Endocrinology Vol. 139, No. 8 3375-3381
Copyright © 1998 by The Endocrine Society
Induction of the Vitamin D 24-Hydroxylase (CYP24) by 1,25-Dihydroxyvitamin D3 Is Regulated by Parathyroid Hormone in UMR106 Osteoblastic Cells1
H. J. Armbrecht,
T. L. Hodam,
M. A. Boltz,
N. C. Partridge,
A. J. Brown and
V. B. Kumar
Geriatric Research, Education and Clinical Center (H.J.A., T.L.H.,
M.A.B., V.B.K.), St. Louis VA Medical Center, St. Louis, Missouri
63125; Division of Geriatric Medicine (H.J.A., T.L.H., M.A.B., V.B.K.),
Department of Biochemistry and Molecular Biology (H.J.A.), Department
of Pharmacological and Physiological Science (N.C.P.), St. Louis
University Health Sciences Center, St. Louis, Missouri 63104; and Renal
Division (A.J.B.), Washington University School of Medicine, St. Louis,
Missouri 63110
Address all correspondence and requests for reprints to: H. J. Armbrecht, Ph.D., Geriatric Center (11G-JB), St. Louis VA Medical Center, St. Louis, Missouri 63125.
 |
Abstract
|
|---|
The expression of the vitamin D 24-hydroxylase is highly regulated in
target tissues for 1,25-dihydroxyvitamin D3 (1,
25(OH)2D), where it may modulate the action of
1,25(OH)2D. In UMR106 osteoblastic cells,
1,25(OH)2D and PTH synergistically induce 24-hydroxylase
expression. The purpose of these studies was to characterize the
interaction between 1,25(OH)2D and PTH with regard to the
messenger RNA (mRNA) levels of the cytochrome P450 component of the
24-hydroxylase (CYP24). PTH alone had no effect on CYP24 mRNA levels,
and 1,25(OH)2D alone produced only a modest increase.
However, 1,25(OH)2D and PTH together synergistically
increased CYP24 mRNA levels 3-fold compared with 1,25(OH)2D
alone. PTH also increased the sensitivity of UMR cells to
1,25(OH)2D from 10-8 to 10-10
M. PTH worked through the cAMP signaling pathway as
evidenced by the lack of effect of PTH (334) and by the full activity
of 8-bromo-cAMP. PTH in the presence of 1,25(OH)2D
increased CYP24 gene transcription as shown by nuclear run-on studies
and by activation of a CYP24 promoter-reporter construct after
transfection. PTH also increased vitamin D receptor number in UMR
cells, but this occurred at times later than the increase in
transcription. These studies demonstrate that PTH in the presence of
1,25(OH)2D works through the cAMP-dependent signaling
pathway to increase transcription of the CYP24 gene, to increase CYP24
protein levels, and to increase 24-hydroxylase activity.
 |
Introduction
|
|---|
THE 1,25-dihydroxyvitamin D-24-hydroxylase
is a cytochrome P450-containing enzyme (CYP24) that is important in the
regulation of vitamin D metabolism (1, 2). It is found in tissues such
as intestine, kidney, and bone, which are target tissues for
1,25-dihydroxyvitamin D3 (1, 25(OH)2D), the
active metabolite of vitamin D. The 24-hydroxylase initiates
inactivation of 1,25(OH)2D in these tissues, and in this
way it may regulate the action of 1,25(OH)2D (3, 4). The
24-hydroxylase is induced by 1,25(OH)2D in its target
tissues, and this induction is modulated by phorbol esters (5, 6, 7, 8), PTH
(9), and insulin (10).
It has previously been shown that PTH enhances the induction of
24-hydroxylase activity by 1,25(OH)2D in UMR106
osteoblastic cells (9). This could be accounted for by the synergistic
induction of CYP24 messenger RNA (mRNA) levels by PTH in the presence
of 1,25(OH)2D. The effect of PTH does not require new
protein synthesis (10). However, the mechanism by which PTH and
1,25(OH)2D interact to increase CYP24 mRNA levels is not
known.
The purpose of these studies was to characterize the effects of PTH on
induction of CYP24 mRNA by 1,25(OH)2D and to determine the
mechanism by which PTH exerts its effects. Of particular interest was
the second messenger pathway through which PTH worked and the
involvement of PTH in the transcriptional regulation of the CYP24 gene.
In view of previous studies demonstrating that PTH increased vitamin D
receptor (VDR) number in UMR cells (11), the role of VDR in the action
of PTH was also of interest. Finally, the effect of PTH and
1,25(OH)2D on CYP24 protein expression was studied to
determine the relationship between CYP24 mRNA levels, protein levels,
and 24-hydroxylase activity.
 |
Materials and Methods
|
|---|
Cell culture
UMR106 cells were obtained from the American Type Culture
Collection. Cells were cultured in T25 flasks with DMEM (Gibco BRL,
Gaithersburg, MD) containing 10% FBS (Hyclone, Logan, UT) (complete
medium). Cells reached confluence in 35 days and were used within 30
passages of receipt. Primary rat osteoblasts were isolated from 2- to
3-day-old rat calvaria as previously described (12). Cells were
isolated from calvaria by sequential digestion with collagenase and
trypsin. Cells were then cultured to confluency in MEM (Gibco BRL) with
10% FBS.
Measurement of CYP24 mRNA levels
The effects of hormones on CYP24 mRNA levels were determined as
described previously (9, 10). Confluent cells were deprived of serum
for 24 h and treated with 1,25(OH)2D and PTH at the
indicated concentrations and times. The 1,25(OH)2D was the
kind gift of Dr. Milan Uskokovic (Hoffmann-LaRoche, Nutley, NJ), and
rat PTH (134) was from Bachem (Torrance, CA), unless otherwise
indicated. After treatment, cells were washed and frozen until
isolation of total RNA using RNAzol (Tel-Test, Inc., Friendswood, TX).
CYP24 mRNA levels were measured by dot blot using the full length clone
for rat CYP24 (13), kindly supplied by Drs. Y. Ohyama and K. Okuda
(Hiroshima University School of Dentistry, Hiroshima, Japan). After
hybridization, filters were washed and exposed to x-ray film. The dots
on the x-ray film were quantitated by densitometry, and the data were
expressed as OD per mg of total RNA (OD/mg). The CYP24 mRNA levels
expressed in this way are comparable within experiments. However, the
absolute numbers are not comparable between experiments due to
differences in exposure time, etc. Some blots were stripped and
rehybridized with ß-actin complementary DNA (cDNA) (Oncor, Inc.,
Gaithersburg, MD). Based on actin rehybridization, sample loading was
quite uniform. Therefore, data were routinely normalized to the total
amount of RNA applied (9, 10).
Nuclear run-on assay
Run-on assays were performed using the method of Scott et
al. (14) with modifications. Briefly, after hormone treatment,
cells were rinsed, scraped, resuspended in the lysis buffer,
homogenized, and centrifuged through 1 M sucrose. The
nuclear pellet was resuspended in the reaction buffer and incubated
with 100 uCi of 32P-uridine triphosphate (3000 Ci/mmol) for
1 h at 30 C with shaking. The labeled RNA was then isolated using
RNAzol. The incorporation of radioactivity into RNA was determined by
scintillation counting and the RNA concentration by spectrophotometry.
Complementary CYP24 and actin DNA were applied to Nytran membranes, and
the membranes were prehybridized, hybridized with the labeled RNA, and
washed as previously described (14). The filters were then
autoradiographed, and the resulting bands were quantitated by
densitometry.
Transient transfection
A reporter construct was made consisting of the promoter region
of the CYP24 gene ligated upstream of the chloramphenicol
aceyltransferase (CAT) reporter sequence. The -580 to +8 nucleotide
region of the CYP24 promoter (15), containing the response elements of
interest, was obtained by PCR using specific forward
(AGTTTCAAGTCCTCTCTTCCTTCAGAAGCT) and reverse
(CCTCCCCAAGATTCCAGGCATAGGGACCTCG) primers. This promoter region was
then inserted into the pCAT-Basic vector at the HindIII site
(Promega, Madison, WI). UMR cells growing in 10-cm Petri dishes
(Falcon, Becton-Dickinson Labware, Lincoln Park, NJ) were transfected
using the calcium chloride method (16). Briefly, 10 µg of plasmid DNA
was added to 1 x 106 cells and incubated at 37 C in
8% CO2 for 4 h. A 15% glycerol solution was added,
and the cells were incubated for 3 min. The cells were rinsed with
serum-free media, and complete medium was added. The cells were
incubated overnight at 37 C in 5% CO2. The transfected
cells were treated with hormones for the indicated time, and the CAT
assay performed (16). Briefly, cells were washed, scraped, and lysed by
three freeze-thaw cycles. Lysed cells were heated to 60 C for 10 min to
inactivate endogenous acetylase, and, after centrifugation, the cell
supernate was stored at -20 C until use. The CAT assay was performed
by incubating the cell extract in a reaction mixture containing
14C-chloramphenicol (ICN, Costa Mesa, CA) and N-butyryl
Coenzyme A (Promega, Madison, WI). After 5 h at 37 C, the reaction
was terminated, xylene extractions were performed, and the final
extract was assayed for radioactivity by scintillation counting.
VDR binding assay
VDR number was determined by measuring 1,25(OH)2D
binding in intact cells as previously described (17). Cells were grown
to confluency in six-well plates and were incubated for 2 h with 1
nM 3H-1,25(OH)2D (180 Ci/mmol)
(Amersham, Arlington Heights, IL) with or without 250 nM
cold 1,25(OH)2D. Cells were then washed and sonicated for
30 sec in TEDK buffer (10 mM Tris-HCl (pH 7.4), 1.5
mM EDTA, 5 mM dithiothreitol, and 300
mM KCl). Charcoal/dextran was then added, and the samples
incubated for 15 min on ice. The samples were then centrifuged, and the
supernatants assayed for radioactivity. Binding was expressed as fmol
of 1,25(OH)2D bound per mg of total protein.
Western blotting
Relative levels of CYP24 protein were determined by Western
blotting. For this, cells were grown to confluency in T75 flasks. After
hormone treatment, cells were rinsed, scraped, and collected by
centrifugation. Cells were resuspended in isolation buffer (15
mM Tris-HCl (pH 7.4), 190 mM sucrose, 500
mM EDTA, 1 µg/ml leupeptin, 1 µg/ml pepstatin, and 0.5
mM dithiothreitol), homogenized, and centrifuged at 1600
rpm for 12 min at 4 C. The resulting pellet was resuspended in buffer
containing 0.2% SDS and subjected to SDS-PAGE using 1012% gels.
Proteins were transferred electrophoretically to nitrocellulose
membrane (Hybond-ECL, Amersham, Arlington Heights, IL). The membrane
was incubated first for 1 h at room temperature with a rabbit
polyclonal antibody raised against a synthetic peptide to the first 12
N-terminal amino acids of the mature rat CYP24 (13) (Chiron, San Diego,
CA). The membrane was then incubated with antirabbit IgG linked to
horseradish peroxidase (Amersham) for 1 h at room temperature. The
antigen-antibody complex was visualized by chemiluminescence using
luminol-peroxidase reagents supplied by Amersham (ECL Western Blotting
kit and Hyperfilm-ECL). Bands were quantitated by densitometry.
Statistics
Data are reported as the mean ± SEM of the
indicated number of flasks. The two-tailed Students t test
was used to determine significance, and P < 0.05 was
considered significant.
 |
Results
|
|---|
The induction of CYP24 mRNA by PTH and 1,25(OH)2D was
examined as a function of time (Fig. 1A
).
CYP24 mRNA levels were quantitated by dot blot (data not shown). This
was possible since Northern analysis (Fig. 1B
) showed only a single
mRNA species with a size of 3.6 kb, as previously reported (10). PTH
alone had no effect from 036 h (Fig. 1A
). 1,25(OH)2D
alone had an effect on mRNA levels which was maximal at 1224 h.
1,25(OH)2D and PTH together produced a synergistic
response, which was maximal at the 3 h time point, consistent with
previous studies (9). The maximal response to the two hormones was
three times larger than the maximal response to 1,25(OH)2D
alone. By 36 h, CYP24 mRNA levels had returned to near zero
regardless of hormone treatment.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1. Effect of 1,25(OH)2D and PTH on CYP24
mRNA levels in UMR cells. A, Cells were incubated with
1,25(OH)2D (10-7 M) and/or PTH (25
nM) for the indicated times. CYP24 mRNA levels were
measured by dot blots. Data are expressed as optical density (OD) per
mg of total RNA. Data points are the mean ± SE of six
flasks. 1,25(OH)2D + PTH significantly increased CYP24 mRNA
levels above those seen with 1,25(OH)2D alone at 3 and
12 h (t test, P < 0.05). B,
Northern blot of cells treated with 1) no hormones; 2)
1,25(OH)2D alone; 3) PTH alone; or 4)
1,25(OH)2D + PTH for 3 h.
|
|
Because UMR106 cells are a transformed osteoblastic cell line, the
effects of PTH and 1,25(OH)2D were also examined in primary
rat osteoblasts. This was done to ensure that the results obtained were
not unique to the transformed UMR106 cells. Osteoblasts were isolated
from neonatal rat calvaria and cultured to confluency. Cultured cells
were then treated with PTH and 1,25(OH)2D for 6 h. At
this time, effects of both PTH and 1,25(OH)2D could be
observed in UMR cells (Fig. 1A
). 1,25(OH)2D alone
significantly increased CYP24 mRNA levels above control levels (Fig. 2
). PTH in the presence of
1,25(OH)2D produced a further increase in mRNA levels which
was significantly higher than that seen with 1,25(OH)2D
alone.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 2. Effect of 1,25(OH)2D and PTH on CYP24
mRNA levels in primary rat osteoblasts. Cells were incubated
with 1,25(OH)2D (10-7 M) and PTH
(25 nM) for 6 h. CYP24 mRNA levels were measured by
dot blot. Data are expressed as optical density (OD) per mg of total
RNA. Bars are the mean ± SE of three
flasks. *, Significantly different than control (t test,
P < 0.05). **, Significantly different than
1,25(OH)2D (t test, P <
0.05)
|
|
The effect of PTH in UMR cells was further characterized by determining
the effect of PTH on the 1,25(OH)2D dose-response curve
(Fig. 3
). Cells were incubated with
1,25(OH)2D for 12 h, and PTH or vehicle was added
during the last 3 h. Cells were incubated with
1,25(OH)2D for 12 h so that the effects of
1,25(OH)2D alone and 1,25(OH)2D plus PTH could
be easily measured (Fig. 1A
). In the absence of PTH, the response to
1,25(OH)2D was minimal. CYP24 mRNA levels were not
significantly increased until 10-8 M, and it
was maximal at 10-7 M. However, in the
presence of PTH, mRNA levels were significantly increased at
1,25(OH)2D concentrations as low as 10-10
M. The maximal response to 1,25(OH)2D was also
10-7 M, where the mRNA levels were about
6-fold higher than those seen in the absence of PTH. Thus, PTH altered
both the sensitivity of the UMR cells to 1,25(OH)2D and
their maximal response.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 3. Effect of PTH on 1,25(OH)2D dose
response in UMR cells. Cells were incubated with the indicated
concentration of 1,25(OH)2D for a total of 12 h. 25
nM PTH (+PTH) or vehicle only (-PTH) were added for the
last 3 h. CYP24 mRNA levels were determined by dot blot. Data are
expressed as OD per mg of total RNA. Data points are the mean ±
SE of three flasks. PTH significantly increased mRNA levels
at all 1,25(OH)2D concentrations compared with
1,25(OH)2D alone (t test,
P < 0.05).
|
|
The effect of PTH on the action of vitamin D metabolites other than
1,25(OH)2D was examined in UMR cells (Table 1
). Cells were incubated with hormones
for 3 h because this was the time of maximal effect for
1,25(OH)2D plus PTH (Fig. 1A
). PTH had almost no effect on
the action of vitamin D metabolites, which lacked the 1-
-hydroxyl
group. PTH had a large effect on the action of
1,24,25(OH)3D which was equivalent to that of
1,25(OH)2D itself.
PTH is known to activate several signal transduction pathways in UMR
cells (18). Therefore, a series of experiments were performed to
determine the pathway by which PTH stimulates the effect of
1,25(OH)2D. These experiments were performed using a 3-h
time point because this was the time of maximal effect for
1,25(OH)2D plus PTH (Fig. 1A
). First, the effect of
PTH(334), which activates the Ca/PKC pathway but not the cAMP pathway
(19), was examined. Bovine PTH(334) in the presence of
1,25(OH)2D produced a 2-fold increase in CYP24 mRNA levels
compared with 1,25(OH)2D alone (Table 2
). Bovine PTH(134), on the other hand,
produced a 10-fold increase in mRNA levels. This suggests that almost
all of the effect of PTH is mediated by the cAMP-dependent pathway. To
provide further evidence for this, studies were performed with the cAMP
analog 8-bromo-cAMP in the presence of 1,25(OH)2D (Table 3
). A maximal concentration of
8-bromo-cAMP markedly increased CYP24 mRNA to levels significantly
higher than those seen with maximal concentrations of PTH(134).
Addition of PTH resulted in no further increase in mRNA levels compared
with that seen with 8-bromo-cAMP alone. This suggests that 8-bromo-cAMP
and PTH work through a common pathway. The fact that the maximal
stimulation by PTH is less than that by 8-bromo-cAMP suggests that PTH
may also have an inhibitory pathway, perhaps mediated by protein kinase
C.
One way by which PTH could increase CYP24 mRNA levels in the presence
of 1,25(OH)2D is by increasing CYP24 gene transcription.
This possibility was studied by performing nuclear run-on assays on
isolated nuclei and by transfecting promoter-reporter constructs into
UMR cells. For the run-on measurements, UMR cells were treated with
1,25(OH)2D (10-7 M),
1,25(OH)2D + PTH (25 nM), or vehicle only
(Control). Cells were incubated with hormones for 1.5 h because
this corresponded to the time of maximal rate of increase in mRNA
levels (Fig. 1A
). After hormone treatment, nuclei were isolated and
labeled with 32P-uridine triphosphate. The labeled RNA was
then isolated and hybridized to filters containing probes for CYP24 and
for actin. There was no detectable CYP24 gene transcription in
untreated cells. In cells treated with 1,25(OH)2D alone,
the CYP24/actin ratio was 0.05 ± 0.03, and with
1,25(OH)2D + PTH the ratio was 0.33 ± 0.09 (mean
± SE of three flasks) (Fig. 5
). Thus, PTH significantly
increased CYP24 gene transcription compared with 1,25(OH)2D
alone (P < 0.05, t test). In a separate
experiment, PTH alone had no significant effect on CYP24 gene
transcription.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 5. Effect of 1,25(OH)2D and PTH on CAT
activity in UMR cells. A reporter construct consisting of the promoter
region of the rat CYP24 gene (-580 to +8 nucleotides) attached to the
Promega CAT vector was transfected into UMR cells. After 48 h,
cells were treated with 1,25(OH)2D (10-7
M) and PTH (25 nM) for the indicated time. CAT
activity was then determined and expressed relative to the activity in
the absence of hormones (Control). Bars are the
mean ± SE of 612 flasks. *, Significantly different
than control (t test, P < 0.05).
|
|
Because PTH increased transcription, the question of whether PTH
exerted its effect by acting through the upstream promoter region of
the CYP24 gene was examined. A reporter construct was made consisting
of the -580 to +8 nucleotide region of the CYP24 promoter (15)
inserted into the Promega CAT vector. The vector was transfected into
UMR cells. After the cells recovered, they were treated with hormones
for various periods of time and the CAT activity measured.
1,25(OH)2D alone had no significant effect on CAT activity
at 3 and 6 h, but it significantly increased activity at 12 h
(Fig. 5
). PTH in the presence of 1,25(OH)2D significantly
increased CAT activity at 3 and 6 h. At 12 h, PTH had no
additional effect compared with 1,25(OH)2D alone. The
effect of PTH alone on CAT activity was also determined. At 3 h,
PTH alone produced a relative CAT activity of 1.37 ± 0.11 (n
= 4). This was much less than than the CAT activity in the presence of
1,25(OH)2D + PTH at 3 h (Fig. 5
).
Another way in which PTH could increase CYP24 transcriptional activity
in the presence of 1,25(OH)2D is by altering
1,25(OH)2D receptor number. Therefore, the effect of PTH on
vitamin D receptor number in UMR cells was determined by ligand binding
studies as a function of time (Fig. 6
). PTH significantly increased
ligand binding by about 2-fold at 4 and 6 h. However, there was no
significant increase at 2 h. Because CYP24 mRNA levels were
maximal at 3 h in the presence of PTH (Fig. 1A
), the effect of PTH
on receptor number was also measured at this time in a separate
experiment. 1,25(OH)2D receptor binding was 54.6 ±
2.7 and 58.0 ± 3.0 fmol/mg (n = 5) in the absence and
presence of PTH, respectively, which was not significantly
different.

View larger version (67K):
[in this window]
[in a new window]
|
Figure 6. Effect of PTH on 1,25(OH)2D binding by
UMR cells. Cells were incubated for the indicated time with 25
nM PTH or vehicle only (Control). 1,25(OH)2D
binding was measured in intact cells by incubating with
3H-1,25(OH)2D for the final 2 h in the
presence or absence of 250 nM cold 1,25(OH)2D.
Binding was expressed as fmol of 1,25(OH)2D bound per mg of
total cellular protein. Specific 1,25(OH)2D binding was
calculated by subtracting nonspecific binding (in the presence of 250
nM cold 1,25(OH)2D) from total
1,25(OH)2D binding. Bars are the mean
± SE of four flasks. *, Significantly different than
control (t test, P < 0.05).
|
|
Finally, because PTH and 1,25(OH)2D markedly increased
CYP24 mRNA levels (Fig. 1A
), the effect of these hormones on CYP24
protein levels was measured. Western blotting revealed that PTH and
1,25(OH)2D induced a single band with a size of 56 kDa
(Fig. 7B
). This is the size of the mature CYP24 protein predicted from
the nucleic acid sequence (13). Protein levels, determined by
densitometry, were significantly increased by PTH and
1,25(OH)2D at 3 h, but the major increase was between
3 and 6 h in the presence of PTH (Fig. 7A
). In the absence of PTH,
1,25(OH)2D produced only small increases in CYP24 protein
over this 12-h time period. Thus, the synergistic increase seen between
PTH and 1,25(OH)2D with regard to mRNA was also reflected
in CYP24 protein levels.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7. Effect of PTH on CYP24 protein levels in UMR
cells. A, Cells were incubated with 1,25(OH)2D
(10-7 M) or 1,25(OH)2D + PTH (25
nM) for the indicated time. CYP24 mRNA levels were measured
by Western blotting using an antibody to N-terminal amino acids 112
of the mature rat CYP24 protein. Data points are the mean ±
SE of six flasks. PTH in the presence of
1,25(OH)2D significantly increased protein levels at all
time points compared with 1,25(OH)2D alone
(t test, P < 0.05). B, Western blot
of pooled samples incubated with 1,25(OH)2D + PTH for the
indicated time.
|
|
 |
Discussion
|
|---|
The results presented in this investigation demonstrate that in
the presence of 1,25(OH)2D PTH works through the
cAMP-dependent signaling pathway to increase transcription of the CYP24
gene. The involvement of the cAMP-dependent pathway is evidenced by
the minimal effect of bPTH(334) (Table 2
), which does not activate
the cAMP-dependent pathway (19). In addition, 8-bromo-cAMP increases
CYP24 mRNA to levels higher than those seen with PTH and is nonadditive
with PTH (Table 3
). These results are consistent with the previous
study (9), which found that forskolin, a stimulator of intracellular
cAMP levels, increased CYP24 mRNA levels. On the other hand, phorbol
esters, which activate protein kinase C, did not.
The fact that PTH stimulates transcription of the CYP24 gene is
demonstrated by the nuclear run-on (Fig. 4
) and CAT assay (Fig. 5
). Quantitatively, it is difficult to
know if these increases in transcription account for all of the
increase in CYP24 mRNA levels induced by PTH at 3 h (Fig. 1A
). PTH
may also have effects on mRNA stability. However, effects of PTH on
CYP24 mRNA stability have not yet been demonstrated experimentally in
this system. At 12 h, PTH has no additional effect on CAT activity
above that of 1,25(OH)2D alone (Fig. 5
). This could account
for the decrease in CYP24 mRNA levels between 3 and 12 h in the
presence of PTH (Fig. 1A
).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 4. Effect of PTH on transcription of CYP24 gene in
UMR cells. Individual flasks were treated with 1,25(OH)2D
(10-7 M) in the presence (+) or absence (-)
of PTH (25 nM) in triplicate for 1.5 h. Nuclei were
then isolated and a run-on assay performed. Radiolabeled RNA was
hybridized to complementary CYP24 and actin DNA immobilized on Nytran
membranes. Membranes were washed and autoradiographed, and the
resulting bands (see above) were quantitated by densitometry. The
CYP24/actin ratio was 0.05 ± 0.03 in the absence of PTH and
0.33 ± 0.09 in the presence of PTH (mean ± SE
of three flasks).
|
|
To exert its effect, PTH requires the presence of
1,25(OH)2D (Fig. 1A
). Specifically, the data are consistent
with a requirement for the 1-
-hydroxyl group on the vitamin D
structure (Table 1
). This suggests that PTH action requires occupancy
of the VDR, which also is dependent on the presence of the
1-
-hydroxyl group (20). It is of interest that
1,24,25(OH)3D is as effective as 1,25(OH)2D in
increasing CYP24 mRNA levels (Table 1
). 1,24,25(OH)3D is
thought to be the first step in the breakdown of 1,25(OH)2D
(3). 1,24,25(OH)3D may further stimulate the 24-hydroxylase
and the catabolism of 1,25(OH)2D.
Whether the initial effect of PTH requires an increase in VDR number is
not clear. As reported previously (11), it was found that PTH
significantly increased VDR number at 4 and 6 h in UMR cells (Fig. 6
). However, there was no significant
increase at 2 or 3 h. Three hours is the time of maximal increase
in mRNA levels (Fig. 1A
) and of significant transcriptional activity
(Fig. 5
). In addition, the fact that PTH action does not require new
protein synthesis (10) would argue against the necessity for the
synthesis of new VDR. It may be that the observed increase in VDR
number plays a role in sustaining the PTH effect at times greater than
3 h.
These studies give some insight into possible mechanisms by which PTH
may potentiate the effect of 1,25(OH)2D. The effect of PTH
is rapid in that there is a measurable increase in transcription (Fig. 4
) and CAT activity (Fig. 5
) within 3 h and that mRNA levels are
markedly elevated at 3 h (Fig. 1A
). The effect of PTH is mediated
through cAMP (Tables 2
and 3
) and thus probably involves protein
phosphorylation mediated by protein kinase A. A previous study using
this system showed that the action of PTH does not require new protein
synthesis (10). Cycloheximide had no effect on the capacity of PTH to
increase CYP24 mRNA levels. The fact that new protein synthesis is not
required would also be consistent with a rapid phosphorylation
mechanism. On the other hand, the effect of 1,25(OH)2D
alone is not maximal until 24 h (Fig. 1A
). This may be due to the
fact that, unlike PTH, the action of 1,25(OH)2D requires
new protein synthesis (data not shown). By way of contrast, other
actions of PTH in UMR106 cells do not require 1,25(OH)2D.
These include activation of the collagenase (14) and c-fos
(16) genes via a cAMP-dependent pathway. Thus, 1,25(OH)2D
is not necessary for the activation of the cAMP-dependent pathway by
PTH.
There are several possible targets for protein kinase A phosphorylation
in UMR cells. Protein kinase A may phosphorylate the cAMP-response
element binding protein (CREB), which could then act on cAMP-response
elements (CRE). PTH has been shown to phosphorylate CREB in UMR cells
(16). PTH also increases c-fos expression by a
cAMP-dependent mechanism in UMR cells (16), and c-fos could
then act on AP-1 sites. However, this would require new protein
synthesis, which is not required for the stimulation of CYP24 mRNA
levels by PTH. Finally, phosphorylation of VDR has been shown to alter
VDR activity, although phosphorylation by protein kinase A has been
reported to inhibit activity in vitro (21).
One possible mechanism by which PTH could increase promoter activity in
conjunction with 1,25(OH)2D would involve CREB. The region
of the CYP24 promoter (-580 to +8 nucleotides) used in the CAT assay
(Fig. 5
) contains two well characterized vitamin D-response elements
(VDREs) (15) as well as putative CRE sites (22). One possibility is
that PTH phosphorylates CREB, which then binds to the CRE sites and
interacts with the VDR/VDRE complexes to synergistically increase
promoter activity. Another mitochondrial steroid hydroxylase, the
CYP11B, is stimulated by ACTH acting through cAMP, CREB, and a CRE
element in the promoter region (23). However, other steroid
hydroxylases are regulated by cAMP acting through unique elements that
are not conventional CREs and do not involve CREB (24).
The marked potentiation of CYP24 mRNA levels by PTH (Fig. 1A
) resulted
in a marked increase in CYP24 protein levels compared with
1,25(OH)2D alone (Fig. 7
).
The fact that mRNA levels peak at 3 h, whereas the protein levels
do not increase markedly until 6 h probably represents a lag in
protein synthesis from mRNA. Thus, the effect of PTH on mRNA levels may
have physiological importance in that it is translated into CYP24
protein and 24-hydroxylase activity (9). Interestingly, at 3 h
after PTH addition, CYP24 protein levels are still relatively low (Fig. 7
), whereas 24-hydroxylase activity is already high (9). This suggests
that at this time point PTH may in some way activate the protein in
addition to increasing the amount of protein present.
The synergistic increase in CYP24 expression by 1,25(OH)2D,
and PTH may have physiological importance. PTH makes the osteoblast
more sensitive to the action of 1,25(OH)2D by about two
orders of magnitude (Fig. 3
). In the presence of PTH (25
nM), 1,25(OH)2D increases CYP24 mRNA levels at
concentrations as low as 0.1 nM, which is in the
physiological range. PTH also increases the maximal response to
1,25(OH)2D by about 6-fold. The fact that
1,25(OH)2D and PTH work together to increase CYP24 levels
in primary osteoblasts (Fig. 2
) suggests that this interaction may have
importance in the intact animal. A recent study reported that mice
deficient in CYP24 have skeletal abnormalities, suggesting that the
24-hydroxylase may play an important role in bone development and
homeostasis (25). This could be due to the role of the 24-hydroxylase
in modulating the action of 1,25(OH)2D in bone cells, or it
could be due to the role of the 24-hydroxylase in producing vitamin D
metabolites such as 24,25-dihydroxyvitamin D, which has been reported
to be essential for bone formation (26).
 |
Acknowledgments
|
|---|
We thank Drs. Y. Ohyama and K. Okuda (Hiroshima University
School of Dentistry, Hiroshima, Japan) for the rat CYP24 clone and
Connie Young for the photography.
 |
Footnotes
|
|---|
1 This work was supported by the Geriatric Research, Education, and
Clinical Center and the Medical Research Service of the Department of
Veterans Affairs and by NIH Grant AG-12587. 
Received December 5, 1997.
 |
References
|
|---|
-
DeLuca HF 1988 The vitamin D story: a
collaborative effort of basic science and clinical medicine. FASEB J 2:224236[Abstract]
-
Minghetti PP, Norman AW 1988 1,25(OH)2-vitamin D3 receptors: gene regulation
and genetic circuitry. FASEB J 2:30433053[Abstract]
-
Kumar R 1984 Metabolism of 1,25-dihydroxyvitamin
D3. Physiol Rev 64:478504[Abstract/Free Full Text]
-
Reinhardt TA, Horst RL 1989 Self-induction of
1,25-dihydroxyvitamin D3 metabolism limits receptor
occupancy and target tissue responsiveness. J Biol Chem 264:1591715921[Abstract/Free Full Text]
-
Henry HL, Luntao EM 1989 Interactions between
intracellular signals involved in the regulation of 25-hydroxyvitamin
D3 metabolism. Endocrinology 124:22282234[Abstract]
-
Armbrecht HJ, Hodam TL, Boltz MA, Chen ML 1993 Phorbol ester markedly increases the sensitivity of intestinal
epithelial cells to 1,25-dihydroxyvitamin D. FEBS Lett 327:1316[CrossRef][Medline]
-
Chen ML, Boltz MA, Armbrecht HJ 1993 Effects of
1,25-dihydroxyvitamin D3 and phorbol ester on
25-hydroxyvitamin D3 24-hydroxylase cytochrome P450
messenger ribonucleic acid levels in primary cultures of rat renal
cells. Endocrinology 132:17821788[Abstract]
-
Armbrecht HJ, Chen ML, Hodam TL, Boltz MA 1997 Induction of 24-hydroxylase cytochrome P450 mRNA by
1,25-dihydroxyvitamin D and phorbol esters in normal rat kidney
(NRK-52E) cells. J Endocrinol 153:199205[Abstract]
-
Armbrecht HJ, Hodam TL 1994 Parathyroid hormone
and 1,25-dihydroxyvitamin D synergistically induce the
1,25-dihydroxyvitamin D-24-hydroxylase in rat UMR-106 osteoblast-like
cells. Biochem Biophys Res Commun 205:674679[CrossRef][Medline]
-
Armbrecht HJ, Wongsurawat VT, Hodam TL, Wongsurawat
N 1996 Insulin markedly potentiates the capacity of parathyroid
hormone to increase expression of 25-hydroxyvitamin
D3-24-hydroxylase in rat osteoblastic cells in the presence
of 1,25-dihydroxyvitamin D3. FEBS Lett 393:7780[CrossRef][Medline]
-
Krishnan AV, Cramer SD, Bringhurst FR, Feldman D 1995 Regulation of 1,25-dihydroxyvitamin D3 receptors by
parathyroid hormone in osteoblastic cells: role of second messenger
pathways. Endocrinology 136:705712[Abstract]
-
Shalhoub V, Conlon D, Tassinari M, Quinn C, Partridge N,
Stein GS, Lian JB 1992 Glucocorticoids promote development of the
osteoblast phenotype by selectively modulating expression of cell
growth and differentiation associated genes. J Cell Biochem 50:425440[CrossRef][Medline]
-
Ohyama Y, Noshiro M, Okuda K 1991 Cloning and
expression of cDNA encoding 25-hydroxyvitamin D3
24-hydroxylase. FEBS Lett 278:195198[CrossRef][Medline]
-
Scott DK, Brakenhoff KD, Clohisy JC, Quinn CO, Partridge
NC 1992 Parathyroid hormone induces transcription of collagenase
in rat osteoblastic cells by a mechanism using cyclic adenosine
3',5'-monophosphate and requiring protein synthesis. Mol Endocrinol 6:21532159[Abstract]
-
Ohyama Y, Ozono K, Uchida M, Shinki T, Kato S, Suda T,
Yamamoto O, Noshiro M, Kato Y 1994 Identification of a vitamin
D-responsive element in the 5'-flanking region of the rat
25-hydroxyvitamin D3 24-hydroxylase gene. J Biol Chem 269:1054510550[Abstract/Free Full Text]
-
Pearman AT, Chou WY, Bergman KD, Pulumati MR, Partridge
NC 1996 Parathyroid hormone induces c-fos promoter activity in
osteoblastic cells through phosphorylated cAMP response element
(CRE)-binding protein binding to the major CRE. J Biol Chem 271:2571525721[Abstract/Free Full Text]
-
Brown AJ, Berkoben M, Ritter CS, Slatopolsky E 1992 Binding and metabolism of 1,25-dihydroxyvitamin D3 in cultured bovine
parathyroid cells. Endocrinology 130:276281[Abstract]
-
Partridge NC, Bloch SR, Pearman AT 1994 Signal
transduction pathways mediating parathyroid hormone regulation of
osteoblastic gene expression. J Cell Biochem 55:321327[CrossRef][Medline]
-
Fujimori A, Cheng SL, Avioli LV, Civitelli R 1991 Dissociation of second messenger activation by parathyroid hormone
fragments in osteosarcoma cells. Endocrinology 128:30323039[Abstract]
-
Link R, DeLuca HF 1985 The vitamin D receptor. In:
Conn PM (ed) The Receptors. Academic Press, New York, vol II:135
-
Haussler MR, Jurutka PW, Hsien JC, Thompson PD,
Selznick SH, Haussler CA, Whitfield GK 1994 Receptor mediated
genomic actions of 1,25(OH)2D3: modulation by
phosphorylation. In: Norman AW, Bouillon R, Thomasset M (eds) Vitamin D
- A Pluripotent Steroid Hormone: Structural Studies, Molecular
Endocrinology and Clinical Applications. Walter de Gruyter, Berlin, pp
209216
-
Zierold C, Darwish HM, DeLuca HF 1994 Identification of a vitamin D-response element in the rat calcidiol
(25-hydroxyvitamin D3)-24-hydroxylase gene. Proc Natl Acad
Sci USA 91:900902[Abstract/Free Full Text]
-
Honda S, Morohashi K, Omura T 1990 Novel cAMP
regulatory elements in the promoter region of bovine P45011B gene.
J Biochem 108:10421049[Abstract/Free Full Text]
-
Waterman MR, Bischof LJ 1997 Diversity of ACTH
(cAMP)-dependent transcription of bovine steroid hydroxylase genes.
FASEB J 11:419427[Abstract]
-
St.-Arnaud R, Arabian A, Glorieux FH 1996 Abnormal
bone development in mice deficient for the vitamin D 24-hydroxylase
gene. J Bone Miner Res 11:S126 (Abstract)
-
Ornoy A, Goodwin D, Noff D, Edelstein S 1978 24,25-dihydroxyvitamin D is a metabolite of vitamin D essential for
bone formation. Nature 276:517519[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
S. Sundaram, M. J. Beckman, A. Bajwa, J. Wei, K. M. Smith, G. H. Posner, and D. A. Gewirtz
QW-1624F2-2, a synthetic analogue of 1,25-dihydroxyvitamin D3, enhances the response to other deltanoids and suppresses the invasiveness of human metastatic breast tumor cells.
Mol. Cancer Ther.,
November 1, 2006;
5(11):
2806 - 2814.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ren, L. Nguyen, S. Wu, C. Encinas, J. S. Adams, and M. Hewison
Alternative Splicing of Vitamin D-24-Hydroxylase: A NOVEL MECHANISM FOR THE REGULATION OF EXTRARENAL 1,25-DIHYDROXYVITAMIN D SYNTHESIS
J. Biol. Chem.,
May 27, 2005;
280(21):
20604 - 20611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Huening, G. Yehia, C. A. Molina, and S. Christakos
Evidence for a Regulatory Role of Inducible cAMP Early Repressor in Protein Kinase A-Mediated Enhancement of Vitamin D Receptor Expression and Modulation of Hormone Action
Mol. Endocrinol.,
September 1, 2002;
16(9):
2052 - 2064.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Barletta, L. P. Freedman, and S. Christakos
Enhancement of VDR-Mediated Transcription by Phosphorylation: Correlation with Increased Interaction Between the VDR and DRIP205, a Subunit of the VDR-Interacting Protein Coactivator Complex
Mol. Endocrinol.,
February 1, 2002;
16(2):
301 - 314.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Yang, S. J. Hyllner, and S. Christakos
Interrelationship between signal transduction pathways and 1,25(OH)2D3 in UMR106 osteoblastic cells
Am J Physiol Endocrinol Metab,
July 1, 2001;
281(1):
E162 - E170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. Armbrecht, M. A. Boltz, and V. B. Kumar
Intestinal plasma membrane calcium pump protein and its induction by 1,25(OH)2D3 decrease with age
Am J Physiol Gastrointest Liver Physiol,
July 1, 1999;
277(1):
G41 - G47.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Yang, P. A. Friedman, R. Kumar, J. L. Omdahl, B. K. May, M.-L. Siu-Caldera, G. S. Reddy, and S. Christakos
Expression of 25(OH)D3 24-hydroxylase in distal nephron: coordinate regulation by 1,25(OH)2D3 and cAMP or PTH
Am J Physiol Endocrinol Metab,
April 1, 1999;
276(4):
E793 - E805.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. St-Arnaud and F. H. Glorieux
Editorial: 24, 25-Dihydroxyvitamin D--Active Metabolite or Inactive Catabolite?
Endocrinology,
August 1, 1998;
139(8):
3371 - 3374.
[Full Text]
[PDF]
|
 |
|