help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Armbrecht, H. J.
Right arrow Articles by Kumar, V. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Armbrecht, H. J.
Right arrow Articles by Kumar, V. B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*1,25-DIHYDROXYCHOLECALCIFEROL
*PARATHYROID HORMONE
Endocrinology Vol. 139, No. 8 3375-3381
Copyright © 1998 by The Endocrine Society


ARTICLES

Induction of the Vitamin D 24-Hydroxylase (CYP24) by 1,25-Dihydroxyvitamin D3 Is Regulated by Parathyroid Hormone in UMR106 Osteoblastic Cells1

H. J. Armbrecht, T. L. Hodam, M. A. Boltz, N. C. Partridge, A. J. Brown and V. B. Kumar

Geriatric Research, Education and Clinical Center (H.J.A., T.L.H., M.A.B., V.B.K.), St. Louis VA Medical Center, St. Louis, Missouri 63125; Division of Geriatric Medicine (H.J.A., T.L.H., M.A.B., V.B.K.), Department of Biochemistry and Molecular Biology (H.J.A.), Department of Pharmacological and Physiological Science (N.C.P.), St. Louis University Health Sciences Center, St. Louis, Missouri 63104; and Renal Division (A.J.B.), Washington University School of Medicine, St. Louis, Missouri 63110

Address all correspondence and requests for reprints to: H. J. Armbrecht, Ph.D., Geriatric Center (11G-JB), St. Louis VA Medical Center, St. Louis, Missouri 63125.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The expression of the vitamin D 24-hydroxylase is highly regulated in target tissues for 1,25-dihydroxyvitamin D3 (1, 25(OH)2D), where it may modulate the action of 1,25(OH)2D. In UMR106 osteoblastic cells, 1,25(OH)2D and PTH synergistically induce 24-hydroxylase expression. The purpose of these studies was to characterize the interaction between 1,25(OH)2D and PTH with regard to the messenger RNA (mRNA) levels of the cytochrome P450 component of the 24-hydroxylase (CYP24). PTH alone had no effect on CYP24 mRNA levels, and 1,25(OH)2D alone produced only a modest increase. However, 1,25(OH)2D and PTH together synergistically increased CYP24 mRNA levels 3-fold compared with 1,25(OH)2D alone. PTH also increased the sensitivity of UMR cells to 1,25(OH)2D from 10-8 to 10-10 M. PTH worked through the cAMP signaling pathway as evidenced by the lack of effect of PTH (3–34) and by the full activity of 8-bromo-cAMP. PTH in the presence of 1,25(OH)2D increased CYP24 gene transcription as shown by nuclear run-on studies and by activation of a CYP24 promoter-reporter construct after transfection. PTH also increased vitamin D receptor number in UMR cells, but this occurred at times later than the increase in transcription. These studies demonstrate that PTH in the presence of 1,25(OH)2D works through the cAMP-dependent signaling pathway to increase transcription of the CYP24 gene, to increase CYP24 protein levels, and to increase 24-hydroxylase activity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE 1,25-dihydroxyvitamin D-24-hydroxylase is a cytochrome P450-containing enzyme (CYP24) that is important in the regulation of vitamin D metabolism (1, 2). It is found in tissues such as intestine, kidney, and bone, which are target tissues for 1,25-dihydroxyvitamin D3 (1, 25(OH)2D), the active metabolite of vitamin D. The 24-hydroxylase initiates inactivation of 1,25(OH)2D in these tissues, and in this way it may regulate the action of 1,25(OH)2D (3, 4). The 24-hydroxylase is induced by 1,25(OH)2D in its target tissues, and this induction is modulated by phorbol esters (5, 6, 7, 8), PTH (9), and insulin (10).

It has previously been shown that PTH enhances the induction of 24-hydroxylase activity by 1,25(OH)2D in UMR106 osteoblastic cells (9). This could be accounted for by the synergistic induction of CYP24 messenger RNA (mRNA) levels by PTH in the presence of 1,25(OH)2D. The effect of PTH does not require new protein synthesis (10). However, the mechanism by which PTH and 1,25(OH)2D interact to increase CYP24 mRNA levels is not known.

The purpose of these studies was to characterize the effects of PTH on induction of CYP24 mRNA by 1,25(OH)2D and to determine the mechanism by which PTH exerts its effects. Of particular interest was the second messenger pathway through which PTH worked and the involvement of PTH in the transcriptional regulation of the CYP24 gene. In view of previous studies demonstrating that PTH increased vitamin D receptor (VDR) number in UMR cells (11), the role of VDR in the action of PTH was also of interest. Finally, the effect of PTH and 1,25(OH)2D on CYP24 protein expression was studied to determine the relationship between CYP24 mRNA levels, protein levels, and 24-hydroxylase activity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
UMR106 cells were obtained from the American Type Culture Collection. Cells were cultured in T25 flasks with DMEM (Gibco BRL, Gaithersburg, MD) containing 10% FBS (Hyclone, Logan, UT) (complete medium). Cells reached confluence in 3–5 days and were used within 30 passages of receipt. Primary rat osteoblasts were isolated from 2- to 3-day-old rat calvaria as previously described (12). Cells were isolated from calvaria by sequential digestion with collagenase and trypsin. Cells were then cultured to confluency in MEM (Gibco BRL) with 10% FBS.

Measurement of CYP24 mRNA levels
The effects of hormones on CYP24 mRNA levels were determined as described previously (9, 10). Confluent cells were deprived of serum for 24 h and treated with 1,25(OH)2D and PTH at the indicated concentrations and times. The 1,25(OH)2D was the kind gift of Dr. Milan Uskokovic (Hoffmann-LaRoche, Nutley, NJ), and rat PTH (1–34) was from Bachem (Torrance, CA), unless otherwise indicated. After treatment, cells were washed and frozen until isolation of total RNA using RNAzol (Tel-Test, Inc., Friendswood, TX). CYP24 mRNA levels were measured by dot blot using the full length clone for rat CYP24 (13), kindly supplied by Drs. Y. Ohyama and K. Okuda (Hiroshima University School of Dentistry, Hiroshima, Japan). After hybridization, filters were washed and exposed to x-ray film. The dots on the x-ray film were quantitated by densitometry, and the data were expressed as OD per mg of total RNA (OD/mg). The CYP24 mRNA levels expressed in this way are comparable within experiments. However, the absolute numbers are not comparable between experiments due to differences in exposure time, etc. Some blots were stripped and rehybridized with ß-actin complementary DNA (cDNA) (Oncor, Inc., Gaithersburg, MD). Based on actin rehybridization, sample loading was quite uniform. Therefore, data were routinely normalized to the total amount of RNA applied (9, 10).

Nuclear run-on assay
Run-on assays were performed using the method of Scott et al. (14) with modifications. Briefly, after hormone treatment, cells were rinsed, scraped, resuspended in the lysis buffer, homogenized, and centrifuged through 1 M sucrose. The nuclear pellet was resuspended in the reaction buffer and incubated with 100 uCi of 32P-uridine triphosphate (3000 Ci/mmol) for 1 h at 30 C with shaking. The labeled RNA was then isolated using RNAzol. The incorporation of radioactivity into RNA was determined by scintillation counting and the RNA concentration by spectrophotometry. Complementary CYP24 and actin DNA were applied to Nytran membranes, and the membranes were prehybridized, hybridized with the labeled RNA, and washed as previously described (14). The filters were then autoradiographed, and the resulting bands were quantitated by densitometry.

Transient transfection
A reporter construct was made consisting of the promoter region of the CYP24 gene ligated upstream of the chloramphenicol aceyltransferase (CAT) reporter sequence. The -580 to +8 nucleotide region of the CYP24 promoter (15), containing the response elements of interest, was obtained by PCR using specific forward (AGTTTCAAGTCCTCTCTTCCTTCAGAAGCT) and reverse (CCTCCCCAAGATTCCAGGCATAGGGACCTCG) primers. This promoter region was then inserted into the pCAT-Basic vector at the HindIII site (Promega, Madison, WI). UMR cells growing in 10-cm Petri dishes (Falcon, Becton-Dickinson Labware, Lincoln Park, NJ) were transfected using the calcium chloride method (16). Briefly, 10 µg of plasmid DNA was added to 1 x 106 cells and incubated at 37 C in 8% CO2 for 4 h. A 15% glycerol solution was added, and the cells were incubated for 3 min. The cells were rinsed with serum-free media, and complete medium was added. The cells were incubated overnight at 37 C in 5% CO2. The transfected cells were treated with hormones for the indicated time, and the CAT assay performed (16). Briefly, cells were washed, scraped, and lysed by three freeze-thaw cycles. Lysed cells were heated to 60 C for 10 min to inactivate endogenous acetylase, and, after centrifugation, the cell supernate was stored at -20 C until use. The CAT assay was performed by incubating the cell extract in a reaction mixture containing 14C-chloramphenicol (ICN, Costa Mesa, CA) and N-butyryl Coenzyme A (Promega, Madison, WI). After 5 h at 37 C, the reaction was terminated, xylene extractions were performed, and the final extract was assayed for radioactivity by scintillation counting.

VDR binding assay
VDR number was determined by measuring 1,25(OH)2D binding in intact cells as previously described (17). Cells were grown to confluency in six-well plates and were incubated for 2 h with 1 nM 3H-1,25(OH)2D (180 Ci/mmol) (Amersham, Arlington Heights, IL) with or without 250 nM cold 1,25(OH)2D. Cells were then washed and sonicated for 30 sec in TEDK buffer (10 mM Tris-HCl (pH 7.4), 1.5 mM EDTA, 5 mM dithiothreitol, and 300 mM KCl). Charcoal/dextran was then added, and the samples incubated for 15 min on ice. The samples were then centrifuged, and the supernatants assayed for radioactivity. Binding was expressed as fmol of 1,25(OH)2D bound per mg of total protein.

Western blotting
Relative levels of CYP24 protein were determined by Western blotting. For this, cells were grown to confluency in T75 flasks. After hormone treatment, cells were rinsed, scraped, and collected by centrifugation. Cells were resuspended in isolation buffer (15 mM Tris-HCl (pH 7.4), 190 mM sucrose, 500 mM EDTA, 1 µg/ml leupeptin, 1 µg/ml pepstatin, and 0.5 mM dithiothreitol), homogenized, and centrifuged at 1600 rpm for 12 min at 4 C. The resulting pellet was resuspended in buffer containing 0.2% SDS and subjected to SDS-PAGE using 10–12% gels. Proteins were transferred electrophoretically to nitrocellulose membrane (Hybond-ECL, Amersham, Arlington Heights, IL). The membrane was incubated first for 1 h at room temperature with a rabbit polyclonal antibody raised against a synthetic peptide to the first 12 N-terminal amino acids of the mature rat CYP24 (13) (Chiron, San Diego, CA). The membrane was then incubated with antirabbit IgG linked to horseradish peroxidase (Amersham) for 1 h at room temperature. The antigen-antibody complex was visualized by chemiluminescence using luminol-peroxidase reagents supplied by Amersham (ECL Western Blotting kit and Hyperfilm-ECL). Bands were quantitated by densitometry.

Statistics
Data are reported as the mean ± SEM of the indicated number of flasks. The two-tailed Student’s t test was used to determine significance, and P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The induction of CYP24 mRNA by PTH and 1,25(OH)2D was examined as a function of time (Fig. 1AGo). CYP24 mRNA levels were quantitated by dot blot (data not shown). This was possible since Northern analysis (Fig. 1BGo) showed only a single mRNA species with a size of 3.6 kb, as previously reported (10). PTH alone had no effect from 0–36 h (Fig. 1AGo). 1,25(OH)2D alone had an effect on mRNA levels which was maximal at 12–24 h. 1,25(OH)2D and PTH together produced a synergistic response, which was maximal at the 3 h time point, consistent with previous studies (9). The maximal response to the two hormones was three times larger than the maximal response to 1,25(OH)2D alone. By 36 h, CYP24 mRNA levels had returned to near zero regardless of hormone treatment.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Effect of 1,25(OH)2D and PTH on CYP24 mRNA levels in UMR cells. A, Cells were incubated with 1,25(OH)2D (10-7 M) and/or PTH (25 nM) for the indicated times. CYP24 mRNA levels were measured by dot blots. Data are expressed as optical density (OD) per mg of total RNA. Data points are the mean ± SE of six flasks. 1,25(OH)2D + PTH significantly increased CYP24 mRNA levels above those seen with 1,25(OH)2D alone at 3 and 12 h (t test, P < 0.05). B, Northern blot of cells treated with 1) no hormones; 2) 1,25(OH)2D alone; 3) PTH alone; or 4) 1,25(OH)2D + PTH for 3 h.

 
Because UMR106 cells are a transformed osteoblastic cell line, the effects of PTH and 1,25(OH)2D were also examined in primary rat osteoblasts. This was done to ensure that the results obtained were not unique to the transformed UMR106 cells. Osteoblasts were isolated from neonatal rat calvaria and cultured to confluency. Cultured cells were then treated with PTH and 1,25(OH)2D for 6 h. At this time, effects of both PTH and 1,25(OH)2D could be observed in UMR cells (Fig. 1AGo). 1,25(OH)2D alone significantly increased CYP24 mRNA levels above control levels (Fig. 2Go). PTH in the presence of 1,25(OH)2D produced a further increase in mRNA levels which was significantly higher than that seen with 1,25(OH)2D alone.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. Effect of 1,25(OH)2D and PTH on CYP24 mRNA levels in primary rat osteoblasts. Cells were incubated with 1,25(OH)2D (10-7 M) and PTH (25 nM) for 6 h. CYP24 mRNA levels were measured by dot blot. Data are expressed as optical density (OD) per mg of total RNA. Bars are the mean ± SE of three flasks. *, Significantly different than control (t test, P < 0.05). **, Significantly different than 1,25(OH)2D (t test, P < 0.05)

 
The effect of PTH in UMR cells was further characterized by determining the effect of PTH on the 1,25(OH)2D dose-response curve (Fig. 3Go). Cells were incubated with 1,25(OH)2D for 12 h, and PTH or vehicle was added during the last 3 h. Cells were incubated with 1,25(OH)2D for 12 h so that the effects of 1,25(OH)2D alone and 1,25(OH)2D plus PTH could be easily measured (Fig. 1AGo). In the absence of PTH, the response to 1,25(OH)2D was minimal. CYP24 mRNA levels were not significantly increased until 10-8 M, and it was maximal at 10-7 M. However, in the presence of PTH, mRNA levels were significantly increased at 1,25(OH)2D concentrations as low as 10-10 M. The maximal response to 1,25(OH)2D was also 10-7 M, where the mRNA levels were about 6-fold higher than those seen in the absence of PTH. Thus, PTH altered both the sensitivity of the UMR cells to 1,25(OH)2D and their maximal response.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Effect of PTH on 1,25(OH)2D dose response in UMR cells. Cells were incubated with the indicated concentration of 1,25(OH)2D for a total of 12 h. 25 nM PTH (+PTH) or vehicle only (-PTH) were added for the last 3 h. CYP24 mRNA levels were determined by dot blot. Data are expressed as OD per mg of total RNA. Data points are the mean ± SE of three flasks. PTH significantly increased mRNA levels at all 1,25(OH)2D concentrations compared with 1,25(OH)2D alone (t test, P < 0.05).

 
The effect of PTH on the action of vitamin D metabolites other than 1,25(OH)2D was examined in UMR cells (Table 1Go). Cells were incubated with hormones for 3 h because this was the time of maximal effect for 1,25(OH)2D plus PTH (Fig. 1AGo). PTH had almost no effect on the action of vitamin D metabolites, which lacked the 1-{alpha}-hydroxyl group. PTH had a large effect on the action of 1,24,25(OH)3D which was equivalent to that of 1,25(OH)2D itself.


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of Vitamin D metabolites and PTH on CYP24 mRNA levels

 
PTH is known to activate several signal transduction pathways in UMR cells (18). Therefore, a series of experiments were performed to determine the pathway by which PTH stimulates the effect of 1,25(OH)2D. These experiments were performed using a 3-h time point because this was the time of maximal effect for 1,25(OH)2D plus PTH (Fig. 1AGo). First, the effect of PTH(3–34), which activates the Ca/PKC pathway but not the cAMP pathway (19), was examined. Bovine PTH(3–34) in the presence of 1,25(OH)2D produced a 2-fold increase in CYP24 mRNA levels compared with 1,25(OH)2D alone (Table 2Go). Bovine PTH(1–34), on the other hand, produced a 10-fold increase in mRNA levels. This suggests that almost all of the effect of PTH is mediated by the cAMP-dependent pathway. To provide further evidence for this, studies were performed with the cAMP analog 8-bromo-cAMP in the presence of 1,25(OH)2D (Table 3Go). A maximal concentration of 8-bromo-cAMP markedly increased CYP24 mRNA to levels significantly higher than those seen with maximal concentrations of PTH(1–34). Addition of PTH resulted in no further increase in mRNA levels compared with that seen with 8-bromo-cAMP alone. This suggests that 8-bromo-cAMP and PTH work through a common pathway. The fact that the maximal stimulation by PTH is less than that by 8-bromo-cAMP suggests that PTH may also have an inhibitory pathway, perhaps mediated by protein kinase C.


View this table:
[in this window]
[in a new window]
 
Table 2. Effect of PTH analogs on CYP24 mRNA levels

 

View this table:
[in this window]
[in a new window]
 
Table 3. Effect of PTH and 8-BROMO-cAMP on CYP24 mRNA levels

 
One way by which PTH could increase CYP24 mRNA levels in the presence of 1,25(OH)2D is by increasing CYP24 gene transcription. This possibility was studied by performing nuclear run-on assays on isolated nuclei and by transfecting promoter-reporter constructs into UMR cells. For the run-on measurements, UMR cells were treated with 1,25(OH)2D (10-7 M), 1,25(OH)2D + PTH (25 nM), or vehicle only (Control). Cells were incubated with hormones for 1.5 h because this corresponded to the time of maximal rate of increase in mRNA levels (Fig. 1AGo). After hormone treatment, nuclei were isolated and labeled with 32P-uridine triphosphate. The labeled RNA was then isolated and hybridized to filters containing probes for CYP24 and for actin. There was no detectable CYP24 gene transcription in untreated cells. In cells treated with 1,25(OH)2D alone, the CYP24/actin ratio was 0.05 ± 0.03, and with 1,25(OH)2D + PTH the ratio was 0.33 ± 0.09 (mean ± SE of three flasks) (Fig. 5Go). Thus, PTH significantly increased CYP24 gene transcription compared with 1,25(OH)2D alone (P < 0.05, t test). In a separate experiment, PTH alone had no significant effect on CYP24 gene transcription.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 5. Effect of 1,25(OH)2D and PTH on CAT activity in UMR cells. A reporter construct consisting of the promoter region of the rat CYP24 gene (-580 to +8 nucleotides) attached to the Promega CAT vector was transfected into UMR cells. After 48 h, cells were treated with 1,25(OH)2D (10-7 M) and PTH (25 nM) for the indicated time. CAT activity was then determined and expressed relative to the activity in the absence of hormones (Control). Bars are the mean ± SE of 6–12 flasks. *, Significantly different than control (t test, P < 0.05).

 
Because PTH increased transcription, the question of whether PTH exerted its effect by acting through the upstream promoter region of the CYP24 gene was examined. A reporter construct was made consisting of the -580 to +8 nucleotide region of the CYP24 promoter (15) inserted into the Promega CAT vector. The vector was transfected into UMR cells. After the cells recovered, they were treated with hormones for various periods of time and the CAT activity measured. 1,25(OH)2D alone had no significant effect on CAT activity at 3 and 6 h, but it significantly increased activity at 12 h (Fig. 5Go). PTH in the presence of 1,25(OH)2D significantly increased CAT activity at 3 and 6 h. At 12 h, PTH had no additional effect compared with 1,25(OH)2D alone. The effect of PTH alone on CAT activity was also determined. At 3 h, PTH alone produced a relative CAT activity of 1.37 ± 0.11 (n = 4). This was much less than than the CAT activity in the presence of 1,25(OH)2D + PTH at 3 h (Fig. 5Go).

Another way in which PTH could increase CYP24 transcriptional activity in the presence of 1,25(OH)2D is by altering 1,25(OH)2D receptor number. Therefore, the effect of PTH on vitamin D receptor number in UMR cells was determined by ligand binding studies as a function of time (Fig. 6Go). PTH significantly increased ligand binding by about 2-fold at 4 and 6 h. However, there was no significant increase at 2 h. Because CYP24 mRNA levels were maximal at 3 h in the presence of PTH (Fig. 1AGo), the effect of PTH on receptor number was also measured at this time in a separate experiment. 1,25(OH)2D receptor binding was 54.6 ± 2.7 and 58.0 ± 3.0 fmol/mg (n = 5) in the absence and presence of PTH, respectively, which was not significantly different.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 6. Effect of PTH on 1,25(OH)2D binding by UMR cells. Cells were incubated for the indicated time with 25 nM PTH or vehicle only (Control). 1,25(OH)2D binding was measured in intact cells by incubating with 3H-1,25(OH)2D for the final 2 h in the presence or absence of 250 nM cold 1,25(OH)2D. Binding was expressed as fmol of 1,25(OH)2D bound per mg of total cellular protein. Specific 1,25(OH)2D binding was calculated by subtracting nonspecific binding (in the presence of 250 nM cold 1,25(OH)2D) from total 1,25(OH)2D binding. Bars are the mean ± SE of four flasks. *, Significantly different than control (t test, P < 0.05).

 
Finally, because PTH and 1,25(OH)2D markedly increased CYP24 mRNA levels (Fig. 1AGo), the effect of these hormones on CYP24 protein levels was measured. Western blotting revealed that PTH and 1,25(OH)2D induced a single band with a size of 56 kDa (Fig. 7BGo). This is the size of the mature CYP24 protein predicted from the nucleic acid sequence (13). Protein levels, determined by densitometry, were significantly increased by PTH and 1,25(OH)2D at 3 h, but the major increase was between 3 and 6 h in the presence of PTH (Fig. 7AGo). In the absence of PTH, 1,25(OH)2D produced only small increases in CYP24 protein over this 12-h time period. Thus, the synergistic increase seen between PTH and 1,25(OH)2D with regard to mRNA was also reflected in CYP24 protein levels.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 7. Effect of PTH on CYP24 protein levels in UMR cells. A, Cells were incubated with 1,25(OH)2D (10-7 M) or 1,25(OH)2D + PTH (25 nM) for the indicated time. CYP24 mRNA levels were measured by Western blotting using an antibody to N-terminal amino acids 1–12 of the mature rat CYP24 protein. Data points are the mean ± SE of six flasks. PTH in the presence of 1,25(OH)2D significantly increased protein levels at all time points compared with 1,25(OH)2D alone (t test, P < 0.05). B, Western blot of pooled samples incubated with 1,25(OH)2D + PTH for the indicated time.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results presented in this investigation demonstrate that in the presence of 1,25(OH)2D PTH works through the cAMP-dependent signaling pathway to increase transcription of the CYP24 gene. The involvement of the cAMP-dependent pathway is evidenced by the minimal effect of bPTH(3–34) (Table 2Go), which does not activate the cAMP-dependent pathway (19). In addition, 8-bromo-cAMP increases CYP24 mRNA to levels higher than those seen with PTH and is nonadditive with PTH (Table 3Go). These results are consistent with the previous study (9), which found that forskolin, a stimulator of intracellular cAMP levels, increased CYP24 mRNA levels. On the other hand, phorbol esters, which activate protein kinase C, did not.

The fact that PTH stimulates transcription of the CYP24 gene is demonstrated by the nuclear run-on (Fig. 4Go) and CAT assay (Fig. 5Go). Quantitatively, it is difficult to know if these increases in transcription account for all of the increase in CYP24 mRNA levels induced by PTH at 3 h (Fig. 1AGo). PTH may also have effects on mRNA stability. However, effects of PTH on CYP24 mRNA stability have not yet been demonstrated experimentally in this system. At 12 h, PTH has no additional effect on CAT activity above that of 1,25(OH)2D alone (Fig. 5Go). This could account for the decrease in CYP24 mRNA levels between 3 and 12 h in the presence of PTH (Fig. 1AGo).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Effect of PTH on transcription of CYP24 gene in UMR cells. Individual flasks were treated with 1,25(OH)2D (10-7 M) in the presence (+) or absence (-) of PTH (25 nM) in triplicate for 1.5 h. Nuclei were then isolated and a run-on assay performed. Radiolabeled RNA was hybridized to complementary CYP24 and actin DNA immobilized on Nytran membranes. Membranes were washed and autoradiographed, and the resulting bands (see above) were quantitated by densitometry. The CYP24/actin ratio was 0.05 ± 0.03 in the absence of PTH and 0.33 ± 0.09 in the presence of PTH (mean ± SE of three flasks).

 
To exert its effect, PTH requires the presence of 1,25(OH)2D (Fig. 1AGo). Specifically, the data are consistent with a requirement for the 1-{alpha}-hydroxyl group on the vitamin D structure (Table 1Go). This suggests that PTH action requires occupancy of the VDR, which also is dependent on the presence of the 1-{alpha}-hydroxyl group (20). It is of interest that 1,24,25(OH)3D is as effective as 1,25(OH)2D in increasing CYP24 mRNA levels (Table 1Go). 1,24,25(OH)3D is thought to be the first step in the breakdown of 1,25(OH)2D (3). 1,24,25(OH)3D may further stimulate the 24-hydroxylase and the catabolism of 1,25(OH)2D.

Whether the initial effect of PTH requires an increase in VDR number is not clear. As reported previously (11), it was found that PTH significantly increased VDR number at 4 and 6 h in UMR cells (Fig. 6Go). However, there was no significant increase at 2 or 3 h. Three hours is the time of maximal increase in mRNA levels (Fig. 1AGo) and of significant transcriptional activity (Fig. 5Go). In addition, the fact that PTH action does not require new protein synthesis (10) would argue against the necessity for the synthesis of new VDR. It may be that the observed increase in VDR number plays a role in sustaining the PTH effect at times greater than 3 h.

These studies give some insight into possible mechanisms by which PTH may potentiate the effect of 1,25(OH)2D. The effect of PTH is rapid in that there is a measurable increase in transcription (Fig. 4Go) and CAT activity (Fig. 5Go) within 3 h and that mRNA levels are markedly elevated at 3 h (Fig. 1AGo). The effect of PTH is mediated through cAMP (Tables 2Go and 3Go) and thus probably involves protein phosphorylation mediated by protein kinase A. A previous study using this system showed that the action of PTH does not require new protein synthesis (10). Cycloheximide had no effect on the capacity of PTH to increase CYP24 mRNA levels. The fact that new protein synthesis is not required would also be consistent with a rapid phosphorylation mechanism. On the other hand, the effect of 1,25(OH)2D alone is not maximal until 24 h (Fig. 1AGo). This may be due to the fact that, unlike PTH, the action of 1,25(OH)2D requires new protein synthesis (data not shown). By way of contrast, other actions of PTH in UMR106 cells do not require 1,25(OH)2D. These include activation of the collagenase (14) and c-fos (16) genes via a cAMP-dependent pathway. Thus, 1,25(OH)2D is not necessary for the activation of the cAMP-dependent pathway by PTH.

There are several possible targets for protein kinase A phosphorylation in UMR cells. Protein kinase A may phosphorylate the cAMP-response element binding protein (CREB), which could then act on cAMP-response elements (CRE). PTH has been shown to phosphorylate CREB in UMR cells (16). PTH also increases c-fos expression by a cAMP-dependent mechanism in UMR cells (16), and c-fos could then act on AP-1 sites. However, this would require new protein synthesis, which is not required for the stimulation of CYP24 mRNA levels by PTH. Finally, phosphorylation of VDR has been shown to alter VDR activity, although phosphorylation by protein kinase A has been reported to inhibit activity in vitro (21).

One possible mechanism by which PTH could increase promoter activity in conjunction with 1,25(OH)2D would involve CREB. The region of the CYP24 promoter (-580 to +8 nucleotides) used in the CAT assay (Fig. 5Go) contains two well characterized vitamin D-response elements (VDREs) (15) as well as putative CRE sites (22). One possibility is that PTH phosphorylates CREB, which then binds to the CRE sites and interacts with the VDR/VDRE complexes to synergistically increase promoter activity. Another mitochondrial steroid hydroxylase, the CYP11B, is stimulated by ACTH acting through cAMP, CREB, and a CRE element in the promoter region (23). However, other steroid hydroxylases are regulated by cAMP acting through unique elements that are not conventional CREs and do not involve CREB (24).

The marked potentiation of CYP24 mRNA levels by PTH (Fig. 1AGo) resulted in a marked increase in CYP24 protein levels compared with 1,25(OH)2D alone (Fig. 7Go). The fact that mRNA levels peak at 3 h, whereas the protein levels do not increase markedly until 6 h probably represents a lag in protein synthesis from mRNA. Thus, the effect of PTH on mRNA levels may have physiological importance in that it is translated into CYP24 protein and 24-hydroxylase activity (9). Interestingly, at 3 h after PTH addition, CYP24 protein levels are still relatively low (Fig. 7Go), whereas 24-hydroxylase activity is already high (9). This suggests that at this time point PTH may in some way activate the protein in addition to increasing the amount of protein present.

The synergistic increase in CYP24 expression by 1,25(OH)2D, and PTH may have physiological importance. PTH makes the osteoblast more sensitive to the action of 1,25(OH)2D by about two orders of magnitude (Fig. 3Go). In the presence of PTH (25 nM), 1,25(OH)2D increases CYP24 mRNA levels at concentrations as low as 0.1 nM, which is in the physiological range. PTH also increases the maximal response to 1,25(OH)2D by about 6-fold. The fact that 1,25(OH)2D and PTH work together to increase CYP24 levels in primary osteoblasts (Fig. 2Go) suggests that this interaction may have importance in the intact animal. A recent study reported that mice deficient in CYP24 have skeletal abnormalities, suggesting that the 24-hydroxylase may play an important role in bone development and homeostasis (25). This could be due to the role of the 24-hydroxylase in modulating the action of 1,25(OH)2D in bone cells, or it could be due to the role of the 24-hydroxylase in producing vitamin D metabolites such as 24,25-dihydroxyvitamin D, which has been reported to be essential for bone formation (26).


    Acknowledgments
 
We thank Drs. Y. Ohyama and K. Okuda (Hiroshima University School of Dentistry, Hiroshima, Japan) for the rat CYP24 clone and Connie Young for the photography.


    Footnotes
 
1 This work was supported by the Geriatric Research, Education, and Clinical Center and the Medical Research Service of the Department of Veterans Affairs and by NIH Grant AG-12587. Back

Received December 5, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. DeLuca HF 1988 The vitamin D story: a collaborative effort of basic science and clinical medicine. FASEB J 2:224–236[Abstract]
  2. Minghetti PP, Norman AW 1988 1,25(OH)2-vitamin D3 receptors: gene regulation and genetic circuitry. FASEB J 2:3043–3053[Abstract]
  3. Kumar R 1984 Metabolism of 1,25-dihydroxyvitamin D3. Physiol Rev 64:478–504[Abstract/Free Full Text]
  4. Reinhardt TA, Horst RL 1989 Self-induction of 1,25-dihydroxyvitamin D3 metabolism limits receptor occupancy and target tissue responsiveness. J Biol Chem 264:15917–15921[Abstract/Free Full Text]
  5. Henry HL, Luntao EM 1989 Interactions between intracellular signals involved in the regulation of 25-hydroxyvitamin D3 metabolism. Endocrinology 124:2228–2234[Abstract/Free Full Text]
  6. Armbrecht HJ, Hodam TL, Boltz MA, Chen ML 1993 Phorbol ester markedly increases the sensitivity of intestinal epithelial cells to 1,25-dihydroxyvitamin D. FEBS Lett 327:13–16[CrossRef][Medline]
  7. Chen ML, Boltz MA, Armbrecht HJ 1993 Effects of 1,25-dihydroxyvitamin D3 and phorbol ester on 25-hydroxyvitamin D3 24-hydroxylase cytochrome P450 messenger ribonucleic acid levels in primary cultures of rat renal cells. Endocrinology 132:1782–1788[Abstract/Free Full Text]
  8. Armbrecht HJ, Chen ML, Hodam TL, Boltz MA 1997 Induction of 24-hydroxylase cytochrome P450 mRNA by 1,25-dihydroxyvitamin D and phorbol esters in normal rat kidney (NRK-52E) cells. J Endocrinol 153:199–205[Abstract/Free Full Text]
  9. Armbrecht HJ, Hodam TL 1994 Parathyroid hormone and 1,25-dihydroxyvitamin D synergistically induce the 1,25-dihydroxyvitamin D-24-hydroxylase in rat UMR-106 osteoblast-like cells. Biochem Biophys Res Commun 205:674–679[CrossRef][Medline]
  10. Armbrecht HJ, Wongsurawat VT, Hodam TL, Wongsurawat N 1996 Insulin markedly potentiates the capacity of parathyroid hormone to increase expression of 25-hydroxyvitamin D3-24-hydroxylase in rat osteoblastic cells in the presence of 1,25-dihydroxyvitamin D3. FEBS Lett 393:77–80[CrossRef][Medline]
  11. Krishnan AV, Cramer SD, Bringhurst FR, Feldman D 1995 Regulation of 1,25-dihydroxyvitamin D3 receptors by parathyroid hormone in osteoblastic cells: role of second messenger pathways. Endocrinology 136:705–712[Abstract]
  12. Shalhoub V, Conlon D, Tassinari M, Quinn C, Partridge N, Stein GS, Lian JB 1992 Glucocorticoids promote development of the osteoblast phenotype by selectively modulating expression of cell growth and differentiation associated genes. J Cell Biochem 50:425–440[CrossRef][Medline]
  13. Ohyama Y, Noshiro M, Okuda K 1991 Cloning and expression of cDNA encoding 25-hydroxyvitamin D3 24-hydroxylase. FEBS Lett 278:195–198[CrossRef][Medline]
  14. Scott DK, Brakenhoff KD, Clohisy JC, Quinn CO, Partridge NC 1992 Parathyroid hormone induces transcription of collagenase in rat osteoblastic cells by a mechanism using cyclic adenosine 3',5'-monophosphate and requiring protein synthesis. Mol Endocrinol 6:2153–2159[Abstract/Free Full Text]
  15. Ohyama Y, Ozono K, Uchida M, Shinki T, Kato S, Suda T, Yamamoto O, Noshiro M, Kato Y 1994 Identification of a vitamin D-responsive element in the 5'-flanking region of the rat 25-hydroxyvitamin D3 24-hydroxylase gene. J Biol Chem 269:10545–10550[Abstract/Free Full Text]
  16. Pearman AT, Chou WY, Bergman KD, Pulumati MR, Partridge NC 1996 Parathyroid hormone induces c-fos promoter activity in osteoblastic cells through phosphorylated cAMP response element (CRE)-binding protein binding to the major CRE. J Biol Chem 271:25715–25721[Abstract/Free Full Text]
  17. Brown AJ, Berkoben M, Ritter CS, Slatopolsky E 1992 Binding and metabolism of 1,25-dihydroxyvitamin D3 in cultured bovine parathyroid cells. Endocrinology 130:276–281[Abstract/Free Full Text]
  18. Partridge NC, Bloch SR, Pearman AT 1994 Signal transduction pathways mediating parathyroid hormone regulation of osteoblastic gene expression. J Cell Biochem 55:321–327[CrossRef][Medline]
  19. Fujimori A, Cheng SL, Avioli LV, Civitelli R 1991 Dissociation of second messenger activation by parathyroid hormone fragments in osteosarcoma cells. Endocrinology 128:3032–3039[Abstract/Free Full Text]
  20. Link R, DeLuca HF 1985 The vitamin D receptor. In: Conn PM (ed) The Receptors. Academic Press, New York, vol II:1–35
  21. Haussler MR, Jurutka PW, Hsien JC, Thompson PD, Selznick SH, Haussler CA, Whitfield GK 1994 Receptor mediated genomic actions of 1,25(OH)2D3: modulation by phosphorylation. In: Norman AW, Bouillon R, Thomasset M (eds) Vitamin D - A Pluripotent Steroid Hormone: Structural Studies, Molecular Endocrinology and Clinical Applications. Walter de Gruyter, Berlin, pp 209–216
  22. Zierold C, Darwish HM, DeLuca HF 1994 Identification of a vitamin D-response element in the rat calcidiol (25-hydroxyvitamin D3)-24-hydroxylase gene. Proc Natl Acad Sci USA 91:900–902[Abstract/Free Full Text]
  23. Honda S, Morohashi K, Omura T 1990 Novel cAMP regulatory elements in the promoter region of bovine P45011B gene. J Biochem 108:1042–1049[Abstract/Free Full Text]
  24. Waterman MR, Bischof LJ 1997 Diversity of ACTH (cAMP)-dependent transcription of bovine steroid hydroxylase genes. FASEB J 11:419–427[Abstract]
  25. St.-Arnaud R, Arabian A, Glorieux FH 1996 Abnormal bone development in mice deficient for the vitamin D 24-hydroxylase gene. J Bone Miner Res 11:S126 (Abstract)
  26. Ornoy A, Goodwin D, Noff D, Edelstein S 1978 24,25-dihydroxyvitamin D is a metabolite of vitamin D essential for bone formation. Nature 276:517–519[CrossRef][Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
S. Sundaram, M. J. Beckman, A. Bajwa, J. Wei, K. M. Smith, G. H. Posner, and D. A. Gewirtz
QW-1624F2-2, a synthetic analogue of 1,25-dihydroxyvitamin D3, enhances the response to other deltanoids and suppresses the invasiveness of human metastatic breast tumor cells.
Mol. Cancer Ther., November 1, 2006; 5(11): 2806 - 2814.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ren, L. Nguyen, S. Wu, C. Encinas, J. S. Adams, and M. Hewison
Alternative Splicing of Vitamin D-24-Hydroxylase: A NOVEL MECHANISM FOR THE REGULATION OF EXTRARENAL 1,25-DIHYDROXYVITAMIN D SYNTHESIS
J. Biol. Chem., May 27, 2005; 280(21): 20604 - 20611.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Huening, G. Yehia, C. A. Molina, and S. Christakos
Evidence for a Regulatory Role of Inducible cAMP Early Repressor in Protein Kinase A-Mediated Enhancement of Vitamin D Receptor Expression and Modulation of Hormone Action
Mol. Endocrinol., September 1, 2002; 16(9): 2052 - 2064.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
F. Barletta, L. P. Freedman, and S. Christakos
Enhancement of VDR-Mediated Transcription by Phosphorylation: Correlation with Increased Interaction Between the VDR and DRIP205, a Subunit of the VDR-Interacting Protein Coactivator Complex
Mol. Endocrinol., February 1, 2002; 16(2): 301 - 314.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
W. Yang, S. J. Hyllner, and S. Christakos
Interrelationship between signal transduction pathways and 1,25(OH)2D3 in UMR106 osteoblastic cells
Am J Physiol Endocrinol Metab, July 1, 2001; 281(1): E162 - E170.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. J. Armbrecht, M. A. Boltz, and V. B. Kumar
Intestinal plasma membrane calcium pump protein and its induction by 1,25(OH)2D3 decrease with age
Am J Physiol Gastrointest Liver Physiol, July 1, 1999; 277(1): G41 - G47.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
W. Yang, P. A. Friedman, R. Kumar, J. L. Omdahl, B. K. May, M.-L. Siu-Caldera, G. S. Reddy, and S. Christakos
Expression of 25(OH)D3 24-hydroxylase in distal nephron: coordinate regulation by 1,25(OH)2D3 and cAMP or PTH
Am J Physiol Endocrinol Metab, April 1, 1999; 276(4): E793 - E805.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. St-Arnaud and F. H. Glorieux
Editorial: 24, 25-Dihydroxyvitamin D--Active Metabolite or Inactive Catabolite?
Endocrinology, August 1, 1998; 139(8): 3371 - 3374.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Armbrecht, H. J.
Right arrow Articles by Kumar, V. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Armbrecht, H. J.
Right arrow Articles by Kumar, V. B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*1,25-DIHYDROXYCHOLECALCIFEROL
*PARATHYROID HORMONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals