal standard (slopes 0.229 and 0.234, respectively, for AT1; slopes 0.257 and 0.253, respectively, for AT2).

To avoid competition between endogenous and synthetic RNAs, different amounts of total RNA combined with 10,000 molecules of the internal standard were reverse-transcribed, and the resultant cDNA mixtures were amplified by PCR. Figure 2Go, C and D, shows a linear relation between the radioactivity incorporated into the PCR products and the amount of starting RNA (200 to 1, 400 ng), whereas the radioactivity incorporated into the internal standard of each tube remained unchanged. This indicates the absence of competition between endogenous and synthetic RNAs.

Changes in ventricular Ang II receptor subtype mRNA levels. Figures 3AGo and 4AGo show typical RT-PCR analysis of AT1 and AT2 subtype mRNA in the LV of the young adult and aged rats. After PCR amplification, we obtained a PCR product of 444 bp for AT1 mRNA, as expected (Fig. 3AGo). The two subtypes of AT1 mRNA could then be differentiated by size after exposure to EcoRI, which hydrolyzed the AT1a mRNA into two fragments of 269 and 175 bp but did not affect the AT1b or internal standard mRNAs (Fig. 3BGo). As shown in Fig. 3CGo, the AT1 mRNA level was 2.6-fold higher in the RV than in the LV of the young adult rat heart (60, 728 ± 4,063 and 21, 707 ± 2, 101 molecules of AT1 mRNA/µg of total RNA, P < 0.0001, respectively). With aging, AT1 gene expression was increased 5.6-fold in the LV (P < 0.0001), but remained unchanged in the RV. The AT1 mRNA level was thus 2-fold higher in the LV than in the RV of aged rats. The percentages of AT1a mRNA (81%) and AT1b mRNA (19%) were the same in both adult and aged hearts and were independent of the ventricle analyzed.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Effect of aging on AT1 mRNA expression in the left (LV) and right (RV) ventricles of young adult and aged rats. RT-PCR analysis of cardiac AT1 receptor (A) and AT1 receptor subtype (B) mRNA levels in the left ventricle of young adult (lanes 1 and 2) and aged rats (lanes 3 and 4). 400 and 800 ng of total RNA with 10,000 molecules of internal standard were assayed. The RT-PCR products were loaded onto 5% polyacrylamide gel. Data are mean ± SEM of six separate experiments (C). MWM, Molecular weight marker.

 


View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. Effect of aging on AT2 mRNA expression in the left (LV) and right (RV) ventricles of young adult and aged rats. RT-PCR analysis of cardiac angiotensin AT2 receptor (A) mRNA levels in the left ventricle of young adult (lanes 1 and 2) and aged rats (lanes 3 and 4). 400 and 800 ng of total RNA with 10,000 molecules of internal standard AT2 RNA were assayed. The RT-PCR products were loaded onto a 5% polyacrylamide gel. Data are mean ± SEM of six separate experiments (B). MWM, Molecular weight marker.

 
For AT2 mRNA, a PCR product of 536 bp was obtained, as expected (Fig. 4AGo). The AT2 mRNA level was higher in the RV than in the LV of the young adult rat heart (33, 838 ± 2, 485 and 23, 821 ± 1, 257 molecules of AT2 mRNA/µg of total RNA, P < 0.008, respectively). With aging, AT2 gene expression was increased 4.2-fold in the LV (P < 0.0001) and 2.8-fold in the RV (P < 0.0001) (Fig. 4BGo).

To assess the cellular expression of Ang II receptor subtypes, we analyzed their relative level in freshly isolated cardiomyocytes. As shown in Fig. 5Go, A and B, freshly isolated myocytes from the LV of young adult rat hearts expressed both AT1 and AT2 mRNAs. Quantification showed a 2.3- (P < 0.003) and 2.1-fold (P < 0.01) increase in AT1 and AT2 mRNA accumulations, respectively, in the cardiomyocytes of senescent rats (Fig. 5CGo).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 5. Effect of aging on AT1 (A) and AT2 (B) gene expression in freshly isolated cardiomyocytes of young adult and aged rats. The levels of each subtype were quantified by RT-PCR as described in Fig 2Go. The RT-PCR products were loaded onto a 5% polyacrylamide gel. The absolute values in the control group were expressed as molecules/µg of total RNA. An experiment was performed using total RNA extracted from cells obtained by a single preparation. Data are mean ± SEM of six separate experiments. **, P < 0.01 (C). MWM, Molecular weight marker.

 
ACE mRNA accumulation
Finally, because ACE mRNA level has been recently correlated with that of AT1-receptor signaling, we quantified levels of ACE mRNA. ACE mRNA level was 40-fold higher in the RV than in the LV of the young adult rat heart (P < 0.0001). ACE gene expression was increased 1.9-fold in the LV of senescent rats as compared with young animals (1,089 ± 0, 136 vs. 551 ± 29 fg mRNA/µg total RNA, P < 0.003), but remained unchanged in the RV (22,797 ± 2,154 vs. 21,830 ± 2,414 fg mRNA/µg total RNA, P = NS).

Ang II binding assay
125I-Ang II binding was uniformly distributed throughout the ventricular myocardium (Fig. 6AGo). Addition of 10-6 M of Ang II reduced binding in all structures (Fig. 6BGo). No difference was observed between the specific binding in the LV and RV of both adult and senescent rat hearts (Fig. 6Go, C and D, respectively). PD 123319 (Fig. 6Go, E and F) and losartan (Fig. 6Go, G and H) also inhibited radioligand binding in all structures of both adult and senescent rat myocardium. Quantification of specific binding in the LV myocardium of young adult rats indicated that the density of AT1 and AT2 was similar (53% for AT1 and 47% for AT2), in agreement with previous studies in normal rat hearts (32, 33). The mean Ang II receptor density was 7.92 fmol/mg of protein, as previously described (31).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. Age-related regulation of rat myocardial angiotensin II (Ang II) receptor and Ang II receptor subtype (AT1 and AT2) densities. Equatorial sections (20 µm) of rat heart were incubated with 2 nM (125I-Sar1-Ile8)-Angiotensin II. Ligand binding was widely distributed in the myocardium (A). Incubation with 5 µM Ang II markedly inhibited radioligand binding (B). Panels C and D show the specific binding in both adult and senescent rat hearts, respectively. Identification of Ang II receptor subtypes (AT1 and AT2) was determined in competition binding experiments by their sensitivity to subtype-selective concentrations of PD123319 or losartan. Specific 125I-angiotensin II binding sensitive to PD123319 or losartan is estimated as the density of AT1 receptor (panel E for young adult rat myocardium, and panel F for senescent rat myocardium) or the density of AT2 receptor (panel G for young adult rat myocardium, and panel H for senescent rat myocardium), respectively. Specific binding was calculated as the difference between total and nonspecific binding. Values are given as the mean ± SEM of six separate experiments. **, P < 0.0001.

 
Quantification of 125I-Ang II binding (Fig. 6Go, right panel) demonstrated a 3.9-fold increase in specific binding in the LV myocardium of senescent rats (30.67 ± 3.13 vs. 7.92 ± 0.72 fmol/mg protein in aged and young rat myocardium, respectively, P < 0.0001). The percentage of AT-R subtypes did not change with aging (55% and 45% for AT1 and AT2, respectively).

Statistical analysis
As shown in Table 2Go, linear regression analysis was performed for each parameter in both ventricles. In the LV, significant correlations were observed between all parameters studied. By contrast, in the RV only AT2 mRNA level was significantly correlated with fibrosis.


View this table:
[in this window]
[in a new window]
 
Table 2. Simple correlations between Ang II receptor subtype mRNA levels, ACE mRNA levels, and interstitial fibrosis in the ventricles of aged rat myocardium

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously demonstrated activation of intracardiac Ang II synthesis during aging (26). Thus, the aim of the present study was to test the hypothesis that the expression of Ang II receptor subtypes was also modified.

The present study demonstrates differential expression of AT1 and AT2 receptor subtype mRNAs in the rat heart. In the young adult, the levels of AT1 and AT2 mRNA are markedly higher in the right than in the left ventricle. Interestingly, such differences in gene expression between the RV and LV have been previously described for other components of the cardiac RAS, such as ANG and ACE mRNA (26). With aging, we observed that AT2 mRNA level increase equally in both ventricles, whereas AT1a and AT1b mRNA levels increase markedly in the LV only.

The increase in mRNA levels coding for Ang II receptor subtypes detected in the LV of senescent rats was also observed in freshly isolated cardiomyocytes. However, the magnitude of the increase in LV cardiomyocytes (>2-fold increase for both subtypes) was less prominent compared with that in LV tissue (>4-fold increase for both subtypes). Therefore, AT1 and AT2 gene expression in aged rat LV is also increased, and to a greater extent, in the nonmyocyte cell population (including fibroblasts, vascular smooth muscle cells and endothelial cells), which is known to express both Ang II receptor subtypes (34, 35, 36). Finally, the increase in Ang II receptor subtype mRNA levels in the LV is quite similar to that observed for the corresponding protein, suggesting transcriptional regulation of these genes in the LV of aged rats.

The presumed mechanistic pathways involved in the increase in cardiac Ang II receptor gene expression are multiple. First, this up-regulation could be intrinsic to the developmental gene reprogramming often associated with senescence. Indeed, it is well established that cardiac senescence is characterized by the reexpression of fetal proteins, such as the contractile protein isoform ß-MHC and the atrial natriuretic peptide gene (37, 38). On the other hand, several studies in rat ventricular tissue have previously demonstrated developmental regulation of cardiac Ang II receptor subtype densities and gene expression, which are abundant during the neonatal period and decrease with maturation (31, 34, 39). Secondly, humoro-hormonal status is modified during senescence, and is characterized by a large decrease in plasma Ang II synthesis, and an increase in plasma cortisol level (26). A number of circulating factors, such as vasoactive substances, growth factors, and steroids, modulate AT1 expression via their effects on the transcriptional activity of AT1 gene (40, 41, 42, 43). However, the differential pattern of AT1 gene expression observed in the LV and RV of aged rats makes a major role of hormones in the regulation of AT1 gene expression unlikely. In contrast, much less is known about the hormonal regulation of AT2 mRNA level. However, based on the up-regulation of AT2 gene expression in both ventricles of aged rats, hormonal and humoral factors might be one of the triggers for the increase in cardiac AT2 gene expression during senescence. Thirdly, mechanical factors are repeatedly proposed as triggers for the regulation of genetic expression during the development of cardiac hypertrophy. Activation of AT1 and/or AT2 gene expression has been demonstrated in ventricular tissue during hemodynamic overload (19, 33). Mechanical stretch has also been recently shown to up-regulate AT1 and AT2 gene expression in neonatal rat cardiac myocytes, the increase in AT1 gene expression being mainly due to increased transcription, whereas that of AT2 results from stabilization of AT2 mRNA metabolism (44). Even though cardiac output and ejection fraction of both aged human and rat hearts are unaltered, the increase in vascular stiffness and aortic impedance during aging result in a moderate increase in LV afterload (45, 46). These changes in LV properties might therefore account, at least in part, for the up-regulation of AT1 gene expression in the LV of aged rats.

The present study demonstrates increased density of both AT1 and AT2 receptors in the LV myocardium of senescent rats and extends our previous observations concerning an activation of the intracardiac RAS in aging, associated with suppression of plasma Ang II synthesis. Such local and independent regulation of intracardiac Ang II synthesis and receptor subtype expression could account for both autocrine and paracrine actions (47) and support the concept of intracardiac Ang II production as a regulator of cardiac hypertrophy and collagen accumulation. We and others have demonstrated that cardiac senescence is associated with both modulation of myocardial phenotype and remodeling of both ventricles, characterized by increased deposition of extracellular matrix proteins, such as collagen, in the interstitium and around vessels (22, 25). Cardiac fibrosis is a major factor in enhancing myocardial stiffness and results in altered diastolic compliance. Recently, it has been shown that age-induced cardiac fibrosis mainly results from decreased collagenase activity, and not from collagen gene up-regulation (48). Moreover, Ang II has been proposed to contribute directly to the development of fibrosis via both AT1 and AT2 receptor subtypes. In vitro, Ang II induces cardiac fibroblast hyperplasia and collagen expression via AT1 receptor (16, 49). Activation of the AT2 receptor also seems to be involved in the fibrotic process because Ang II stimulates collagen synthesis via this receptor (50). The strong correlation between AT2 gene expression and fibrosis in both ventricles in the present study, compared with the correlation of AT1 and ACE mRNA levels with LV fibrosis only, leads us to propose that age-associated cardiac fibrosis is more closely related to the AT2 than the AT1 receptor subtype. These data are in agreement with the recent study of Lorell et al., who demonstrated that both AT1 inhibition and decrease in ACE gene expression affected neither cardiac fibrosis or hypertrophy in a presssure-overload rat model (51).

In conclusion, the present study extends our previous observations demonstrating the activation of an intracardiac RAS in senescent rats. Such up-regulation of the cardiac RAS may, in part, compensate for the large age-related fall in plasma Ang II synthesis. However, activation of the intracardiac RAS and increased expression of Ang II receptor subtypes might have detrimental effects when other pathologies often associated with senescence, such as hypertension and heart failure, are superimposed. Ang II receptor subtype antagonists could be therapeutically useful in elderly people. However, this possibility would require direct testing in experimental animals.


    Acknowledgments
 
The authors thank Dr. L. Rappaport for helpful discussions, and Dr. S. Lehoux and Dr. B. Prendergast for kind help in preparing the manuscript. They also thank Mr. T. Dakhli for animal handling.


    Footnotes
 
1 This study was supported in part by grants from Fédération Française de Cardiologie, Fondation pour la Recherche Médicale, and Société Française d’Hypertension Artérielle, INSERM. Back

Received December 4, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Campbell DJ 1987 Circulating and tissue angiotensin systems. J Clin Invest 79:1–6
  2. Dzau VJ 1988 Circulating vs. local renin-angiotensin system in cardiovascular homeostasis. Circulation [Suppl I] 77:4–13
  3. Lindpainter K, Jin M, Niederlaier N, Wilhelm M, Ganten D 1990 Cardiac angiotensinogen and its local activation in the isolated perfused beating heart. Circ Res 67:564–573[Abstract/Free Full Text]
  4. Schunkert H, Dzau VJ, Tang SS, Hirsch AT, Apstein CS, Lorell BH 1990 Increased rat cardiac angiotensin-converting enzyme activity and mRNA levels in pressure overload left ventricular hypertrophy. J Clin Invest 86:1913–1920
  5. Timmermans PBMWM, Wong PC, Chiu AT, Herblin WF, Benfield P, Carini DJ, Lee RJ, Wexler RR, Saye JAM, Smith RD 1993 Angiotensin II receptors and angiotensin II antagonists. Pharmacol Rev 45:201–251
  6. Iwai N, Inagami T 1992 Identification of two subtypes in the rat type I angiotensin II receptors. FEBS Lett 298:257–260[CrossRef][Medline]
  7. Kakar SS, Sellers JC, Devor DC, Musgrove LC, Neill JD 1992 Angiotensin II type I receptor subtype cDNAs: differential expression and hormonal regulation. Biochem Biophys Res Commun 183:1090–1096[CrossRef][Medline]
  8. Sandberg K, Ji H, Clark AJL, Shapira H, Catt KJ 1992 Cloning and expression of a novel angiotensin II receptor subtype. J Biol Chem 267:9455–9458[Abstract/Free Full Text]
  9. Szpirer C, Rivière M, Szpirer J, Levan G, Guo DF, Iwai N, Inagami T 1993 Chromosomal assigment of human and rat hypertension candidate genes: type I angiotensin II receptor genes and the Sa gene. J Hypertens 11:919–925[CrossRef][Medline]
  10. Grady EF, Sechi LA, Griffin CA, Schambelan M, Kalinyak JE 1991 Expression of AT2 receptors in the developing rat fetus. J Clin Invest 88:921–933
  11. Tsutsumi K, Strömberg C, Viswanathan M, Saavedra JM 1991 Angiotensin II receptor subtypes in fetal tissues of the rat: autoradiography, guanine nucleotide sensitivity and association with phosphoinositide hydrolysis. Endocrinology 129:1075–1082[Abstract/Free Full Text]
  12. Linz W, Schoelkens BA, Ganten D 1989 Converting enzyme inhibitor spec-ifically prevents development and induces the regression of cardiac hypertrophy in rats. Clin Exp Hypertens 11:1325–1350[CrossRef]
  13. Pahor M, Bernabei R, Sgadari A, Gambassi Jr G, Giudice PL, Pacifici L, Ramacci MT, Lagrasta C, Olivetti G, Carbonin P 1991 Enalapril prevents cardiac fibrosis and arrhythmias in hypertensive rats. Hypertension 18:148–157[Abstract/Free Full Text]
  14. Brilla CG, Janicki JS, Weber KT 1991 Cardioreparative effects of lisinopril in rats with genetic hypertension and left ventricular hypertrophy. Circulation 83:1771–1779[Abstract/Free Full Text]
  15. Geisterfer AAT, Peach MJ, Owens GK 1988 Angiotensin II induces hypertrophy, not hyperplasia, of cultured rat aortic smooth muscle cells. Circ Res 62:749–756[Abstract/Free Full Text]
  16. Sadoshima J, Izumo S 1993 Molecular characterisation of angiotensin II induced hypertrophy of cardiac myocytes and hyperplasia of cardiac fibroblasts. Circ Res 73:413–423[Abstract/Free Full Text]
  17. Crabos M, Roth M, Hahn AWA, Erne P 1994 Characterization of angiotensin II receptors in cultured adult rat cardiac fibroblasts. J Clin Invest 93:2372–2378
  18. Kato H, Suzoki H, Tajima S, Ogata Y, Tominaga T, Sato A, Sarota T 1991 Angiotensin II stimulates collagen synthesis in cultured vascular smooth cells. J Hypertens 9:17–22[Medline]
  19. Nio Y, Matsubara H, Murasawa S, Kanasaki M, Indana M 1995 Regulation of gene transcription of angiotensin II receptor subtypes in myocardial infarction. J Clin Invest 95:46–54
  20. Wu J, Edwards D, Berecek KH 1994 Changes in renal angiotensin II receptors in spontaneously hypertensive rats by early treatment with the angiotensin-converting enzyme inhibitor captopril. Hypertension 23:819–822[Abstract/Free Full Text]
  21. Lakatta EG 1993 Cardiovascular regulatory mechanisms in advanced age. Physiol Rev 73:413–467[Free Full Text]
  22. Besse S, Robert V, Assayag P, Delcayre C, Swynghedauw B 1994 Nonsynchronous changes in myocardial collagen mRNA and protein during aging: effect of DOCA-salt hypertension. Am J Physiol 267:H2237–H2244
  23. Hachamovitch R, Wicker P, Capasso JM, Anversa P 1989 Alterations of coronary blood flow and reserve with aging in Fischer 344 rats. Am J Physiol 256:H66–H73
  24. Carré F, Lessard Y, Coumel P, Ollivier L, Besse S, Lecarpentier Y, Swynghedauw B 1992 Spontaneous arrhythmias in various models of cardiac hypertrophy and senescence of rats: a Holter monitoring study. Cardiovasc Res 26:698–705[Medline]
  25. Michel JB, Heudes D, Michel O, Poitevin P, Philippe M, Scalbert E, Corman B, Levy BI 1994 Effect of chronic angiotensin converting enzyme inhibition of the aging processes: II-large arteries. Am J Physiol 267:R124–R135
  26. Heymes C, Swynghedauw B, Chevalier B 1994 Activation of angiotensinogen and angiotensin-converting enzyme gene expression in the left ventricle of senescent rats. Circulation 90:1328–1333[Abstract/Free Full Text]
  27. Aupetit-Faisant B, Battaglia C, Zenatti M, Emeric-Blanchouin N, Legrand JC 1993 Hypoaldosteronism accompanied by normal or elevated mineralocorticosteroid pathway steroid: a marker of adrenal carcinoma. J Clin Endocrinol Metab 76:38–43[Abstract]
  28. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  29. Dubus I, Samuel JL, Marotte F, Delcayre C, Rappaport L 1990 ß-adrenergic agonists stimulate the synthesis of noncontractile but not contractile proteins in cultured myocytes isolated from adult rat heart. Circ Res 66:867–874[Abstract/Free Full Text]
  30. Llorens-Cortes C, Greenberg B, Huang H, Corvol P 1994 Tissular expression and regulation of type I angiotensin receptor subtypes by quantitative reverse transcriptase polymerase chain reaction analysis. Hypertension 24:538–548[Abstract/Free Full Text]
  31. Hunt RA, Ciuffo GM, Saavedra JM, Tucker DC 1995 Quantification and localisation of angiotensin II receptors and angiotensin converting enzyme in the developing rat heart. Cardiovasc Res 29:834–840[CrossRef][Medline]
  32. Sechi LA, Griffin CA, Grady EF, Kalinyak JE, Schambelan M 1992 Characterization of angiotensin II receptor subtypes in rat heart. Circ Res 71:1482–1489[Abstract/Free Full Text]
  33. Suzuki J, Matsubara H, Urakami M, Inada M 1993 Rat angiotensin II (type IA) receptor mRNA regulation and subtype expression in myocardial growth and hypertrophy. Circ Res 73:439–447[Abstract/Free Full Text]
  34. Matsubara H, Kanasaki M, Murasawa S, Tsukagushi Y, Nio Y, Inada M 1994 Differential gene expression and regulation of angiotensin II receptor subtypes in rat cardiac fibroblasts and cardiomyocytes in culture. J Clin Invest 93:1592–1601
  35. Nakajima M, Hutchinson HG, Fujinaga M, Hayashida W, Morishita R, Zhang L, Horiuchi M, Pratt RE, Dzau VJ 1995 The angiotensin II type 2 (AT2) receptor antagonizes the growth effects of the AT1 receptor: gain-of-function study using gene transfer. Proc Natl Acad Sci USA 92:10663–10667[Abstract/Free Full Text]
  36. Stoll M, Steckelings M, Paul M, Bottari SP, Metzger R, Unger T 1995 The angiotensin AT2-receptor mediates inhibition of cell proliferation in coronary endothelial cells. J Clin Invest 95:651–657
  37. Lompre AM, Mercadier JJ, Schwartz K 1991 Changes in gene expression during cardiac growth. Int Rev Cytol 124:137–186[Medline]
  38. Chien KR, Knowlton KU, Zhu H, Chien S 1991 Regulation of cardiac gene expression during myocardial growth and hypertrophy: molecular studies of an adaptative physiologic response. FASEB J 5:3037–3046[Abstract]
  39. Everett AD, Fisher A, Tufro-McReddie A, Harris M 1997 Developmental regulation of angiotensin type 1 and 2 receptor gene expression and heart growth. Mol Cell Cardiol 29:141–148[CrossRef][Medline]
  40. Guo DF, Uno S, Ishihata A, Nakamura N, Inagami T 1995 Identification of a cis-acting glucocorticoid responsive element in the rat angiotensin II type IA promoter. Circ Res 77:249–257[Abstract/Free Full Text]
  41. Sato A, Suzuki H, Murakami M, Nakazato Y, Iwaita Y, Saruta T 1994 Glucocorticoid increases angiotensin II type I receptor and its gene expression. Hypertension 23:25–30[Abstract/Free Full Text]
  42. Ullian ME, Schelling JR, Linas SL 1992 Aldosterone enhances angiotensin II receptor binding and inositol phosphate responses. Hypertension 20:67–73[Abstract/Free Full Text]
  43. Iwai N, Inagami T 1992 Regulation of the expression of the rat angiotensin II receptor mRNA. Biochem Biophys Res Commun 182:1094–1099[CrossRef][Medline]
  44. Kijima K, Matsubara H, Murasawa S, Murayama K, Mori Y, Ohkubo N, Komuro I, Yazaki Y, Iwasaka T, Inada M 1996 Mechanical stretch induces enhanced expression of angiotensin II receptor subtypes in neonatal rat cardiac myocytes. Circ Res 79:887–897[Abstract/Free Full Text]
  45. Rodeheffer RJ, Gerstenblith G, Becker LC, Fleg JL, Weisfeldt ML, Lakatta EG 1984 Exercise cardiac output is maintained with advancing age in healthy human subjects: cardiac dilatation and increased stroke volume compensate for a diminished heart rate. Circulation 69:203–213[Abstract/Free Full Text]
  46. Assayag P, Charlemagne D, de Leiris J, Boucher F, Valère PE, Lortet S, Swynghedaw B, Besse S 1997 Senescent heart compared with pressure overload-induced hypertrophy. Hypertension 29:15–21[Abstract/Free Full Text]
  47. Baker KM, Booz GW, Dostal DE 1992 Cardiac actions of angiotensin II: role of an intracardiac renin-angiotensin system. Annu Rev Physiol 54:227–241[CrossRef][Medline]
  48. Robert V, Besse S, Sabri A, Silvestre JS, Assayag P, Van Thiem N, Swynghedauw B, Delcayre C 1997 Differential regulation of matrix metalloproteinases associated with aging and hypertension in the rat heart. Lab Invest 76:729–738[Medline]
  49. Brilla CG, Zhou G, Matsubara L, Weber KT 1994 Collagen metabolism in cultured adult rat cardiac fibroblasts: response to angiotensin II and aldosterone. J Mol Cell Cardiol 26:809–820[CrossRef][Medline]
  50. Levy BI, Benessiano J, Henrion D, Caputo L, Heymes C, Duriez M, Poitevin P, Samuel JL 1996 Chronic blockade of AT2-subtype receptors prevents the effect of angiotensin II on the rat vascular structure. J Clin Invest 98:418–425[Medline]
  51. Weinberg EO, Lee MA, Weigner M, Lindpainter K, Bishop SP, Benedict CR, Ho KKL, Douglas PS, Chafizadeh E, Lorell BH 1997 Angiotensin AT1 receptor inhibition. Effects on hypertrophic remodeling and ACE expression in rats with pressure-overload hypertrophy due to ascending aortic stenosis. Circulation 95:1592–1600[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
HypertensionHome page
F. Scalera, J. Martens-Lobenhoffer, A. Bukowska, U. Lendeckel, M. Tager, and S. M. Bode-Boger
Effect of Telmisartan on Nitric Oxide-Asymmetrical Dimethylarginine System: Role of Angiotensin II Type 1 Receptor and Peroxisome Proliferator Activated Receptor {gamma} Signaling During Endothelial Aging
Hypertension, March 1, 2008; 51(3): 696 - 703.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
I. H. Schulman, M.-S. Zhou, E. A. Jaimes, and L. Raij
Dissociation between metabolic and vascular insulin resistance in aging
Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H853 - H859.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
L. Groban, N. A. Pailes, C. D. L. Bennett, C. S. Carter, M. C. Chappell, D. W. Kitzman, and W. E. Sonntag
Growth Hormone Replacement Attenuates Diastolic Dysfunction and Cardiac Angiotensin II Expression in Senescent Rats
J. Gerontol. A Biol. Sci. Med. Sci., January 1, 2006; 61(1): 28 - 35.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. Kintsurashvili, A. Duka, I. Ignjacev, G. Pattakos, I. Gavras, and H. Gavras
Age-related changes of bradykinin B1 and B2 receptors in rat heart
Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H202 - H205.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Volkova, R. Garg, S. Dick, and K. R. Boheler
Aging-associated changes in cardiac gene expression
Cardiovasc Res, May 1, 2005; 66(2): 194 - 204.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Yamamoto, K. Takeshita, T. Kojima, J. Takamatsu, and H. Saito
Aging and plasminogen activator inhibitor-1 (PAI-1) regulation: implication in the pathogenesis of thrombotic disorders in the elderly
Cardiovasc Res, May 1, 2005; 66(2): 276 - 285.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. M. Duke, R. G. Evans, and R. E Widdop
AT2 receptors contribute to acute blood pressure-lowering and vasodilator effects of AT1 receptor antagonism in conscious normotensive but not hypertensive rats
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2289 - H2297.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. G. Ebrahimian, R. Tamarat, M. Clergue, M. Duriez, B. I. Levy, and J.-S. Silvestre
Dual Effect of Angiotensin-Converting Enzyme Inhibition on Angiogenesis in Type 1 Diabetic Mice
Arterioscler Thromb Vasc Biol, January 1, 2005; 25(1): 65 - 70.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
F. Michel, M.-L. Ambroisine, M. Duriez, C. Delcayre, B. I. Levy, and J.-S. Silvestre
Aldosterone Enhances Ischemia-Induced Neovascularization Through Angiotensin II-Dependent Pathway
Circulation, April 27, 2004; 109(16): 1933 - 1937.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Shivakumar, D. E. Dostal, K. Boheler, K. M. Baker, and E. G. Lakatta
Differential response of cardiac fibroblasts from young adult and senescent rats to ANG II
Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1454 - H1459.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. Xu, I. A Arenas, S. J Armstrong, and S. T Davidge
Estrogen modulation of left ventricular remodeling in the aged heart
Cardiovasc Res, February 1, 2003; 57(2): 388 - 394.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Adamy, P. Oliviero, S. Eddahibi, L. Rappaport, J.-L. Samuel, E. Teiger, and C. Chassagne
Cardiac modulations of ANG II receptor expression in rats with hypoxic pulmonary hypertension
Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H733 - H740.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J.-S. Silvestre, R. Tamarat, T. Senbonmatsu, T. Icchiki, T. Ebrahimian, M. Iglarz, S. Besnard, M. Duriez, T. Inagami, and B. I. Levy
Antiangiogenic Effect of Angiotensin II Type 2 Receptor in Ischemia-Induced Angiogenesis in Mice Hindlimb
Circ. Res., May 31, 2002; 90(10): 1072 - 1079.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. M. Roesch, Y. Tian, W. Zheng, M. Shi, J. G. Verbalis, and K. Sandberg
Estradiol Attenuates Angiotensin-Induced Aldosterone Secretion in Ovariectomized Rats
Endocrinology, December 1, 2000; 141(12): 4629 - 4636.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Gallinat, S. Busche, M. K. Raizada, and C. Sumners
The angiotensin II type 2 receptor: an enigma with multiple variations
Am J Physiol Endocrinol Metab, March 1, 2000; 278(3): E357 - E374.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. Yang, D. F. Larson, and R. Watson
Age-related left ventricular function in the mouse: analysis based on in vivo pressure-volume relationships
Am J Physiol Heart Circ Physiol, November 1, 1999; 277(5): H1906 - H1913.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
V. Robert, C. Heymes, J.-S. Silvestre, A. Sabri, B. Swynghedauw, and C. Delcayre
Angiotensin AT1 Receptor Subtype as a Cardiac Target of Aldosterone : Role in Aldosterone-Salt–Induced Fibrosis
Hypertension, April 1, 1999; 33(4): 981 - 986.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heymes, C.
Right arrow Articles by Samuel, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heymes, C.
Right arrow Articles by Samuel, J.-L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals