Endocrinology Vol. 139, No. 8 3465-3479
Copyright © 1998 by The Endocrine Society
Hypophysiotropic Action of Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) in the Goldfish: Immunohistochemical Demonstration of PACAP in the Pituitary, PACAP Stimulation of Growth Hormone Release from Pituitary Cells, and Molecular Cloning of Pituitary Type I PACAP Receptor1
A. O. L. Wong,
M. Y. Leung,
W. L. C. Shea,
L. Y. Tse,
J. P. Chang and
B. K. C. Chow
Department of Zoology, University of Hong Kong, Hong Kong; and the
Department of Biological Sciences, University of Alberta (J.P.C.),
Edmonton, Alberta T6G 2E9, Canada
Address all correspondence and requests for reprints to: Dr. Anderson O. L. Wong, Department of Zoology, University of Hong Kong, Pokfulam Road, Hong Kong.
 |
Abstract
|
|---|
Pituitary adenylate cyclase-activating polypeptide (PACAP) is a member
of the glucagon/secretin peptide family, and its molecular structure is
highly conserved in vertebrates. In this study, the functional role of
PACAP in regulating GH release in the goldfish was investigated. Using
immunohistochemical staining, nerve fibers with PACAP immunoreactivity
were identified in the vicinity of goldfish somatotrophs, suggesting
that this neuropeptide may influence GH release in the goldfish. The
direct regulatory action of PACAP on GH secretion was demonstrated
in vitro in perifused goldfish pituitary cells. PACAPs
(0.01 nM to 1 µM) from different species,
including ovine PACAP27, ovine PACAP38, frog
PACAP38, zebra fish PACAP27, and zebra fish
PACAP38, were all effective in stimulating GH release with
ED50 values of 8.9 ± 3.5, 3.3 ± 1.6, 14.4
± 3.5, 15.4 ± 4.1, and 1.4 ± 0.2 nM,
respectively. Similar concentrations of vasoactive intestinal
polypeptide (VIP), a peptide related to PACAP, was not effective in
this respect. In addition, the GH-releasing action of ovine
PACAP38 (10 nM) was inhibited by the PACAP
antagonist PACAP638 (10 µM), but not by the
VIP antagonist
[4-Cl-D-Phe6,Leu17]VIP (10
µM). The pharmacology of these GH responses is consistent
with the mammalian type I PACAP receptors, suggesting that a similar
receptor subtype is present in the goldfish pituitary and mediates the
GH-releasing action of PACAP. To establish the structural identity of
this goldfish PACAP receptor, a complementary DNA (cDNA) clone sharing
a high degree of sequence homology with mammalian type I PACAP
receptors was isolated from a goldfish pituitary cDNA library. This
cDNA was 5.2 kb in size with a 1.4-kb open reading frame and encoded a
465-amino acid protein with the typical structure of a 7-transmembrane
domain-containing, G protein-coupled receptor. Functional expression of
this cDNA in COS-7 cells revealed that this fish type I PACAP receptor
could be activated by ovine PACAP27 and PACAP38
to increase cAMP synthesis with ED50 values of 2.4 ±
0.8 and 4.2 ± 1.2 nM, respectively. Other
structurally related peptides, including VIP (100 nM),
GH-releasing hormone (100 nM), glucagon (100
nM), secretin (100 nM), gastric inhibitory
polypeptide (100 nM), and PTH (100 nM), were
not effective in altering cAMP production. Using Northern blot and
RT-PCR, messenger RNA transcripts of this PACAP receptor were
identified in the brain, heart, and pituitary of the goldfish. These
results, taken together, support the hypothesis that PACAP functions as
a novel GH-releasing factor in the goldfish through activation of type
I PACAP receptors.
 |
Introduction
|
|---|
PITUITARY adenylate cyclase-activating
polypeptide (PACAP) is a member of the secretin/glucagon/vasoactive
intestinal polypeptide (VIP) family (1). In mammals, two biologically
active forms of PACAP have been purified, namely PACAP38
(2) and PACAP27 (3). PACAP38 is a 38-amino acid
peptide with its N-terminal 28 amino acids sharing 68% sequence
identity with VIP, and PACAP27 is a truncated form of
PACAP38 containing only the first 27 amino acids. These 2
peptides are derived from the same precursor prepro-PACAP through
posttranslational proteolysis and alternative
-amidation (1). In
the rat, immunoreactivity for PACAP has been identified in the
brain, intestine, adrenal gland, and testes (4), and
PACAP38 was the predominant form (5). In general,
PACAP is considered a neurotransmitter/neuromodulator in the central
nervous system (6), although its roles as a growth factor (7) and
vasoregulator (8) have also been suggested.
The molecular structure of PACAP is highly conserved among vertebrates.
PACAP complementary DNAs (cDNAs) have been cloned in the rat (9), sheep
(10), mouse (11), and human (12), and the deduced amino acid sequences
of PACAP38 were identical. PACAP has also been isolated
from amphibian (13), chicken (14), and teleost fish tissues (15).
PACAP38 from the frog has only one amino acid substitution
at position 35, with isoleucine substituted for valine in rat
PACAP38 (13). PACAP cDNAs from the salmon (16) and catfish
(17) reveal that the fish PACAP38 is highly homologous to
the mammalian form and has only three or four amino acid substitutions
in the C-terminal. Furthermore, these fish PACAP cDNAs also contain the
coding sequence of a GH-releasing hormone (GHRH)-like peptide, and
differential expression of PACAP and this GHRH-like peptide as a result
of exon skipping has been reported in salmons (18). In general, it is
believed that the two separate genes encoding PACAP and GHRH in mammals
are the result of gene duplication during evolution from fish to
tetrapods (16, 17). Recently, PACAP27 has been identified
in the neural gland of tunicates (19), suggesting that PACAP may be a
neuropeptide in protochordates.
In mammals, the biological actions of PACAP are mediated through two
different receptor subtypes, namely type I and type II PACAP receptors
(1). Both of them are G protein-coupled receptors with a classical
structure of seven transmembrane domains (TMD). Type I PACAP receptors
(or PVR1 receptors) exhibit a high binding affinity for
PACAP38 and PACAP27, but not for VIP. Type II
PACAP receptors, in contrast, have equal binding affinities for
PACAP38, PACAP27, and VIP. Therefore, this
group of PACAP receptors is also referred to as VIP receptors in some
studies (20, 21). Type II PACAP receptors can be further subdivided
into VIP1 (or PVR2 receptors) and VIP2 receptors (or PVR3 receptors),
which are encoded by different genes, respectively (for a recent review
on PACAP receptors, see Ref. 22).
In recent years, the role of PACAP as a hypophysiotropic factor in
mammals has been proposed based on the findings that PACAP nerve fibers
are present in the median eminence (23), PACAP immunoreactivity can be
detected in the hypophysial portal blood (24), and PACAP stimulates
cAMP production in pituitary cell cultures (2, 3) and under certain
conditions induces LH, FSH, GH, and ACTH release from rat pituitary
cells (25). Regarding the GH-releasing action, PACAP is a weak (25) or
modest stimulator (26) of GH release. In general, it is not considered
to be a typical GH-releasing factor but, rather, a modulator of
pituitary hormone secretion (22). In the rat, PACAP-stimulated GH
release from pituitary cells is more readily observed using a
perifusion system (2) or a reverse hemolytic plaque assay (27). In
perifused GH3 cells, a rat pituitary cell line, the
stimulatory action of PACAP on GH release is mediated through type II
PACAP receptors (28). Results from static incubation studies, however,
are more variable; no effects (2) as well as a modest stimulation after
a long incubation (25) have been reported. In in vivo
studies, PACAP increases plasma GH levels in the rat (29), but not in
the sheep (30) or human (31), suggesting that the GH-releasing effect
of PACAP is species specific. In the ewe, injection of PACAP into the
brain induces a paradoxical inhibition of GH release (30). These
results indicate that PACAP may also act centrally to regulate GH
secretion.
In teleost fishes, the brain-pituitary axis is unique for the lack of a
hypophysial portal blood system (32). Unlike that in mammals, the
median eminence of teleosts is functionally incorporated into the
anterior pituitary, and individual pituitary cells are directly
innervated by neuronal fibers from the hypothalamus (33). Neuropeptides
(e.g. GnRH, TRH, and neuropeptide Y) as well as
neurotransmitters (e.g. dopamine), besides acting within the
hypothalamus, exert their regulatory actions on GH release directly at
the pituitary cell level (for a recent review, see Ref. 34). In lower
vertebrates, especially in fish, the studies of PACAP have focused
mainly on the structural evolution of the peptide, and very little is
known about its biological functions. Whether PACAP is a
hypophysiotropic factor in teleosts is unclear, as neither the delivery
of PACAP nor the presence of PACAP receptors has been demonstrated in
the pituitary of fish species. In this study, the role of PACAP as a
potential hypophysiotropic factor regulating GH release in goldfish via
activation of pituitary type I PACAP receptors was examined.
 |
Materials and Methods
|
|---|
Animals
Goldfish (Carassius auratus) of the common or comet
variety with body weight ranging from 2535 g were purchased from
local pet stores and maintained in 200 liters aquaria at 18 C under a
12-h light, 12-h dark photoperiod for 2 weeks before experiments. The
fish were fed to satiation daily with commercial fish feed. As the fish
used in this study were in the early stages of gonadal recrudescence,
and sexual dimorphism was not apparent, goldfish of mixed sexes were
used for the preparation of pituitary cells and extraction of tissue
messenger RNA (mRNA).
Reagents and test substances
PACAP638,
[4-Cl-D-Phe6,Leu17]VIP, frog
PACAP38, ovine PACAP27, and PACAP38
were obtained from Peninsula Laboratories (Belmont, CA). Zebra fish
PACAP27 and PACAP38 were gifts from Dr. S.
Mojsov (Rockefeller University, New York, NY). PACAP-related peptides,
including glucagon, secretin, GHRH, PTH, VIP, and gastric inhibitory
polypeptide (GIP), were purchased from Bachem Fine Chemicals (La Jolla,
CA). All of these peptides were dissolved in doubled distilled water
and stored frozen as 1-mM stocks at -20 C. Subsequent
dilution to appropriate concentrations with culture medium was
performed 15 min before drug treatment. Ionomycin obtained from
Calbiochem (La Jolla, CA) and 1-methyl-3-iso-butylxanthine (IBMX) from
Research Biochemical International (Natick, MA) were stored as
10-mM and 1-M stocks in dimethylsulfoxide,
respectively. The final level of dimethylsulfoxide in culture medium
was always 0.1% or less, and it did not alter basal GH release from
goldfish pituitary cells.
Column perifusion of goldfish pituitary cells
Dispersed goldfish pituitary cells were prepared by controlled
trypsin/deoxyribonuclease digestion as described previously (35). The
viability of pituitary cells was always 94% or more, as indicated by
trypan blue exclusion test. After dispersion, pituitary cells were
resuspended in plating medium (medium 199 with Earles salts at pH
7.2, containing 26 mM NaHCO3, 25 mM
HEPES, 100,000 U penicillin/liter, 100 mg streptomycin/liter, and 1%
horse serum) and incubated with preswollen Cytodex beads (Sigma
Chemcial Co., St. Louis, MO) at 28 C under 5% CO2 and
saturated humidity. Cell attachment on Cytodex beads was greater than
95% after overnight incubation. Cytodex beads with pituitary cells
attached were then transferred into 0.5-ml microcolumns (
2 million
cells/column; ACUSYST-S System, Endotronics, Minneapolis, MN) for
in vitro column perifusion. Pituitary cells were perifused
at a flow rate of 15 ml/h with perifusion medium (medium 199 with
Hanks salts at pH 7.2 containing 26 mM
NaHCO3, 25 mM HEPES, 100,000 U
penicillin/liter, 100 mg streptomycin/liter, and 0.1% BSA). After
3 h of continuous perifusion, GH release from pituitary cells
remained relatively stable in the absence of stimulation. Test
substances were then applied from a drug reservoir to the perifusion
column through a three-way stopcock. Perifusate samples were collected
in 5-min fractions and stored frozen at -20 C. GH contents in these
samples were assayed using a RIA previously validated for goldfish GH
(36).
Immunohistochemical staining of goldfish pituitary sections
Goldfish pituitaries were excised and fixed in Bouins fixative
at 4 C for 48 h. After washing in 70% ethanol to remove picric
acid, these fixed pituitaries were dehydrated with a graded series of
ethanol and embedded in paraffin. Pituitary sections, 12 µm thick,
were prepared and mounted on gelatin-coated slides. Immunohistochemical
staining was performed using the Vectastain ABC kit (Vector
Laboratories, Burlingame, CA) with minor modifications. Briefly,
pituitary sections were deparaffinized, hydrated, and treated with
0.3% H2O2 to inactivate endogenous peroxidase
activity. After washing in 10 mM PBS (pH 7.5) for 10 min,
pituitary sections were incubated in a blocking agent containing BSA
(0.5%), gelatin (0.5%), and normal goat serum (2.5%) for 30 min.
After a 10-min wash in PBS, these pituitary sections were exposed to
antisera specific for ovine PACAP38 (1:2,000; IHC8920,
Peninsula Laboratories) and goldfish GH (1:50,000), respectively.
Incubation with these antisera was conducted in a humidified chamber
for 24 h at 4 C. Pituitary sections were then treated with
biotinylated goat antirabbit antibody for 30 min, followed by another
40-min incubation with the freshly prepared avidin-biotin-peroxidase
complex reagent. After rinsing briefly in PBS, these pituitary sections
were then exposed to diaminobenzidine (1.28 mM) in the
presence of nickel ammonium sulfate (0.038 mM) for color
development. In this study, the specificity of immunostaining was
confirmed by three different approaches. Firstly, pituitary sections
were incubated with either PBS or normal rabbit serum without PACAP
antiserum. In both cases, no immunostaining was observed in the absence
of the primary antibody. Secondly, a serial dilution of PACAP antiserum
resulted in a gradual decrease and eventually a complete loss of
immunoreactivity. Finally, the specificity of immunostaining was
further confirmed by preabsorbing PACAP antiserum (1:2000) with ovine
PACAP38 (0.1 mM) for 24 h at 4 C. A total
loss of PACAP immunoreactivity was observed after preabsorbing the
antiserum with ovine PACAP38.
Cloning of goldfish type I PACAP receptor cDNA
A partial cDNA clone corresponding to the coding sequence from
TMD2 to TMD6 of the goldfish PACAP receptor was obtained using a
two-step nested PCR approach. Total RNA was isolated from freshly
excised goldfish pituitaries, and polyadenylated
[poly(A)+] mRNA was purified using a polyATract mRNA
isolation kit (Promega, Madison, WI). First strand cDNA was prepared
and used as the template for PCR amplification. The primers for PCR,
including G2, G6, and G7, were designed according to the respective
consensus regions of TMD2, TMD6, and TMD7 of mammalian PACAP receptors.
The nucleotide sequences of G2, G6, and G7 are
TGCAG/TTGG/TACA/C/T/GA/CGA/C/T/GAAG/TTAG/TATYCA,
AGC/GGGGATC/GAGC/GA/GG/TA/C/T/GAGA/C/T/GGTGGAG/TTT, and
TGC/GACCTCA/C/T/GCCA/ GTTA/C/T/GAC/GA/GAAA/GCAA/GTA,
respectively. The first PCR was performed using G2 and G7 as the
primers, and a 1-µl sample of the resulting PCR products was
reamplified in a second PCR using the nested primers G2 and G6. PCR
products of 500600 bp in size were purified and subcloned into PUC-18
for subsequent DNA sequencing. PCR amplifications were carried out
according to the conditions reported previously (37). The partial cDNA
clone of this PACAP receptor was used as a probe to screen a goldfish
pituitary cDNA library, which was constructed using a ZAP-Express cDNA
library system (Stratagene, Cambridge, UK). A full-length cDNA clone of
a goldfish type I PACAP receptor was obtained and excised from the
original phagemid to the pBK-cytomegalovirus (CMV) vector for DNA
sequencing. This goldfish type I PACAP receptor cDNA was sequenced from
both strands using a T7 sequencing kit (Pharmacia, Piscataway, NJ) by
primer-walking and subcloning of restriction fragments. The DNA
sequences obtained were analyzed using the computer program HIBIO
MacDNasis 2.0 (Hitachi, Tokyo, Japan).
Functional expression of goldfish type I PACAP receptor
A 5.2-kb BamHI/XhoI fragment of the
goldfish PACAP receptor cDNA was subcloned into pBluescript
SK+ (Stratagene, La Jolla, CA). From this construct, a
5.2-kb NotI/ApaI fragment was excised and
directionally inserted into the expression vector pRC-CMV (Invitrogen,
San Diego, CA). This newly constructed expression vector,
pRC-CMV/gf.PACAP.R, was used to transfect the mammalian cell line COS-7
by lipofection. After 2 weeks of G418 (500 µg/ml) selection, a
permanent cell line, COS-gf.PACAP.R, with stable transfection of this
goldfish PACAP receptor was obtained. To test for the functionality of
the expressed PACAP receptors, the effects of PACAPs and its related
peptides, including PTH, GIP, glucagon, secretin, GHRH, and VIP on
cAMP synthesis in this transformed cell line were examined. These
experiments were performed in the presence of 0.2 mM IBMX,
a phosphodiesterase inhibitor, to prevent cAMP degradation. The
procedures for functional expression of receptors and cAMP RIA have
been reported previously (38).
Tissue distribution of goldfish PACAP receptor mRNA
Various tissues of the goldfish, including the heart, brain,
pituitary, liver, gall bladder, gills, intestine, gonads, muscle,
spleen, and kidney, were freshly excised and homogenized for the
preparation of poly(A)+ mRNA. About 3 µg mRNA from
individual tissues were size-fractionated by electrophoresis in a
denaturing agarose gel (1.2%) with formaldehyde (6.3%), followed by
transblotting and UV cross-linking onto a Hybond N+
membrane. A full-length cDNA of the goldfish PACAP receptor was labeled
with [
-32P]deoxy-ATP (3 µCi/mmol) using a
Mega-primed DNA labeling kit (Amersham, Arlington Heights, IL). After
overnight hybridization with the labeled probe at 65 C, the membrane
was washed three times under high stringency conditions (0.1 x
SSC-0.1% SDS) and exposed to BioMax film (Eastman Kodak, Rochester,
NY) for 48 h at -80 C. To serve as an internal control, the
membrane was stripped and reprobed with a 32P-labeled
partial cDNA (
200 bp) for goldfish ß-actin. Tissue distribution of
this goldfish PACAP receptor was further confirmed using RT-PCR. First
strand cDNAs were prepared from tissue mRNA samples and used as the
templates for PCR using specific primers for goldfish ß-actin and
PACAP receptors. The nucleotide sequences of the primers for goldfish
PACAP receptor, gf.PACAP.R1 and gf.PACAP.R2, are
AGTGTCGGCAAGGTCGTGGAGGTC and CGCAGGTAGATGCTGGACTCGTTC, respectively.
The PCR conditions for this goldfish PACAP receptor were 1 min at 94 C,
40 sec at 68 C, and 1 min at 72 C for a total of 28 cycles. The
sequences of primers specific for goldfish ß-actin and the respective
conditions for PCR have been reported previously (37).
Data transformation and statistics
GH data (nanograms per ml) from individual columns were
expressed as a percentage of the mean GH contents of the first six
fractions collected at the beginning of perifusion before drug
treatment (referred to as % basal). This data transformation was
performed to allow pooling of GH data from separate columns without
distortion of the profile of GH release. In this study, GH responses
were quantitated by calculating the net change in GH release after a
pulse of drug treatment (i.e. a net change in the area under
the curve). cAMP synthesis were measured in terms of picomoles of cAMP
produced per ml/well or as the fold increase in cAMP content with
respect to the control value. Dose-response curves were analyzed with
the Allfit computer program to obtain the respective ED50
values and maximal GH responses. The minimal effective concentration
was defined as the lowest concentration of peptide tested that induced
a significant increase in GH release with respect to the basal value
(i.e. significantly different from zero GH response). Data
for GH release and cAMP contents were subjected to statistical analysis
using either Students t test or ANOVA followed by
Fishers least significant difference (LSD) test. Differences were
considered significant at P < 0.05.
 |
Results
|
|---|
Effects of ovine PACAP27 and
PACAP38 on GH release from goldfish pituitary
cells
Direct actions of PACAP on GH release at the pituitary level were
examined in goldfish pituitary cells under column perifusion. Ovine
PACAP38 (0.01 nM to 1 µM; Fig. 1A
) and PACAP27 (0.01
nM to 1 µM; Fig. 1B
), but not VIP (0.01
nM to 1 µM; Fig. 1C
), stimulated GH release
from goldfish pituitary cells in a concentration-dependent manner. The
kinetics of these GH responses were rapid, with peak hormone release
observed within the first 10 min after drug administration. The
ED50 values of ovine PACAP38 and
PACAP27 were 3.3 ± 1.6 nM and
8.9 ± 3.5 nM, respectively. The minimal effective
concentration of PACAP38 (0.1 nM) to induce GH
release was 10-fold lower than that of PACAP27 (1.0
nM). However, the magnitudes of the maximal GH responses to
these two peptides were not significantly different from each other
(764 ± 154% basal for PACAP38 vs.
1149 ± 257% basal for PACAP27; P >
0.05).

View larger version (50K):
[in this window]
[in a new window]
|
Figure 1. Effects of ovine PACAP38 (A),
PACAP27 (B), and VIP (C) on basal GH release from perifused
goldfish pituitary cells. Increasing concentrations (0.01
nM to 1 µM) of ovine PACAP38,
PACAP27, and VIP were given as 5-min pulses, as indicated
by the vertical bars. GH data for these peptides,
expressed as the mean ± SEM (n = 46), were
pooled results from at least four independent experiments. In this
study, separate columns were used for individual concentrations of
peptide tested, and the mean basal GH level was 37.7 ± 3.1 ng
GH/ml. Profiles of GH release are presented on the left,
and the quantitated GH responses are shown on the right.
GH responses were quantitated as the net change in GH release after a
pulse of drug treatment (i.e. a net change of area under
the curve). A similar magnitude of GH responses is denoted by the same
letter (by ANOVA and Fishers LSD test, P >
0.05). ED50 values for the GH-releasing effect of ovine
PACAP38 and PACAP27 were 3.3 ± 1.6
nM and 8.9 ± 3.5 nM, respectively.
|
|
To further confirm the specificity of PACAPs action in the goldfish,
the GH-releasing effect of ovine PACAP38 (10
nM) was tested in the presence of either the PACAP
antagonist PACAP638 (Fig. 2A
) or the VIP antagonist
[4-Cl-D-Phe6,Leu17]VIP (Fig. 2B
).
In this case, the GH response to PACAP38 (10
nM) was significantly reduced by a 10-µM
concentration of PACAP638 (486 ± 42% basal in the
control group vs. 321 ± 31% basal with the PACAP
antagonist; P < 0.05). A similar concentration of
[4-Cl-D-Phe6,Leu17]VIP was not
effective in this regard (475 ± 56% basal in the control
vs. 446 ± 61% basal with the VIP antagonist;
P > 0.05).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 2. Effects of the PACAP antagonist
PACAP638 (A) and VIP antagonist
[4-Cl-D-Phe6,Leu17]-VIP (B) on
ovine PACAP38-stimulated GH release from perifused goldfish
pituitary cells. A 5-min pulse of ovine PACAP38 (10
nM; vertical bars) was given during the
1.5-h continuous perifusion (horizontal bars) of either
the PACAP antagonist PACAP638 (10 µM) or
the VIP antagonist
[4-Cl-D-Phe6,Leu17]VIP (10
µM). GH data, expressed as the mean ±
SEM (n = 4), were pooled results from four separate
experiments, and the mean basal GH level was 34.7 ± 2.5 ng GH/ml.
Profiles of GH release are presented on the left, and
the quantitated GH responses are shown on the right. GH
responses were quantitated as the net change in GH release after a
pulse of drug treatment (i.e. a net change in the area
under the curve). A similar magnitude of GH responses is denoted by the
same letter (by ANOVA and Fishers LSD test, P >
0.05). In this study, PACAP and VIP antagonists were dissolved directly
in the perifusion medium, and therefore, the normal culture medium 199
was used as the control treatment.
|
|
Effects of nonmammalian PACAPs on GH release from goldfish
pituitary cells
To test whether nonmammalian PACAPs also have GH-releasing
activity in the goldfish, perifused goldfish pituitary cells were
exposed to increasing concentrations of PACAPs from amphibian and
teleost fish. Similar to the mammalian counterparts, frog
PACAP38 (0.01 nM to 1 µM; Fig. 3A
), zebra fish PACAP27
(0.011 µM; Fig. 3B
), and zebra fish PACAP38
(0.011 µM; Fig. 3C
) were all effective in stimulating
GH release with ED50 values of 14.4 ± 3.5, 15.4
± 4.1, and 1.4 ± 0.2 nM, respectively. The minimal
effective concentration of zebra fish PACAP38 (0.01
nM) that induced GH release was 100-fold lower than that of
zebra fish PACAP27 (1.0 nM) and 10-fold lower
than that of frog PACAP38 (0.1 nM). The
magnitudes of maximal GH responses to frog PACAP38
(393 ± 89% basal) and zebra fish PACAP27 (558
± 60% basal) were similar (P > 0.05), but were
significantly smaller (P < 0.05) than that to zebra
fish PACAP38 (1301 ± 174% basal).

View larger version (56K):
[in this window]
[in a new window]
|
Figure 3. Effects of frog PACAP38 (A), zebra
fish PACAP27 (B), and zebra fish PACAP38 (C) on
basal GH release from perifused goldfish pituitary cells. Increasing
concentrations (0.01 nM to 1 µM) of frog
PACAP38, zebra fish PACAP27, and zebra fish
PACAP38 were given as 5-min pulses, as indicated by the
vertical bars. GH data presented for these peptides,
expressed as the mean ± SEM (n = 45), were
pooled results from at least four independent experiments. In this
study, separate columns were used for individual concentrations of
peptide tested, and the mean basal GH level was 35.5 ± 4.2 ng
GH/ml. Profiles of GH release are presented on the left,
and the quantitated GH responses are shown on the right.
GH responses were quantitated as the net change in GH release after a
pulse of drug treatment (i.e. a net change in the area
under the curve). A similar magnitude of GH responses is denoted by the
same letter (by ANOVA and Fishers LSD test, P >
0.05). ED50 values for the GH-releasing effect of frog
PACAP38, zebra fish PACAP27, and zebra fish
PACAP38 were 14.4 ± 3.5, 1.4 ± 0.2, and
15.4 ± 4.1 nM, respectively.
|
|
Desensitization of PACAP-stimulated GH release in the
goldfish
In the preceding studies, individual concentrations of PACAPs were
tested in separate perifusion columns for GH-releasing activity. When
decreasing concentrations of ovine PACAP38 (0.01
nM to 1 µM) were given as consecutive 5-min
pulses at 1-h intervals, GH release was observed only after the first
pulse of ovine PACAP38 (1 µM), but not for
subsequent pulses of lower concentrations (1000.01 nM;
data not shown). These results suggest that there may be a
down-regulation of GH responses to repeated pulses of PACAP
stimulation. To test this hypothesis, increasing concentrations of
ovine PACAP38 (0.01 nM to 1 µM)
were applied to perifused goldfish pituitary cells as three consecutive
5-min pulses at 1-h intervals (Fig. 4
).
Repeated pulses of the same concentration of PACAP38 up to
1 nM induced similar magnitudes of GH responses (Fig. 4
, AC). When the concentrations of PACAP38 tested were 10
nM or more, the ability of the subsequent pulses to induce
GH release was diminished (Fig. 4
, DF). At the end of the perifusion
experiments, a 5-min pulse of ionomycin (10 µM) was given
as a positive control, and ionomycin treatment consistently induced a
significant increase in basal GH secretion.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 4. Effect of repeated exposure to increasing
concentrations of ovine PACAP38 on basal GH release from
perifused goldfish pituitary cells. Ovine PACAP38 with
concentrations ranging from 0.01 nM to 1 µM
(AF) was given as three consecutive 5-min pulses at 1-h intervals as
indicated by the vertical bars. As a positive control, a
10-min pulse of ionomycin (50 µM) was given at the end of
these perifusion experiments. The kinetics of GH release in response to
different concentrations of PACAP38 during the course of
perifusion are presented in the left panels
(SEMs are omitted for clarity), whereas the quantitated GH
responses, calculated as the net change in the area under the curve,
are given in the right panels. A similar magnitude of GH
responses is denoted by the same letter (by ANOVA followed by Fishers
LSD test, P > 0.05). GH data (mean ±
SEM) are pooled results from six separate experiments
(n = 6), and the mean basal GH release was 36.8 ± 1.3 ng
GH/ml.
|
|
Immunohistochemical staining of PACAP in goldfish pituitary
sections
The immunoreactivity of PACAP was demonstrated in the goldfish
pituitary sections using antiserum IHC8920 raised against ovine
PACAP38 (Fig. 5
, A and B).
PACAP immunostaining was found in nerve fibers located in the pars
distalis (PD) and neurointermediate lobe (NIL). These nerve fibers were
identified mostly in the periphery of rostral PD (RPD; Fig. 5
, A, a),
whereas in the proximal PD (PPD; Fig. 5A
, b) and NIL (Fig. 5A
, c), a
random distribution pattern was observed. In the PPD, some of these
nerve fibers were located in close proximity to pituitary cells
immunoreactive to GH antiserum (Fig. 5B
, ac). Occasionally, pituitary
cells with PACAP immunoreactivity were found near some blood vessels in
the NIL (Fig. 6
, AC). In this study,
the specificity of PACAP immunostaining was confirmed using normal
rabbit serum as the control and preabsorption of IHC8920 with ovine
PACAP38. In both cases, no immunostaining signals were
found in goldfish pituitary sections (data not shown).

View larger version (89K):
[in this window]
[in a new window]
|
Figure 5. A, Distribution of PACAP immunoreactivity in the
goldfish pituitary. PACAP immunoreactivity was found in branches of
nerve bundles located mainly in the periphery of the RPD (a). In the
PPD (b) and NIL (c), PACAP immunostaining was identified mainly in
nerve fibers of a smaller size. In contrast to that in the RPD, no
specific distribution pattern of PACAP immunostaining was observed in
the PPD or NIL. B, Immunostaining of PACAP (a) and GH (b) in
consecutive goldfish pituitary sections. Pituitary cells with GH
immunoreactivity were found only in the PPD, not in the RPD nor NIL. In
the PPD, some of the fibers with PACAP immunoreactivity (indicated by
arrows) were identified in the vicinity of pituitary
cells with GH immunostaining. The distribution of PACAP immunostaining
(dots) and GH cells (shaded area) in
consecutive pituitary sections was mapped using a computer-generated
overlay diagram (c). Brightfield microscopy; magnification, x100.
|
|

View larger version (144K):
[in this window]
[in a new window]
|
Figure 6. Pituitary cells with PACAP immunoreactivity in the
neurointermediate lobe. A, Pituitary cells with PACAP immunostaining
were identified occasionally around the blood vessels in the
neurointermediate lobe (brightfield; magnification, x100). B, PACAP
immunoreactivity was found in the cytoplasm but not in the nuclei of
these cells (brightfield; magnification, x200). C, These
PACAP-positive pituitary cells do not have the flattened structure
typical of the endothelial cells, suggesting that they may not be a
part of the blood vessels (brightfield; magnification, x400).
|
|
Molecular cloning of goldfish type I PACAP receptor cDNA
A partial cDNA clone with nucleotide sequence similar to the
coding region from TMD2 to TMD6 of mammalian PACAP receptors was
obtained using a nested PCR approach. This partial cDNA clone was used
as a probe to screen a goldfish pituitary cDNA library, and a
full-length cDNA clone of 5.2 kb in size was isolated (Fig. 7
). This full-length cDNA contained a
single open reading frame of 1395 bp encoding a 465-amino acid protein.
Seven segments of hydrophobic amino acids corresponding to the
transmembrane-spanning regions TMD16 of G protein-coupled receptors
were identified in this receptor protein, as indicated by the results
of Kyte-Doolittle hydrophobicity analysis (data not shown). When
compared with the human and rat type I PACAP receptors, the deduced
amino acid sequence of this goldfish receptor was 85.7% and 85.1%
homologous to these mammalian counterparts, respectively (Fig. 8
). The intracellular and extracellular
loops, TMDs, and the cytoplasmic tail in the C-terminal were largely
conserved in this goldfish PACAP receptor. All 15 cysteine residues,
aspartic acid at position 75, and proline residues in TMD46 reported
in mammalian type I PACAP receptors were also present. The N-terminal
extracellular domain of this goldfish receptor was more variable;
especially, the first putative N-linked glycosylation site
reported in mammalian PACAP receptors was not found.

View larger version (106K):
[in this window]
[in a new window]
|
Figure 7. The cDNA and deduced amino acid sequences of the
goldfish type I PACAP receptor. The seven transmembrane domains
(TMD17) of this goldfish receptor are double
underlined and labeled accordingly. The conserved cysteine
residues and putative N-linked glycosylation sites are
in bold and labeled * and #, respectively. The proline
residues in TMD46, which are highly conserved among G protein-coupled
receptors, are in bold italic. The consensus sequence
RLAR in the third intracellular loop for the coupling with
Gs is in bold, and the polyadenylation
signals AATAAA/AACAAA in the 3'-end are underlined.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
Figure 8. Amino acid sequence alignment of human, rat, and
goldfish type I PACAP receptor. The horizontal arrows
indicate the seven putative transmembrane domains (TMD17) of the
receptor. The amino acid residues that are identical or conserved among
these PACAP receptors are boxed. The conserved sequences
of N-linked glycosylation sites, cysteine residues, and
aspartic acid at position 75 are labeled #, *, and +, respectively.
|
|
Functional expression of goldfish type I PACAP receptors
To establish the functionality of goldfish type I PACAP receptor,
the full-length cDNA clone of this receptor was stably transfected into
COS-7 cells. This newly transfected cell line, namely COS-gf.PACAP.R,
was then exposed to a 100-nM concentration of ovine
PACAP27 and PACAP38, as well as other
structurally related peptides, including VIP, GHRH, PTH, GIP, glucagon,
and secretin (Fig. 9A
). The concentration
of peptides tested was fixed at 100 nM, as this
concentration of PACAPs was previously shown to induce a maximal GH
response in goldfish pituitary cells (Figs. 1
and 3
). In this study, a
significant increase in cellular cAMP content was observed after
stimulating COS-gf.PACAP.R cells with ovine PACAP27 and
PACAP38. Other peptides, including VIP, GHRH, PTH, GIP,
glucagon, and secretin, were not effective in this respect.
Furthermore, PACAP-stimulated cAMP production was concentration
dependent (Fig. 9B
). Ovine PACAP27 (0.01 nM to
1 µM) and PACAP38 (0.01 nM to 1
µM) increased cellular cAMP contents with
ED50 values of 2.4 ± 0.8 and 4.2 ± 1.2
nM, respectively. In the same experiment, similar
concentrations of GHRH and an inactive fragment of PACAP,
PACAP1638, did not alter basal cAMP synthesis.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 9. Functional expression of goldfish type I receptor
in COS-7 cells. A, Effects of ovine PACAP27,
PACAP38, and related peptides, including VIP, GHRH,
glucagon, secretin, GIP, and PTH, on cellular cAMP contents in COS-7
cells with stable expression of goldfish type I PACAP receptors. The
concentration of peptide tested was fixed at 100 nM, and
cAMP data were transformed into the fold increase in cAMP content in
the control group (without drug treatment). B, Effect of increasing
concentrations (0.01 nM-1 µM) of ovine
PACAP27 and PACAP38 on cAMP synthesis in COS-7
cells with goldfish type I PACAP receptors. Similar concentrations of
GHRH (0.01 nM to 1 µM) and
PACAP1638 (0.01 nM to 1 µM), an
inactive analog of PACAP38, were used as the negative
control. In these experiments, cAMP data were simply expressed as
picomoles of cAMP per ml/well, and the estimated ED50
values for ovine PACAP27 and PACAP38 were
2.4 ± 0.8 and 4.2 ± 1.2 nM, respectively. In
this study, the duration of drug treatment was fixed at 45 min in the
presence of 0.2 mM IBMX.
|
|
Tissue distribution of goldfish type I PACAP receptor mRNA
To examine the tissue distribution of goldfish type I PACAP
receptors, poly(A)+ mRNAs prepared from various tissues of
the goldfish, including the heart, brain, pituitary, liver, gall
bladder, gills, intestine, gonads, muscle, spleen, and kidney, were
subjected to Northern blot analysis (Fig. 10
, A and B). Hybridization signals to
a 32P-labeled probe of goldfish type I PACAP receptor were
found only in the heart, brain, and pituitary, not in the other tissues
tested. Two mRNA transcripts for PACAP receptors of 5.4 and 7.4 kb were
consistently identified in these three tissues. The 7.4-kb transcript
in the brain was present at a comparable level as the 5.4-kb variant,
whereas the predominant form in the heart and pituitary was the one
that was 5.4 kb in size. A Northern blot of ß-actin transcript was
conducted to serve as an internal control for the quality of mRNA
prepared. The ß-actin transcript 2.3 kb in size was observed in all
of the tissues tested, and there was no indication of mRNA degradation
(data not shown).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 10. Northern blot analysis of the goldfish type I
PACAP receptor. Poly(A)+ RNA was prepared from various
tissues of the goldfish, including A) heart, kidney, liver, muscle,
pituitary, and spleen; and B) brain, gall bladder, gill, gonad,
intestine, and heart. These samples (3 µg) were electrophoresed in a
1.2% agarose gel with formaldehyde and transblotted onto a Hybond
N+ nylon membrane. Northern hybridization was performed
using a full-length goldfish PACAP receptor cDNA probe. Transcripts of
7.4 and 5.4 kb were detected at high levels in the brain and heart and
at a modest level in the pituitary, but were not detectable in other
tissues. In this study, a Northern blot of goldfish ß-actin was also
performed to control for the quality of mRNA prepared (results not
shown), and there was no indication of mRNA degradation.
|
|
Tissue distribution of type I PACAP receptors in the goldfish was
further confirmed using RT-PCR (Fig. 11
). The primers specific for goldfish
type I PACAP receptor amplified a PCR product of 700 bp in the brain,
heart, and pituitary. In other tissues, including the gall bladder,
gills, gonads, intestine, kidney, liver, muscle, and spleen, a faint
band of the same size was also observed, suggesting that type I PACAP
receptors are expressed at low levels in these tissues. The
authenticity of PCR products was confirmed by Southern blotting using a
32P-labeled full-length cDNA probe. In the same study,
RT-PCR of ß-actin was performed to serve as an internal control for
the integrity of first strand cDNAs. Except for the negative control
(i.e. PCR without a template), a 200-bp PCR product specific
for goldfish ß-actin was consistently observed.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 11. Tissue distribution of goldfish type I PACAP
receptors as revealed by RT-PCR. Poly(A)+ RNA was prepared
from various tissues of the goldfish, including the brain, gall
bladder, gill, gonad, intestine, heart, kidney, liver, muscle,
pituitary, and spleen. RT-PCR was performed using the specific primers
for goldfish type I PACAP receptor, and a 700-bp PCR product was
observed in the brain, heart, and pituitary (A). In other tissues, a
faint band of the same size was also observed. As an internal control,
RT-PCR for goldfish ß-actin was performed (B). In these tissue
samples, except for the negative control (i.e. PCR
without a template), a 200-bp PCR product specific for goldfish
ß-actin was consistently observed.
|
|
 |
Discussion
|
|---|
In mammals, such as the rat, PACAP perikarya are located in the
paraventricular and supraoptic nuclei of the hypothalamus (39), PACAP
nerve terminals are present in the median eminence (23), and PACAP
immunoreactivity can be detected in the hypophysial portal blood (24).
These findings support the idea that PACAP is produced in the
hypothalamus and delivered to the anterior pituitary to serve as a
hypophysiotropic factor. Teleosts, unlike mammals, do not have a
hypophysial portal blood system, and their anterior pituitaries are
directly innervated by the hypothalamus (32). In this study, direct
evidence has been presented for the first time to demonstrate the
presence of PACAP immunoreactivity in the pituitary of a fish species.
In the goldfish, nerve fibers with PACAP immunostaining were identified
in the periphery of RPD, but were randomly distributed in the PPD and
NIL. Some of these nerve fibers were localized in the vicinity of
somatotrophs in the PPD, suggesting that PACAP may influence GH release
in the goldfish. Occasionally, pituitary cells with PACAP
immunostaining were found near the blood vessels in the NIL. Although
the identity of these cells is still unknown, they may represent the
sites of local production of PACAP at the pituitary level.
Alternatively, PACAP may be taken up from circulation and concentrated
in these cells. In the rat, a detectable level of PACAP
immunoreactivity has been identified in some gonadotrophs and
lactotrophs (40), and these two cell types are known to be target cells
for PACAP (41). Therefore, we do not exclude the possibility that PACAP
may also function as an autocrine/paracrine factor in the goldfish
pituitary.
Consistent with our hypothesis that PACAP may function as a GH
regulator in the goldfish, PACAPs from different species, including
mammalian and nonmammalian variants, concentration dependently
stimulated GH release from perifused goldfish pituitary cells. The rank
order of ED50 of these peptides was: zebra fish
PACAP38
ovine PACAP38 < ovine
PACAP27
zebra fish PACAP27
frog
PACAP38 << mammalian VIP. Similarly, the rank order of
sensitivity of goldfish pituitary cells to PACAP stimulation (as
indicated by the minimal effective concentration of PACAP to induce GH
release) was: zebra fish PACAP38 < ovine
PACAP38
frog PACAP38 < zebra fish
PACAP27
ovine PACAP27. Apparently, zebra
fish PACAP38 is the most potent PACAP analog tested in this
study. Comparison with other known GH secretagogues in the goldfish
tested under a similar, if not identical, column perifusion system
showed that the potency of zebra fish PACAP38
(ED50 = 1.4 ± 0.2 nM) is higher than
those of chicken GnRH-II (ED50 = 19.2 ± 1.3
nM) (42) and dopamine (ED50 =
0.26 ± 0.06 µM) (43), similar to those of TRH
(ED50 = 5.7 ± 3.1 nM) (44) and
salmon GnRH (ED50 = 2.5 ± 1.4
nM) (45), but lower than that of mammalian neuropeptide Y
(ED50 = 0.5 ± 0.2 nM) (46) and
common carp GHRH (ED50 = 0.1 ± 0.1
nM) (47). The maximal GH responses induced by these GH
secretagogues, e.g. dopamine (184% of basal) (43), salmon
GnRH (150% of basal) (45), TRH (125% of basal) (44), mammalian
neuropeptide Y (150% of basal) (46), and common carp GHRH (175% of
basal) (47), were lower than that of zebra fish PACAP38
(1301 ± 174% of basal). These findings suggest that, unlike
mammals, PACAP is not only a modulator of pituitary hormone secretion,
but may also function as a novel GH-releasing factor in the
goldfish.
Stimulatory effects of PACAP on GH release have been demonstrated
in vitro in rat somatotrophs (27) and clonal pituitary cell
lines (26, 28). In perifusion studies with GH3 cells,
PACAP-stimulated GH release can be mimicked by the structurally related
peptide VIP and abolished by simultaneous treatment with a VIP
antagonist (28). The pharmacology of these GH responses suggests that
PACAP stimulates GH release from GH3 cells via activation
of type II PACAP receptors. This is in agreement with the findings that
type II PACAP receptors, in particular the helodermin-preferring VIP2
(PVR3) receptors, are the major form of PACAP receptors expressed in
GH4C1 cells (48). In this clonal GH cell line,
type I PACAP receptors are not expressed at a significant level. In the
present study, VIP was unable to stimulate GH release from perifused
goldfish pituitary cells. In addition, the GH-releasing action of ovine
PACAP38 was blunted by the PACAP antagonist
PACAP638, and the VIP antagonist
[4-Cl-D-Phe6,Leu17]VIP was not
effective in this regard. These results indicate that PACAP-stimulated
GH release in the goldfish is mediated through pituitary receptors
resembling the mammalian type I PACAP receptors.
Given that the structure of type I PACAP receptors is virtually
unknown in lower vertebrates, molecular cloning of the goldfish type I
PACAP receptor was performed to establish its structural identity and
functional relevance in regulating GH release in the goldfish. A
full-length cDNA clone of goldfish type I PACAP receptor was isolated,
and the deduced amino acid sequence revealed that it is a G
protein-coupled receptor with 7 transmembrane domains. At the amino
acid sequence level, this goldfish receptor is highly homologous to
that of the rat (85.7%) (49) and human (85.1%) (50) type I PACAP
receptors. The 15 cysteine residues reported in these mammalian
counterparts together with the proline residues found in TMD4, TMD5,
and TMD6 are all conserved in this fish receptor. Cysteine residues, by
forming intramolecular disulfide bonds, determine the 3-dimensional
structure of receptors (51), whereas proline residues are known to
introduce kinks in the
-helixes of TMDs and are involved in the
formation of a ligand binding pocket in some receptors, e.g.
dopamine receptors (52). Based on this structural information, it would
be expected that the goldfish PACAP receptor should have a tertiary
structure similar to that of the mammalian receptor. This idea is in
agreement with the present findings that ovine PACAP27 and
PACAP38 were effective in stimulating GH release from
goldfish pituitary cells, suggesting that this fish type I PACAP
receptor can cross-react with mammalian PACAPs.
The aspartic acid residue at position 75 of the N-terminal, which
is a common feature of the secretin receptor family, is also found in
this goldfish type I PACAP receptor. A point mutation that altered this
aspartic acid to glycine has been reported in the GHRH receptor of the
little (lit) mouse model (53), and this mutated receptor is
defective in transducing signals through the cAMP-dependent pathway. In
this goldfish type I PACAP receptor, a consensus sequence, RLAR, has
been identified in the third intracellular loop. A similar motif
reported in ß-adrenergic receptors is known to be essential for the
coupling to Gs
and the activation of adenylate
cyclase (54). These structural characteristics suggest that the
biological actions of goldfish PACAP receptor are mediated through the
cAMP-dependent pathway. To test this hypothesis, functional expression
of goldfish type I PACAP receptors was conducted in COS-7 cells. Ovine
PACAP27 and PACAP38 stimulated cAMP production
in these COS-7 cells in a concentration-dependent manner. Other related
peptides, including VIP, GHRH, GIP, PTH, glucagon, and secretin, were
not effective in this respect. The lack of a stimulatory action of VIP
on cAMP synthesis further confirms that this newly cloned goldfish
receptor is indeed a type I PACAP receptor. The
ED50 values for PACAP27- and
PACAP38-stimulated cAMP production were 2.4 ± 0.8 and
4.2 ± 1.2 nM, respectively. These
ED50 values are in the same concentration range
as that for PACAP-stimulated GH release from goldfish pituitary cells.
In our previous studies, the adenylate cyclase activator forskolin and
membrane- permeant cAMP analogs were effective in stimulating GH
release from goldfish pituitary cells (55). Therefore, it is
conceivable that the cAMP signaling pathway is involved in
PACAP-stimulated GH release in goldfish via activation of type I
PACAP receptors.
To examine the tissue distribution of this goldfish type I PACAP
receptor, Northern blot using mRNAs prepared from various tissues of
the goldfish was performed. Transcripts of this goldfish receptor were
identified in the brain, heart, and pituitary, but not in other
tissues, including the liver, kidney, gonads, spleen, intestine, gills,
muscle, and gall bladder. The presence of type I PACAP receptors in the
brain is consistent with the roles of PACAP as a
neurotransmitter/neuromodulator (6) and nerve growth factor (7).
Although PACAP is also proposed to be a vasoregulator (8), the
expression of PACAP receptors in the heart has not been previously
reported. In the goldfish, the heart contains a high level of mRNA for
type I PACAP receptors. Therefore, it is logical to speculate that
PACAP may play a role in the control of cardiac functions in this fish
species. Compared with those in the brain and heart, the level of
expression of goldfish PACAP receptors was lower in the pituitary.
Nevertheless, the presence of type I PACAP receptors in the goldfish
pituitary is consistent with our findings that PACAP stimulates GH
release from goldfish pituitary cells through activation of type I
PACAP receptors. Together with the identification of PACAP nerve fibers
in the goldfish pituitary, it is highly possible that PACAP may
function as a classical hypophysiotropic factor in teleost fishes. In
this study, the tissue distribution of this goldfish type I PACAP
receptor was further confirmed using RT-PCR. Using this more sensitive
approach, besides the predominant signals found in the brain, heart,
and pituitary, a faint band of the same size was demonstrated in other
tissues as well (e.g. gall bladder, gills, gonads,
intestine, kidney, liver, muscle, and spleen). The authenticity of
these PCR signals was confirmed by Southern blot, suggesting that type
I PACAP receptors are also expressed in these tissues at low levels. At
present, the biological relevance of such a low level of receptor
expression in the goldfish is unclear.
In this study, direct actions of PACAP on GH release from goldfish
pituitary cells were tested using a column perifusion system. Static
incubation of goldfish pituitary cells were deliberately avoided. In
mammals, such as the rat, PACAP-stimulated GH release is not a
consistent observation using static incubation of pituitary cells; both
no effects (2) and a weak stimulation after a long incubation has been
reported (25, 29). In those studies with a stimulatory effect, an
indirect action of PACAP by inducing the release of autocrine/paracrine
factors has been suggested (29). This idea is supported by the findings
that PACAP stimulates interleukin-6 release from folliculo-stellate
cells in the rat pituitary (56), and interleukin-6 is known to have
GH-releasing activity (57). In the goldfish, the rapidity of GH
responses to PACAP stimulation (<5 min) argues against the possibility
of an indirect action of PACAP through autocrine/paracrine factors.
Furthermore, indirect actions of PACAP in this study were avoided using
a perifusion system that removes the secreted products from goldfish
pituitary cells and prevents any accumulation of autocrine/paracrine
factors. Besides, in this study it has been shown that repeated
exposure to PACAP dose dependently reduced the GH-releasing action of
PACAP in perifused goldfish pituitary cells. This desensitization of
GH-releasing action may explain why some of the static incubation
studies with PACAP did not exhibit a consistent GH-releasing effect. In
the goldfish, this loss of responsiveness could not be due to a
depletion of cellular GH stores, as the positive control ionomycin was
still effective in stimulating GH release at the end of these
experiments. At present, the mechanism(s) for this down-regulation of
PACAP-stimulated GH release is unknown, but similar observations in
other receptor systems have been attributed to a decrease in receptor
capacity [e.g. GnRH receptors, (58)] and/or an uncoupling
of signaling pathways from membrane receptors [e.g.
ß-adrenergic receptors (59)].
In summary, we have demonstrated that PACAP nerve fibers are present in
the goldfish pituitary, and PACAPs from different species, including
the mammalian and nonmammalian variants, are effective in stimulating
GH release from perifused goldfish pituitary cells. The potency of
these PACAPs on GH release is in the nanomolar concentration range, and
the efficacy of their GH-releasing actions, especially for zebra fish
PACAP38, is higher than that of other known GH-releasing
factors reported in the goldfish. The GH-releasing effect of PACAP can
be desensitized by repeated exposure to increasing concentrations of
ovine PACAP38. In this study, the pharmacology of
PACAP-stimulated GH release reveals that this stimulatory action is
mediated through pituitary type I PACAP receptors. This idea is
supported by the molecular cloning and subsequent tissue distribution
studies of goldfish type I PACAP receptor. This newly cloned goldfish
PACAP receptor has the classical structure of a G protein-coupled
receptor with seven transmembrane domains and is highly homologous to
the mammalian type I PACAP receptors. Functional expression of this
goldfish receptor indicates that it is functionally coupled to the
cAMP-dependent pathway and exhibits a similar pattern of ligand
selectivity as that of type I PACAP receptors. In the goldfish, this
type I PACAP receptor is expressed at a high level in the brain and
heart and to a modest level in the pituitary, but to a low level in
other tissues, including the liver, kidney, gonads, spleen, gill,
intestine, muscle, and gall bladder. These results, as a whole, suggest
that PACAP, through activation of pituitary type I PACAP receptors, may
function as a novel GH-releasing factor in the goldfish.
 |
Acknowledgments
|
|---|
Special thanks are given to Dr. R. E. Peter (University of
Alberta, Edmonton, Canada) for the supply of GH standard and antiserum
for GH RIA, Dr. S. Mojsov (Rockefeller University, New York, NY) for
providing us with zebra fish PACAP27 and
PACAP38, and Mr. E. K. Y. Lee (Hong Kong
University) for his help with PACAP immunohistochemical staining. We
are also grateful to Drs. K. L. Yu, D. K. O. Chan,
F. C. Leung, and S. M. Chan for their support throughout the
research project.
 |
Footnotes
|
|---|
1 Part of the present study was presented in the 10th International
Congress of Endocrinology, San Francisco, CA, June 1215, 1996, and
the 2nd International Union of Biological Sciences Symposium on
Advances in Molecular Endocrinology of Fish, Toronto, Canada, May
1719, 1997. This work was supported by Research Grant Council Grants
(Hong Kong; to A.O.L.W. and B.K.C.C.) and the Department of Zoology
(Hong Kong University; to M.Y.L., L.Y.T., and W.L.C.S.) in the form of
teaching assistantship. 
Received November 24, 1997.
 |
References
|
|---|
-
Rawlings SR 1994 PACAP, PACAP receptors, and
intracellular signalling. Mol Cell Endocrinol 101:C5C9
-
Miyata A, Arimura A, Dahl DH, Minamino N, Uehara A,
Jiang L, Culler MD, Coy DH 1989 Isolation of a novel 38 residue
hypothalamic peptide which stimulates adenylate cyclase in pituitary
cells. Biochem Biophys Res Commun 164:567574[CrossRef][Medline]
-
Miyata A, Dah DH, Jiang L, Kitada K, Fujino M, Minamino
N, Arimura A 1990 Isolation of a neuropeptide corresponding to the
N-terminal 27 residues of the pituitary adenylate cyclase activating
polypeptide with 38 residues (PACAP38). Biochem Biophys Res
Commun 170:643648[CrossRef][Medline]
-
Arimura A, Shioda S 1995 Pituitary adenylate
cyclase polypeptide (PACAP) and its receptors: neuroendocrine and
endocrine interaction. Front Neuroendocrinol 16:5388[CrossRef][Medline]
-
Arimura A, Somogyvari-Vigh A, Miyata A, Mizuno K, Coy
DH, Kitada C 1991 Tissue distribution of PACAP as determined by
RIA: highly abundant in the rat brain and testes. Endocrinology 129:27872789[Abstract/Free Full Text]
-
Masuo Y, Suzuki N, Matsumoto H, Tokito F, Matsumoto Y,
Tsuda M, Fujino M 1993 Regional distribution of pituitary
adenylate cyclase activating polypeptide (PACAP) in the rat central
nervous system as determined by sandwich-enzyme immunoassay. Brain Res 602:5763[CrossRef][Medline]
-
Chang JY, Korolev VV, Wang JZ 1996 Cyclic AMP and
pituitary adenylate cyclase-activating polypeptide (PACAP) prevent
programmed cell death of cultured rat cerebellar granule cells.
Neurosci Lett 206:181184[CrossRef][Medline]
-
Carlsson PO, Ostenson CG, Efendic S, Langel U, Jansson
L 1996 Pituitary adenylate cyclase activating polypeptide (PACAP)
redistributes the blood within the pancreas of anesthetized rats. Regul
Pept 63:123128[CrossRef][Medline]
-
Ogi K, Kimura C, Onda H, Arimura A, Fujino M 1990 Molecular cloning and characterization of the cDNA for the precursor of
rat pituitary adenylate cyclase-activating polypeptide (PACAP). Biochem
Biophys Res Commun 173:12711279[CrossRef][Medline]
-
Kimura C, Ohkubo S, Ogi K, Hosoya M, Itoh Y, Onda H,
Miyata A, Jiang L, Dahl RR, Stibbs HH, Arimura A, Fujino M 1990 A
novel peptide which stimulates adenylate cyclase: molecular cloning and
characterization of the ovine and human cDNAs. Biochem Biophys Res
Commun 166:8189[CrossRef][Medline]
-
Okazaki K, Itoh Y, Ogi K, Ohkubo S, Onda H 1995 Characterization of murine PACAP mRNA. Peptide 16:12951299[CrossRef][Medline]
-
Ohkubo S, Kimura C, Ogi K, Okazaki K, Hosaya M, Onda H,
Miyata A, Arimura A, Fujino M 1992 Primary structure and
characterization of the precursor to human pituitary adenylate cyclase
activating polypeptide. DNA Cell Biol 11:2130[Medline]
-
Chartrel N, Tonon MC, Vaudry H, Conlon JM 1991 Primary structure of frog pituitary adenylate cyclase-activating
polypeptide (PACAP) and effects of ovine PACAP on frog pituitary.
Endocrinology 129:33673371[Abstract/Free Full Text]
-
Yasuhara T, Mizuno K, Somogyvari-Vigh A, Komaki G,
Arimura A 1992 Isolation and primary structure of chicken PACAP.
Regul Pept 37:326 (Abstract)[CrossRef]
-
Montero M, Yon L, Rousseau K, Arimura A, Fournier
A, Dufour S, Vaudry H 1997 Distribution, characterization,
and hypophysiotropic activity of PACAP in the European eel
Anguilla anguilla. Regul Pept 71:123 (Abstract)
-
Parker DB, Coe IR, Dixon GH, Sherwood NM 1993 Two
salmon neuropeptides encoded by one brain cDNA are structurally related
to members of the glucagon superfamily. Eur J Biochem 215:439448[Medline]
-
McRory JE, Parker DB, Ngamvongchon S, Sherwood NM 1995 Sequence and expression of cDNA for pituitary adenylate cyclase
activating polypeptide (PACAP) and growth hormone-releasing hormone
(GHRH)-like peptide in catfish. Mol Cell Endocrinol 108:169177[CrossRef][Medline]
-
Parker DB, Power ME, Swanson P, Rivier J, Sherwood
NM 1997 Exon skipping in the gene encoding pituitary adenylate
cyclase-activating polypeptide in salmon alters the expression of two
hormones that stimulate growth hormone release. Endocrinology 138:414423[Abstract/Free Full Text]
-
McRory J, Sherwood NM 1997 Two protochordate genes
encode pituitary adenylate cyclase-activating polypeptide and related
family members. Endocrinology 138:23802390[Abstract/Free Full Text]
-
Convineau A, Rouyer-Fessard C, Darmoul D, Maoret JJ,
Carrero I, Ogier-Denis E, Laburthe M 1994 Human intestinal VIP
receptor: cloning and functional expression of two cDNA encoding
proteins with different N-terminal domains. Biochem Biophys Res Commun 200:769776[CrossRef][Medline]
-
Lutz EM, Sheward WJ, West KM, Morrow JA, Fink G, Harmar
AJ 1993 The VIP2 receptor: molecular characterization of a cDNA
encoding a novel receptor for VIP. FEBS Lett 334:38[CrossRef][Medline]
-
Rawlings SR, Hezareh M 1996 Pituiaty adenylate
cyclase activating polypeptide (PACAP) and PACAP/vasoactive intestinal
polypeptide receptors: actions on the anterior pituitary gland. Endocr
Rev 17:429[Abstract/Free Full Text]
-
Koves K, Arimura A, Somogyvari-Vigh A, Vigah S, Miller
J 1990 Immunohisto-chemical demonstration of a novel hypothalamic
peptide, pituitary adenylate cyclase-activating polypeptide, in the
ovine hypothalamus. Endocrinology 127:264271[Abstract/Free Full Text]
-
Dow RC, Bennie J, Fink G 1994 Pituitary adenylate
cyclase-activating polypeptide-38 (PACACP38) is released into
hypophysial portal blood in the male and female rat. J Endocrinol
142:R1R4
-
Hart GR, Gowing H, Burrin JM 1992 Effects of a
novel hypothalamic peptide, pituitary adenylate cyclase-activating
polypeptide, on pituitary hormone release in rats. J Endocrinol 134:3341[Abstract/Free Full Text]
-
Propato-Mussafiri R, Kanse SM, Ghatei MA, Bloom SR 1992 Pituitary adenylate cyclase activating polypeptide releases 7B2,
adenocorticotropin, growth hormone, and prolactin from the mouse and
rat clonal pituitary cell lines AtT-20 and GH3. J
Endocrinol 132:107113[Abstract/Free Full Text]
-
Goth MI, Lyons CE, Canny BJ, Thorner MO 1992 Pituitary adenylate cyclase activating polypeptide, growth hormone
(GH)-releasing peptide and GH-releasing hormone stimulate GH release
through distinct pituitary receptors. Endocrinology 130:939944[Abstract/Free Full Text]
-
Murakami Y, Koshimura K, Yamauchi K, Nishiki M, Tanaka
J, Furuya H, Miyake T, Kato Y 1995 Pituitary adenylate cyclase
activating polypeptide (PACAP) stimulates growth hormone release from
GH3 cells through type II PACAP receptor. Regul Pept 56:3540[CrossRef][Medline]
-
Jarry H, Leonhardt S, Schmidt WE, Creutzfeldt W, Wuttke
W 1992 Contrasting effects of pituitary adenylate cyclase
activating polypeptide (PACAP) on in vivo and in
vitro prolactin and growth hormone release in male rats. Life Sci 51:823830[CrossRef][Medline]
-
Sawangjaroen K, Curlewis JD 1994 Effects of
pituitary adenylate cyclase-activating polypeptide (PACAP) and
vasoactive intestinal polypeptide (VIP) on prolactin, luteinizing
hormone and growth hormone secretion in the ewe. J Neuroendocrinol 6:549555[Medline]
-
Chiodera P, Volpi R, Capretti L, Caffarri G, Magotti MG,
Coiro V 1996 Effects of intravenously infused pituitary adenylate
cyclase-activating polypeptide on adenohypo-physeal hormone secretion
in normal men. Neuroendocrinology 64:242246[Medline]
-
Kah O, Anglade I, Lepretre E, Dubourg P, De Monbrison
D 1993 The reproductive brain in fish. Fish Physiol Biochem 11:8598[CrossRef]
-
Peter RE, Yu KL, Marchant TA, Rosenblum PM 1990 Direct neural regulation of the teleost adenohypophysis. J Exp Zool
[Suppl] 4:8498
-
Peng C, Peter RE 1997 Neuroendocrine regulation of
growth hormone secretion and growth in fish. Zool Stud 36:7989
-
Chang JP, Cook H, Freeman GL, Wiggs AJ, Somoza GM, De
Leeuw R, Peter RE 1990 Use of a pituitary cell dispersion method
and primary culture system for the studies of gonadotropin-releasing
hormone action in the goldfish, Carassius auratus. I.
Initial morphological, static, and cell column perifusion studies. Gen
Comp Endocrinol 77:256273[CrossRef][Medline]
-
Marchant TA, Fraser RA, Andrews PC, Peter RE 1987 The influence of mammalian and teleost somatostatins on the
secretion of growth hormone from goldfish (Carassius auratus
L) pituitary fragments in vitro. Regul Pept 17:4152[CrossRef][Medline]
-
Chow BKC 1997 The goldfish vasoactive intestinal
polypeptide receptor: functional studies and tissue distribution. Fish
Physiol Biochem 17:213222[CrossRef]
-
Chow BKC 1995 Molecular cloning and functional
characterization of a human secretin receptor. Biochem Biophys Res
Commun 212:204211[CrossRef][Medline]
-
Takahashi K, Totsune K, Murakami O, Satoh F, Sone M,
Ohneda M, Sasano H, Mouri T 1994 Pituitary adenylate cyclase
activating polypeptide (PACAP)-like immunoreactivity in human
hypothalamus: co-localization with arginine vasopressin. Regul Pept 50:267275[CrossRef][Medline]
-
Koves K, Molnar J, Kantor O, Gorcs TJ, Lakatos A,
Arimura A 1995 New aspects of the neuroendocrine role of PACAP.
Ann NY Acad Sci 805:648654[Medline]
-
Vigh S, Arimura A, Gottschall PE, Kitada C,
Somogyvari-Vigh A, Childs GV 1993 Cytochemical characterization of
anterior pituitary target cells for the neuropeptide, pituitary
adenylate cyclase activating polypeptide (PACAP) using biotinylated
ligands. Peptides 14:5965[CrossRef][Medline]
-
Habibi HR, Peter RE, Nahorniak CS, De L Milton RC,
Millar RP 1992 Activity of vertebrate gonadotropin-releasing
hormones and analogs with variant amino acid residues in positions 5,
7, and 8 in the goldfish pituitary. Regul Pept 37:271284[CrossRef][Medline]
-
Wong AOL, Chang JP, Peter RE 1992 Dopamine
stimulates growth hormone release from the pituitary of goldfish,
Carassius auratus, through the dopamone D1 receptors.
Endocrinology 130:12011210[Abstract/Free Full Text]
-
Trudeau VL, Somoza GM, Nahorniak CS, Peter RE 1992 Interactions of estradiol with gonadotropin-releasing hormone and
thyrotropin-releasing hormone in the control of growth hormone
secretion in the goldfish. Neuroendocrinoloy 56:483490[Medline]
-
Marchant TA, Chang JP, Nahorniak CS, Peter RE 1989 Evidence that gonadotropin-releasing hormone functions as a growth
hormone-releasing factor in the goldfish. Endocrinology 124:25092518[Abstract/Free Full Text]
-
Peng C, Huang YP, Peter RE 1990 Neuropeptide Y
stimulates growth hormone and gonadotropin release from the goldfish
pituitary in vitro. Neuroendocrinology 52:2834[Medline]
-
Vaughan JM, Rivier J, Spiess J, Peng C, Chang JP, Peter
RE, Vale W 1992 Isolation and characterization of hypothalamic
growth hormone-releasing factor from common carp, Cyprinus
carpio. Neuroendocrinology 56:539549[Medline]
-
Rawlings SR, Piuz I, Schlegel W, Bockaert J, Journot
L 1995 Differential expression of pituitary adenylate
cyclase-activating polypeptide/vasoactive intestinal polypeptide
receptor subtypes in clonal pituitary somatotrophs and gonadotrophs.
Endocrinology 136:20882098[Abstract]
-
Pisegna JR, Wank SA 1993 Molecular cloning and
functional expression of the pituitary adenylate cyclase-activating
polypeptide type I receptor. Proc Natl Acad Sci USA 90:63456349[Abstract/Free Full Text]
-
Ogi K, Miyamoto Y, Masuda Y, Habata Y, Hosoya M, Ohtaki
T, Masuo Y, Onda H, Fujion M 1993 Molecular cloning and functional
expression of a cDNA encoding the human pituitary adenylate cyclase
activating polypeptide receptor. Biochem Biophys Res Commun 196:15111521[CrossRef][Medline]
-
Sprengel R, Braum T, Nikolics K, Segalooff DL, Seeburg
PH 1990 The testicular receptor for follicle-stimulating hormone:
structure and functional expression of cloned cDNA. Mol Endocrinol 4:525530[Abstract/Free Full Text]
-
Dahl SG, Edvardsen O, Style I 1991 Molecular
dynamics of dopamine at the D2 receptor. Proc Natl Acad Sci USA 88:81118115[Abstract/Free Full Text]
-
Godfrey PG, Rahal JO, Beamer WG, Copeland NG, Jenkins
NA, Mayo KE 1993 GHRH receptor of little mice contains a missense
mutation in the extracellular domain that disrupts receptor function.
Nat Genet 4:227232[CrossRef][Medline]
-
Okamoto T, Murayama Y, Hayashi Y. Inagaki M, Ogata E,
Nishimoto I 1991 Identification of a Gs activator region of the
ß2-adrenergic receptor that is autoregulated via protein kinase
A-dependent phosphorylation. Cell 67:723730[CrossRef][Medline]
-
Wong AOL, Van der Kraak G, Chang JP 1994 Cyclic
3',5'-adenosine monophosphate mediates dopamine D1-stimulated
growth hormone release from goldfish pituitary cells. Neuroendocrinoloy 60:410417[Medline]
-
Tatsuno I, Somogyvari-Vigh A, Mizuno K, Gottschall PE,
Hidaka H, Arimura A 1991 Neuropeptide regulation of interleukin-6
production from the pituitary: stimulation by pituitary adenylate
cyclase activating polypeptide and calcitonin gene-related peptide.
Endocrinology 129:17971804[Abstract/Free Full Text]
-
Artz E, Buric R, Stelzer G, Stalla J, Sauer J, Renner U,
Stalla GK 1993 Interleukin involvement inanterior pituitary cell
growth regulation: effects of IL-2 and IL-6. Endocrinology 132:459467[Abstract/Free Full Text]
-
Habibi HR 1991 Homologous desensitization of
gonadotropin-releasing hormone (GnRH) receptors in the goldfish
pituitary: effects of native GnRH peptides and a synthetic GnRH
antagonist. Biol Reprod 44:275283[Abstract]
-
Benovic JL, Strasser RH, Daniel JL, Lefkowitz
RJ 1986 Beta adrenergic receptor kinase: identification of a novel
protein kinase that phosphorylates the agonist-occupied form of the
receptor. Proc Natl Acad Sci USA 83:27972801[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J.-C. Le Mevel, F. Lancien, N. Mimassi, and J. M. Conlon
Ventilatory and cardiovascular actions of centrally and peripherally administered trout pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal peptide (VIP) in the unanaesthetized trout
J. Exp. Biol.,
December 1, 2009;
212(23):
3919 - 3927.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Vaudry, A. Falluel-Morel, S. Bourgault, M. Basille, D. Burel, O. Wurtz, A. Fournier, B. K. C. Chow, H. Hashimoto, L. Galas, et al.
Pituitary Adenylate Cyclase-Activating Polypeptide and Its Receptors: 20 Years after the Discovery
Pharmacol. Rev.,
September 1, 2009;
61(3):
283 - 357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-T. Huang, C.-J. Li, P.-J. Wu, Y.-S. Chang, T.-L. Lee, and C.-F. Weng
Expression and in vitro regulation of pituitary adenylate cyclase-activating polypeptide (pacap38) and its type I receptor (pac1-r) in the gonads of tilapia (Oreochromis mossambicus)
Reproduction,
March 1, 2009;
137(3):
449 - 467.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. F. Canosa, N. Stacey, and R. E. Peter
Changes in brain mRNA levels of gonadotropin-releasing hormone, pituitary adenylate cyclase activating polypeptide, and somatostatin during ovulatory luteinizing hormone and growth hormone surges in goldfish
Am J Physiol Regulatory Integrative Comp Physiol,
December 1, 2008;
295(6):
R1815 - R1821.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wu, G. J Roch, L. A Cervini, J. E Rivier, and N. M Sherwood
Newly-identified receptors for peptide histidine-isoleucine and GHRH-like peptide in zebrafish help to elucidate the mammalian secretin superfamily
J. Mol. Endocrinol.,
November 1, 2008;
41(5):
343 - 366.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Jiang, W. K. W. Ko, E. A. Lerner, K. M. Chan, and A. O. L. Wong
Grass carp somatolactin: I. Evidence for PACAP induction of somatolactin-{alpha} and -{beta} gene expression via activation of pituitary PAC-I receptors
Am J Physiol Endocrinol Metab,
August 1, 2008;
295(2):
E463 - E476.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Jiang, M. He, X. Wang, and A. O. L. Wong
Grass carp somatolactin: II. Pharmacological study on postreceptor signaling mechanisms for PACAP-induced somatolactin-{alpha} and -{beta} gene expression
Am J Physiol Endocrinol Metab,
August 1, 2008;
295(2):
E477 - E490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Lugo, A. Rodriguez, Y. Helguera, R. Morales, O. Gonzalez, J. Acosta, V. Besada, A. Sanchez, and M. P. Estrada
Recombinant novel pituitary adenylate cyclase-activating polypeptide from African catfish (Clarias gariepinus) authenticates its biological function as a growth-promoting factor in low vertebrates
J. Endocrinol.,
June 1, 2008;
197(3):
583 - 597.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. H. Sze, H. Zhou, Y. Yang, M. He, Y. Jiang, and A. O. L. Wong
Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) as a Growth Hormone (GH)-Releasing Factor in Grass Carp: II. Solution Structure of a Brain-Specific PACAP by Nuclear Magnetic Resonance Spectroscopy and Functional Studies on GH Release and Gene Expression
Endocrinology,
October 1, 2007;
148(10):
5042 - 5059.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Wang, M. M. S. Chu, and A. O. L. Wong
Signaling mechanisms for {alpha}2-adrenergic inhibition of PACAP-induced growth hormone secretion and gene expression grass carp pituitary cells
Am J Physiol Endocrinol Metab,
June 1, 2007;
292(6):
E1750 - E1762.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, J. Li, C. Y. Wang, A. H. Y. Kwok, and F. C. Leung
Identification of the Endogenous Ligands for Chicken Growth Hormone-Releasing Hormone (GHRH) Receptor: Evidence for a Separate Gene Encoding GHRH in Submammalian Vertebrates
Endocrinology,
May 1, 2007;
148(5):
2405 - 2416.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Chi-Wei, S.-L. Chang, and C.-F. Weng
Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) Regulates the Expression of PACAP in Cultured Tilapia Astrocytes
Experimental Biology and Medicine,
February 1, 2007;
232(2):
262 - 276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. O. L. Wong, W. Li, C. Y. Leung, L. Huo, and H. Zhou
Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) as a Growth Hormone (GH)-Releasing Factor in Grass Carp. I. Functional Coupling of Cyclic Adenosine 3',5'-Monophosphate and Ca2+/Calmodulin-Dependent Signaling Pathways in PACAP-Induced GH Secretion and GH Gene Expression in Grass Carp Pituitary Cells
Endocrinology,
December 1, 2005;
146(12):
5407 - 5424.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zhou, Y. Jiang, W. K W Ko, W. Li, and A. O L Wong
Paracrine regulation of growth hormone gene expression by gonadotrophin release in grass carp pituitary cells: functional implications, molecular mechanisms and signal transduction
J. Mol. Endocrinol.,
April 1, 2005;
34(2):
415 - 432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Huo, E. K. Y. Lee, P. C. Leung, and A. O. L. Wong
Goldfish Calmodulin: Molecular Cloning, Tissue Distribution, and Regulation of Transcript Expression in Goldfish Pituitary Cells
Endocrinology,
November 1, 2004;
145(11):
5056 - 5067.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J C R Cardoso, D M Power, G Elgar, and M S Clark
Duplicated receptors for VIP and PACAP (VPAC1R and PAC1R) in a teleost fish, Fugu rubripes
J. Mol. Endocrinol.,
October 1, 2004;
33(2):
411 - 428.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zhou, W. K. W. Ko, W. K. K. Ho, S. S. Stojilkovic, and A. O. L. Wong
Novel Aspects of Growth Hormone (GH) Autoregulation: GH-Induced GH Gene Expression in Grass Carp Pituitary Cells through Autocrine/Paracrine Mechanisms
Endocrinology,
October 1, 2004;
145(10):
4615 - 4628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Unniappan and R. E. Peter
In vitro and in vivo effects of ghrelin on luteinizing hormone and growth hormone release in goldfish
Am J Physiol Regulatory Integrative Comp Physiol,
June 1, 2004;
286(6):
R1093 - R1101.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. K. Yunker, S. Smith, C. Graves, P. J. Davis, S. Unniappan, J. E. Rivier, R. E. Peter, and J. P. Chang
Endogenous Hypothalamic Somatostatins Differentially Regulate Growth Hormone Secretion from Goldfish Pituitary Somatotropes in Vitro
Endocrinology,
September 1, 2003;
144(9):
4031 - 4041.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Montpetit, A. Shahsavarani, and S. F. Perry
Localisation of VIP-binding sites exhibiting properties of VPAC receptors in chromaffin cells of rainbow trout (Oncorhynchus mykiss)
J. Exp. Biol.,
June 1, 2003;
206(11):
1917 - 1927.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-M. Yeung, S. Mojsov, P.-Y. Mok, and B. K. C. Chow
Isolation and Structure-Function Studies of a Glucagon-Like Peptide 1 Receptor from Goldfish Carassius auratus: Identification of Three Charged Residues in Extracellular Domains Critical for Receptor Function
Endocrinology,
December 1, 2002;
143(12):
4646 - 4654.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Alexandre, H. Vaudry, L. Grumolato, V. Turquier, A. Fournier, S. Jegou, and Y. Anouar
Novel Splice Variants of Type I Pituitary Adenylate Cyclase-Activating Polypeptide Receptor in Frog Exhibit Altered Adenylate Cyclase Stimulation and Differential Relative Abundance
Endocrinology,
July 1, 2002;
143(7):
2680 - 2692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L.-Y. Tse, R. T.-K. Pang, A. O.-L. Wong, S.-M. Chan, H. Vaudry, and B. K.-C. Chow
Identification of a Potential Receptor for Both Peptide Histidine Isoleucine and Peptide Histidine Valine
Endocrinology,
April 1, 2002;
143(4):
1327 - 1336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. M. Sherwood, S. L. Krueckl, and J. E. McRory
The Origin and Function of the Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP)/Glucagon Superfamily
Endocr. Rev.,
December 1, 2000;
21(6):
619 - 670.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Z. Hu, V. Lelievre, J. Tam, J. W. Cheng, G. Fuenzalida, X. Zhou, and J. A. Waschek
Molecular Cloning of Growth Hormone-Releasing Hormone/Pituitary Adenylyl Cyclase-Activating Polypeptide in the Frog Xenopus laevis: Brain Distribution and Regulation after Castration
Endocrinology,
September 1, 2000;
141(9):
3366 - 3376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Vaudry, B. J. Gonzalez, M. Basille, L. Yon, A. Fournier, and H. Vaudry
Pituitary Adenylate Cyclase-Activating Polypeptide and Its Receptors: From Structure to Functions
Pharmacol. Rev.,
June 1, 2000;
52(2):
269 - 324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Trudeau, O Kah, J. Chang, B. Sloley, P Dubourg, E. Fraser, and R. Peter
The inhibitory effects of (gamma)-aminobutyric acid (GABA) on growth hormone secretion in the goldfish are modulated by sex steroids
J. Exp. Biol.,
January 5, 2000;
203(9):
1477 - 1485.
[Abstract]
[PDF]
|
 |
|