| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Inhibits Leydig Cell Steroidogenesis through a Decrease in Steroidogenic Acute Regulatory Protein Expression1
INSERM U407 (C.M., M.-A.C., M.B.), Centre Hospitalier Lyon-Sud, 69 495 Pierre Bénite cedex, France; INSERM U189 (F.G., C.R., P.L.), Faculté de Médecine Lyon-Sud, BP 12, 69 921 Oullins, France; and Department of Cell Biology and Biochemistry (D.M.S.), Texas Tech University Health Sciences Center, Lubbock, Texas 79430
Address all correspondence and requests for reprints to: Claire Mauduit, INSERM U407, Bât 3B, Centre Hospitalier Lyon-Sud, 69 495 Pierre Bénite cedex, France. E-mail: mauduit{at}lsgrisn1.univ-lyon1.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(tumor necrosis factor alpha) on
LH/hCG-stimulated testosterone formation. By using cultured porcine
Leydig cells as a model, TNF was shown to inhibit testosterone
secretion when testicular cells were stimulated with hCG but not when
incubated with 22R-hydroxycholesterol (a cholesterol substrate
derivative that readily passes through cell and mitochondrial
membranes). Such an observation suggested that the cytokine may affect
cholesterol transport and/or availability to cytochrome P450scc in the
mitochondria. Specifically, we report here that TNF reduced in a
dose- and time-dependent manner hCG-induced StAR (steroidogenic acute
regulatory protein) levels. The maximal and half-maximal effects were
obtained with 20 ng/ml (1.2 nM) and 1.6 ng/ml (0.09
nM) of TNF, respectively. Maximal inhibitory effects of
TNF on StAR messenger RNA and protein levels were obtained after
48 h of treatment. Additionally, the presence of TNF receptors
P55 in terms of protein (identified through cross-linking experiments)
and messenger RNA (identified through RT-PCR analysis) suggested that
the effects of the cytokine are directly exerted on the testicular
steroidogenic cell type. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(TNF) in male gonadal function, particularly in Leydig cell
steroidogenesis. The TNF that affected Leydig cells could originate
from interstitial macrophages (1) and/or from the circulatory system
(2). Interstitial macrophages might be activated during an immune
challenge or chronic inflammatory diseases, resulting in production of
elevated levels of TNF in the vicinity of the Leydig cells (3).
Elevated TNF levels in the circulatory system have been observed in
patients with critical illness, burns, and sepsis (3, 4, 5). It is of
interest to note that those patients have depressed gonadal function
(6, 7). Additionally, more direct observations indicate that TNF is
probably involved in the decrease in male gonadal activity: 1) a severe
hypogonadism was observed in male rats injected ip (8) or iv (9) with
endotoxin, a substance known to stimulate TNF production; 2)
recombinant human TNF (2–4 x 105 U/kg·24 h)
administration by continuous infusion to male Wistar rats induced a
dramatic decline in testosterone concentration and severe seminiferous
epithelium damage (2). The increase in LH and FSH levels in these
TNF treated male rats would indicate that the detrimental effects of
the cytokine are primarily exerted on the testis; 3) by using an
in vitro model (i.e. cultured purified Leydig
cells) we have shown that TNF exerted a profound inhibitory effect
on LH/hCG stimulated-testosterone formation (10).
Together, although these data strongly suggested that TNF is an
inhibitor of testosterone formation under gonadotropin control, the
sites of action of the cytokine and the expression of TNF receptors
supporting a direct interaction between the cytokine and the testicular
cell type still remain to be identified in Leydig cells. The
steroidogenesis process involves at least two mechanisms: 1) transport
of cholesterol substrate in the inner mitochondrial membrane, a process
that involves probably several mediators and particularly StAR
(steroidogenic acute regulatory protein) (11); 2) transformation of
cholesterol into testosterone which results from different
steroidogenic enzyme activities (12).
By using cultured porcine Leydig cells, as an experimental model, we
report here that TNF exerts its inhibitory action on Leydig cell
steroidogenesis mainly through a decrease in StAR expression and that
such an inhibitory action is probably mediated by TNF receptor p55
expressed in the testicular cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
was obtained from Prepro Tech (Canton, MA).
22R-hydroxycholesterol (5-cholestene-3ß, 22(R)-diol:
22R-hydroxycholesterol), insulin, transferrin, vitamin E, HEPES, and
deoxyribonuclease type I (DNase) were purchased from Sigma Chemical Co.
(St. Louis, MO). Na125I (IMS 30) and [32P]
dCTP were purchased from Amersham (Aylesbury, UK). Iodo-Gen and
disuccinimidyl suberate were obtained from Pierce (Rockford, IL),
Taq polymerase from Appligene-Oncor (Illkirch, France), and
oligonucleotides primers from Genset (Paris, France).
Leydig cell preparation and culture
Leydig cells were prepared from immature porcine testes (2–3
weeks old) by collagenase treatment (13). Briefly, decapsulated testes
were minced and washed in DME/Ham’s F-12 medium (1:1). After
collagenase dissociation (0.5 mg/ml, 90 min at 32 C), cells were washed
by centrifugation (200 x g for 10 min). The pellet was
then resuspended and submitted to two successive sedimentations of 5
and 15 min. The crude interstitial cells were recovered from the
supernatants, and Leydig cells were prepared from this fraction by
Percoll gradient centrifugation. The purity of Leydig cells was more
than 90%, as determined by histochemical 3ß-hydroxysteroid
dehydrogenase staining. Leydig cells were plated in Falcon (Los
Angeles, CA) 24-multiwell plates (0.5 x 106
cells/dish) and cultured at 32 C in a humidified atmosphere of 5%
CO2, 95% air in DME/Ham’s F-12 medium (1:1) containing
sodium bicarbonate (1.2 mg/ml), 15 mM
4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES), and
gentamicin (20 µg/ml). This medium was supplemented with insulin (2
µg/ml), transferrin (5 µg/ml), and -tocopherol (10 µg/ml).
Testosterone measurement
Testosterone levels were measured in the culture medium by using
a previously reported specific RIA (14).
Western blot analysis
StAR protein contents in whole Leydig cells and in isolated
mitochondria were identified through Western blot analysis. For
isolation of mitochondria, the harvested cells were pelleted by
centrifugation at 200 x g for 10 min. The pelleted
cells were resuspended in ice-cold buffer A consisting of 275
mM sucrose, 10 mM Tris-HCl, pH 7.4, 1
mM EDTA (0.5 ml of buffer/75 x 106
cells), and homogenized with a Teflon homogenizer. Cellular fragments
and nuclei were removed from homogenates by centrifugation at 960
x g for 15 min. The pellet was resuspended in buffer A,
homogenized, and centrifuged under the same conditions. The
supernatants were pooled and centrifuged at 8,600 x g
for 15 min to yield the mitochondrial pellet. To purify mitochondria,
the crude mitochondrial pellet was suspended in isolation buffer and
centrifuged at 960 x g for 3 min. The resultant
supernatant was centrifuged twice at 8,600 x g for 15
min.
Proteins from whole Leydig cells and isolated mitochondria were resolved on 12% SDS/polyacrylamide gels and electrophoretically transferred to nitrocellulose membranes using 25 mM Tris, 185 mM glycine, pH 8.3, containing 20% methanol. The transfer was performed at a constant voltage of 100 V for 45 min. Following transfer, the membrane was incubated in a blocking buffer (TBS buffer containing 10% nonfat dry milk) overnight at 4 C. The membrane was rinsed three times with TBS/Tween 0.1% (3 x 10 min), then incubated with an antibody raised against a ten amino acid peptide (88–98) of the 30 kDa StAR protein (1/1000 dilution in TBS containing 2% nonfat dry milk) for 1 h at room temperature. The membrane was rinsed with TBS/Tween 0.1% (3 x 10 min) and then incubated with horseradish peroxidase-labeled goat antirabbit IgG (CovalAb, 1/1000 dilution in TBS containing 2% nonfat dry milk) for 1 h at room temperature. The membrane was thoroughly washed with TBS/Tween 0.1% (3 x 10 min) and then with TBS. Bound antibodies were detected by chemiluminescence using a CovalAb detection kit and Biomax MR film from Kodak. Protein concentration was determined by the Bradford assay (15).
125I-TNF binding and affinity cross-linking
experiments
TNF was labeled with carrier-free Na125I by the
Iodo-Gen method (16) and had a specific activity of 1700 Ci/mmol. For
binding experiments, cultured Leydig cells were incubated at 4 C for
4 h with 125I-TNF in a total volume of 0.2 ml. At
the end of the incubation, cells were washed three times with ice-cold
PBS and incubated with disuccinimidyl suberate (2 mM).
After 30 min at 4 C, the cells were washed with PBS and scraped off
with scraping buffer (Tris 10 mM, pH 7, sucrose 0.25
M, EDTA 1 mM, PMSF 1 mM, leupeptin
10 µg/ml). After centrifugation (300 x g, 10 min)
proteins were extracted with a triton buffer (Tris 10 mM pH
7, EDTA 0.1 mM, Triton X100 1%, PMSF 1 mM,
leupeptin 50 µg/ml) 40 min at 4 C. After a second centrifugation,
proteins were analyzed by SDS-PAGE. Dried gels were exposed 15 days to
Kodak film.
RNA extraction
Total RNAs were extracted from porcine Leydig cells with TRIzol
reagent, a mono-phasic solution of phenol and guanidine isothiocyanate.
This reagent is an improvement to the single-step RNA isolation
developed by Chomczynski and Sacchi (17). The amount of RNA was
estimated by spectophotometry at 260 nm.
RT-PCR analysis
Single stranded complementary DNAs (cDNAs) were obtained from
reverse transcription of 3 µg of total RNAs using random
hexanucleotides as primer (5 µM), in the presence of dNTP
(0.2 mM), dithiothreitol (10 µM) and M-MLV
(10 U/µl), 1 h at 37 C. cDNA (1 µl of RT mixture) were
amplified by PCR with Taq polymerase (0.01 U/µl), dNTP (50
µM), and specific primers (2 µM). The
mixture was first heated at 92 C for 3 min and then 25 cycles of 92 C
for 30 sec, 57 C for 30 sec, 70 C for 30 sec, then 70 C for 5 min. PCR
products were analyzed on 2% agarose gel and visualized using a UV
(254 nm) table (Appligène). Intensities bands were estimated by
densitometric scanning using the BioImage scanner (BioImage, Cheshire,
UK). The data were expressed as StAR/ßactin messenger RNAs (mRNAs)
ratio. The oligonucleotides primers for StAR were:
5'TGGAGAGGCTTTATGAGGAGC3' (forward), 5'GCCAGGTGAGTTTGGTCTTCG3'
(reverse). StAR amplified products were 337 bp. The oligonucleotides
primers for ßactin were (18): 5'TTGCTGATCCACATCTGCTG3' (forward),
5'GACAGGATGCAGAAGGAGAT3' (reverse). ßactin amplified products were
146 bp. The oligonucleotides primers for TNF R55 were:
5'TGCTGCACCAAGTGCCACAAAG3' (forward), 5'CAGATGGTGTCCTGTTTCTTC3'
(reverse). R55 amplified products were 326 bp. The oligonucleotides
primers for TNF R75 were: 5'CTCTTCCAGTTGGACTGATTG3' (forward),
5'TCTCCAGGGAGCTGCTGCTG3' (reverse). R75 amplified products were 221
bp.
PCR analysis for StAR and ßactin were carried out from the logarithmic phase of amplification. PCR amplified products were checked by restriction enzymes. RT-PCR primers were designed inside separate exons to avoid any bias due to residual genomic contamination. Moreover, for all primers, no amplification was observed when PCR was performed on RNA preparations. For the figures, scanned images were inverted.
Northern blot analysis
About 15 µg of total RNA (denaturated 15 min at 65 C in the
presence of formaldehyde 2.2 M, formamide 12.5
M, 1 x 3(N-morpholino)propanesulfonic
acid: MOPS) were electophoresed on 1.2% agarose/2.2 M
formaldehyde gel. After migration in 0.02 M MOPS running
buffer, RNAs were transferred to nitrocellulose membrane Hybond-C extra
(Amersham, UK) in 10 x SSC (1.5 M NaCl, 0.15
M sodium citrate) and fixed at 80 C for 2 h. cDNA
probes (StAR, 1.6 kb NotI-SalI and GAPDH, 1.7 kb
PstI) were labeled with 30 µCi of [32P]
dCTP (SA, 109 dpm/µg DNA) using a random primed labeling
kit (Promega, Madison, WI). Labeled probes were separated from free
nucleotides by a G50 spin column. After 3 h of prehybridation at
42 C, filters were hybridized with labeled probe (1–4 x
106 cpm/ml) overnight at 42 C in 50% formamide, 5 x
SSPE (0.9 M NaCl, 50 mM sodium phosphate, 5
mM EDTA, pH 7.4), 5 x Denhardt’s solution (1 g
Ficoll, 1 g polyvinylpyrrolidone, 1 g BSA/liter), 1% SDS and
100 µg/ml herring sperm DNA. Afterward, membranes were washed four
times in 2 x SSC, 0.1% SDS (20 min, RT), followed by 40 min at
55 C. Filters were exposed to Kodak X-OMAT S films at -70 C for 1–2
days. Intensities of autoradiographic bands were estimated by
densitometric scanning using the BioImage scanner (BioImage). The data
were expressed as StAR/GAPDH mRNAs ratio.
Data analysis
All experimental data are presented as the mean ±
SD of triplicate determinations of three replicate cultures
within each treatment group. All experiments reported here were
repeated at least three times with independent cell preparations. A
representative experiment of each series of experiments is presented.
Statistical significance between groups was determined by Student’s
t test using the StatWorks (Hyden and Son Ltd, London, UK)
package on a Macintosh computer. Differences are accepted as
significant at P < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
inhibited cholesterol mobilization (20 ng/ml, 72 h) had no
effect on basal testosterone secretion (Fig. 1
). The cytokine inhibited (90%
decrease, P < 0.001) testosterone production when
Leydig cells were stimulated with LH/hCG (3 ng/ml, 3 h), but not
when incubated with a cholesterol substrate derivative, which readily
passes through cell and mitochondrial membranes
(22R-hydroxycholesterol, 5 µg/ml, 2 h) (Fig. 1). These data
suggest that the inhibitory action of TNF resulted from an
antagonistic interaction with the steroidogenic activity of LH/hCG. The
disappearance of the inhibitory action of the cytokine in the presence
of a cholesterol substrate derivative, which is readily diffusable to
the inner mitochondrial membrane, without any active transport,
suggests that TNF may exert an inhibitory action on cholesterol
transport. Together these observations make StAR a potential target for
TNF action in Leydig cells.
|
effects on StAR mRNA inhibited in a dose-dependent manner StAR mRNA levels as
shown through RT-PCR (Fig. 2) approach.
The maximal inhibitory (P < 0.001) effect of the
cytokine was observed with 20 ng/ml, 1.17 nM (Fig. 2), and
the IC50 was obtained with 1.6 ng/ml (0.09
nM).
|
).
|
). As depicted in Fig. 4, TNF had no
effect on hCG-induced StAR expression between 0.5 and 6 h.
However, long-term treatment with TNF (20 ng/ml) resulted in a
time-dependent decrease of StAR mRNA. The effect of the cytokine was
detected at 24 h (P < 0.01) and was maximal at
48 h (P < 0.004) (Fig. 5).
|
|
effects on StAR protein gives a summary of
immunoblot analysis of StAR protein accumulation in porcine Leydig
cells treated with hCG, TNF, and their combination. As expected,
StAR protein levels were markedly increased (at least 3-fold in the
four experiments) in hCG-treated cells compared with untreated control
cells. TNF treatment of Leydig cells abolished the hCG-induced
increase in StAR expression (the inhibition reaching at least 63% in
the four experiments). TNF, after 48 h of treatment, inhibited
hCG-induced StAR protein expression with a similar pattern in whole
Leydig cells (Fig. 6B) and isolated mitochondria (Fig. 6C). Maximal
inhibitory effects of TNF on StAR protein were obtained after
48 h of treatment (data not shown).
|
receptors receptors were identified in terms of proteins and mRNAs.
Cross-linking experiments showed a unique band of 72 kDa (Fig. 7A, lane 1). This band was specific in
that it disappeared in the presence of an excess (50 nM) of
unlabeled TNF (Fig. 7A, lane 2). According to the observation of
Hohmann et al. (19), cross-linked products were generated by
a single cross-linking reaction involving one (17 kDa) of the three
TNF molecules of the bound trimer and the receptor protein. This
suggests, therefore, a molecular mass of about 55 kDa (for the 72 kDa
cross-linked product in Fig. 7A), which is related to the p55 form of
the cytokine receptor. In these experiments, no other cross-linked
product giving rise to a higher molecular mass receptor was detected
even after a longer exposure (60 days).
|
). By using RT-PCR analysis, we were not able to detect
transcripts for p75 receptor in this testicular cell type (Fig. 7B). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The aim of the present study was to clarify whether the anti-LH action
of TNF on testosterone formation was related to a regulatory action
on StAR expression. Indeed, we (10) and others (27, 28, 29), using Leydig
cells from porcine (10), mouse (27, 28), and rat (29) testis, have
reported that TNF inhibited LH/hCG-induced (10) or cAMP-induced (27, 28) testosterone production. Indeed, to inhibit LH-induced testosterone
production, TNF has been shown to involve different mechanisms such
as redistribution of the cytoskeleton elements (our unpublished data),
and steroidogenic enzymes (for example P450scc and P450c17 in mouse/rat
Leydig cells, 27–29). That an inhibitory action on cholesterol
transport was probably also involved in TNF action was suggested by
the fact that incubation of Leydig cells with 22R-hydroxycholesterol (a
cholesterol substrate derivative that readily passes through cell
membranes) reversed most of the inhibitory effects of TNF. According
to these observations, we have identified, in the present study, StAR
as a target for TNF action in Leydig cells. Indeed, TNF decreased
hCG-induced StAR mRNA and protein levels in Leydig cells. In previous
experiments, we show that TNF maximal inhibitory effect on
hCG-induced testosterone production was obtained after 48 h of
treatment (10). TNF inhibitory action on StAR levels (the present
study) and on testosterone production (10) were kinetically similar (48
h), reinforcing the idea that the decrease in StAR expression is a
crucial target of the cytokine during its inhibitory action on Leydig
cell steroidogenesis. TNF must be considered now as one of the major
factors involved in the regulation of StAR expression, including also
insulin-like growth factor I (30) and LPS (31). Indeed, insulin-like
growth factor I, a growth factor involved in maturation and
differentiation of granulosa cells, increases steroidogenesis in those
cells by enhancing, synergistically with FSH, StAR mRNA and protein
expression (30). As for endotoxin, ip injection of LPS to male mouse
induces a rapid (within 2 h) and a prolonged (up to 9 days)
decrease in serum testosterone level (31). The early depression of
serum testosterone seems to be associated with a decrease in StAR
protein levels only while the prolonged decrease corresponds to a
inhibition of P450c17 protein and mRNA levels in Leydig cells (31).
These discrepancies between action of LPS (31) and TNF (our present
study) on StAR expression are not known. However, it could be due to
species specificity (mouse vs. pig) because in mouse Leydig
cells TNF inhibited LH-induced testosterone production by decreasing
P450c17 expression (27), whereas in porcine Leydig cells, TNF
decrease StAR protein and mRNA expression (the present study).
TNF inhibitory action on StAR levels occurred at a concentration
(0.09 nM) compatible with the Kd range of the
cytokine binding sites found on Leydig cells (10). These observations
suggest a direct action of TNF on Leydig cells. Indeed, it is
reported here that TNF may use the p55 receptor (rather the p75
receptor) in porcine Leydig cells because protein and mRNA of this
receptor type were found in this testicular cell type. P55 receptors
have been implicated in many biological processes triggered by TNF
including cytokine production in fibroblasts (32) and anti-FSH action
in Sertoli cells (33). The p75 receptors have also been associated, at
high abundance, with cell death (34).
With regard to the mechanisms involved in the negative effect of TNF
on StAR mRNA levels, it might be due to a decrease in the
transcriptional activity and/or mRNA stabilization. TNF may affect
StAR gene expression through interactions, with transcriptional factors
that might bind to the StAR gene promoter (35, 36). In this context,
TNF may antagonize the cAMP production and/or the cAMP action,
i.e. induction of proteins that regulate StAR gene
transcription such as SF-1 (steroidogenic factor-1), which has been
shown to regulate, in human, StAR gene expression (36, 37). Indeed, in
the experimental model used here, we have previously shown that TNF
inhibited both cAMP formation induced by LH/hCG and cAMP action
(through 8-bromo-cAMP, 10). As TNF activates different intracellular
signaling pathways (protein kinase C, sphingomyelinase, NFkB, 34), it
remains to be determined which of these pathways (negatively)
cross-talks with the cAMP pathway under the control of LH/hCG.
In summary, by using a model of cultured porcine Leydig cells, we have
shown that the inhibitory action of TNF on LH/hCG-induced
testosterone formation might be exerted through a decrease in StAR
expression, probably, mediated via the p55 receptor type.
|
Footnotes |
|---|
Received November 12, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-interferon and 
-interferon in the serum of patients with septic
shock. J Infect Dis 161:982–987[Medline]
inhibits gonadotropin
action in cultured porcine Leydig cells: site(s) of action.
Endocrinology 129:2933–2940-hydroxylase/C17–20lyase in Leydig cells. Biol Reprod 42:399–404[Abstract]
inhibition of 17-hydroxylase/C17–20 lyase gene
(Cyp17) expression. Endocrinology 136:3519–3526[Abstract]
antagonizes follicle-stimulating hormone action in cultured porcine
Sertoli cells. Endocrinology 133:69–76This article has been cited by other articles:
 |
|
 |
|
  H. A. LaVoie and S. R. King Transcriptional Regulation of Steroidogenic Genes: STARD1, CYP11A1 and HSD3B Experimental Biology and Medicine, August 1, 2009; 234(8): 880 - 907. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-L. Yao, Y.-C. Lin, and J. H. Richburg TNF Alpha-Mediated Disruption of Spermatogenesis in Response to Sertoli Cell Injury in Rodents Is Partially Regulated by MMP2 Biol Reprod, March 1, 2009; 80(3): 581 - 589. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Tronchon, F. Vialard, M. El Sirkasi, H. Dechaud, J. Rollet, M. Albert, M. Bailly, P. Roy, C. Mauduit, P. Fenichel, et al. Tumor necrosis factor-alpha -308 polymorphism in infertile men with altered sperm production or motility Hum. Reprod., December 1, 2008; 23(12): 2858 - 2866. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-L. Yao, Y.-C. Lin, P. Sawhney, and J. H. Richburg Transcriptional Regulation of FasL Expression and Participation of sTNF-{alpha} in Response to Sertoli Cell Injury J. Biol. Chem., February 23, 2007; 282(8): 5420 - 5431. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Y. Hong, J. H. Park, R. S. Ahn, S. Y. Im, H.-S. Choi, J. Soh, S. H. Mellon, and K. Lee Molecular Mechanism of Suppression of Testicular Steroidogenesis by Proinflammatory Cytokine Tumor Necrosis Factor Alpha Mol. Cell. Biol., April 1, 2004; 24(7): 2593 - 2604. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Morales, P. Santana, R. Diaz, C. Tabraue, G. Gallardo, F. L. Blanco, I. Hernandez, L. F. Fanjul, and C. M. Ruiz de Galarreta Intratesticular Delivery of Tumor Necrosis Factor-{alpha} and Ceramide Directly Abrogates Steroidogenic Acute Regulatory Protein Expression and Leydig Cell Steroidogenesis in Adult Rats Endocrinology, November 1, 2003; 144(11): 4763 - 4772. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. O. Suescun, C. Rival, M. S. Theas, R. S. Calandra, and L. Lustig Involvement of Tumor Necrosis Factor-{alpha} in the Pathogenesis of Autoimmune Orchitis in Rats Biol Reprod, June 1, 2003; 68(6): 2114 - 2121. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Devoto, P. Kohen, R. R. Gonzalez, O. Castro, I. Retamales, M. Vega, P. Carvallo, L. K. Christenson, and J. F. Strauss III Expression of Steroidogenic Acute Regulatory Protein in the Human Corpus Luteum throughout the Luteal Phase J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5633 - 5639. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Pentikainen, K. Erkkila, L. Suomalainen, M. Otala, M. O. Pentikainen, M. Parvinen, and L. Dunkel TNF{alpha} Down-Regulates the Fas Ligand and Inhibits Germ Cell Apoptosis in the Human Testis J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4480 - 4488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Mauduit, I. Goddard, V. Besset, E. Tabone, C. Rey, F. Gasnier, F. Dacheux, and M. Benahmed Leukemia Inhibitory Factor Antagonizes Gonadotropin Induced-Testosterone Synthesis in Cultured Porcine Leydig Cells: Sites of Action Endocrinology, June 1, 2001; 142(6): 2509 - 2520. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Reaven, L. Zhan, A. Nomoto, S. Leers-Sucheta, and S. Azhar Expression and microvillar localization of scavenger receptor class B, type I (SR-BI) and selective cholesteryl ester uptake in Leydig cells from rat testis J. Lipid Res., March 1, 2000; 41(3): 343 - 356. [Abstract] [Full Text]
|
|
|
|
|
|
M. Kanzaki and P. L. Morris Growth Hormone Regulates Steroidogenic Acute Regulatory Protein Expression and Steroidogenesis in Leydig Cell Progenitors Endocrinology, April 1, 1999; 140(4): 1681 - 1686. [Abstract] [Full Text]
|
|
|
|
|
|
Y.-J. Chen, Q. Feng, and Y.-X. Liu Expression of the Steroidogenic Acute Regulatory Protein and Luteinizing Hormone Receptor and Their Regulation by Tumor Necrosis Factor {alpha} in Rat Corpora Lutea Biol Reprod, February 1, 1999; 60(2): 419 - 427. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
