| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Zoology, University of Oxford, Oxford, United Kingdom OX1 3PS
Address all correspondence and requests for reprints to: Dr. Silvio Zaina, Wallenberg Laboratory, Malmö General Hospital, University of Lund, 205 02 Malmö, Sweden. E-mail: silvio.zaina{at}medforsk.mas.lu.se
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The IGF2R is an approximately 250-kDa membrane protein that binds at least two classes of ligands: insulin-like growth factor II (IGF-II), a fetal growth and survival factor, and proteins containing mannose-6-phosphate (M6P) residues (7, 8). IGF-II is internalized and degraded after binding to IGF2R, whereas a different protein, the type 1 IGF receptor (IGF1R), mediates most biological responses to both IGF-II and the related IGF-I peptide (8, 9). Lysosomal enzymes and the latent form of transforming growth factor-ß1 (TGFß1) are among the M6P-containing ligands of this receptor (10, 11, 12). Newly synthesized lysosomal enzymes acquire M6P residues and are transported from the Golgi to the endosomes by intracellular IGF2R. Free receptors either recycle back to the Golgi to repeat the process or travel to the plasma membrane, where they mediate endocytosis and lysosomal targeting of extracellular lysosomal enzymes. Binding to the IGF2R is probably required for activation of the latent form of TGFß1, a growth inhibitor for many cell types (13, 14). The biological significance of additional ligands of this receptor is not clear; they include retinoic acid and the M6P containing proliferin, herpes simplex glycoprotein D, and thyroglobulin (11, 15).
A soluble form of the IGF2R (sIGF2R) is produced by proteolytic cleavage of the membrane receptor by deletion of the transmembrane and cytoplasmic domains and is present in serum, urine, and amniotic fluid of rodents and humans (16, 17, 18, 19). It is not known whether the sIGF2R is an inert degradation product or a biologically active compound. sIGF2R binds 3% and 25% of the total circulating IGF-II in rat and FBS, respectively, including functionally uncharacterized multiple high mol wt IGF-II forms (20, 21). In cell culture, sIGF2R inhibits IGF-II- and epidermal growth factor (EGF)-induced DNA synthesis (22).
In the present work we studied the effects of sIGF2R on organ size in vivo. To this end, we generated transgenic mice expressing a mouse Igf2r complementary DNA (cDNA) that has been mutated to encode a soluble receptor. To preserve the physiological levels of early fetal IGFs and to distinguish local from systemic effects, the transgene was driven by the bovine homolog of the keratin-10 promoter, which is active from late fetal life onward (23). We obtained evidence that the soluble form of IGF2R reduces organ size in vivo.
| Materials and Methods |
|---|
|
|
|---|
Transgene construction and generation of transgenic mice
The mouse Igf2r cDNA was made to encode a soluble
protein by deletion of the transmembrane domain (TM) sequence
(nucleotides 72107278 of cDNA) (24). The sequence 5' to the TM was
amplified using the forward primer CCTGTGGACGGGCCCCCTATAGATATTGGC
(nucleotides 54525481 of cDNA) containing an ApaI site and
the reverse primer
ACTACTACTACTAGTCTGACTCCGCTCTGAGAGTCCTTT-ATACTCTGGCCC containing the
cDNA sequence between nucleotides 71747209 and a 5'-tail with a
SpeI site.
The sequence 3' to the TM was amplified by the forward primer
AGTACTACTACTAGTAAGAAGGAGAGAAGGGAAACTGTGATA-AACAAGCTGACC
containing the cDNA sequence between nucleotides 72797327 and a
5'-tail with a SpeI site, and the reverse primer
ATTTAGGTGACACTATAGAACC corresponding to a sequence of the SP6 promoter
of pSP73. PCR condition were in both cases 94 C for 1 min, 61 C for 6
min, and 72 C for 10 min (28 cycles). The two PCR products were ligated
together after digestion with SpeI, digested with
ApaI/EcoRV, and used to replace cDNA sequences
between these two latter restriction sites to produce the s
IGF2R
mutant cDNA in pSP73 (pSP73s
IGF2R). In the mutant cDNA the
TM-encoding sequence is replaced by a 6-bp sequence encoding an
in-frame SerThr. These two amino acids do not create any known
phosphorylation consensus sequence; therefore, we assume that the
pattern of phosphorylation of the transgenic protein and that of the
endogenous sIGF2R are not different. The HindIII site in
pSP73s
IGF2R was suppressed by an adaptor insertion (no. 1103, New
England Biolabs, Beverley, MA). The 8983-bp
XhoI/NheI digestion product containing the
s
IGF2R cDNA was inserted between the XhoI and
XbaI sites in a pcDNAI/Amp (Invitrogen, San Diego, CA)
version in which the EcoNI site in position 4130 was
replaced by a HindIII site by linker insertion (New England
Biolabs no. 1022). The XhoI/NheI cDNA fragment
did not include the last 278 bp of exon 48, containing the endogenous
polyadenylase [poly(A)] signal. The pcDNAK10p:s
IGF2R plasmid was
obtained by inserting a 4.5-kb SalI/XhoI fragment
containing the keratin-10 promoter (K10p) (22) in the XhoI
site of pcDNAs
IGF2R. The K10p:s
Igf2r transgene (Fig. 1A
) was injected into pronuclei as a
13.5-kb HindIII fragment containing a 3.5-kb region of
K10p, the s
Igf2r cDNA (8.9 kb), the simian
virus 40 intron/poly(A) cassette provided by pcDNAI/Amp, and 338 bp of
plasmid sequence. Transgenic mice were obtained by standard techniques
(25). The injected eggs were from crosses of
F1(C57Bl/6 x CBA) mice.
|
Genomic DNA was prepared from tail blood using the Isocode Stix method
(Schleicher and Schuell, Keene, NH) according to the manufacturers
instructions or from tail tissue (26). Genotyping was performed by PCR
using the following primers, amplifying a region containing the TM
sequence: ACGAGACCGCTGACTGCCAGTACC (forward) corresponding to
nucleotides 70887111 of s
IGF2R cDNA, and
AGCCATTCTGTCTCATTCTCATCTGTCTCC (reverse) corresponding to nucelotides
73157344. The conditions used were 94 C for 3 min, 60 C for 2 min,
and 72 C for 2 min (35 cycles). The transgene produced a unique 256-bp
fragment (Fig. 1A
).
Transgene expression was analyzed by RT-PCR. cDNA was transcribed from
1 µg total RNA (Reverse Transcription System, Promega, Madison, WI)
and amplified with the same primers and conditions as those used for
genotyping. Transgenic and endogenous RNA produce 256- and 319-bp
fragments, respectively (Fig. 1A
). Lines were scored for transgenic
expression by comparing the intensities of the transgenic bands by eye
and using the endogenous product as an internal control. Experiments
routinely included controls in which reverse transcriptase was
omitted.
Animal procedures and organ analysis
Analysis of organ weights was performed in 90-day-old
heterozygotes. Live weight was recorded, then anesthetized mice were
bled by decapitation and dissected, and the total wet weight of organs
was measured after removal of fat and mesenteries. The contents of the
alimentary canal were removed by gentle scraping in PBS, followed by
blotting on tissue paper. Organs were always dissected in the same
order to normalize wet weight loss due to evaporation. Each organ was
cut into two or three parts, and the parts were weighed. This made it
possible to calculate the total organ dry weight, water content, DNA,
and detergent-soluble protein and collagen content after assaying
different parts.
For dry weight measurement, tissue fragments were dried at 65 C for 6 days. For the determination of collagen content, hydroxyproline was measured by a microtiter plate assay based on the method by Berg (27). Tissue fragments (20100 mg) were hydrolyzed in 6 M HCl at 110 C for 2024 h. Lysates were diluted in 0.25 M citric acid, 0.88 M sodium acetate, and 0.85 M NaOH, pH 6. Thirty microliters of sample or hydroxyproline standard (025 µg/ml) were added to 50 µl 11.7 g/liter chloramine-T and incubated at room temperature for 5 min, followed by the addition of 50 µl 27% (vol/vol) perchloric acid and an additional 5-min incubation. One hundred and twenty-five microliters of a 5% (wt/vol) solution of p-dimethylaminobenzaldehyde in propanol were added, and development was carried out by quickly bringing the samples to 70 C, followed by a 10- to 20-min incubation. Absorbance was measured at 540 nm. Collagen content was calculated by multiplying the hydroxyproline content by 10 (28). Collagen contents ranged from 0.52% of tissue wet weight (28). Detergent-soluble protein was measured by the Coomassie blue method (Bradford reagent, Sigma) after tissue homogenization in 20 mM Tris (pH 7.5), 10 mM EDTA, 0.1% Tween 20, and 0.15 M NaCl. DNA was measured in the same extract using the Hoechst 33258 fluorochrome (Sigma) (29), after the addition of NaCl to a 2-M final concentration and brief sonication. For all measured parameters, relative values (e.g. per mg wet wt) were first obtained by dividing the value obtained for a given tissue part by the wet weight of that tissue part. This relative value was then multiplied by the total organ wet weight to obtain the total value (e.g. for the whole organ). Total water content was calculated by subtracting the total dry weight from the total wet weight. Total water content was divided by the total dry weight (milligrams of water per mg dry matter) or by the total DNA content (milligrams of water per mg DNA) to obtain the corresponding relative values.
To estimate the effect of the transgene on the volume occupied by different tissues, a study was made of the colon after it had been flushed out with PBS. Whole colons from sex- and litter-matched, 2- to 3-month-old transgenics and wild-type mice were pinned out to a length of about 8 cm, fixed in Bouins, dehydrated, and cut transversely into 4 equal lengths, and 120 6-µm sections were taken from the cranial end. The area occupied by the crypts and the smooth muscle with the connective tissue was measured with the Image v1.49 program in 48 sections in each piece after staining with hematoxylin and eosin (60160 µm between each measured section). The objective was a x1.6 lens with the image on the screen at 7.7 pixels/100 µm on the section. An average of 16 frames was taken, and the image was sharpened before measuring the area of the lumen, the area bounded by the periphery of the crypt epithelium, and the area bounded by the outside of the colon. Subtraction of these figures gave areas occupied by crypt epithelium and the muscle plus the connective tissue.
All comparisons were made using t test between pairs of mice matched for litter, age, sex, and body weight.
For serum preparation, blood was allowed to clot at 4 C for 1 h and centrifuged. EDTA-plasma was prepared by collecting blood in potassium-EDTA-coated tubes (Sarstedt, Leicester, UK) and centrifugation. Serum and plasma were stored at -40 C.
Adsorption with M6P-agarose and IGF-II binding assay
The adsorption and binding assays were performed according to
previously described protocols (17, 18) with minor modifications. All
steps were carried out at 4 C. To dissociate receptor-ligand complexes,
50 µl serum were acidified with 450 µl citrate buffer [12
mM citrate/phosphate (pH 5), 0.15 M NaCl, and
protease inhibitors] for 10 min. Samples were neutralized with 1.5 ml
HEPES buffer [50 mM HEPES (pH 7.4), 0.15 M
NaCl, 0.05% Triton, 5 mM ß-glycerophosphate, and
protease inhibitors]. The buffer was exchanged by three washes with 2
ml HEPES buffer in Centricon 100 tubes (Amicon, Beverly, MA).
Samples (
100 µl) were added to approximately 8 mg M6P-agarose
beads previously washed twice with 0.5 ml HEPES buffer. After gentle
rolling for 2 h in the presence or absence of 5 mM
M6P, the beads were washed twice in HEPES buffer and resuspended in 0.2
ml Krebs-Ringer phosphate buffer with 1% (wt/vol) BSA, containing 4
nM [125I]IGF-II with or without 400
nM unlabeled IGF-II. Binding was carried out at 4 C for
16 h, followed by cross-linking with 0.125 mM
disuccinimidyl suberate in ice for 1 h. Samples were boiled in
nonreducing Laemmli buffer, followed by electrophoresis in a 6%
SDS-PAGE gel and autoradiography. Alternatively, after washes in HEPES
buffer, the beads were resuspended in nonreducing Laemmli buffer and
electrophoresed under the same conditions, and proteins were visualized
by silver staining. To quantify the relative amounts of transgenic and
endogenous protein, silver-stained gels or autoradiography films were
scanned, and band densities were determined.
Determination of circulating growth factors
All growth factors were quantified in heterologous assays using
the corresponding human peptide as standard.
For serum IGF-I and IGF-II determination, IGF-binding proteins were
removed by acid-ethanol cryoprecipitation (30). IGF-I was determined by
RIA (Amersham, Aylesbury, UK) with the charcoal separation method
according to the manufacturers instructions. The circulating level in
control mice corresponded to 131 ng/ml human IGF-I. Absolute values
were in the range of published data (23, 31, 32). IGF-II was determined
by RIA using an antihuman IGF-II antiserum (Gropep) at the dilution
recommended by the manufacturer. All reagents were in RIA buffer [30
mM Na phosphate (pH 7.4), 10 mM EDTA, 0.05%
Tween-20, 0.2% BSA, 0.2 g/liter protamine sulfate, and 0.25 g/liter
sodium azide]. Each tube contained 0.1 ml of antiserum, standards, or
unknowns and about 20,000 cpm [125I]IGF-II tracer. The
antiserum was preincubated with standard/unknown at room temperature
for 30 min before the addition of tracer, followed by binding at 4 C
for 1624 h. Bound IGF-II was separated by fractional precipitation
using polyethylene glycol (PEG); 0.4 ml 25% PEG was added to each
sample, followed by vortexing and incubation at 4 C for 15 min. Samples
were centrifuged at 5000 x g for 30 min, the
supernatant was aspirated, and the pellet was washed with 1 ml 15%
PEG, followed by vortexing and centrifugation. The precipitate was
counted in a
-counter. IGF-II levels in controls were equivalent to
23.2 ng/ml human IGF-II. This value is within the range of published
levels for serum IGF-II (2, 3, 23). Intraassay variation was 11%,
interassay variation was 12%, and recovery was greater than 90%.
EGF and TGFß1 levels were measured in plasma and serum, respectively, by immunoassays (R&D Systems, Minneapolis, MN) according to the manufacturers instructions. The values for latent TGFß1 were obtained by subtraction of active (samples not acidified) from total (after acidification) TGFß1 values. Circulating levels in controls were equivalent to 13.7 ng/ml total human TGFß1 or 4.6 pg/ml human EGF. These absolute levels were consistent with published data for EGF and TGFß1 (13, 33).
Lysosomal enzyme assays
Fluorometric assays for lysosomal enzymes in serum and tissues
were performed as described previously (34), the exception that 0.1
M sodium citrate was used as a buffer for
ß-hexosaminidase.
| Results |
|---|
|
|
|---|
Igf2r contained a mouse
Igf2r cDNA deleted in the transmembrane domain sequence
(s
Igf2r) placed under the control of the keratin-10
promoter. Eight of 102 mice analyzed at 46 weeks were transgenic
after microinjection of K10p:s
Igf2r, and lines were
established from 7 founders. All studies were conducted on the
transgene heterozygotes during the first 23 generations of
progressive breeding from a mixed C57BL/6 and CBA strain background
onto a 129J/Sv background. Transgenic mice from all of the lines
appeared normal and were fertile. Transgene expression was studied in
the skin of 2- to 3-week-old progeny of the founders by RT-PCR, and 6
lines were found to express transgene RNA.
A detailed developmental analysis was carried out in the line
expressing at the highest levels (Kipps; Table 1
). In the whole fetus, expression of the
transgene was detectable on embryonic day 12.5 (E12.5) and was strong
on E16.5 (Table 1
). No expression was detected in the placenta or yolk
sac from E15.5 onward (the earliest stage studied). Individual tissues
were analyzed 21 and 90 days after birth (Fig. 1B
and Table 1
). At both
ages, the highest levels of transgene RNA were detected in the skin and
stomach. Analysis of the fore and hind stomach at 90 days revealed that
transgenic expression was restricted to the fore stomach. Lower levels
of expression were detected in the small intestine, cecum, and colon.
In the uterus, transgene RNA was undetectable at 21 days and was
present in virgins at relatively low levels from at least 70 days
onward. Expression was also detected in the spleen, pancreas and
nonlactating mammary gland. Liver, kidney, heart, and fat (fat pad
corresponding to the fourth mammary gland taken from males) were
all negative. Other nonexpressing organs were the brain, salivary
gland, testis, and total blood cells.
|
Organ and body size
To analyze the effects of s
IGF2R on organ and body sizes, the
wet weights of some expressing (skin, alimentary canal, and uterus) and
nonexpressing organs (liver, kidneys, and heart) were measured at 90
days in the line expressing at the highest level (Kipps) and
in the next highest expressing line (Krishna). In both
lines, the wet weight of the alimentary canal was generally lower than
the control value (Table 2
). The extent
of the decrease in wet weight ranged from 920%. The skin, although
expressing s
IGF2R at high levels, did not show any significant
diminution in wet weight. The wet weight of the uterus of virgins was
30% less in Kipps and was unaffected in Krishna.
Among nonexpressing organs, only liver (9%) and heart (4%) showed a
modest, but significant, decrease in wet weight in the Kipps
line. In a third line (Keith), which expressed at relatively
low levels, the decrease in wet weight was limited to the stomach
(21.1% decrease; P < 0.05; nine pairs analyzed). A
fourth line (Kali) did not express any detectable transgene
RNA and did not show any decrease in organ wet weight (data not
shown).
|
IGF-IIR does not substantially
alter the body fat content.
To understand the effects of s
IGF2R on organ size, total dry weight,
DNA, and soluble protein and water contents were measured in selected
expressing and nonexpressing organs. The dry weights of the stomach and
colon were decreased in both lines by 2030% compared with control
values (Table 2
), whereas no significant change was detectable in
either DNA or soluble protein content. The water content per unit dry
weight was not significantly changed in any of the organs examined
(Table 2
). Consistent with the effect of the transgene on DNA levels,
the water content per unit DNA was significantly lower in the stomach
and colon of both Kipps and Krishna lines (Table 2
). In an initial attempt to investigate the nature of the decrease in
dry weight, total collagen was measured and was slightly (810%) less
represented in the stomach, small intestine, and colon in the
Kipps line compared with control values (Table 2
).
Circulating growth factors
The systemic levels of growth factors that are known to interact
with the IGF2R were measured. IGF-II measured in serum at 10 days was
significantly elevated in both Kipps and Krishna
lines by 58% and 77%, respectively (Table 3
). In a third line expressing the
transgene at relatively low levels and showing a weaker phenotype
(Keith), the average value of serum IGF-II was higher than
the control value (33.2 ± 6.5 ng/ml; n = 8), but the
increase was not statistically significant. Serum IGF-I levels were
unchanged in both Kipps and Krishna lines (Table 3
).
|
Lysosomal enzymes in serum and tissues
The activities of the acidic hydrolases arylsulfatase, ß-
glucuronidase, ß-galactosidase, and ß-hexosaminidase were
measured in serum and tissues to determine whether s
IGF2R levels
affect lysosomal enzymes trafficking (1, 35, 36). Enzyme serum levels
were not significantly different in transgenics and controls (Table 4
). In the organs
examined, the activities of the four hydrolases did not follow any
pattern that could be related to genotype or transgene expression
(stomach, colon, and kidneys). The only exception was the colon of the
Kipps line, in which the specific activities of
arylsulfatase, ß-glucuronidase, and ß-hexosaminidase were
significantly lower than control values (36%, 26%, and 50%
reductions, respectively; Tale 4).
|
| Discussion |
|---|
|
|
|---|
Transgene expression
The K10 promoter gave high expression of the
s
Igf2r cDNA in the skin, alimentary canal, and uterus.
This pattern of expression had been observed previously when the same
promoter was used to drive transcription of IGF-II (23). In addition,
we detected transgene RNA in the spleen, pancreas, and nonlactating
virgin mammary gland, although at relatively low levels. The detection
of transgene expression in the latter tissue cannot be a result of
contamination from the underlying skin tissue, because in males, the
fat pad corresponding to the fourth mammary gland is negative
for transgene expression, and the male pad is contaminated with a
relatively larger amount of body wall connective tissue.
The transgenic polypeptide is a soluble protein detectable in serum,
and it displays both IGF-II- and M6P-binding activities, thus
resembling the endogenous sIGF2R. The only structural difference
between the s
IGF2R and the endogenous sIGF2R is the presence of the
intracellular domain in our transgenic protein. In the transmembrane
form of IGF2R, the intracellular domain is involved in endocytosis and
lysosomal targeting (37, 38). A soluble secreted form of the receptor
is not likely to be involved in either of these functions if it is
rapidly secreted. Therefore, we assume that the biological effects of
s
IGF2R and the endogenous sIGF2R are comparable. The presence of a
minor band migrating below the 205-kDa marker is consistent with the
presence of minor forms of sIGF2R previously reported in serum
(17).
sIGF2R and organ size
This report provides the first evidence that sIGF2R affects organ
size in vivo. The reduction in wet weight is mainly local
and affects the alimentary canal and the uterus (Kipps
line), but not the skin, despite the relatively high level of transgene
expression in this tissue. This suggests that none of the endogenous
growth factors modulated by s
IGF2R is essential for skin development
and growth or, alternatively, that a compensatory mechanism preserving
skin homeostasis counteracts most effects of s
IGF2R.
Reduction of organ size is not an unexpected response to s
IGF2R, as
one consequence of Igf2r gene disruption in mice is
augmented fetal growth (1, 2, 3). This is consistent with the idea that
IGF2R acts as a sink for IGF-II and participates in the activation
TGFß1, a growth inhibitor for many cell types (12, 39). Furthermore,
sIGF2R inhibits IGF-II-induced DNA synthesis in cell culture (22).
Basis of decreased organ weight
In K10p:s
Igf2r transgenics, the decrease in total
organ wet weight is associated with a significant decrease in dry
weight, whereas DNA content is not significantly affected. Assuming
that the soluble receptor does not alter cell number, it must act by
reducing dry matter and water content. The dry matter changes occur
without significant changes in detergent soluble material, and it
follows that detergent-insoluble material must account for the
alteration in dry matter. This includes the extracellular matrix and/or
other insoluble structures, such as the cytoskeleton. The decrease in
collagen content observed in the Kipps line is consistent
with this view, although it only accounts for only 7.9% and 2% of the
loss of dry weight in the stomach and colon, respectively (data not
shown). The components of the IGF system are known to regulate the
composition and amount of extracellular matrix, and IGF2R has been
implicated in proteoglycan turnover (7, 40). Both IGF-I and IGF-II can
stimulate extracellular matrix synthesis in cell culture (41, 42, 43, 44), as
does TGFß (14, 45). It is possible that the decrease in dry weight in
organs expressing s
IGF2R is caused by inhibition of extracellular
matrix deposition through local IGF-II sequestration and/or enhanced
matrix degradation associated with failure to recycle hydrolytic
enzymes.
In mice lacking IGF2R, plasma IGF-II levels are raised, and the tissues
are edematous, with a high wet/dry weight ratio in some cases (1, 2, 3).
It might be expected that the wet/dry weight ratio would be altered in
the s
IGF2R mice. However, the wet and dry weights were reduced
proportionately in both transgenic lines. These observations suggest
that s
IGF2R does not change the amount of intercellular or trapped
extracellular fluid and that the reduced water content may be secondary
to a decrease in dry matter.
The loss of wet and dry weights from the transgenic organs was not obvious in tissue sections. However, when transgenic and wild-type colons were fixed to the same length, transverse sections showed differences in the areas occupied by the two major tissues after hematoxylin and eosin staining. In two comparisons, the transgenics had 8% and 13% less total tissue area, with the area occupied by smooth muscle and connective tissue dropping by 22% and 15%, respectively, and the crypt epithelium decreasing by 3% and 12%, respectively (data not shown). It was also clear in two other pairs of colons that the transgenic colon had a reduced mucopolysaccaride content after staining with alcian blue. Taken with the drop of collagen content, these observations suggest that a major part of the wet weight loss in the colon is due to reduced water trapped in the mucopolysaccaride of the lumen and crypts and that a major part of the dry weight loss is due to reduced detergent-insoluble material that makes up the smooth muscle cytoskeleton and surrounding extracellular matrix.
None of the other organs was examined in similar detail, and further quantitative work is required to identify the histological changes in each. However, we note that smooth muscle is abundant in the rest of the alimentary canal and the uterus, and that a reduced mass of smooth muscle could partly account for the reduction in weight of these organs when the bioavailability of IGF-II is lowered, as in this study, and for the increased mass of these organs and cardiac muscle when IGF-II levels are abnormally high (1, 2, 3, 23). The sizes of most of these organs are also increased when IGF-I is locally expressed in smooth muscle (46).
Our data suggest that neither cell size nor cell number is
significantly altered by s
IGF2R. The wet weight and dry weight
decrease together without similar changes in cell size, as monitored by
soluble protein, or cell number, as indicated by DNA content.
Circulating growth factor levels
The elevated s
IGF2R level increases the levels of both IGF-II
and the latent, but not the active mature, form of TGFß1 in serum.
One possibility is that s
IGF2R competes with the membrane form of
the receptor for binding IGF-II and latent TGFß1, forcing the
displacement of these two ligands from the cell surface into the serum.
In this case the two ligands could originate from both organs that
express and those that do not express the transgene. A second
possibility is that s
IGF2R drags both of the newly synthesized
ligand molecules along the secretory pathway inside the cell and
consequently increases their efflux into the serum. The latter model
requires the organs expressing the transgene to be the source of the
excess IGF-II and latent TGFß1 in transgenic serum. As cleavage of
the transmembrane IGF2R to produce sIGF2R is accomplished inside the
cell (47), both mechanisms might also occur in normal mice.
The overall negative effects of s
IGF2R on organ size suggest that
the elevated levels of serum IGF-II probably reflect local
sequestration and enhanced turnover of this growth factor, possibly by
renal clearance. The latter mechanism is consistent with the presence
of sIGF2R in the urine of normal mice (17).
The mean levels of circulating IGF-II and TGFß1 are higher in the Krishna line than in Kipps. This difference is statistically significant only in the case of the latent form of TGFß1. The reason for the apparent discrepancy between relative transgene messenger RNA or protein expression levels and circulating TGFß1 levels is unknown.
The observation that plasma EGF levels are decreased in
K10p:s
Igf2r transgenics suggests that the soluble
receptor can have two actions on EGF: first, a reduction of circulating
levels, and second, an inhibitory effect on biological responses to EGF
(22). At present, the mechanism by which the soluble IGF2R modulates
systemic EGF levels is not known.
The multiple effects of s
IGF2R on circulating growth factors raises
the possibility that the phenotype observed in these transgenics may be
the combined result of neutralized growth inducers (IGF-II and EGF?)
and increased local availability of yet unidentified growth
inhibitors. Evidence in favor of a combinatorial mechanism comes from
mice that are transgenic for s
IGF2R and carry a disrupted paternal
Igf2 allele. In these mice, the phenotype cannot be
explained solely by interactions between IGF-II and s
IGF2R (Zaina,
S., and S. Squire, unpublished).
Mutant soluble receptor expression has been shown to modulate the
activity of endogenous ligands in a variety of different biological
systems. Examples are receptors for fibroblast growth factors,
transforming growth factor-ß (TGFß type II receptor), vascular
endothelial growth factor, tumor necrosis factor (TNF), erythropoietin,
and interleukin-5 (48, 49, 50, 51, 52, 53). These results suggest that soluble receptor
fragments may be universal regulators of the ligand-binding activity
and signal transduction of membrane-bound receptor counterparts.
Interestingly, elevated levels of the TNF soluble receptor produced an
increase in the serum TNF levels reminiscent of the increase in IGF-II
and TGFß1 circulating levels observed in the s
IGF2R transgenics
(54).
Lysosomal enzyme activity
The modulation of the activities of the four lysosomal hydrolases
examined does not seem to represent a general mechanism for organ size
regulation in the s
IGF2R transgenics, because the patterns of enzyme
activities in the stomach and colon are dissimilar. The similarity of
enzyme serum levels in transgenics and controls suggests that the
enzyme tissue levels are changed in few, if any, organs that contribute
to enzyme plasma levels by s
IGF2R. The exception is
ß-hexosaminidase serum levels in Kipps, where the colon
also had a significantly high enzyme activity. We cannot rule out the
possibility that s
IGF2R changes the activities of other hydrolases
that influence growth. Interestingly, the patterns of
ß-glucuronidase, ß-hexosaminidase, and ß-galactosidase changes in
transgenic colon are similar to those found for the intracellular
levels of the same enzymes in cultured Igf2rko embryonic
fibroblasts. In both situations, the first two hydrolases were
substantially lower in mutant than in wild-type animals, and
ß-galactosidase was only marginally affected (1). This suggests a
tissue-specific role of s
IGF2R in competing with the membrane IGF2R
for enzyme binding and/or in altering the secretion/uptake rate.
Functions of the endogenous soluble IGF2R
The results of our study suggest that the high levels of
endogenous sIGF2R in fetal and newborn sera may function to reduce
organ size in the normal mouse by regulating the levels of active
IGF-II and possibly EGF and TGFß1. In the adult animal, the
endogenous sIGF2R may also have important regulatory functions, as high
serum levels of soluble receptor can be detected after hepatectomy
(47). Furthermore, circulating sIGF2R levels are relatively high in
adult humans (19).
The conclusions of the present work are based on the current knowledge of the biology of IGF2R, but more work is necessary to understand the mechanism of action of the receptor in vivo.
Received January 29, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. B. Corcoran, T. Bachar Raveh, M. T. Barakat, E. Y. Lee, and M. P. Scott Insulin-like Growth Factor 2 Is Required for Progression to Advanced Medulloblastoma in patched1 Heterozygous Mice Cancer Res., November 1, 2008; 68(21): 8788 - 8795. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Harper, J. L. Burns, E. J. Foulstone, M. Pignatelli, S. Zaina, and A. B. Hassan Soluble IGF2 Receptor Rescues ApcMin/+ Intestinal Adenoma Progression Induced by Igf2 Loss of Imprinting Cancer Res., February 15, 2006; 66(4): 1940 - 1948. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. V. O. Hansen, N. A. Hammer, J. Nielsen, M. Madsen, C. Dalbaeck, U. M. Wewer, J. Christiansen, and F. C. Nielsen Dwarfism and Impaired Gut Development in Insulin-Like Growth Factor II mRNA-Binding Protein 1-Deficient Mice Mol. Cell. Biol., May 15, 2004; 24(10): 4448 - 4464. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zaina, L. Pettersson, A. B. Thomsen, C.-M. Chai, Z. Qi, J. Thyberg, and J. Nilsson Shortened Life Span, Bradycardia, and Hypotension in Mice with Targeted Expression of an Igf2 Transgene in Smooth Muscle Cells Endocrinology, June 1, 2003; 144(6): 2695 - 2703. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Hassan Keys to the Hidden Treasures of the Mannose 6-Phosphate/Insulin-Like Growth Factor 2 Receptor Am. J. Pathol., January 1, 2003; 162(1): 3 - 6. [Full Text] [PDF] |
||||
![]() |
A Wutz, H. Theussl, J Dausman, R Jaenisch, D. Barlow, and E. Wagner Non-imprinted Igf2r expression decreases growth and rescues the Tme mutation in mice Development, January 5, 2001; 128(10): 1881 - 1887. [Abstract] [PDF] |
||||
![]() |
K. Ong, J. Kratzsch, W. Kiess, M. Costello, C. Scott, and D. Dunger Size at Birth and Cord Blood Levels of Insulin, Insulin-Like Growth Factor I (IGF-I), IGF-II, IGF-Binding Protein-1 (IGFBP-1), IGFBP-3, and the Soluble IGF-II/Mannose-6-Phosphate Receptor in Term Human Infants J. Clin. Endocrinol. Metab., November 1, 2000; 85(11): 4266 - 4269. [Abstract] [Full Text] |
||||
![]() |
J. C. Byrd, G. R. Devi, A. T. De Souza, R. L. Jirtle, and R. G. MacDonald Disruption of Ligand Binding to the Insulin-like Growth Factor II/Mannose 6-Phosphate Receptor by Cancer-associated Missense Mutations J. Biol. Chem., August 20, 1999; 274(34): 24408 - 24416. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Poretsky, N. A. Cataldo, Z. Rosenwaks, and L. C. Giudice The Insulin-Related Ovarian Regulatory System in Health and Disease Endocr. Rev., August 1, 1999; 20(4): 535 - 582. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.L. Gardner, S. Squire, S. Zaina, S. Hills, and C.F. Graham Insulin-Like Growth Factor-2 Regulation of Conceptus Composition: Effects of the Trophectoderm and Inner Cell Mass Genotypes in the Mouse Biol Reprod, January 1, 1999; 60(1): 190 - 195. [Abstract] [Full Text] |
||||
![]() |
J. Linnell, G. Groeger, and A. B. Hassan Real Time Kinetics of Insulin-like Growth Factor II (IGF-II) Interaction with the IGF-II/Mannose 6-Phosphate Receptor. THE EFFECTS OF DOMAIN 13 AND pH J. Biol. Chem., June 22, 2001; 276(26): 23986 - 23991. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |