help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, J. H.
Right arrow Articles by Murphy, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, J. H.
Right arrow Articles by Murphy, B. D.
Endocrinology Vol. 139, No. 8 3629-3636
Copyright © 1998 by The Endocrine Society


ARTICLES

Cloning, Developmental Expression, and Immunohistochemistry of Cyclooxygenase 2 in the Endometrium during Embryo Implantation and Gestation in the Mink (Mustela vison)1

Jian H. Song, Jean Sirois, Alain Houde2 and Bruce D. Murphy

Centre de Recherche en Reproduction Animale, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, Québec, Canada J2S 7C6

Address all correspondence and requests for reprints to: Dr. Bruce D. Murphy, Centre de Recherche en Reproduction Animale, Faculté de Médecine Vétérinaire, 3200 rue Sicotte, St-Hyacinthe, Québec, Canada J2S 7C6. E-mail: murphyb{at}medvet.umontreal.ca


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cyclooxygenase (COX) is the first rate-limiting enzyme in the biosynthesis of PGs. There are two isoforms, COX-1, a constitutive enzyme and COX-2, the induced form, products of two different genes. In this study, we report COX-2 complementary DNA cloning, uterine expression, and immunohistochemical localization in the mink uterus during postimplantation gestation. The open reading frame of mink COX-2 contains 1812 nucleotides encoding 604 amino acids. The homologies are 86%, 83%, 83%, 83%, 85%, and 84% in nucleotides and 86%, 87%, 87%, 85%, 86%, and 88% in amino acids with human, mouse, rat, guinea pig, sheep, and rabbit, respectively. All domains associated with biological activity are conserved in the mink. Northern analysis revealed a transcript of 4.2 kb for COX-2 in mink uterus and adrenal. Semiquantitative RT-PCR showed that COX-2 messenger RNA is not present during diapause. The abundance of COX-2 messenger RNA reached its maxima (P < 0.05) on days 3–5 of postimplantation, gradually decreased through day 9, and was not present thereafter. By immunohistochemistry, COX-2 was present in uterine epithelium, stroma, and necks of endometrial glands at sites of implantation. COX-2 expression appears to be induced in the endometrium by the embryo and may play a role in implantation and placentation in the mink.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
OBLIGATE embryonic diapause is a condition in which, during every pregnancy, there is a period of arrest in mitotic activity in the embryo. In a number of mustelid carnivores, including the mink, an obligate delay of implantation of variable duration has been identified (1). In the mink, the length of diapause can be as brief as 6 days (2) or can be extended under experimental conditions to more than 55 days (3). Embryonic diapause in mink is believed to be under maternal control, based on reciprocal transfer of embryos between the mink and the ferret, a related species that does not normally display a delay of implantation (4). Further evidence for maternal control can be found in the capability of embryos in diapause to reinitiate development in vitro when provided with the appropriate culture conditions (5, 6).

Mustelid embryos do not hatch from the zona pellucida-derived glycoprotein coat before implantation, as occurs in other species. Rather, syncytial trophoblastic knobs pierce the zona at several sites on the antimesometrial side of the uterus and adhere focally to the endometrial epithelium (7, 8). The trophoblast intrudes between endometrial epithelial cells, the endometrial epithelium is then eliminated over broad areas, and the trophoblast invades down the necks of the epithelial glands (9). The endometrial glands respond by undergoing hyperplasia and elongation (8). The mature placenta is zonary and epitheliochorial (10).

The role of PG synthesis in embryo implantation was first demonstrated by Lau et al. (11), who blocked implantation with the cyclooxygenase (COX) inhibitor, indomethacin, and overcame the blockade by administration of PGs. Subsequent investigations confirmed a role for PG synthesis in embryo implantation in rodents (12). There is clear evidence that PGs, primarily PGE2, are necessary for increased vascular permeability at the site of implantation (13) and for increased local blood flow (14). PGs are implicated in decidualization of rodent (15) and human (16) stromal cells. Transcripts coding for PG receptors have been found in mouse luminal endometrial epithelium coincident with the time of expected implantation (17). PGs are believed to be involved in adhesion of the ovine trophoblast to the endometrium (18) and in regulation of local immune responses (19). PGs also initiate endometrial plasminogen activator expression in the rat and, therefore, may be involved in the tissue remodeling associated with trophoblast invasion (20, 21). PG regulation of expression of maternal tissue inhibitors of metalloproteinase enzymes has been suggested as a mechanism of limitation of the extent of ovine trophoblast invasion (18, 22, 23).

There is little information on the role of PGs in carnivore implantation. Treatment of ferrets with indomethacin reduced the number and size of implantation sites, but did not alter uterine vascular permeability at the time of implantation (24).

PG synthesis from arachidonic acid is catalyzed by two isoforms of the COX enzyme that are derived from two different genes (reviewed in Ref. 25). The isoform known as COX-1 is widely distributed and appears to be constitutively expressed, whereas COX-2 is regulated by a number of intra- and extracellular stimuli (25). Jacobs et al. (26) showed that COX-2 localizes to uterine stroma in regions of mouse blastocyst attachment. A more complete investigation by Chakraborty et al. (27) showed that COX-1 is present before implantation in the mouse in uterine luminal epithelium and subepithelial stromal cells. COX-2, however, is locally expressed in the uterus in the region surrounding the implanting blastocyst at the time of embryo attachment (day 4) and persists until early on day 5 (27). Coincidence of implantation and COX-2 expression in uterine and/or trophoblastic tissue has been reported in the ovine (18, 22), bovine (28), and human (29) uterus. Transgenic mice bearing a mutation that eliminates expression of the COX-1 gene were capable of reproduction (30). In contrast, knockout of COX-2 had profound negative consequences on reproduction, including interference with the ovulatory process and failure of embryo implantation (30). Further, specific COX-2 inhibitors severely compromise embryo implantation in the mouse (30).

The role of PGs in carnivore embryo implantation has not been clearly established, nor has it been shown whether mustelid carnivores such as the mink possess the COX-2 isoform. Thus, the objectives of this study were 1) to determine whether COX-2 is present in the mink by complementary DNA (cDNA) cloning and 2) to investigate COX-2 gene expression and the patterns of occurrence of COX-1 and COX-2 proteins in the mink uterus during early gestation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and sample collection
Primiparous Standard Dark variety female mink were maintained on a commercial farm (Morrow Fourrures, St. Paul d’Abbotsford, Canada) under approved husbandry conditions. Breeding was performed by exposing the females to males every 2 days until they mated. Females were remated to different males 7–9 days after the first mating according to standard husbandry practice. Matings were confirmed by observation of sperm in vaginal smears. All animal treatment protocols were approved by the Faculté de Médecine Vétérinaire, Comité de Déontologie, in accordance with regulations of the Canadian Council of Animal Care.

To bracket the period of implantation, uteri were collected every 3 days from 10–20 pregnant mink randomly selected from the experimental population, beginning at least 6 days after the final mating and continuing through the periods of embryonic diapause and implantation and into late gestation. Animals were terminated by the injection of euthanol (T-61, Hoechst, Regina, Canada), and uteri were removed by midventral laparatomy. The embryos were judged to be in diapause when they could be readily flushed from the uterus and had a diameter not greater than 1.0 mm (31) and when there was no implantation chamber in the uterus. The expansion or periimplantation phase of gestation was identified by the presence of embryos that were expanded to 1.5–2.0 mm, but were not attached to the endometrium. At this time, the implantation chamber was visible on inspection of the outer surface of the uterus. Implantation was characterized by visible enlargements of the uterine horns and by attachment and invasion of the endometrium by the trophoblast. Postimplantation age was determined by swelling size and by embryonic characteristics, as previously described (3, 32). Uteri from diapause, implantation chambers, swelling sites, and portions of uterus from regions between swelling sites in the uterine horn were collected for RNA and histological analyses. For comparative purposes, adrenal glands were also processed for histological scrutiny.

Samples for total RNA extraction were immediately placed in 4 M guanidinium isothiocyanate (Life Technologies, Burlington, Canada) solution containing 0.12 M ß-mercaptoethanol (Sigma Chemical Co., St. Louis, MO), snap-frozen in liquid nitrogen, and stored at -70 C until total RNA was extracted. For immunohistochemical investigation, pieces of uterus were placed in Bouin’s fixative overnight, then transferred into 70% ethanol and stored at 4 C until being embedded in paraffin. Longitudinal and cross-sections of the uterine horns were prepared using standard histological procedures.

RNA purification
Tissue total RNA was isolated by CsCl (Life Technologies) gradient ultracentrifugation (33). Briefly, tissue samples were homogenized with a PT 3000 Polytron (Brinkmann, Rexdale, Canada) in 4 M guanidinium isothiocyanate solution. The homogenate was then layered onto a 5.7-M CsCl gradient and centrifuged at 174,000 x g using a SW-41 rotor (Beckman, Mississauga, Canada) for 20 h at 21 C. The RNA pellet was dissolved in 360 µl diethylpyrocarbonate (DEPC; Sigma)-treated distilled water and precipitated twice in 0.1 vol 3 M sodium acetate (pH 5.2) and 2 vol absolute ethanol. After the final washing, the pellet was dissolved in DEPC-treated water and stored at -70 C until use. The total RNA concentration was determined by spectrophotometry at 260 nm.

Oligonucleotide primers
Primers used in this study were prepared by Life Technologies. The sequences of the primers were designed from conserved regions of COX-2 from mouse (34), rat (35), human (36), and sheep (37) sequences. The primers for mink ribosomal S26 protein were designed from the sequence in GenBank (accession X79237).

Sense primers were: COX-2-A, 5'ACAGATCTCGAGCGAGGACC [nucleotides (nt) 592–611]; COX-2-B, 5'-CAGTCAAAGACACTCAGGTGG (nt 752–772); COX-2-C, 5'-CAGCAAATCCTTGCTGTTCC (nt 50–69); COX-2-D, 5'-CGCCGCTGCGATGCTC (nt -10 to +6); and mkS26-A, 5'-AGATGACTAAGAGAGAGGAG.

Antisense primers were: COX-2–1, 5'-CTACAGCTCCGTTGAACGTTCCTTTAGTAGGACTG (nt 1815–1781); COX-2–2, 5'-CCGCAGCCATTTCCTTCTCTCCTG (nt 1426–1403); COX-2–3, 5'-ATCGATTACCTGGTATTTC (mink sequence, nt 732–714); and mkS26–1, 5'-CGATACGAACTTCTTAATGG.

Strategy for mink COX-2 cDNA cloning
Mink COX-2 cDNA was cloned by the RT-PCR method, as outlined in Fig. 1Go. The RT reactions were performed using the Superscript II kit (Life Technologies) according to manufacturer’s instructions. A final volume of 20 µl containing 5 µg total RNA from the mink uterine implantation sites, 20 nmol deoxy (d)-NTP (dATP, dCTP, dGTP, and dTTP), 40 U Superscript II Moloney murine leukemia virus reverse transcriptase (Life Technologies), 10 mM dithiothreitol, single strength first strand synthesis buffer, and 20 pmol of the downstream primer COX-2–1 or COX-2–2. PCR amplifications were performed in a Hybaid Omnigene Thermal Cycler (Intersciences, Markham, Canada) for 40 cycles consisting of 94 C for 45 sec, 52 C for 45 sec, 72 C for 1 or 2 min, and 72 C for 10-min extension at the last cycle. PCR reactions were made in a total volume of 100 µl containing 10 µl 10 x PCR buffer [0.5 M Tris (pH 9), 15 mM MgCl2, and 0.2 M NH2SO4], 20 pmol of each sense and antisense primer, 20 nmol dNTP, 5 U Taq DNA polymerase (Pharmacia, Baie D’Urfé, Canada), and 5 µl of RT products.



View larger version (6K):
[in this window]
[in a new window]
 
Figure 1. Cloning strategy for the mink COX-2 cDNA. Cloning was via first strand cDNA generation by RT from uterine total RNA, followed by PCR amplification using the primers described in Materials and Methods. The sense primers are indicated by capital letters, and the right arrowheads, whereas the antisense primers are indicated by numbers and left arrowheads. The broken line represents the coding region of the COX-2 cDNA structure, and overlapping cloned sequences are represented above the composite diagram of the mink COX-2 cDNA.

 
PCR products were size-fractionated by electrophoresis on 1% agarose gels, and fragment sizes were compared with a 1-kb DNA ladder (Life Technologies). Amplicons of the expected size were excised from the gel and purified with Sephaglas Bandpreps kit (Pharmacia). The purified cDNA was ligated into pGEM-T vector using T4 DNA ligase according to the manufacturer’s instructions (Promega, Nepean, Canada), and ligation products were transformed into Escherichia coli JM 109. Plasmid inserts from positive clones were sequenced with the T7 sequencing kit (Pharmacia). To guard against misincorporation of nucleotides by Taq polymerase during PCR amplification, three independent clones were sequenced for each gene fragment, and the consensus sequence was taken.

Northern analysis
In addition to mink uterine samples, ovaries, adrenals, pieces of the cerebral cortex, large intestine, kidney, and skeletal muscle were collected for Northern analysis. Samples of 20 or 40 µg total uterine RNA samples were denatured and separated by formaldehyde-agarose gel electrophoresis and transferred to a nylon membrane. RNA was cross-linked to the membrane by UV irradiation. The blot was prehybridized, hybridized, and washed as described previously (38). A 1063-nt probe (fragment mkCOX-2 B-1) was generated from mink uterine total RNA by RT-PCR with upstream primer COX-2-A and downstream primer COX-2–1. This probe (50 ng) was labeled using the random primed DNA labeling kit (Boehringer Mannheim, Laval, Canada) and was hybridized at 60 C overnight. The blots were rinsed once with 2 x SSC containing 0.1% SDS, followed by two washes at 65 C for 15 min each. The blots were then exposed to Kodak X-5 film (Eastman Kodak, Rochester, NY) at -80 C for 2 weeks. To monitor the total RNA loading, the blot was stripped and rehybridized with human 28S probe (39). Transcript size was determined by comparison with a RNA ladder (Life Technologies), which was subjected to concurrent electrophoresis.

Semiquantitative RT-PCR
COX-2 transcript abundance in the uterus was determined by semiquantitative PCR. The mink ribosomal protein S26 gene PCR fragment (121 nt) was used as a control for RNA loading and for the efficiency of RT. The S26 fragment was subcloned into pGEM-T vector, and its sequence was confirmed. The quantification procedure was standardized as previously described (40, 41) with a modification. Briefly, both downstream primers, COX-2–1 and S26–1, were used in RT with 5 µg total RNA from each sample. RT reactions were performed as described above, and products were diluted to a final volume of 200 µl with DEPC-treated water and stored at -20 C. A negative control was carried out by omission of reverse transcriptase in the RT reaction and in the subsequent PCR assay. All PCR reactions were performed in final volume of 100 µl containing single strength PCR buffer, 1.5 mM MgCl2, 20 nmol dNTPs, 20 nmol of each primer, 5 U Taq polymerase (Pharmacia), and RT products, 20 µl for COX-2 and 2 µl for S26.

A pool of total RNA from early postimplantation uterine samples was used to optimize the conditions of PCR quantification for COX-2 and S26. Primers COX-2-B and COX-2–2 were employed because they bracket several introns of the genomic version of COX-2 in other species. They generate a 675-nt fragment of cDNA; thus, contamination of RT products with genomic DNA would be readily evident by the size of the amplified products. RT products equivalent to 0.25, 0.5, 0.75, 1, 1.25, 2.5, and 5 µg total RNA were amplified using COX-2 primers for 30 cycles in an amplification program consisting of 94 C for 45 sec, 52 C for 45 sec, and 72 C for 1 min followed by an extension amplification step at 72 C for 10 min at the end of the PCR reaction. The amount of 0.5 µg total RNA was on the linear portion of the amplification curve. Similarly, primers S26-A and S26–1 amplified a 121-nt fragment of S26, and 50 ng RNA were on the linear portion of the curve. To determine optimal amplification conditions, RT products were subject to 15–40 PCR cycles. The 30-cycle point for COX-2 and the 25-cycle point for S26 were on the linear portion amplification curves just below the asymptote. These cycle numbers were therefore employed in the subsequent semiquantitative PCR assays, which were carried out in separate reactions as we have previously described (19). For each COX-2 assay sample, 20 µl COX-2 and 10 µl S26 PCR products were combined and subjected to electrophoresis on a 2% agarose gel containing ethidium bromide (Sigma). The densities of the amplified fragments were analyzed by Collage computer software (Photodyne, New Berlin, WI). Three independent RT-PCR assays for each sample were performed, and the results were expressed as a density ratio of COX-2 to the external control, the PCR-amplified S26 DNA fragment.

Immunohistochemistry of COX-2
A Vectastain ABC Kit (Vector Laboratories, Burlington, Canada) was used for immunohistochemistry staining according to the manufacturer’s protocol. Deparaffinized and hydrated sections were immersed in methanol (BDH, Ville St. Laurent, Canada) containing 0.3% hydrogen peroxide (Fisher Scientific, Pittsburgh, PA) for 15 min. All incubations were performed in a humidified chamber to minimize evaporation. After three 5-min washes in PBS, the sections were incubated with 5% normal goat serum at room temperature for 45 min. The excess serum was carefully blotted off, and 200 µl COX-2 (rabbit against human COX-2, PG26, Oxford Biomedical Research, Oxford, MI) antibodies were applied on each slide at a 1:50 dilution in PBS and incubated at 4 C for 18 h. After the primary antibody reaction, slides were washed in PBS (twice, 5 min each time) at room temperature, then the slides were incubated with biotinylated second antibody for 45 min. After two 5-min washes in PBS, a complex of avidin-biotin-peroxidase was applied for 45 min. The positive reaction was then identified by the application of the peroxidase substrate, 3, 3'-diaminobenzidine (Sigma). For comparative purposes, COX-1 staining was performed on separate sections by the same procedure, employing antibodies raised in rabbits against ovine COX-1 at a 1:50 dilution (42, 43). Sections were then washed in distilled water and lightly counterstained with hematoxylin 1 (Fisher Scientific). Control sections were subjected to the same procedure, except that dilute rabbit serum replaced the first antibody.

Statistical analysis
The mean density ratio of the PCR fragments COX-2 to S26 from 3 separate amplifications was taken as an assay value for each sample. Means were then calculated for 6 stages of gestation, diapause, the period of embryo expansion, days 2–4, 6–7, 8–9, and 12–15 after implantation. There were a minimum of 3 and a maximum of 12 different animals represented at each stage of gestation. Where detected (days 2–4, 6–7, and 8–9), COX-2 abundance was compared by one-way ANOVA, followed by individual comparisons by means of Dunnett’s test. P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning and sequence analysis of mink COX-2 cDNA
We cloned the open reading frame of 1812 nt of mink COX-2 cDNA by the RT-PCR method (Fig. 2Go; GenBank accession no. AF047841). The coding region of mink COX-2 cDNA shows high homology with its human counterpart at the nucleotide and amino acid levels (86% and 86%, respectively) (36). Homologies to other species are: guinea pig, 83% and 85% (44); rat, 83% and 87% (35); rabbit, 84% and 88% (45); mouse, 83% and 87% (34); and sheep, 85% and 86% (37), respectively. The ATG translation start site and the surrounding nucleotides are almost entirely conserved relative to other species. The transmembrane domain and other important functional sites, such as those for heme coordination, aspirin acetylation, putative glycosylation, and active site tyrosine, are conserved (Fig. 2Go).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Deduced amino acid sequence of mink COX-2 compared with other known sequences. A period identifies identical amino acids, whereas mismatches are shown with the different one-letter codes. A shift in the sheep sequence to maximize alignment is indicated (•). The potential sites of N-glycosylation are underlined, and the putative membrane spanning domain is marked by double underlines. The heme coordination sites are indicated by an underlined lowercase letter, and the aspirin acetylation site is indicated by an asterisk. G. pig, Guinea pig sequence.

 
Characteristics of COX-2 messenger RNA (mRNA) in the mink
Northern analysis employing 20 µg total RNA demonstrated that the COX-2 probe hybridized with a single transcript of approximately 4.2 kb in the adrenal. There was a suggestion of hybridization in implantation sites, which was confirmed when larger amounts of RNA were employed (below). There was weak hybridization with skeletal muscle, but no signal was detected in brain, intestine, kidney, or liver (Fig. 3AGo). When 40 µg uterine RNA were loaded on the gels, the COX-2 probe hybridized with message from embryo-uterine complexes at implantation sites at early stages of postimplantation (days 2–8; Fig. 3BGo), but not in the uterus of diapause or in the areas of the postimplantation uterus between swellings (data not shown).



View larger version (86K):
[in this window]
[in a new window]
 
Figure 3. A, Detection of COX-2 mRNA in mink tissues by Northern blot employing 20 µg total RNA. B, Northern blot of COX-2 in the uterus through diapause and late postimplantation. An aliquot of 40 µg total RNA was loaded for each sample. After hybridization with the homologous COX-2 probe, blots were hybridized to a human 28S probe. Diapause indicates the uterus of delay before implantation; expansion (day 0) refers to the time when the embryo is reactivated and expanded, but has not yet attached to the endometrium. Days 2, 4, 8, 10–14, and 15–18 represent samples of embryo-uterine complexes. The postimplantation age was determined by swelling size and morphological characteristics of the embryo.

 
Abundance of COX-2 transcripts in the uterus
COX-2 transcripts quantified by RT-PCR were detected only in uterine swellings during early postimplantation gestation. No COX-2 mRNA was detected in uterine samples from the diapause phase of pregnancy, from the periimplantation period when the blastocysts were expanded but not attached, or from the interswelling regions between implanted embryos. Transcripts were more abundant in early implantation (days 2–4) than on days 6–7 postimplantation (P < 0.05; Fig. 4Go). No expression could be detected in uterine swellings or interswelling regions of the uterus taken from days 12–15 postimplantation.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. Illustration of semiquantitative RT-PCR for COX-2 transcripts in the mink uterus during diapause and postimplantation gestation. A, A representative agarose gel demonstrating migration of triplicate RT-PCR products (upper band, 20 µl COX-2; lower band, 10 µl S26). Samples were subjected to the same RT, amplified in separate tubes, and then combined for electrophoretic analysis. The first lane on the left is the 1-kb DNA ladder. B, Mean ± SEM of the dimensionless ratio of COX-2 to S26 amplicons from embryo-uterus complexes of various postimplantation ages in the mink. Day 0 represents the day of embryo expansion before attachment. All means were different from each other at P < 0.05.

 
Immunolocalization of COX proteins
In the uterus taken during diapause, staining for COX-1 protein was found in low intensity in endometrial epithelium and in the bases of the uterine glands adjacent to the myometrium. No COX-2 staining was detected at this time. At the periimplantation stage, when the blastocyst was expanded, and the uterine diameter at the site of imminent implantation was approximately 3.5 mm, staining for COX-1 was restricted to the deep regions of the uterine glands, with minor concentrations present in the subepithelial stroma, and as before, no COX-2 protein localization was detectable. At the time of adhesion and early invasion, or day 2 of the implantation process, there was strong signal for COX-2 in the luminal epithelium (Fig. 5AGo), subepithelial stroma, and necks of the uterine glands at the antimesometrial pole of the uterus. This phase of implantation was characterized by a swelling size with an external diameter of approximately 4.0 mm, by attachment of the trophoblast plaques to the endometrium, and by the presence of minor focal invasion. At this time, COX-2 staining was strongest in the antimesometrial regions and was associated with the region of attachment of the trophoblast. At the adhesion phase, low levels of COX-1 could be detected in gland bases in samples taken from regions of the uterus where no implantation was present, but no COX-2 signal could be found at these sites (data not shown). When the swelling size attained 5.5–6.0 mm (~day 4 postimplantation), the glands were elongated, their cells were hypertrophied, and the trophoblast had eliminated the endometrial epithelium at sites of attachment. There was COX-2 immunoreactivity in the maternal stroma, but none in the trophoblast (Fig. 5BGo). At this time there was a strong COX-2 signal in the necks of the hypertrophied glands, most pronounced in the basal portions of the cells (Fig. 5Go, B–D). No binding of the COX-1 antibody was detected. When the uterine swelling diameter reached 8–9 mm, 7–8 days after implantation, the trophoblast had begun to invade the uterine glands. COX-2 staining was strong in the basal region of the cells, down the length of the extended uterine gland necks (Fig. 5EGo), and had spread to the mesometrial side of the uterus, where invasion does not occur (data not shown). COX-1 was not widely detected in the uterus at any time after implantation. The fundal regions of maternal gland cells in areas between uterine swellings showed some COX-1 activity (Fig. 5FGo), whereas COX-2 did not localize to these sites (Fig. 5GGo). By day 12 postimplantation, when the swelling size attained 10 mm or more, the maternal-fetal labyrinth portion of the placenta was formed. At this time, no COX-1 nor COX-2 could be localized in the endometrium, and there was no detectable binding of the COX-2 antibody to either the maternal or the fetal component of the placenta.



View larger version (138K):
[in this window]
[in a new window]
 
Figure 5. Immunohistochemical localization of COX isoforms in the mink uterus. A, Expression of COX-2 in the uterine epithelium at the site of embryo attachment on day 2 postimplantation. The trophoblast overlying the epithelium is blue-purple; examples of epithelial expression of COX-2 are indicated by arrows. B, On day 4 postimplantation, the trophoblast (T) has eliminated the epithelium at the sites of invasion and COX-2 localized to uterine stroma (arrows) and to uterine gland cells (asterisks). C, COX-2 localization in the basal regions of uterine gland necks on day 4 postimplantation. D, Negative control for localization in C; tissue sections were subjected to the same treatment except dilute rabbit serum replaced the anti-COX-2 antibody. E, Lower power micrograph of the mink uterus showing the extent of COX-2 expression in the necks of elongated uterine glands (arrows) on day 4 postimplantation. F, COX-1 localization in the fundi of uterine glands in the interswelling area on day 4 postimplantation. G, COX-2 antiserum-treated section adjacent to that in F (above), demonstrating the absence of localization of this isoform of the enzyme. The bar on each photo represents 10 µm.

 
Immunohistochemistry demonstrated that COX-2 also localized to the adrenal cortex in mink, in keeping with the distribution of its mRNA by the Northern analysis (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The mink sequence proved to have substantial homology with other known species, in the range of 83–88%. All of the active sites were conserved, including the heme coordination sites, the aspirin acetylation site, the putative transmembrane domain, and glycosylation sites (44, 46). The mink sequence contained a potential signal peptide of 24 amino acids that preceded the amino-terminal, as first shown in the sheep sequence (46). There were three areas of variability with sequences in other species, one in the signal peptide region, a second at nt 1141–1320, and the carboxyl-terminal region, nt 1747–1775. Interspecies variation in signal peptide and carboxyl-terminus regions has previously been noted in comparisons between the sheep and human sequences (46).

PG synthesis is essential to successful embryo implantation in rodents (30). Its involvement in carnivores is indicated by the ability of indomethacin treatment to delay implantation in the ferret (24). This is the first indication of a role for COX in implantation in a species displaying obligate embryonic diapause. RT-PCR analysis demonstrates that COX-2 expression is a transient event that occurs at the time of trophoblast attachment and invasion in the mink, over the first 8–9 days after initiation of implantation. Histochemical findings concur. The first detectable localization was in uterine stroma and glands at sites where the trophoblast had adhered, but had not yet penetrated the endometrial epithelium. The temporal expression of COX-2, i.e. its relation to the early stages of the implantation process, concurs with findings in the mouse, where in situ hybridization and immunohistochemical localization of COX-2 demonstrated its presence at the time of embryo attachment (27). Spatial localization was similar; COX-2 was associated with the presence of the embryo in both species, and it appeared first in the luminal endometrial epithelium and subepithelial stroma. The pronounced localization in the necks of uterine glands in the mink at the time of early attachment did not occur in the mouse, where fewer gland structures were present. Nonetheless, COX-2 was found in endometrial glands from the human uterus as well as in the decidual tissues (29, 47). The COX-2 signal was likewise present later in gestation in the decidual cells at the mesometrial pole of the uterus of the mouse (27). COX-2 was not found in the mink embryo or before implantation. In contrast, COX-2 was present in both the endometrium (22) and the trophoblast (18) before attachment of the ovine embryo.

The essential role of PGs in decidualization in rodents was demonstrated by Yee and Kennedy (15). Recent evidence indicates that COX-2 is implicated in decidualization in mice, as this process is defective in transgenic mice bearing the null mutation for this gene (30). The cellular analog of the rodent decidual cell (48) appears not to exist in the carnivores (10, 49), suggesting an alternate role for PGs in the establishment of the mink conceptus and consequent placental development.

In the uteri of ovariectomized, steroid-treated mice, COX-2 was not inducible by ovarian steroids alone; rather, it required the presence of the blastocyst for its expression (27). In the mink uterus, COX-2 transcripts and protein were detected only at sites of embryo attachment and invasion. In addition, it was associated with the ablation of the endometrial epithelium and with early establishment of the placenta. Together, these findings suggest that there may be a trophoblastic signal that induces COX-2 expression in mink. We have previously shown that mink embryos can escape diapause in vitro in coculture with mink uterine cell lines (5). Recent investigations indicate that the presence of the mink embryo elevates PGE2 accumulation in uterine stromal cell cultures (Moreau, G. M., J. H. Song, L. C. Smith, and B. D. Murphy, unpublished data). Factors that induce COX-2 and PG expression in other tissues include interleukin-1 (50) and epidermal growth factor (51). Little information is available with respect to carnivore implantation. Nonetheless, there is clear evidence for epidermal growth factor receptors in the endometrium of the spotted skunk at the time of implantation (52). Further, a cytokine, leukemia inhibitory factor, is expressed in the mink uterus at the time of blastocyst expansion and during the first 2 days of postimplantation (53). To date there is no evidence to indicate that either of these factors is of trophoblastic origin.

COX-1 in the present study was distributed throughout the uterus and was present in uterine glands and endometrial epithelium before implantation. Its presence at these two sites is consistent with its occurrence in the preimplantation mouse uterus (27). COX-1 was detectable in the basal region of uterine glands in areas between uterine swellings, but not in at the site of implantation and could not be found later in gestation. COX-1 is not essential for implantation in the mouse (30), and its distribution in the mink indicates that it may not be involved in the implantation process in this species.

In summary, we have determined the cDNA sequence of the COX-2 enzyme in a domestic carnivore in which the reproductive cycle is characterized by obligate delayed implantation. This cDNA has high homology with other known species, and the known biologically active domains are conserved. The enzyme is locally expressed at sites of embryo invasion, particularly in the necks of the uterine glands during early implantation. Its coincidence with embryo implantation, decidualization, and placenta formation suggests that locally produced PGs are proximate inducers of these processes.


    Acknowledgments
 
We thank Derek Boerboom and Dr. M. Doré for aid with cDNA cloning and immunohistochemistry, respectively. The invaluable technical assistance of Mira Dobias is gratefully acknowledged.


    Footnotes
 
1 This work was supported by Natural Sciences and Engineering Research Council Grant OGP137013 (to B.D.M.) and Medical Research Council Grant MT-13190 (to J.S.). Back

2 Present address: Centre de Recherche en Agroalimentaire, Agriculture Canada, St-Hyacinthe, Québec, Canada J2S 8E3. Back

Received February 18, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mead RA 1993 Embryonic diapause in vertebrates. J Exp Zool 266:629–641[CrossRef][Medline]
  2. Hansson A 1947 The physiology of reproduction in mink (Mustela vison Schreb) with special reference to delay implantation. Acta Zool 28:1–136
  3. Murphy BD, James DA 1974 The effects of light and sympathetic innervation to the head on nidation in mink. J Exp Zool 187:267–276[CrossRef][Medline]
  4. Chang MC 1968 Reciprocal insemination and egg transfer between ferrets and mink. J Exp Zool 168:49–60[CrossRef][Medline]
  5. Moreau GM, Arslan A, Douglas DA, Song JH, Smith LC, Murphy BD 1995 Development of immortalized endometrial and stromal cell lines from the mink (Mustela vison) uterus and their effects on the survival in vitro of mink blastocysts in obligate diapause. Biol Reprod 53:511–518[Abstract]
  6. Polejaeva IA, Reed WA, Bunch TD, Ellis LC, White KL 1997 Prolactin-induced termination of obligate diapause of mink (Mustela vison) blastocysts in vitro and subsequent establishment of embryonic stem-like cells. J Reprod Fertil 109:229–236[Abstract/Free Full Text]
  7. Enders AC, Schlafke S 1972 Implantation in the ferret: epithelial penetration. Am J Anat 133:291–316[CrossRef][Medline]
  8. Enders AC, Mead RA 1996 Progression of trophoblast into the endometrium during implantation in the Western spotted skunk. Anat Rec 244:297–315[CrossRef][Medline]
  9. Schlafke S, Enders AC 1975 Cellular basis of interaction between trophoblast and uterus at implantation. Biol Reprod 12:41–65[CrossRef][Medline]
  10. Enders AC 1957 Histological observations on the chorio-allantoic placenta of the mink. Anat Rec 127:231–245
  11. Lau IF, Saksena SK, Chang MC 1973 Pregnancy blockade by indomethacin, an inhibitor of prostaglandin synthesis: its reversal by prostaglandins and progesterone in mice. Prostaglandins 4:795–803[CrossRef][Medline]
  12. Kennedy TG 1977 Evidence for a role for prostaglandins in the initiation of blastocyst implantation in the rat. Biol Reprod 16:286–291[Abstract]
  13. Kennedy TG 1980 Prostaglandins and the endometrial vascular permeability changes preceding blastocyst implantation and decidualization. Prog Reprod Biol 7:234–243
  14. Hamilton G, Kennedy TG 1994 Uterine vascular changes after unilateral intrauterine infusion of indomethacin and prostaglandin E2 to rats sensitized for the decidual cell reaction. Biol Reprod 50:757–764[Abstract]
  15. Yee G, Kennedy TG 1988 Stimulatory effects of prostaglandins upon endometrial alkaline phosphatase activity during the decidual cell reaction in the rat. Biol Reprod 38:1129–1136[Abstract]
  16. Han S, Lei ZM, Rao CV 1996 Up-regulation of cyclooxygenase-2 gene expression by chorionic gonadotropin during the differentiation of human endometrial stromal cells into decidua. Endocrinology 137:1791–1797[Abstract]
  17. Lim H, Dey SK 1997 Prostaglandin E2 receptor subtype EP2 gene expression in the mouse uterus coincides with differentiation of the luminal epithelium for implantation. Endocrinology 138:4599–4606[Abstract/Free Full Text]
  18. Charpigny G, Reinaud P, Tamby JP, Creminon C, Guillomot M 1997 Cyclooxygenase-2, unlike cyclooxygenase-1 is highly expressed in ovine embryos during the implantation period. Biol Reprod 57:1032–1040[Abstract]
  19. Emond V, Fortier MA, Murphy BD, Lambert RD 1998 Prostaglandin E2 regulates both interleukin-2 and granulocyte-macrophage colony-stimulating factor gene expression in bovine lymphocytes. Biol Reprod 58:143–151[Abstract/Free Full Text]
  20. Zhang X, Shu MA, Ross HE, Kennedy TG 1996 Regulation of plasminogen activator in rat endometrial stromal cells: the role of prostaglandin E2. Biol Reprod 54:1046–1051[Abstract]
  21. Wang S, Kennedy TG, Zhang X 1996 Presence of urokinase plasminogen activator and plasminogen activator inhibitor-1 messenger ribonucleic acids in rat endometrium during decidualization in vivo. Biol Reprod 55:493–497[Abstract]
  22. Charpigny G, Reinaud P, Tamby JP, Creminon C, Martal J, Maclouf J, Guillomot M 1997 Expression of cyclooxygenase-1 and 2 in ovine endometrium during the estrous cycle and early pregnancy. Endocrinology 138:2163–2171[Abstract/Free Full Text]
  23. Salamonsen L, Nagase H, Woolley DE 1995 Matrix metalloproteinases and their tissue inhibitors at the ovine trophoblast-uterine interface. J Reprod Fertil [Suppl] 49:29–37[Medline]
  24. Mead RA, Bremner S, Murphy BD 1988 Changes in endometrial vascular permeability during the periimplantation period in the ferret (Mustela putorius). J Reprod Fertil 82:293–298[CrossRef][Medline]
  25. Williams CS, DuBois RN 1996 Prostaglandin endoperoxide synthase: why two isoforms? Am J Physiol 270:G393–G400
  26. Jacobs A, Hwang D, Julian J, Carson DD 1994 Regulated expression of prostaglandin endoperoxide synthase-2 by uterine stroma. Endocrinology 135:1807–1815[Abstract]
  27. Chakraborty I, Das SK, Wang J, Dey SK 1996 Developmental expression of the cyclo-oxygenase-1 and cyclo-oxygenase-2 genes in the peri-implantation mouse uterus and their differential regulation by the blastocyst and ovarian steroids. J Mol Endocrinol 16:107–122[Abstract/Free Full Text]
  28. Asselin E, Drolet P, Fortier MA 1997 Cellular mechanisms involved during oxytocin-induced prostaglandin F2{alpha} production in endometrial epithelial cells in vitro: role of cyclooxygenase-2. Endocrinology 138:4798–4805[Abstract/Free Full Text]
  29. Jones RL, Kelly RW, Critchley HOD 1997 Chemokine and cyclooxygenase-2 expression in human endometrium coincides with leukocyte accumulation. Hum Reprod 12:1300–1306
  30. Lim H, Paria BC, Das SK, Dinchuk JE, Langenbach R, Trzaskos JM, Dey SK 1997 Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91:197–208[CrossRef][Medline]
  31. Stoufflet I, Mondain-Monval M, Simon P, Martinet L 1989 Patterns of plasma progesterone, androgen and oestrogen concentrations and in-vitro ovarian steroidogenesis during embryonic diapause and implantation in the mink (Mustela vison). J Reprod Fertil 87:209–221[Abstract/Free Full Text]
  32. Song JH, Carrière P, Léveillé R, Douglas DA, Murphy BD 1995 Ultrasonographic analysis of gestation in mink (Mustela vison). Theriogenology 43:585–594
  33. Chirgwin J, Przybia AE, MacDonald KJ, Utter WJ 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294–5299[CrossRef][Medline]
  34. Kujubu D, Fletcher BS, Varnum BC, Lim RW, Herschman HR 1991 TIS10, a phorbol ester tumor promoter-inducible mRNA from Swiss 3T3 cells, encodes a novel prostaglandin synthase/cyclooxygenase homologue. J Biol Chem 266:12866–12872[Abstract/Free Full Text]
  35. Feng L, Sun W, Xia Y, Tang WW, Chanmugam P, Soyoola E, Wilson CB, Hwang D 1993 Cloning two isoforms of rat cyclooxygenase: differential regulation of their expression. Arch Biochem Biophys 30:361–368
  36. Appleby S, Ristimaki A, Neilson K, Narko K, Hla T 1994 Structure of the human cyclo-oxygenase-2 gene. Biochem J 302:723–727
  37. Zhang V, O’Sullivan M, Hussain H, Roswit WT, Holtzman MJ 1996 Molecular cloning, functional expression, and selective regulation of ovine prostaglandin H synthase-2. Biochem Biophys Res Commun 227:499–506[CrossRef][Medline]
  38. Douglas DA, Song JH, Houde A, Cooke GM, Murphy BD 1997 The luteal and placental characteristics of carnivore gestation: expression of genes for luteotrophic receptors and steroidogenic enzymes. J Reprod Fertil [Suppl] 51:153–166[Medline]
  39. Gonzalez I, Gorski JI, Campen TJ, Dorney DJ, Erickson JM, Sylvester JE, Schmickel RD 1985 Variation among human 28S ribosomal RNA genes. Proc Natl Acad Sci USA 82:7666–7670[Abstract/Free Full Text]
  40. de Kossodo S, Grau GE 1993 Profiles of cytokine production in relation with susceptibility to cerebral malaria. J Immunol 151:4811–4820[Abstract]
  41. Bernstein RM, Schluter SF, Lake DF, Marchalonis JJ 1994 Evolutionary conservation and molecular cloning of the recombinase activating gene 1. Biochem Biophys Res Commun 205:687–692[CrossRef][Medline]
  42. Sirois J, Richards JS 1992 Purification and characterization of a novel, distinct isoform of prostaglandin endoperoxide synthase induced by human chorionic gonadotropin in granulosa cells of rat preovulatory follicles. J Biol Chem 267:6382–6388[Abstract/Free Full Text]
  43. Sirois J 1994 Induction of prostaglandin endoperoxide synthase-2 by human chorionic gonadotropin in bovine preovulatory follicles in vivo. Endocrinology 135:841–848[Abstract]
  44. Bracken KE, Elger W, Jantke I, Nanninga A, Gellersen B 1997 Cloning of guinea pig cyclooxygenase-2 and 15-hydroxyprostaglandin dehydrogenase complementary deoxyribonucleic acids: steroid-modulated gene expression correlates to prostaglandin F2{alpha} secretion in cultured endometrial cells. Endocrinology 138:237–247[Abstract/Free Full Text]
  45. Guan Y, Chang M, Cho W, Zhang Y, Redha R, Davis L, Chang S, DuBois RN, Hao CM, Breyer M 1997 Cloning, expression, and regulation of rabbit cyclooxygenase-2 in renal medullary interstitial cells. Am J Physiol 173:F18–F26
  46. Smith WL, Marnett LJ 1991 Prostaglandin endoperoxide synthase: structure and catalysis. Biochim Biophys Acta 1083:1–17[Medline]
  47. O’Neill GP, Ford-Hutchinson AW 1993 Expression of mRNA for cyclooxygenase-1 and cyclooxygenase-2 in human tissues. FEBS Lett 330:156–160[Medline]
  48. Abrahamsohn PA, Zorn TM 1993 Implantation and decidualization in rodents. J Exp Zool 266:603–628[CrossRef][Medline]
  49. Leiser R, Koob B 1993 Development and characteristics of placentation in a carnivore, the domestic cat. J Exp Zool 266:642–656[CrossRef][Medline]
  50. Narko K, Ritvos O, Ristimaki A 1997 Induction of cyclooxygenase-2 and prostaglandin F2{alpha} receptor expression by interleukin-1ß in cultured human granulosa-luteal cells. Endocrinology 138:3638–3644[Abstract/Free Full Text]
  51. Paria BC, Tsukamura, Dey SK 1991 Epidermal growth factor-specific protein tyrosine phosphorylation in preimplantation embryo development. Biol Reprod 45:711–718[Abstract]
  52. Paria BC, Das SK, Mead RA, Dey SK 1994 Expression of epidermal growth factor in the preimplantation uterus and blastocyst of the Western spotted skunk. Biol Reprod 51:205–213[Abstract]
  53. Song JH, Houde A, Murphy BD Cloning of leukemia inhibitory factor (LIF) and its expression in the uterus during embryonic diapause and implantation in the mink (Mustela vison). Mol Reprod Dev, in press



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
J. A Desmarais, F. L Lopes, H. Zhang, S. K Das, and B. D Murphy
The Peroxisome Proliferator-Activated Receptor Gamma Regulates Trophoblast Cell Differentiation in Mink (Mustela vison)
Biol Reprod, November 1, 2007; 77(5): 829 - 839.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. L. Lopes, J. Desmarais, S. Ledoux, N. Y. Gevry, P. Lefevre, and B. D. Murphy
Transcriptional Regulation of Uterine Vascular Endothelial Growth Factor during Early Gestation in a Carnivore Model, Mustela vison
J. Biol. Chem., August 25, 2006; 281(34): 24602 - 24611.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. K. Dey, H. Lim, S. K. Das, J. Reese, B. C. Paria, T. Daikoku, and H. Wang
Molecular Cues to Implantation
Endocr. Rev., June 1, 2004; 25(3): 341 - 373.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
T. Sun, S.-J. Li, H.-L. Diao, C.-B. Teng, H.-B. Wang, and Z.-M. Yang
Cyclooxygenases and prostaglandin E synthases in the endometrium of the rhesus monkey during the menstrual cycle
Reproduction, April 1, 2004; 127(4): 465 - 473.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
F. L. Lopes, J. Desmarais, N. Y. Gevry, S. Ledoux, and B. D. Murphy
Expression of Vascular Endothelial Growth Factor Isoforms and Receptors Flt-1 and KDR During the Peri-Implantation Period in the Mink, Mustela vison
Biol Reprod, May 1, 2003; 68(5): 1926 - 1933.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
S. Lajoie, J. Sirois, and M. Dore
Induction of Cyclo-oxygenase-2 Expression in Naturally Occurring Gastric Ulcers
J. Histochem. Cytochem., July 1, 2002; 50(7): 923 - 934.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. Liu, M. Antaya, A. K. Goff, D. Boerboom, D. W. Silversides, J. G. Lussier, and J. Sirois
Molecular Characterization of Bovine Prostaglandin G/H Synthase-2 and Regulation in Uterine Stromal Cells
Biol Reprod, March 1, 2001; 64(3): 983 - 991.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Kirschenbaum, D. R. Liotta, S. Yao, X.-H. Liu, A. P. Klausner, P. Unger, E. Shapiro, I. Leav, and A. C. Levine
Immunohistochemical Localization of Cyclooxygenase-1 and Cyclooxygenase-2 in the Human Fetal and Adult Male Reproductive Tracts
J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3436 - 3441.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
H. Lim, R. A. Gupta, W.-g. Ma, B. C. Paria, D. E. Moller, J. D. Morrow, R. N. DuBois, J. M. Trzaskos, and S. K. Dey
Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARdelta
Genes & Dev., June 15, 1999; 13(12): 1561 - 1574.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
H. Lim, L. Ma, W.-g. Ma, R. L. Maas, and S. K. Dey
Hoxa-10 Regulates Uterine Stromal Cell Responsiveness to Progesterone during Implantation and Decidualization in the Mouse
Mol. Endocrinol., June 1, 1999; 13(6): 1005 - 1017.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
S.K. Das, J. Wang, S.K. Dey, and R.A. Mead
Spatiotemporal Expression of Cyclooxygenase 1 and Cyclooxygenase 2 during Delayed Implantation and the Periimplantation Period in the Western Spotted Skunk
Biol Reprod, April 1, 1999; 60(4): 893 - 899.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, J. H.
Right arrow Articles by Murphy, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, J. H.
Right arrow Articles by Murphy, B. D.


HOME HELP FEEDBACK SUBSCRIPTIONS