| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
INSERM U127 (C.H., J.-S.S., F.M., B.C., B.S., J.-L.S.), INSERM U141 (B.I.L.), IFR Circulation, Hôpital Lariboisière, 75475 Paris Cedex 10, France, INSERM U36 (C.L.-C.), Collège de France, 75475 Paris Cedex 5, France
Address all correspondence and requests for reprints to: Dr. Jane-Lise Samuel, INSERM U127, IFR Circulation, Hôpital Lariboisière, 41 bd de la Chapelle, 75475 Paris Cedex 10, France.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
AT1 and AT2 receptor subtype messenger RNA (mRNA) levels were quantitated by RT-PCR. In parallel, specific Ang II densities were determined in competition binding experiments using specific antagonists. AT1a and AT1b mRNA levels were markedly up-regulated (5.6-fold) in the left ventricle of 24-month-old rats compared with 3-month-old rats, but not in the right ventricle. In contrast, AT2 gene expression was increased in both ventricles of senescent rats (4.2- and 2.8-fold in the left and right ventricles, respectively). Similarly, AT1 and AT2 gene expression was increased 2.3- and 2-fold, respectively, in freshly isolated cardiomyocytes from aged rats. Furthermore, AT1 and AT2 specific binding was increased in the aged left ventricular myocardium.
Even though the mechanistic pathway of this up-regulation of Ang II receptor subtype gene expression might be intrinsic to developmental gene reprogramming, the up-regulation of AT1 mRNA accumulation in the left ventricle during aging could also be secondary to age-related hemodynamic changes, whereas increased AT2 gene expression in both ventricles may depend upon hormonal and humoral factors.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Though the favorable effects of ACE inhibition on cardiac function have generally been attributed to afterload reduction, many lines of evidence also suggest a pivotal role for the intracardiac Ang II-forming pathway in mediating cardiac hypertrophy and fibrosis (12, 13, 14). Moreover, recent studies have suggested a direct role for Ang II via its specific receptors. Indeed, Ang II promotes a growth response in cultured vascular smooth muscle cells (15), cardiomyocytes, and fibroblasts (16). Ang II also stimulates collagen synthesis in cardiac fibroblasts (17) and vascular smooth muscle cells (18). To date, most of the well-known cardiovascular functions of Ang II are mediated via the AT1 receptor, whereas there is little information regarding the physiological role of AT2 receptor. Enhanced Ang II receptor subtype expression has been demonstrated in cardiovascular diseases involving cardiovascular remodeling, but the expression of Ang II receptor subtypes has not been investigated in the aging heart (19, 20).
Senescence is associated with marked changes in cardiac structure and morphology such as cardiomyocyte loss, hypertrophy of the remaining cells, and the development of fibrosis (21, 22). These changes may account for the functional characteristics of the senescent myocardium: namely, impaired myocardial perfusion (23), altered diastolic compliance (21), and arrhythmias (24). Vascular structure is also modified, and aging is associated with increased arterial wall stiffness, as shown by a significant decrease in systemic and local arterial compliance and an increase in aortic impedance (21, 25), which may induce mild left ventricular hypertrophy. Interestingly, there is now evidence that senescence is associated with increased cardiac ANG and ACE gene expression, suggesting increased cardiac Ang II synthesis, whereas plasma RAS activity is largely depressed (26).
The present study was thus undertaken to determine the expression of cardiac AT1 and AT2 receptor subtypes in the right and left ventricles of aged rats, at messenger RNA (mRNA) and protein level. The data demonstrate that AT1a and AT1b mRNA levels markedly increase in the left ventricle, whereas AT2 gene expression is up-regulated in both ventricles. To assess cellular expression precisely, we investigated Ang II receptor subtype gene expression in freshly isolated left ventricular cardiomyocytes. Ang II type 1 and type 2 receptor mRNA levels were increased in freshly isolated cardiomyocytes of aged rats compared with cardiomyocytes of young adult rats. Finally, the density of AT1 and AT2 receptors was homogeneously increased in the left ventricular myocardium of aged hearts.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The hearts were removed, and transverse sections of heart were embedded in mounting medium and frozen in liquid nitrogen-cooled isopentane. Left and right ventricles (LV, RV) were then separated from the remainder of the heart, and all samples were stored at -70 C until use.
Collagen morphometry
Transverse myocardial sections (5 µm thick) were stained with
collagen-specific Sirius red stain (0.5% in saturated picric acid).
Sections were studied blindly by a single examiner. Each field was
digitized on a Macintosh Performa 5320 by a gray level camera
(Hamamatsu) mounted on a light microscope (Leica) at 100x
magnification, and collagen was quantified using image-analysis
software (OPTILAB, Graftek, Mirmank, France).
RNA extraction
Total RNA was extracted according to the method of Chomczynski
and Sacchi (28). Purified RNA was dissolved in water and the
concentration measured by absorbance at 260 nm. The yields of total RNA
extracted from LV and RV were similar and unchanged in senescent rats
(data not shown). The quality of RNA was confirmed by ethidium bromide
staining in 1% agarose gel. Quantitative RT-PCR was then performed for
Ang II receptor subtype gene expression. Slot blot were also performed
for quantification of ACE mRNA levels.
Isolation of cardiac myocytes
Left ventricular myocytes were isolated by the procedure of
Dubus et al. (29). Briefly, the hearts of young adult and
aged rats were cannulated through the aorta on a Langendorff apparatus,
and perfused at 37 C for 3 min with a modified Krebs solution (10
mM HEPES buffer, pH 7.4, 35 mM NaCl, 10
mM glucose, 134 mM sucrose, 16 mM
Na2HPO4, 25 mM NaHCO3, 4.75
mM KCl, 1.19 mM
KH2PO4), then for 30 min with the same buffer
supplemented with 1 mg/ml collagenase (EC 3.4.24.3., Boehringer,
Mannheim) and 5 mg/ml of purified BSA (fraction V, Miles Laboratories)
at a rate of 2 ml/min. Perfusion pressure was 60 mmHg. After perfusion,
the LV was gently dissociated with forceps in Hepes buffer, and the
resultant suspension filtered through a nylon mesh (500 µm) and
centrifuged for 4 min at 50 x g. Cells were washed and
sedimented twice in HEPES buffer to purify the myocytes. The fraction
contained 90–95% myocytes, as assessed by microscopic observation of
the cells. Total myocyte RNA was extracted according to the trizol
reagent protocol (Life Technologies, Cergy Pontoise, France), and the
quality of RNA was confirmed by ethidium bromide staining in 1%
agarose gel.
Slot blot analysis of ACE mRNA accumulation
For quantification of ACE mRNA levels, slot blot hybridization
analyses were performed on total RNA from left and right ventricles and
on fragments of mRNA prepared by synthesizing the sense RNA strand from
the ACE plasmid vectors. Samples were formaldehyde-denatured and then
serially diluted in 20 x SSC (pH 7.0) and blotted to nylon
filters (Hybond-N, Amersham, France). Six different concentrations of
total RNA (20, 17.5, 15, 12.5, 10, 7.5 µg and 6.4, 4.8, 3.2, 2.4,
1.2, 0.8 µg for the LV and RV) and six amounts of in vitro
synthesized ACE mRNA (20, 17.5, 15, 12.5, 10, 7.5 pg) were studied.
The ACE complementary DNA (cDNA) was labeled by the random priming method (Multiprime DNA labeling system, Amersham) with (a-32P)dCTP (3,000 Ci/mmol) to a specific activity of 1–1.5 x 109 cpm/µg DNA. The membranes were prehybridized overnight at 42 C in a buffer containing 50% deionized formamide, 5 x Denhardt’s solution, 5 x SSC, 50 mM Na phosphate, pH 6.8, 0.1% SDS, and 250 µg/ml sonicated denaturated herring sperm DNA and hybridized in the same buffer containing labeled probes. For hybridization, 32P-labeled ACE cDNA probe was added to a final concentration of 1–1.8 x 106 cpm/ml. After hybridization, blots were washed in 0.5 x SSC, 0.1% SDS three times for 15 min at room temperature, and twice for 15 min at 60 C. Autoradiograms generated by slot blots were scanned with a microdensitometer. The background was set to zero for each autoradiograph. Regression lines were calculated from integral values obtained by scanning the serial concentrations of each sample. The relative signals of the specific mRNA were estimated from the slope of the regression line. Experiments with synthetic mRNAs as a standard were carried out under conditions described above. One picogram of the 381 bases synthetic ACE mRNA fragment corresponds to 11.3 pg of the 4300 bases ACE mRNA (4300/381 = 11.3).
Quantitative RT-PCR of Ang II receptor subtypes
Oligonucleotides used for RT-PCR. For AT1, the
antisense primer was 5'GCACAATCGCCATAATTATCC3'
(extending from base 719 to base 739 of the coding sequence), and the
sense primer was 5'CACCTATGTAAGATCGCTTC3'
(extending from base 295 to base 314 of the coding sequence), giving a
DNA fragment of 444 bp. For AT2, the antisense primer was
5'ACCACTGAGCATATTTCTCGGG3' (extending from base
600 to base 622 of the coding sequence) and the sense primer was
5'TGAGTCCGCATTTAACTGC3' (extending from base 86
to base 105 of the coding sequence), giving a DNA fragment of 536 bp.
The oligonucleotides were synthesized by Bioprobe Systems (Montreuil,
France).
Internal standard preparation. Quantification of AT1 and AT2 mRNAs was performed in the presence of a defined concentration of specific RNA mutant as an internal standard.
For AT1, an internal standard was synthesized by in vitro transcription of the plasmid Bsd AT1a [a kind gift from Dr. C. Llorens-Cortes (30)] containing the entire coding sequence of the rat AT1a (nucleotides -182 to 1935), except for a 63-nucleotide deletion (nucleotides 502 to 564) containing the EcoRI restriction site. This results in a 384-bp amplification product. The deleted AT1a RNA was obtained using T7 RNA polymerase after linearization with SalI. The transcription reaction was performed in the presence of labeled UTP as a precursor and the concentration of the transcript was determined after measurement of the radioactivity incorporated into RNA product.
For AT2, the PCR product was subcloned into a pCRTMII-vector (TA Cloning Kit, Invitrogen). The AT2 PCR product was then linearized with HpaI and ligated with the 69-bp insert (a PvuI/ScaI fragment of pBluescript II SK phagemid), resulting in a 605-bp amplification product. The internal standard AT2 RNA was obtained using T7 RNA polymerase after the template had been linearised with HindIII. The transcription reaction was performed in the presence of labeled UTP as a precursor and the concentration of the transcript was determined after measurement of the radioactivity incorporated into RNA product.
Quantitative RT-PCR protocol. Total RNA was reverse-transcribed with a fixed amount of the specific synthetic RNA and 200 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies) for 90 min at 39 C. The reaction was performed in 20 µl of a mixture containing 0.4 µM of the reverse primer, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 2.5 mM dNTP, 10 mM DTT, and 50 U RNase inhibitor (Promega, Charbonnières, France). The reaction was stopped by heating samples for 10 min at 70 C. For PCR amplification, the resulting cDNA was amplified using 2.5 U Taq DNA polymerase (Boehringer, Meylan, France) and 80 nM primers in 50 µl of 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 2 mM MgCl2, 0.5 mM dNTP, 2 mM DTT and 0.01% gelatine. Thirty amplification cycles were undertaken as follows: denaturation at 95 C for 1 min, annealing at 54 C and 53 C for AT1 and AT2 respectively for 1 min, and extension at 72 C for 1 min 30 sec. To quantify AT1 and AT2 mRNA levels, a trace amount of (32P)-dCTP was included in the PCR reaction, and the number of C residues present in each fragment was taken into account for further quantification (AT1a = 117, AT1b = 113, AT1 internal standard = 105, AT2 = 105, AT2 internal standard = 123). After PCR amplification, the PCR products were digested by EcoRI to distinguish the AT1a from the AT1b subtype. The PCR products were then separated on a 5% polyacrylamide gel, and radioactive signals were analyzed using a computer based imaging system (Fuji Bas 1000, Fuji Medical Systems, Clichy, France).
Quantitative autoradiography of AT1 and
AT2
Transverse ventricular sections (20 µm thick) were cut on a
cryostat, and thaw mounted on gelatin coated glass slides. Ang II
binding sites were labeled with
(125I-Sar1-Ile8)-Ang II (NEN;
iodinated by DuPont; specific activity 2200 Ci/mmol) as previously
described (31). Briefly, consecutive sections were preincubated for 30
min at 22 C in 10 mM sodium phosphate buffer (pH 7.4)
containing 120 mM NaCl, 5 mM
Na2EDTA, 0.2% proteinase-free BSA (Sigma Chemical Co.,
Saint Quentin Fallavier, France) and 0.005% bacitracin (Sigma) to
remove endogenous bound ligand. Sections were incubated for 120 min at
room temperature in fresh buffer containing either 2 nM
(125I-Sar1-Ile8)-Ang II to
determine the total number of angiotensin II receptors, 0.5
nM (125I-Sar1-Ile8)-Ang
II in the presence of the AT1 antagonist losartan
(10-5 M, Dupont) to identify AT2
receptors or AT2 antagonist PD 123319 (10-5
M, provided by IdRS, Surcones, France) to identify the
AT1 receptors. Nonspecific binding was determined in the
presence of unlabeled Ang II (5 µM; Sigma). After
incubation, sections were washed four times for 1 min in fresh Tris-HCl
buffer 50 mM (pH 7.4, 4 C) and once in water at 4 C for 30
sec. Slides were first exposed to Fuji Bas 1000 screens (Fuji Medical
Systems, Clichy, France) for further quantification and then to
(3H)-hyperfilm in x-ray cassettes. A series of 20 µm
autoradiographic 125I- labeled microscales (Amersham,
Courtaboeuf, France) was included in each cassette. After a 4-week
exposure period, films were developed for 4 min in D19 Kodak
(Rochester, NY) developer, washed for 15 sec in 0.6% acetic acid, and
fixed for 4 min with Kodak rapid fixer. The radioactive signals were
analyzed using a computer-based imaging system (Fuji Bas 1000). Optical
densities of the autoradiograms were determined by computerized
densitometry and expressed as fmol/mg of protein by comparison with a
calibration curve constructed from the 125I-labeled
standards. The quantification of Ang II receptor subtype densities was
performed on the left ventricle, which represent the majority of the
section surface.
Statistics
Statistical significance was estimated between two groups using
one-way ANOVA and group-to-group comparison using the Student’s
t test. The test was considered significant for
P < 0.05. The values presented are mean ±
SEM.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Both the
renin activity and angiotensin I concentration were significantly
reduced, as previously described (25). The aldosterone concentration
remained unchanged, and the plasma cortisol level increased in
senescent rats (Table 1).
|
), as previously
described (23). Sirius red staining revealed an increase in myocardial
fibrosis (i.e. the ratio of total collagen surface area to
total ventricular surface area, expressed as a percentage) in the aged
group relative to controls. Senescent rat heart was characterized by an
increase in interstitial connective tissue surrounding individual
myocytes. There was also a large increase in perivascular fibrosis.
Quantification displayed a 3-fold increase in interstitial fibrosis in
both LV and RV (P < 0.005) of aged rats, as compared
with young adult rats (Fig. 1B).
|
, A and B, shows that the amplification
rate was exponential between 25 and 31 cycles for AT1 and
AT2 cardiac mRNA as well as their specific internal
standard. All experiments were therefore performed at 30 cycles because
this was in the exponential phase and the radioactive signal was
strongly detected.
|
, A and B, the slopes of the curves are
identical, demonstrating that the RT-PCR amplification efficiency was
the same for each Ang II receptor subtype and its specific internal
standard (slopes 0.229 and 0.234, respectively, for AT1;
slopes 0.257 and 0.253, respectively, for AT2).
To avoid competition between endogenous and synthetic RNAs, different
amounts of total RNA combined with 10,000 molecules of the internal
standard were reverse-transcribed, and the resultant cDNA mixtures were
amplified by PCR. Figure 2, C and D, shows a linear relation between
the radioactivity incorporated into the PCR products and the amount of
starting RNA (200 to 1, 400 ng), whereas the radioactivity incorporated
into the internal standard of each tube remained unchanged. This
indicates the absence of competition between endogenous and synthetic
RNAs.
Changes in ventricular Ang II receptor subtype mRNA
levels. Figures 3A and 4A show typical RT-PCR analysis of
AT1 and AT2 subtype mRNA in the LV of the young
adult and aged rats. After PCR amplification, we obtained a PCR product
of 444 bp for AT1 mRNA, as expected (Fig. 3A). The two
subtypes of AT1 mRNA could then be differentiated by size
after exposure to EcoRI, which hydrolyzed the
AT1a mRNA into two fragments of 269 and 175 bp but did not
affect the AT1b or internal standard mRNAs (Fig. 3B). As
shown in Fig. 3C, the AT1 mRNA level was 2.6-fold higher in
the RV than in the LV of the young adult rat heart (60, 728 ±
4,063 and 21, 707 ± 2, 101 molecules of AT1 mRNA/µg of total
RNA, P < 0.0001, respectively). With aging,
AT1 gene expression was increased 5.6-fold in the LV
(P < 0.0001), but remained unchanged in the RV. The
AT1 mRNA level was thus 2-fold higher in the LV than in the
RV of aged rats. The percentages of AT1a mRNA (81%) and
AT1b mRNA (19%) were the same in both adult and aged
hearts and were independent of the ventricle analyzed.
|
|
). The AT2 mRNA level was higher in the RV
than in the LV of the young adult rat heart (33, 838 ± 2, 485 and
23, 821 ± 1, 257 molecules of AT2 mRNA/µg of total RNA,
P < 0.008, respectively). With aging, AT2
gene expression was increased 4.2-fold in the LV (P <
0.0001) and 2.8-fold in the RV (P < 0.0001) (Fig. 4B).
To assess the cellular expression of Ang II receptor subtypes, we
analyzed their relative level in freshly isolated cardiomyocytes. As
shown in Fig. 5, A and B, freshly
isolated myocytes from the LV of young adult rat hearts expressed both
AT1 and AT2 mRNAs. Quantification showed a 2.3-
(P < 0.003) and 2.1-fold (P < 0.01)
increase in AT1 and AT2 mRNA accumulations,
respectively, in the cardiomyocytes of senescent rats (Fig. 5C).
|
Ang II binding assay
125I-Ang II binding was uniformly distributed
throughout the ventricular myocardium (Fig. 6A). Addition of 10-6
M of Ang II reduced binding in all structures (Fig. 6B). No
difference was observed between the specific binding in the LV and RV
of both adult and senescent rat hearts (Fig. 6, C and D, respectively).
PD 123319 (Fig. 6, E and F) and losartan (Fig. 6, G and H) also
inhibited radioligand binding in all structures of both adult and
senescent rat myocardium. Quantification of specific binding in the LV
myocardium of young adult rats indicated that the density of
AT1 and AT2 was similar (53% for
AT1 and 47% for AT2), in agreement with
previous studies in normal rat hearts (32, 33). The mean Ang II
receptor density was 7.92 fmol/mg of protein, as previously described
(31).
|
, right
panel) demonstrated a 3.9-fold increase in specific binding in the
LV myocardium of senescent rats (30.67 ± 3.13 vs.
7.92 ± 0.72 fmol/mg protein in aged and young rat myocardium,
respectively, P < 0.0001). The percentage of AT-R
subtypes did not change with aging (55% and 45% for AT1
and AT2, respectively).
Statistical analysis
As shown in Table 2, linear
regression analysis was performed for each parameter in both
ventricles. In the LV, significant correlations were observed between
all parameters studied. By contrast, in the RV only AT2
mRNA level was significantly correlated with fibrosis.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The present study demonstrates differential expression of AT1 and AT2 receptor subtype mRNAs in the rat heart. In the young adult, the levels of AT1 and AT2 mRNA are markedly higher in the right than in the left ventricle. Interestingly, such differences in gene expression between the RV and LV have been previously described for other components of the cardiac RAS, such as ANG and ACE mRNA (26). With aging, we observed that AT2 mRNA level increase equally in both ventricles, whereas AT1a and AT1b mRNA levels increase markedly in the LV only.
The increase in mRNA levels coding for Ang II receptor subtypes detected in the LV of senescent rats was also observed in freshly isolated cardiomyocytes. However, the magnitude of the increase in LV cardiomyocytes (>2-fold increase for both subtypes) was less prominent compared with that in LV tissue (>4-fold increase for both subtypes). Therefore, AT1 and AT2 gene expression in aged rat LV is also increased, and to a greater extent, in the nonmyocyte cell population (including fibroblasts, vascular smooth muscle cells and endothelial cells), which is known to express both Ang II receptor subtypes (34, 35, 36). Finally, the increase in Ang II receptor subtype mRNA levels in the LV is quite similar to that observed for the corresponding protein, suggesting transcriptional regulation of these genes in the LV of aged rats.
The presumed mechanistic pathways involved in the increase in cardiac Ang II receptor gene expression are multiple. First, this up-regulation could be intrinsic to the developmental gene reprogramming often associated with senescence. Indeed, it is well established that cardiac senescence is characterized by the reexpression of fetal proteins, such as the contractile protein isoform ß-MHC and the atrial natriuretic peptide gene (37, 38). On the other hand, several studies in rat ventricular tissue have previously demonstrated developmental regulation of cardiac Ang II receptor subtype densities and gene expression, which are abundant during the neonatal period and decrease with maturation (31, 34, 39). Secondly, humoro-hormonal status is modified during senescence, and is characterized by a large decrease in plasma Ang II synthesis, and an increase in plasma cortisol level (26). A number of circulating factors, such as vasoactive substances, growth factors, and steroids, modulate AT1 expression via their effects on the transcriptional activity of AT1 gene (40, 41, 42, 43). However, the differential pattern of AT1 gene expression observed in the LV and RV of aged rats makes a major role of hormones in the regulation of AT1 gene expression unlikely. In contrast, much less is known about the hormonal regulation of AT2 mRNA level. However, based on the up-regulation of AT2 gene expression in both ventricles of aged rats, hormonal and humoral factors might be one of the triggers for the increase in cardiac AT2 gene expression during senescence. Thirdly, mechanical factors are repeatedly proposed as triggers for the regulation of genetic expression during the development of cardiac hypertrophy. Activation of AT1 and/or AT2 gene expression has been demonstrated in ventricular tissue during hemodynamic overload (19, 33). Mechanical stretch has also been recently shown to up-regulate AT1 and AT2 gene expression in neonatal rat cardiac myocytes, the increase in AT1 gene expression being mainly due to increased transcription, whereas that of AT2 results from stabilization of AT2 mRNA metabolism (44). Even though cardiac output and ejection fraction of both aged human and rat hearts are unaltered, the increase in vascular stiffness and aortic impedance during aging result in a moderate increase in LV afterload (45, 46). These changes in LV properties might therefore account, at least in part, for the up-regulation of AT1 gene expression in the LV of aged rats.
The present study demonstrates increased density of both AT1 and AT2 receptors in the LV myocardium of senescent rats and extends our previous observations concerning an activation of the intracardiac RAS in aging, associated with suppression of plasma Ang II synthesis. Such local and independent regulation of intracardiac Ang II synthesis and receptor subtype expression could account for both autocrine and paracrine actions (47) and support the concept of intracardiac Ang II production as a regulator of cardiac hypertrophy and collagen accumulation. We and others have demonstrated that cardiac senescence is associated with both modulation of myocardial phenotype and remodeling of both ventricles, characterized by increased deposition of extracellular matrix proteins, such as collagen, in the interstitium and around vessels (22, 25). Cardiac fibrosis is a major factor in enhancing myocardial stiffness and results in altered diastolic compliance. Recently, it has been shown that age-induced cardiac fibrosis mainly results from decreased collagenase activity, and not from collagen gene up-regulation (48). Moreover, Ang II has been proposed to contribute directly to the development of fibrosis via both AT1 and AT2 receptor subtypes. In vitro, Ang II induces cardiac fibroblast hyperplasia and collagen expression via AT1 receptor (16, 49). Activation of the AT2 receptor also seems to be involved in the fibrotic process because Ang II stimulates collagen synthesis via this receptor (50). The strong correlation between AT2 gene expression and fibrosis in both ventricles in the present study, compared with the correlation of AT1 and ACE mRNA levels with LV fibrosis only, leads us to propose that age-associated cardiac fibrosis is more closely related to the AT2 than the AT1 receptor subtype. These data are in agreement with the recent study of Lorell et al., who demonstrated that both AT1 inhibition and decrease in ACE gene expression affected neither cardiac fibrosis or hypertrophy in a presssure-overload rat model (51).
In conclusion, the present study extends our previous observations demonstrating the activation of an intracardiac RAS in senescent rats. Such up-regulation of the cardiac RAS may, in part, compensate for the large age-related fall in plasma Ang II synthesis. However, activation of the intracardiac RAS and increased expression of Ang II receptor subtypes might have detrimental effects when other pathologies often associated with senescence, such as hypertension and heart failure, are superimposed. Ang II receptor subtype antagonists could be therapeutically useful in elderly people. However, this possibility would require direct testing in experimental animals.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received December 4, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  F. Scalera, J. Martens-Lobenhoffer, A. Bukowska, U. Lendeckel, M. Tager, and S. M. Bode-Boger Effect of Telmisartan on Nitric Oxide-Asymmetrical Dimethylarginine System: Role of Angiotensin II Type 1 Receptor and Peroxisome Proliferator Activated Receptor {gamma} Signaling During Endothelial Aging Hypertension, March 1, 2008; 51(3): 696 - 703. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. H. Schulman, M.-S. Zhou, E. A. Jaimes, and L. Raij Dissociation between metabolic and vascular insulin resistance in aging Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H853 - H859. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Groban, N. A. Pailes, C. D. L. Bennett, C. S. Carter, M. C. Chappell, D. W. Kitzman, and W. E. Sonntag Growth Hormone Replacement Attenuates Diastolic Dysfunction and Cardiac Angiotensin II Expression in Senescent Rats J. Gerontol. A Biol. Sci. Med. Sci., January 1, 2006; 61(1): 28 - 35. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kintsurashvili, A. Duka, I. Ignjacev, G. Pattakos, I. Gavras, and H. Gavras Age-related changes of bradykinin B1 and B2 receptors in rat heart Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H202 - H205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Volkova, R. Garg, S. Dick, and K. R. Boheler Aging-associated changes in cardiac gene expression Cardiovasc Res, May 1, 2005; 66(2): 194 - 204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yamamoto, K. Takeshita, T. Kojima, J. Takamatsu, and H. Saito Aging and plasminogen activator inhibitor-1 (PAI-1) regulation: implication in the pathogenesis of thrombotic disorders in the elderly Cardiovasc Res, May 1, 2005; 66(2): 276 - 285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Duke, R. G. Evans, and R. E Widdop AT2 receptors contribute to acute blood pressure-lowering and vasodilator effects of AT1 receptor antagonism in conscious normotensive but not hypertensive rats Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2289 - H2297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. G. Ebrahimian, R. Tamarat, M. Clergue, M. Duriez, B. I. Levy, and J.-S. Silvestre Dual Effect of Angiotensin-Converting Enzyme Inhibition on Angiogenesis in Type 1 Diabetic Mice Arterioscler. Thromb. Vasc. Biol., January 1, 2005; 25(1): 65 - 70. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Michel, M.-L. Ambroisine, M. Duriez, C. Delcayre, B. I. Levy, and J.-S. Silvestre Aldosterone Enhances Ischemia-Induced Neovascularization Through Angiotensin II-Dependent Pathway Circulation, April 27, 2004; 109(16): 1933 - 1937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Shivakumar, D. E. Dostal, K. Boheler, K. M. Baker, and E. G. Lakatta Differential response of cardiac fibroblasts from young adult and senescent rats to ANG II Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1454 - H1459. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Xu, I. A Arenas, S. J Armstrong, and S. T Davidge Estrogen modulation of left ventricular remodeling in the aged heart Cardiovasc Res, February 1, 2003; 57(2): 388 - 394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Adamy, P. Oliviero, S. Eddahibi, L. Rappaport, J.-L. Samuel, E. Teiger, and C. Chassagne Cardiac modulations of ANG II receptor expression in rats with hypoxic pulmonary hypertension Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H733 - H740. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-S. Silvestre, R. Tamarat, T. Senbonmatsu, T. Icchiki, T. Ebrahimian, M. Iglarz, S. Besnard, M. Duriez, T. Inagami, and B. I. Levy Antiangiogenic Effect of Angiotensin II Type 2 Receptor in Ischemia-Induced Angiogenesis in Mice Hindlimb Circ. Res., May 31, 2002; 90(10): 1072 - 1079. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Roesch, Y. Tian, W. Zheng, M. Shi, J. G. Verbalis, and K. Sandberg Estradiol Attenuates Angiotensin-Induced Aldosterone Secretion in Ovariectomized Rats Endocrinology, December 1, 2000; 141(12): 4629 - 4636. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Gallinat, S. Busche, M. K. Raizada, and C. Sumners The angiotensin II type 2 receptor: an enigma with multiple variations Am J Physiol Endocrinol Metab, March 1, 2000; 278(3): E357 - E374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Yang, D. F. Larson, and R. Watson Age-related left ventricular function in the mouse: analysis based on in vivo pressure-volume relationships Am J Physiol Heart Circ Physiol, November 1, 1999; 277(5): H1906 - H1913. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Robert, C. Heymes, J.-S. Silvestre, A. Sabri, B. Swynghedauw, and C. Delcayre Angiotensin AT1 Receptor Subtype as a Cardiac Target of Aldosterone : Role in Aldosterone-Salt–Induced Fibrosis Hypertension, April 1, 1999; 33(4): 981 - 986. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) and internal RT-PCR standard RNA (10,000
molecules, 
) were coamplified for a varying number of PCR cycles.
Panels C and D demonstrate the lack of competition between endogenous
AT1 mRNA, AT2 mRNA and their specific internal
standards. Different amounts of total RNA (
