| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Centre de Recherche en Reproduction Animale, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, Québec, Canada J2S 7C6
Address all correspondence and requests for reprints to: Dr. Bruce D. Murphy, Centre de Recherche en Reproduction Animale, Faculté de Médecine Vétérinaire, 3200 rue Sicotte, St-Hyacinthe, Québec, Canada J2S 7C6. E-mail: murphyb{at}medvet.umontreal.ca
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mustelid embryos do not hatch from the zona pellucida-derived glycoprotein coat before implantation, as occurs in other species. Rather, syncytial trophoblastic knobs pierce the zona at several sites on the antimesometrial side of the uterus and adhere focally to the endometrial epithelium (7, 8). The trophoblast intrudes between endometrial epithelial cells, the endometrial epithelium is then eliminated over broad areas, and the trophoblast invades down the necks of the epithelial glands (9). The endometrial glands respond by undergoing hyperplasia and elongation (8). The mature placenta is zonary and epitheliochorial (10).
The role of PG synthesis in embryo implantation was first demonstrated by Lau et al. (11), who blocked implantation with the cyclooxygenase (COX) inhibitor, indomethacin, and overcame the blockade by administration of PGs. Subsequent investigations confirmed a role for PG synthesis in embryo implantation in rodents (12). There is clear evidence that PGs, primarily PGE2, are necessary for increased vascular permeability at the site of implantation (13) and for increased local blood flow (14). PGs are implicated in decidualization of rodent (15) and human (16) stromal cells. Transcripts coding for PG receptors have been found in mouse luminal endometrial epithelium coincident with the time of expected implantation (17). PGs are believed to be involved in adhesion of the ovine trophoblast to the endometrium (18) and in regulation of local immune responses (19). PGs also initiate endometrial plasminogen activator expression in the rat and, therefore, may be involved in the tissue remodeling associated with trophoblast invasion (20, 21). PG regulation of expression of maternal tissue inhibitors of metalloproteinase enzymes has been suggested as a mechanism of limitation of the extent of ovine trophoblast invasion (18, 22, 23).
There is little information on the role of PGs in carnivore implantation. Treatment of ferrets with indomethacin reduced the number and size of implantation sites, but did not alter uterine vascular permeability at the time of implantation (24).
PG synthesis from arachidonic acid is catalyzed by two isoforms of the COX enzyme that are derived from two different genes (reviewed in Ref. 25). The isoform known as COX-1 is widely distributed and appears to be constitutively expressed, whereas COX-2 is regulated by a number of intra- and extracellular stimuli (25). Jacobs et al. (26) showed that COX-2 localizes to uterine stroma in regions of mouse blastocyst attachment. A more complete investigation by Chakraborty et al. (27) showed that COX-1 is present before implantation in the mouse in uterine luminal epithelium and subepithelial stromal cells. COX-2, however, is locally expressed in the uterus in the region surrounding the implanting blastocyst at the time of embryo attachment (day 4) and persists until early on day 5 (27). Coincidence of implantation and COX-2 expression in uterine and/or trophoblastic tissue has been reported in the ovine (18, 22), bovine (28), and human (29) uterus. Transgenic mice bearing a mutation that eliminates expression of the COX-1 gene were capable of reproduction (30). In contrast, knockout of COX-2 had profound negative consequences on reproduction, including interference with the ovulatory process and failure of embryo implantation (30). Further, specific COX-2 inhibitors severely compromise embryo implantation in the mouse (30).
The role of PGs in carnivore embryo implantation has not been clearly established, nor has it been shown whether mustelid carnivores such as the mink possess the COX-2 isoform. Thus, the objectives of this study were 1) to determine whether COX-2 is present in the mink by complementary DNA (cDNA) cloning and 2) to investigate COX-2 gene expression and the patterns of occurrence of COX-1 and COX-2 proteins in the mink uterus during early gestation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To bracket the period of implantation, uteri were collected every 3 days from 10–20 pregnant mink randomly selected from the experimental population, beginning at least 6 days after the final mating and continuing through the periods of embryonic diapause and implantation and into late gestation. Animals were terminated by the injection of euthanol (T-61, Hoechst, Regina, Canada), and uteri were removed by midventral laparatomy. The embryos were judged to be in diapause when they could be readily flushed from the uterus and had a diameter not greater than 1.0 mm (31) and when there was no implantation chamber in the uterus. The expansion or periimplantation phase of gestation was identified by the presence of embryos that were expanded to 1.5–2.0 mm, but were not attached to the endometrium. At this time, the implantation chamber was visible on inspection of the outer surface of the uterus. Implantation was characterized by visible enlargements of the uterine horns and by attachment and invasion of the endometrium by the trophoblast. Postimplantation age was determined by swelling size and by embryonic characteristics, as previously described (3, 32). Uteri from diapause, implantation chambers, swelling sites, and portions of uterus from regions between swelling sites in the uterine horn were collected for RNA and histological analyses. For comparative purposes, adrenal glands were also processed for histological scrutiny.
Samples for total RNA extraction were immediately placed in 4 M guanidinium isothiocyanate (Life Technologies, Burlington, Canada) solution containing 0.12 M ß-mercaptoethanol (Sigma Chemical Co., St. Louis, MO), snap-frozen in liquid nitrogen, and stored at -70 C until total RNA was extracted. For immunohistochemical investigation, pieces of uterus were placed in Bouin’s fixative overnight, then transferred into 70% ethanol and stored at 4 C until being embedded in paraffin. Longitudinal and cross-sections of the uterine horns were prepared using standard histological procedures.
RNA purification
Tissue total RNA was isolated by CsCl (Life Technologies)
gradient ultracentrifugation (33). Briefly, tissue samples were
homogenized with a PT 3000 Polytron (Brinkmann, Rexdale, Canada) in 4
M guanidinium isothiocyanate solution. The homogenate was
then layered onto a 5.7-M CsCl gradient and centrifuged at
174,000 x g using a SW-41 rotor (Beckman, Mississauga,
Canada) for 20 h at 21 C. The RNA pellet was dissolved in 360 µl
diethylpyrocarbonate (DEPC; Sigma)-treated distilled water and
precipitated twice in 0.1 vol 3 M sodium acetate (pH 5.2)
and 2 vol absolute ethanol. After the final washing, the pellet was
dissolved in DEPC-treated water and stored at -70 C until use. The
total RNA concentration was determined by spectrophotometry at 260
nm.
Oligonucleotide primers
Primers used in this study were prepared by Life Technologies.
The sequences of the primers were designed from conserved regions of
COX-2 from mouse (34), rat (35), human (36), and sheep (37) sequences.
The primers for mink ribosomal S26 protein were designed from the
sequence in GenBank (accession X79237).
Sense primers were: COX-2-A, 5'ACAGATCTCGAGCGAGGACC [nucleotides (nt) 592–611]; COX-2-B, 5'-CAGTCAAAGACACTCAGGTGG (nt 752–772); COX-2-C, 5'-CAGCAAATCCTTGCTGTTCC (nt 50–69); COX-2-D, 5'-CGCCGCTGCGATGCTC (nt -10 to +6); and mkS26-A, 5'-AGATGACTAAGAGAGAGGAG.
Antisense primers were: COX-2–1, 5'-CTACAGCTCCGTTGAACGTTCCTTTAGTAGGACTG (nt 1815–1781); COX-2–2, 5'-CCGCAGCCATTTCCTTCTCTCCTG (nt 1426–1403); COX-2–3, 5'-ATCGATTACCTGGTATTTC (mink sequence, nt 732–714); and mkS26–1, 5'-CGATACGAACTTCTTAATGG.
Strategy for mink COX-2 cDNA cloning
Mink COX-2 cDNA was cloned by the RT-PCR method, as outlined in
Fig. 1
. The RT reactions were performed
using the Superscript II kit (Life Technologies) according to
manufacturer’s instructions. A final volume of 20 µl containing 5
µg total RNA from the mink uterine implantation sites, 20 nmol deoxy
(d)-NTP (dATP, dCTP, dGTP, and dTTP), 40 U Superscript II Moloney
murine leukemia virus reverse transcriptase (Life Technologies), 10
mM dithiothreitol, single strength first strand synthesis
buffer, and 20 pmol of the downstream primer COX-2–1 or COX-2–2. PCR
amplifications were performed in a Hybaid Omnigene Thermal Cycler
(Intersciences, Markham, Canada) for 40 cycles consisting of 94 C for
45 sec, 52 C for 45 sec, 72 C for 1 or 2 min, and 72 C for 10-min
extension at the last cycle. PCR reactions were made in a total volume
of 100 µl containing 10 µl 10 x PCR buffer [0.5
M Tris (pH 9), 15 mM MgCl2, and 0.2
M NH2SO4], 20 pmol of each sense
and antisense primer, 20 nmol dNTP, 5 U Taq DNA polymerase
(Pharmacia, Baie D’Urfé, Canada), and 5 µl of RT products.
|
Northern analysis
In addition to mink uterine samples, ovaries, adrenals, pieces
of the cerebral cortex, large intestine, kidney, and skeletal muscle
were collected for Northern analysis. Samples of 20 or 40 µg total
uterine RNA samples were denatured and separated by
formaldehyde-agarose gel electrophoresis and transferred to a nylon
membrane. RNA was cross-linked to the membrane by UV irradiation. The
blot was prehybridized, hybridized, and washed as described previously
(38). A 1063-nt probe (fragment mkCOX-2 B-1) was generated from mink
uterine total RNA by RT-PCR with upstream primer COX-2-A and downstream
primer COX-2–1. This probe (50 ng) was labeled using the random primed
DNA labeling kit (Boehringer Mannheim, Laval, Canada) and was
hybridized at 60 C overnight. The blots were rinsed once with 2 x
SSC containing 0.1% SDS, followed by two washes at 65 C for 15 min
each. The blots were then exposed to Kodak X-5 film (Eastman Kodak,
Rochester, NY) at -80 C for 2 weeks. To monitor the total RNA loading,
the blot was stripped and rehybridized with human 28S probe (39).
Transcript size was determined by comparison with a RNA ladder (Life
Technologies), which was subjected to concurrent electrophoresis.
Semiquantitative RT-PCR
COX-2 transcript abundance in the uterus was determined by
semiquantitative PCR. The mink ribosomal protein S26 gene PCR fragment
(121 nt) was used as a control for RNA loading and for the efficiency
of RT. The S26 fragment was subcloned into pGEM-T vector, and its
sequence was confirmed. The quantification procedure was standardized
as previously described (40, 41) with a modification. Briefly, both
downstream primers, COX-2–1 and S26–1, were used in RT with 5 µg
total RNA from each sample. RT reactions were performed as described
above, and products were diluted to a final volume of 200 µl with
DEPC-treated water and stored at -20 C. A negative control was carried
out by omission of reverse transcriptase in the RT reaction and in the
subsequent PCR assay. All PCR reactions were performed in final volume
of 100 µl containing single strength PCR buffer, 1.5 mM
MgCl2, 20 nmol dNTPs, 20 nmol of each primer, 5 U
Taq polymerase (Pharmacia), and RT products, 20 µl for
COX-2 and 2 µl for S26.
A pool of total RNA from early postimplantation uterine samples was used to optimize the conditions of PCR quantification for COX-2 and S26. Primers COX-2-B and COX-2–2 were employed because they bracket several introns of the genomic version of COX-2 in other species. They generate a 675-nt fragment of cDNA; thus, contamination of RT products with genomic DNA would be readily evident by the size of the amplified products. RT products equivalent to 0.25, 0.5, 0.75, 1, 1.25, 2.5, and 5 µg total RNA were amplified using COX-2 primers for 30 cycles in an amplification program consisting of 94 C for 45 sec, 52 C for 45 sec, and 72 C for 1 min followed by an extension amplification step at 72 C for 10 min at the end of the PCR reaction. The amount of 0.5 µg total RNA was on the linear portion of the amplification curve. Similarly, primers S26-A and S26–1 amplified a 121-nt fragment of S26, and 50 ng RNA were on the linear portion of the curve. To determine optimal amplification conditions, RT products were subject to 15–40 PCR cycles. The 30-cycle point for COX-2 and the 25-cycle point for S26 were on the linear portion amplification curves just below the asymptote. These cycle numbers were therefore employed in the subsequent semiquantitative PCR assays, which were carried out in separate reactions as we have previously described (19). For each COX-2 assay sample, 20 µl COX-2 and 10 µl S26 PCR products were combined and subjected to electrophoresis on a 2% agarose gel containing ethidium bromide (Sigma). The densities of the amplified fragments were analyzed by Collage computer software (Photodyne, New Berlin, WI). Three independent RT-PCR assays for each sample were performed, and the results were expressed as a density ratio of COX-2 to the external control, the PCR-amplified S26 DNA fragment.
Immunohistochemistry of COX-2
A Vectastain ABC Kit (Vector Laboratories, Burlington, Canada)
was used for immunohistochemistry staining according to the
manufacturer’s protocol. Deparaffinized and hydrated sections were
immersed in methanol (BDH, Ville St. Laurent, Canada) containing 0.3%
hydrogen peroxide (Fisher Scientific, Pittsburgh, PA) for 15 min. All
incubations were performed in a humidified chamber to minimize
evaporation. After three 5-min washes in PBS, the sections were
incubated with 5% normal goat serum at room temperature for 45 min.
The excess serum was carefully blotted off, and 200 µl COX-2 (rabbit
against human COX-2, PG26, Oxford Biomedical Research, Oxford, MI)
antibodies were applied on each slide at a 1:50 dilution in PBS and
incubated at 4 C for 18 h. After the primary antibody reaction,
slides were washed in PBS (twice, 5 min each time) at room temperature,
then the slides were incubated with biotinylated second antibody for 45
min. After two 5-min washes in PBS, a complex of
avidin-biotin-peroxidase was applied for 45 min. The positive reaction
was then identified by the application of the peroxidase substrate, 3,
3'-diaminobenzidine (Sigma). For comparative purposes, COX-1 staining
was performed on separate sections by the same procedure, employing
antibodies raised in rabbits against ovine COX-1 at a 1:50 dilution
(42, 43). Sections were then washed in distilled water and lightly
counterstained with hematoxylin 1 (Fisher Scientific). Control sections
were subjected to the same procedure, except that dilute rabbit serum
replaced the first antibody.
Statistical analysis
The mean density ratio of the PCR fragments COX-2 to S26 from 3
separate amplifications was taken as an assay value for each sample.
Means were then calculated for 6 stages of gestation, diapause, the
period of embryo expansion, days 2–4, 6–7, 8–9, and 12–15 after
implantation. There were a minimum of 3 and a maximum of 12 different
animals represented at each stage of gestation. Where detected (days
2–4, 6–7, and 8–9), COX-2 abundance was compared by one-way ANOVA,
followed by individual comparisons by means of Dunnett’s test.
P < 0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
; GenBank
accession no. AF047841). The coding region of mink COX-2 cDNA shows
high homology with its human counterpart at the nucleotide and amino
acid levels (86% and 86%, respectively) (36). Homologies to other
species are: guinea pig, 83% and 85% (44); rat, 83% and 87% (35);
rabbit, 84% and 88% (45); mouse, 83% and 87% (34); and sheep, 85%
and 86% (37), respectively. The ATG translation start site and the
surrounding nucleotides are almost entirely conserved relative to other
species. The transmembrane domain and other important functional sites,
such as those for heme coordination, aspirin acetylation, putative
glycosylation, and active site tyrosine, are conserved (Fig. 2).
|
). When 40 µg uterine RNA
were loaded on the gels, the COX-2 probe hybridized with message from
embryo-uterine complexes at implantation sites at early stages of
postimplantation (days 2–8; Fig. 3B), but not in the uterus of
diapause or in the areas of the postimplantation uterus between
swellings (data not shown).
|
). No expression could be
detected in uterine swellings or interswelling regions of the uterus
taken from days 12–15 postimplantation.
|
), subepithelial stroma, and necks of
the uterine glands at the antimesometrial pole of the uterus. This
phase of implantation was characterized by a swelling size with an
external diameter of approximately 4.0 mm, by attachment of the
trophoblast plaques to the endometrium, and by the presence of minor
focal invasion. At this time, COX-2 staining was strongest in the
antimesometrial regions and was associated with the region of
attachment of the trophoblast. At the adhesion phase, low levels of
COX-1 could be detected in gland bases in samples taken from regions of
the uterus where no implantation was present, but no COX-2 signal could
be found at these sites (data not shown). When the swelling size
attained 5.5–6.0 mm (
day 4 postimplantation), the glands were
elongated, their cells were hypertrophied, and the trophoblast had
eliminated the endometrial epithelium at sites of attachment. There was
COX-2 immunoreactivity in the maternal stroma, but none in the
trophoblast (Fig. 5B). At this time there was a strong COX-2 signal in
the necks of the hypertrophied glands, most pronounced in the basal
portions of the cells (Fig. 5, B–D). No binding of the COX-1 antibody
was detected. When the uterine swelling diameter reached 8–9 mm, 7–8
days after implantation, the trophoblast had begun to invade the
uterine glands. COX-2 staining was strong in the basal region of the
cells, down the length of the extended uterine gland necks (Fig. 5E),
and had spread to the mesometrial side of the uterus, where invasion
does not occur (data not shown). COX-1 was not widely detected in the
uterus at any time after implantation. The fundal regions of maternal
gland cells in areas between uterine swellings showed some COX-1
activity (Fig. 5F), whereas COX-2 did not localize to these sites (Fig. 5G). By day 12 postimplantation, when the swelling size attained 10 mm
or more, the maternal-fetal labyrinth portion of the placenta was
formed. At this time, no COX-1 nor COX-2 could be localized in the
endometrium, and there was no detectable binding of the COX-2 antibody
to either the maternal or the fetal component of the placenta.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PG synthesis is essential to successful embryo implantation in rodents (30). Its involvement in carnivores is indicated by the ability of indomethacin treatment to delay implantation in the ferret (24). This is the first indication of a role for COX in implantation in a species displaying obligate embryonic diapause. RT-PCR analysis demonstrates that COX-2 expression is a transient event that occurs at the time of trophoblast attachment and invasion in the mink, over the first 8–9 days after initiation of implantation. Histochemical findings concur. The first detectable localization was in uterine stroma and glands at sites where the trophoblast had adhered, but had not yet penetrated the endometrial epithelium. The temporal expression of COX-2, i.e. its relation to the early stages of the implantation process, concurs with findings in the mouse, where in situ hybridization and immunohistochemical localization of COX-2 demonstrated its presence at the time of embryo attachment (27). Spatial localization was similar; COX-2 was associated with the presence of the embryo in both species, and it appeared first in the luminal endometrial epithelium and subepithelial stroma. The pronounced localization in the necks of uterine glands in the mink at the time of early attachment did not occur in the mouse, where fewer gland structures were present. Nonetheless, COX-2 was found in endometrial glands from the human uterus as well as in the decidual tissues (29, 47). The COX-2 signal was likewise present later in gestation in the decidual cells at the mesometrial pole of the uterus of the mouse (27). COX-2 was not found in the mink embryo or before implantation. In contrast, COX-2 was present in both the endometrium (22) and the trophoblast (18) before attachment of the ovine embryo.
The essential role of PGs in decidualization in rodents was demonstrated by Yee and Kennedy (15). Recent evidence indicates that COX-2 is implicated in decidualization in mice, as this process is defective in transgenic mice bearing the null mutation for this gene (30). The cellular analog of the rodent decidual cell (48) appears not to exist in the carnivores (10, 49), suggesting an alternate role for PGs in the establishment of the mink conceptus and consequent placental development.
In the uteri of ovariectomized, steroid-treated mice, COX-2 was not inducible by ovarian steroids alone; rather, it required the presence of the blastocyst for its expression (27). In the mink uterus, COX-2 transcripts and protein were detected only at sites of embryo attachment and invasion. In addition, it was associated with the ablation of the endometrial epithelium and with early establishment of the placenta. Together, these findings suggest that there may be a trophoblastic signal that induces COX-2 expression in mink. We have previously shown that mink embryos can escape diapause in vitro in coculture with mink uterine cell lines (5). Recent investigations indicate that the presence of the mink embryo elevates PGE2 accumulation in uterine stromal cell cultures (Moreau, G. M., J. H. Song, L. C. Smith, and B. D. Murphy, unpublished data). Factors that induce COX-2 and PG expression in other tissues include interleukin-1 (50) and epidermal growth factor (51). Little information is available with respect to carnivore implantation. Nonetheless, there is clear evidence for epidermal growth factor receptors in the endometrium of the spotted skunk at the time of implantation (52). Further, a cytokine, leukemia inhibitory factor, is expressed in the mink uterus at the time of blastocyst expansion and during the first 2 days of postimplantation (53). To date there is no evidence to indicate that either of these factors is of trophoblastic origin.
COX-1 in the present study was distributed throughout the uterus and was present in uterine glands and endometrial epithelium before implantation. Its presence at these two sites is consistent with its occurrence in the preimplantation mouse uterus (27). COX-1 was detectable in the basal region of uterine glands in areas between uterine swellings, but not in at the site of implantation and could not be found later in gestation. COX-1 is not essential for implantation in the mouse (30), and its distribution in the mink indicates that it may not be involved in the implantation process in this species.
In summary, we have determined the cDNA sequence of the COX-2 enzyme in a domestic carnivore in which the reproductive cycle is characterized by obligate delayed implantation. This cDNA has high homology with other known species, and the known biologically active domains are conserved. The enzyme is locally expressed at sites of embryo invasion, particularly in the necks of the uterine glands during early implantation. Its coincidence with embryo implantation, decidualization, and placenta formation suggests that locally produced PGs are proximate inducers of these processes.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Present address: Centre de Recherche en Agroalimentaire, Agriculture
Canada, St-Hyacinthe, Québec, Canada J2S 8E3.
Received February 18, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production in endometrial epithelial cells in vitro: role of
cyclooxygenase-2. Endocrinology 138:4798–4805 secretion in cultured endometrial cells.
Endocrinology 138:237–247 receptor
expression by interleukin-1ß in cultured human granulosa-luteal
cells. Endocrinology 138:3638–3644This article has been cited by other articles:
 |
|
 |
|
  J. A Desmarais, F. L Lopes, H. Zhang, S. K Das, and B. D Murphy The Peroxisome Proliferator-Activated Receptor Gamma Regulates Trophoblast Cell Differentiation in Mink (Mustela vison) Biol Reprod, November 1, 2007; 77(5): 829 - 839. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. L. Lopes, J. Desmarais, S. Ledoux, N. Y. Gevry, P. Lefevre, and B. D. Murphy Transcriptional Regulation of Uterine Vascular Endothelial Growth Factor during Early Gestation in a Carnivore Model, Mustela vison J. Biol. Chem., August 25, 2006; 281(34): 24602 - 24611. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. K. Dey, H. Lim, S. K. Das, J. Reese, B. C. Paria, T. Daikoku, and H. Wang Molecular Cues to Implantation Endocr. Rev., June 1, 2004; 25(3): 341 - 373. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Sun, S.-J. Li, H.-L. Diao, C.-B. Teng, H.-B. Wang, and Z.-M. Yang Cyclooxygenases and prostaglandin E synthases in the endometrium of the rhesus monkey during the menstrual cycle Reproduction, April 1, 2004; 127(4): 465 - 473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. L. Lopes, J. Desmarais, N. Y. Gevry, S. Ledoux, and B. D. Murphy Expression of Vascular Endothelial Growth Factor Isoforms and Receptors Flt-1 and KDR During the Peri-Implantation Period in the Mink, Mustela vison Biol Reprod, May 1, 2003; 68(5): 1926 - 1933. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lajoie, J. Sirois, and M. Dore Induction of Cyclo-oxygenase-2 Expression in Naturally Occurring Gastric Ulcers J. Histochem. Cytochem., July 1, 2002; 50(7): 923 - 934. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Liu, M. Antaya, A. K. Goff, D. Boerboom, D. W. Silversides, J. G. Lussier, and J. Sirois Molecular Characterization of Bovine Prostaglandin G/H Synthase-2 and Regulation in Uterine Stromal Cells Biol Reprod, March 1, 2001; 64(3): 983 - 991. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. Kirschenbaum, D. R. Liotta, S. Yao, X.-H. Liu, A. P. Klausner, P. Unger, E. Shapiro, I. Leav, and A. C. Levine Immunohistochemical Localization of Cyclooxygenase-1 and Cyclooxygenase-2 in the Human Fetal and Adult Male Reproductive Tracts J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3436 - 3441. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. Lim, R. A. Gupta, W.-g. Ma, B. C. Paria, D. E. Moller, J. D. Morrow, R. N. DuBois, J. M. Trzaskos, and S. K. Dey Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARdelta Genes & Dev., June 15, 1999; 13(12): 1561 - 1574. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. Lim, L. Ma, W.-g. Ma, R. L. Maas, and S. K. Dey Hoxa-10 Regulates Uterine Stromal Cell Responsiveness to Progesterone during Implantation and Decidualization in the Mouse Mol. Endocrinol., June 1, 1999; 13(6): 1005 - 1017. [Abstract] [Full Text]
|
|
|
|
|
|
S.K. Das, J. Wang, S.K. Dey, and R.A. Mead Spatiotemporal Expression of Cyclooxygenase 1 and Cyclooxygenase 2 during Delayed Implantation and the Periimplantation Period in the Western Spotted Skunk Biol Reprod, April 1, 1999; 60(4): 893 - 899. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS |
