help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, X.
Right arrow Articles by Conn, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, X.
Right arrow Articles by Conn, P. M.
Endocrinology Vol. 139, No. 9 3896-3902
Copyright © 1998 by The Endocrine Society


ARTICLES

Transcriptional Activation of Gonadotropin-Releasing Hormone (GnRH) Receptor Gene by GnRH and Cyclic Adenosine Monophosphate1

Xinwei Lin and P. Michael Conn

Oregon Regional Primate Research Center (X.L., P.M.C.), Beaverton, Oregon 97006; Department of Physiology and Pharmacology (P.M.C.), Oregon Health Sciences University, Portland, Oregon 97201

Address all correspondence and requests for reprints to: P. Michael Conn, 505 NW 185th Avenue, Beaverton, Oregon 97006. E-mail: connm{at}ohsu.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GnRH appears to regulate messenger RNA levels and synthesis of its own receptor (GnRHR). In this study, we examined the regulation of GnRHR gene transcription by GnRH and cAMP in the GGH3 cell line (GH3 cells stably expressing GnRHR). Transient transfection of GGH3 cells with luciferase reporter gene vector (GnRHR-pXP2) containing a 1226-bp promoter fragment (-1164 to +62, relative to the major transcription start site) of mouse GnRHR gene resulted in an increase in reporter gene (GnRHR-Luc) activity (11- to 22-fold) compared with the promoterless vector. GnRH or a GnRH agonist (Buserelin) significantly stimulated the GnRHR-Luc activity in a dose-dependent manner. Time-course studies using 10-7 M Buserelin revealed that GnRHR-Luc activity increased progressively from 1.5–6 h, with a peak at 6 h. The increase in GnRHR-Luc activity was lower at 12 and 24 h. Both cholera toxin and dBcAMP significantly stimulated GnRHR-Luc activity. Pretreatment with dBcAMP also enhanced the extent of stimulation of GnRHR-Luc activity in response to Buserelin. Pertussis toxin did not induce basal or Buserelin-stimulated GnRHR-Luc activity. Treatment of GGH3 cells with 10-9 or 10-7 M Buserelin for 6 h was sufficient to stimulate a significant increase in cAMP release. An adenylate cyclase inhibitor SQ 22536 did not affect the basal GnRHR-Luc activity but significantly reduced Buserelin-activated GnRHR-Luc activity. These results suggest that GnRH and cAMP activate transcriptional activity of the GnRHR gene and that GnRH activates GnRHR transcriptional activity, in part, through the cAMP pathway. Progressive 5'-deletion analysis revealed that basal and Buserelin- or dBcAMP-stimulated GnRHR-Luc activity were consistently retained after 5'-deletion at position -456, -381, or -331 relative to the major transcription start site but were significantly decreased after subsequent truncation of the promoter from -331 to -255 relative to the major transcription start site. However, the -255 construct still retained responsiveness to Buserelin and dBcAMP, and the relative activity remained similar under both stimulation conditions. These results suggest that elements located between -331 and -255 necessary for transcriptional activity of the GnRHR gene in GGH3 cells, and that the response elements on the mouse GnRHR gene for both GnRH and cAMP reside at two different sites: between -331 and -255 and between -255 and +62.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GnRH stimulates synthesis and release of pituitary gonadotropins (LH and FSH), acting through the specific GnRH receptor (GnRHR) on the plasma membrane (1). The appearance of the GnRHR on the cell surface is a combination of processes of internalization, degradation, recycling, unmasking, and new synthesis of the receptor (1). Using a radioactive ligand binding assay and molecular approaches, it was demonstrated that changes in GnRHR number (2) and the levels of GnRHR messenger RNA (mRNA) (3, 4) occur during the estrous cycle and are associated with changes in sensitivity of gonadotrope to GnRH and levels of serum gonadotropin, suggesting that GnRHR is an important site for regulation of gonadotropin release.

GnRH appears to regulate mRNA levels and synthesis of its own receptor (GnRHR). GnRHR was shown to undergo biphasic (down- and up-regulation) homologous regulation by physiological concentrations of GnRH (3). In addition, pulsatility of GnRH exposure maintains GnRHR levels and subtle increases in the frequency of GnRH pulse sensitize the gonadotrope by increasing GnRHR number (3). Molecular cloning of GnRHR complementary DNA (cDNA) from several species has triggered an extensive study of hormonal regulation of GnRHR gene expression. Results from these studies indicated that pulsatile GnRH up-regulates the expression of its own receptor mRNA (5, 6, 7, 8), whereas high-amplitude pulsatile or continuous treatment with GnRH generally down-regulates the levels of GnRHR mRNA (9, 10, 11, 12, 13). However, it is unclear if homologous regulation of GnRHR gene expression occurs at transcriptional and (or) posttranscriptional levels.

cAMP is an important second messenger in many signal transduction systems. cAMP activates protein kinase A, which, in turn, mediates phosphorylation of a number of cytoplasmic and nuclear proteins to ultimately influence the transcriptional regulation of various genes through distinct, cAMP-inducible promoter responsive sites (14). There is evidence that cAMP enhances gene expression and synthesis of {alpha} and LH and FSH ß subunits and release of LH and FSH (15, 16). However, GnRH stimulation of gonadotropin secretion appears to be independent of changes in cAMP (17), although GnRH was shown to be able to induce the levels of cAMP (18, 19, 20). Moreover, it has been demonstrated that cAMP or its analogs can mimic GnRH to increase GnRHR levels in cultured rat pituitary cells (21, 22), suggesting that cAMP may participate in regulation of GnRHR.

Recently, isolation and characterization of the 5'-flanking region of GnRHR gene from human, mouse, rat, and sheep were accomplished (23, 24, 25, 26, 27, 28), facilitating the study of transcriptional regulation of GnRHR gene. In the present study we examined the regulation of GnRHR gene transcription by GnRH and cAMP and cross-talk between GnRH and cAMP in the GGH3 cell line (GH3 cells stably expressing GnRHR).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Luciferase reporter gene vector (GnRHR-pXP2) with a 1226 bp promoter fragment (-1164 to +62 relative to the major transcription start site) of mouse GnRHR gene (23) and an expression vector (pCIS-LacZ) expressing ß-galactosidase driven by cytomegalovirus (CMV) promoter (29) were generously provided by Dr. W. W. Chin and Dr. Tae H. Ji, respectively. Natural sequence GnRH was provided by the National Pituitary Agency. A GnRH agonist, Buserelin (D-tert-butyl-Ser6-des-Gly10-Pro9-ethylamide-GnRH), was a kind gift from Hoechst-Roussel Phamaceuticals (Somerville, NJ). Cholera toxin and pertussis toxin (List Biological Laboratories, Campbell, CA), dibutyryl cAMP (Sigma Chemical Co., St. Louis, MO), and SQ 22536 (Calbiochem, La Jolla, CA) were obtained from the sources indicated. DMEM, OPTI-MEM, lipofectamine and PCR reagents were purchased from Life Technologies (Grand Island, NY). Restriction enzymes, modified enzymes and competent cells for subcloning were purchased from Promega (Madison, WI). Other reagents were of the highest degree of purity available from commercial sources.

Methods
Construction of reporter plasmids. A 1226-bp fragment (-1164 to +62 relative to the major transcription start site) of 5'-flanking region of mouse GnRHR gene (23) was fused into a luciferase reporter gene vector (pXP2) and designated as GnRHR-pXP2 reporter gene construct. Promoterless pXP2 vector was generated by digestion of the GnRHR-pXP2 construct with BamH I and BglII to delete the GnRHR gene fragment and re-ligation of the vector. An expression vector (pCIS-LacZ) expressing ß-galactosidase driven by CMV promoter was used as an internal control (29).

Progressive 5' deletions in the 5'-flanking region of mouse GnRHR gene were generated by PCR using a sense primer located at the different sites of deletion and an antisense primer (TTGCTCTCCAGCGGTTCCAT) complementary to the sequence of 5'-end of luciferase coding region, with GnRHR-pXP2 reporter gene vector as template. The sequences of the sense primers are: CTAGCTATGGATCCGTCGTGTGAC for deletion at position -456 (relative to the major transcription start site), CAAACAACAGGATCCAAATTGGATCGG for deletion at -381 (relative to the major transcription start site), ATTTCATTTTGGATCCGTCTAGTCAC for deletion at -331 (relative to the major transcription start site), and GTCACTTTCGGGATCCGAATTAGACTC for deletion at -255 (relative to the major transcription start site). A restriction enzyme site (BamHI) was introduced in each of the sense primers (underlined). The resulting DNA fragments contains restriction enzyme sites BamHI and XhoI at their 5'- and 3'-ends, respectively. The DNA fragments were then digested with BamHI and XhoI and subcloned into the same sites in the pXP2 vector.

The identity of all reporter gene constructs and the correctness of all PCR-derived sequences were verified by Dye Terminator Cycle Sequencing according to the manufacturer’s instructions (Perkin Elmer, Foster City, CA). For transfection, large scale of plasmid DNAs were prepared by double banded CsCl gradient centrifugation. The purity and identity of plasmid DNAs were further verified by restriction enzyme analysis.

Transient transfection of GGH3 cells
GnRHR-pXP2 reporter gene vector or control vector pXP2 were transiently expressed in GGH3 cells (30). GGH3 cells were maintained in growth medium [DMEM containing 10% FCS (Hyclone Laboratories, Logan, UT) and 20 µg/ml gentamicin (Gemini Bioproducts, Calabasas, CA)] in a humidified atmosphere (37 C) containing 5% CO2. 5 x 105 cells/well were seeded in 6-well plates (Costar, Cambridge, MA). Twenty-four hours after plating, the cells were transfected with 1.5 µg GnRHR-pXP2 or promoterless pXP2 plus 0.5 µg pCIS-LacZ per well using 5 µl lipofectamine in 1 ml OPTI-MEM. Five hours later, 1 ml of DMEM containing 20% FCS was added to each well. Twenty-four hours after the start of transfection, the medium was replaced with fresh growth medium, and the cells were allowed to grow for another 24 h before treatment and functional assays (luciferase assay, ß-galactosidase assay and cAMP release) were done.

Luciferase and ß-galactosidase assays
After treatment of GGH3 cells with GnRH or other compounds for indicated times, the cells were washed twice with PBS and lysed in 150 µl of Reporter Lysis Buffer (Promega). Luciferase activity in 20 µl of the cell lysate was determined using the Luciferase Assay System (Promega) in a LuciCount microplate luminometer (Packard, Meriden, CT). ß- galactosidase activity in 30 µl of the cell lysate was also measured using ß-Galactosidase Enzyme Assay System (Promega) in a SpectraCount photometric microplate counter (Packard) and was used as an internal control. The luciferase activity was normalized for transfection efficiency of each well by dividing the luciferase activity by ß-galactosidase activity.

Quantitation of cAMP
Forty-eight hours after the start of transfection, the GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ were washed twice with DMEM containing 0.1% BSA (Irvine Scientific, Santa Ana, CA) and 20 µg/ml gentamicin. The cells were then incubated for 6 h with medium alone or Buserelin (10-11, 10-9, and 10-7 M) in 2 ml DMEM-0.1% BSA-20 µg/ml gentamicin containing 0.2 mM methylisobutylxanthine (MIX) to prevent degradation of cAMP. After stimulation, the medium from each well was collected in tubes containing sufficient theophylline for a final concentration of 1 mM. The samples were heated (95 C) for 5 min to destroy phosphodiesterases. RIA of cAMP was performed by a modification of the method of Steiner et al. (31), with the addition of the acetylation step described by Harper and Brooker (32). cAMP antiserum C-1B (prepared in our laboratory, 33) was used at a titer of 1:5100. This antiserum showed less than 0.1% cross-reaction with cGMP, 2',3'-cAMP, 5'-cAMP, 3'-cAMP, ADP, GDP, ATP, CTP, MIX, or theophylline.

Data analysis
Data shown are the means of triplicate assay wells and are presented as the mean ± SEM of replicates in each experiment. The SEM was typically less than 10% of the mean. The data were analyzed by one-way ANOVA followed by Duncan’s multiple range test, P < 0.05 being considered significant. Each experiment was repeated three or more times to ensure the reproducibility of the findings.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activation of GnRHR gene transcriptional activity by GnRH
Transient transfection of GGH3 cells with GnRHR-pXP2, a luciferase reporter gene vector containing a 1226 bp promoter fragment (-1164 to +62, relative to the major transcription start site) of the mouse GnRHR (mGnRHR) gene, resulted in an increase in GnRHR-luciferase reporter gene (GnRHR-Luc) activity (11- to 22-fold) compared with the GGH3 cells transfected with promoterless pXP2 vector (Figs. 1Go and 2Go). This result indicated that the 1226 bp GnRHR promoter is highly expressed and transcriptionally active in GGH3 cells.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Dose-response of GnRH activation of GnRHR-Luc activity. Forty-eight hours after transfection of GGH3 cells with GnRHR-pXP2 plus pCIS-LacZ or pXP2 plus pCIS-LacZ, the cells were incubated with medium or the indicated doses of GnRH for 6 h. The cells were then washed twice with PBS and lysed in Reporter lysis buffer. Luciferase activity in 20 µl of the cell lysate and ß-galactosidase activity in 30 µl of the cell lysate were measured. Luciferase activity was calculated as luciferase activity/ß-galactosidase activity assayed from each well. The luciferase activity was then normalized as fold-induction of luciferase activity from GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ over that from GGH3 cells transfected with promoterless pXP2 plus pCIS-LacZ. The data shown are the means of triplicate determinations. Error bars show the SEM. Significant differences at P < 0.05 between groups are designated by different lower case letters above the bars.

 


View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Dose-response (upper panel) and time-course (lower panel) of activation of GnRHR-Luc activity by GnRH agonist Buserelin. Forty-eight hours after transfection of GGH3 cells with GnRHR-pXP2 plus pCIS-LacZ or pXP2 plus pCIS-LacZ, the cells were incubated with medium or the indicated doses of Buserelin for 6 h. For time course studies, the cells were treated with medium or Buserelin (10-7 M) for different periods of time and harvested at the same time. The cells were then lysed, and luciferase and ß-galactosidase activities were measured. Luciferase activity was calculated as luciferase activity/ß-galactosidase activity and then normalized as fold induction over that of pXP2. The data shown are the means of triplicate determinations. Error bars show the SEM. Significant differences at P < 0.05 between groups are designated by different lower case letters above the bars.

 
To examine the transcriptional regulation of GnRHR gene by GnRH, GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ or promoterless pXP2 plus pCIS-LacZ were treated with medium, GnRH (10-11, 10-9 and 10-7 M) or a metabolically stable GnRH agonist Buserelin (10-11, 10-9 and 10-7 M) for 6 h. Both GnRH and Buserelin stimulated a significant increase in the GnRHR-Luc activity in a dose-dependent manner, with 128.4 ± 9.3% and 120 ± 5.9% above basal levels with 10-7 M GnRH and 10-7 M Buserelin, respectively (Fig. 1Go; Fig. 2Go, upper panel). There were no significant effects of GnRH or Buserelin on the luciferase activity of GGH3 cells transfected with promoterless vector pXP2 or on the ß-galactosidase activity of GGH3 cells cotransfected with pCIS-LacZ. Time course studies using 10-7 M Buserelin revealed that GnRHR-Luc activity was increased progressively from 1.5–6 h, with a peak of 111.5 ± 14% above basal levels at 6 h. The increase in GnRHR-Luc activity was lower at 12 h (39.7 ± 8%) and at 24 h (38.6 ± 4.2%) (Fig. 2Go, lower panel). These results indicated that GnRH activates GnRHR promoter activity in a dose- and time-dependent manner.

Activation of GnRHR gene transcriptional activity by cAMP
To examine the transcriptional regulation of GnRHR gene by cAMP, GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ or pXP2 plus pCIS-LacZ were pretreated with medium alone, cholera toxin (CTX; 5 µg/ml), pertussis toxin (PTX; 100 ng/ml), or dBcAMP (5 mM) for 18 h. The cells were then stimulated with medium or Buserelin (10-7 M) for 6 h. Pretreatment with CTX stimulated GnRHR-Luc activity by 148.1 ± 6.5% above basal levels; this was mimicked by pretreatment with dBcAMP (167.2 ± 9.7%) (Fig. 3Go). Pretreatment with CTX did not affect the extent of stimulation of GnRHR-Luc activity by Buserelin, whereas pretreatment with dBcAMP enhanced the extent of stimulation of GnRHR-Luc activity by Buserelin (Fig. 3Go). Pretreatment with PTX did not induce basal and Buserelin-stimulated GnRHR-Luc activity (Fig. 3Go). There were no significant effects of pretreatment with either CTX, PTX, or dBcAMP on the luciferase activity of GGH3 cells transfected with promoterless vector pXP2 or on the ß-galactosidase activity of GGH3 cells cotransfected with pCIS-LacZ. These results indicate that cAMP activates transcriptional activity of GnRHR gene; cAMP also enhances the transcriptional activation of GnRHR gene by GnRH.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. Activation of GnRHR-Luc by cAMP. Forty-eight hours after transfection of GGH3 cells with GnRHR-pXP2 plus pCIS-LacZ or pXP2 plus pCIS-LacZ, the cells were pretreated with medium alone, cholera toxin (CTX; 5 ug/ml), pertussis toxin (PTX; 100 ng/ml), or a cAMP analog dibutyryl cAMP (dBcAMP; 5 mM) for 18 h. The cells were then stimulated with medium or Buserelin (10-7 M) for 6 h. The cells were then lysed, and luciferase and ß-galactosidase activities were measured. Luciferase activity was calculated as luciferase activity/ß-galactosidase activity and then normalized as fold induction over that of pXP2. The data shown are the means of triplicate determinations. Error bars show the SEM. Significant differences at P < 0.05 between groups are designated by different lower case letters above the bars.

 
Cross-talk between GnRH and cAMP in transcriptional regulation of GnRHR gene
GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ were used to examine the influence of GnRH on the cAMP production. Treatment with 10-9 or 10-7 M Buserelin for 6 h was sufficient to stimulate a significant increase in cAMP release (Fig. 4Go). In addition, an adenylate cyclase inhibitor SQ 22536 [9-(tetrahydro-2'-furyl)adenine] (34) was used to determine the contribution of cAMP to the transcriptional regulation of GnRHR gene by GnRH. GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ or pXP2 plus pCIS-LacZ were pretreated with medium alone or 0.5 mM SQ 22536 for 1 h. The cells were then incubated with medium, Buserelin (10-7 M), or Buserelin (10-7 M) plus 0.5 mM SQ 22536 for 6 h. SQ 22536 did not affect the basal GnRHR-Luc activity (Fig. 5Go) but significantly reduced Buserelin-activated GnRHR-Luc activity, which was even lower after pretreatment with SQ 22536 (Fig. 5Go). However, SQ 22536 did not completely abolish the Buserelin activation of GnRHR-Luc activity (Fig. 5Go). No further inhibition of Buserelin-stimulated GnRHR-Luc activity was found by pretreatment of the cells with 5 mM SQ 22536 for 1 h followed by incubation with Buserelin (10-7 M) plus 5 mM SQ 22536 for 6 h (data not shown). There were no significant effects of SQ 22536 on the luciferase activity of GGH3 cells transfected with promoterless vector pXP2 or on the ß-galactosidase activity of GGH3 cells cotransfected with pCIS-LacZ. These results indicate that GnRH is able to stimulate cAMP production and GnRH activates GnRHR transcriptional activity, in part, through the cAMP signal transduction pathway.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Dose-response of Buserelin-stimualted cAMP release. Forty-eight hours after transfection of GGH3 cells with GnRHR-pXP2 plus pCIS-LacZ, the cells were incubated with medium or indicated concentrations of Buserelin and 0.2 mM MIX for 6 h. The media were collected and were then heated at 95 C for 5 min with 1 mM theophylline, and their cAMP contents were determined by RIA. The data shown are the means of triplicate determinations. Error bars show the SEM. Significant differences at P < 0.05 between groups are designated by different lower case letters above the bars.

 


View larger version (48K):
[in this window]
[in a new window]
 
Figure 5. Effect of an adenylate cyclase inhibitor SQ 22536 on basal and Buserelin-stimulated GnRHR-Luc activity. Forty-eight hours after transfection of GGH3 cells with GnRHR-pXP2 plus pCIS-LacZ or pXP2 plus pCIS-LacZ, the cells were pretreated with medium alone or 0.5 mM SQ 22536 for 1 h. The cells were then incubated with medium, Buserelin (10-7 M), or Buserelin (10-7 M) plus 0.5 mM SQ 22536 for 6 h. The cells were then lysed, and luciferase and ß-galactosidase activities were measured. Luciferase activity was calculated as luciferase activity/ß-galactosidase activity and then normalized as fold induction over that of pXP2. The data shown are the means of triplicate determinations. Error bars show the SEM. Significant differences at P < 0.05 between groups are designated by different lower case letters above the bars.

 
Progressive 5' deletion analysis of sequence required for basal and GnRH- or cAMP-activated transcriptional activity of GnRHR gene
To determine the GnRH or cAMP responsive sequence, four 5' deletions in the 1226 bp 5'-flanking region of mouse GnRHR gene was generated at positions -456, -381, -331, and -255 (relative to the major transcription start site), respectively (Fig. 6Go). Transient expression of the constructs containing one of 5'-deleted promoter sequences or original promoter (1226 bp) in GGH3 cells revealed that basal GnRHR-Luc activity was retained after 5'-deletion at position -456, -381 or -331 but was significantly decreased after 5'-deletion at position -255 (Fig. 6Go). Similarly, stimulation of GnRHR-Luc activity by Buserelin (10-7 M, 6 h) or by dBcAMP (5 mM, 18 h) were consistently retained after 5'-deletion of GnRHR promoter at positions -456, -381, and -331, and were significantly decreased after 5'-deletion of GnRHR promoter at positions -255 (Fig. 6Go). However, the -255 GnRHR promoter construct still retained the responsiveness to Buserelin and dBcAMP and the proportions of activity remained were similar under both stimulation conditions. These results indicate that elements located between -331 and -255 are necessary for transcriptional activity of GnRHR gene in GGH3 cells and that the response elements on the mouse GnRHR gene to both GnRH and cAMP appear to reside at two different sites: between -331 to -255 and between -255 to +62 (relative to the major transcription start site).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 6. Progressive 5' deletion analysis of sequence required for basal and GnRH- or cAMP-activated transcriptional activity of GnRHR gene. Four 5' deletions in the 1226 bp promoter fragment (-1164 to +62, relative to the major transcription start site) of mouse GnRHR gene was generated at positions -456, -381, -331, and -255 (relative to the major transcription start site), respectively. The major transcription start site is indicated by a bent arrow. Forty-eight hours after transfection of GGH3 cells with GnRHR-pXP2 containing one of 5'-deleted promoter sequences or original promoter (1226 bp) plus pCIS-LacZ or pXP2 plus pCIS-LacZ, the cells were treated with medium or Buserelin (10-7 M) for 6 h, or were treated with medium or dBcAMP (5 mM) for 18 h. The cells were then lysed, and luciferase and ß-galactosidase activities were measured. Luciferase activity was calculated as luciferase activity/ß-galactosidase activity and then normalized as fold induction over that of pXP2. The data shown are the means of triplicate determinations. Error bars show the SEM. Significant differences at P < 0.05 between groups are designated by different lower case letters above the bars.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, a luciferase reporter gene vector (GnRHR-pXP2) containing a 1226 bp promoter fragment (-1164 to +62 relative to the major transcription start site) of mGnRHR gene (23) was used to examine the regulation of GnRHR gene transcription by GnRH and cAMP in the GGH3 cells, a GH3 cell line stably expressing GnRHR that has been demonstrated to be a useful model system for study of GnRH action (35). GnRH or its agonist Buserelin activates GnRHR promoter activity in dose- and time-dependent manners; GnRH is also able to stimulate cAMP production. On the other hand, cAMP activates GnRHR promoter activity and enhances the transcriptional activation of GnRHR gene by GnRH. In addition, a competitive inhibitor of adenylate cyclase, SQ 22536, partially blocked the GnRH stimulation of GnRHR gene transcriptional activity, suggesting that GnRH activates GnRHR transcriptional activity, in part, through the cAMP signal transduction pathway.

GnRH was shown to stimulate the synthesis of its own receptor (36). In addition, GnRH up-regulates or down-regulates the mRNA levels of its receptor, dependent on the pattern of administration with GnRH (5, 6, 7, 8, 9, 10, 11, 12, 13). In the present study, both GnRH and a GnRH agonist significantly stimulated mGnRHR gene promoter activity in GGH3 cells in a dose-dependent manner, suggesting that homologous regulation of GnRHR gene expression also occurs at the transcriptional level. In addition, the present results indicate that GnRH activates GnRHR transcriptional activity in a time-dependent manner. The GnRHR-Luc activity was stimulated by Buserelin progressively from 1.5–6 h, and the increase in GnRHR-Luc activity was significantly lower with longer exposure of the cells to Buserelin (12 h and 24 h). These results suggest that short-term treatment with GnRH agonist up-regulates the GnRHR transcriptional activity, whereas long-term treatment with GnRH agonist desensitize the GnRHR transcriptional activity in responses to GnRH agonist. Similarly, GnRH has been shown to cause transcriptional stimulation of the gonadotropin {alpha}-subunit promoter in the period of 4–6 h followed by desensitization in a period of 6–24 h in {alpha}T3 cells (37). In addition, several earlier reports demonstrated that continuous treatment (hours or days) with GnRH or its agonist down-regulates the levels of GnRHR mRNA; the same treatment also down-regulates GnRHR numbers assessed by radioligand binding (9, 10, 11, 12, 13). Thus the down-regulation of GnRHR receptor number may, in part, contribute to the homologous desensitization of GnRHR transcriptional activity.

GnRHR is a member of the G protein-coupled receptor (GPCR) family (38). The GnRHR appears to couple to multiple G proteins (39). In GGH3 cells, GnRHR is coupled to Gq/11{alpha} as well as to Gs{alpha}, which activates adenylate cyclase, leading to production of cAMP (35, 40, 41, 42). Recently, a study relying on palmitoylation of G proteins and overexpression of different G protein {alpha} subunit cDNAs, showed that GnRHR couples to Gq/11{alpha} as well as to Gs{alpha} and Gi{alpha} in both GGH3 cells and pituitary gonadotropes, suggesting that similar signal transduction pathways are employed to mediate GnRH action in GGH3 cells and in pituitary cells and that adenylate cyclase-cAMP signal transduction pathway is involved in GnRH action (43). In the earlier studies, GnRH induced the levels of cAMP in hemipituitary and whole pituitary (18, 19, 20). However, in some other studies, GnRH agonist had no significant effect on cAMP levels in primary gonadotropes (17). This difference may be due to the different estrous cycle stages at which pituitary was collected, as pituitary levels of G proteins (Gs{alpha}, Gi{alpha}, Go{alpha}, and ß subunit) were shown to be significantly modulated during the various phases of the rat estrous cycle (44). Furthermore, it has been demonstrated that cAMP or its analogs can mimic GnRH stimulated increases in GnRHR levels in cultured rat pituitary cells, suggesting that cAMP may participate in regulation of GnRHR (21, 22). The present results show that GnRH agonist stimulates cAMP levels in GGH3 cells, consistent with the previous finding that GnRHR couples to Gs{alpha} to activate adenylate cyclase and subsequent production of cAMP (35, 40, 41, 42). On the other hand, the present results show that CTX stimulated GnRHR-Luc activity, which was mimicked by treatment with dBcAMP. In addition, dBcAMP augmented GnRH stimulation of GnRHR-Luc activity. These results demonstrate that cAMP can activate GnRHR transcriptional activity and may mediate GnRH regulation of GnRHR transcriptional activity. Furthermore, an adenylate cyclase inhibitor SQ 22536 partially blocked GnRH agonist-stimulated GnRHR promoter activity, supporting the view that GnRH activates GnRHR promoter activity, in part, through cAMP signal transduction pathway. SQ 22536 did not affect the influence of overexpression of mitogen-activated protein kinase (MAPK) kinase (Raf-1) on GnRHR-Luc activity, suggesting no effect of SQ 22536 on PKC/MAPK pathway (our unpublished observation). Several earlier studies showed that pituitary GnRHR number and the levels of GnRHR mRNA change during the estrous cycle and during pregnancy and lactation and are associated with changes in sensitivity of gonadotrope to GnRH and levels of serum gonadotropin (2, 3, 4), suggesting that GnRH may be involved in the regulation of its own receptor, which, in turn, mediates regulation of gonadotropin synthesis and release. Indeed GnRH has been shown to regulate mRNA levels and synthesis of its own receptor (2). Because GGH3 cells and pituitary primary cells have similar GnRHR-G protein coupling and signal transduction pathways, the present results imply that the homologous regulation of GnRHR at the transcriptional level via cAMP signal transduction pathway participates in the physiological regulation of pituitary GnRHR during reproductive cycle. The other pathways involved in GnRH regulation of GnRHR gene transcription may include Gq/11{alpha}-mediated activation of PLC, leading to activation of PKC and MAPK cascade (unpublished observation). Similarly, PKC and MAPK signal transduction pathway have been shown to mediate activation of gonadotropin {alpha}-subunit promoter activity by GnRH (45). A recent report showed that frequency of calcium pulsatile signals regulates GnRHR gene expression, suggesting that GnRH-stimualted intracellular Ca2+ signals may also be involved in mediation of the transcriptional regulation of GnRHR gene by GnRH (5).

Sequence analysis of 5'-flanking regions of GnRHR gene from several species revealed the presence of consensus sequences that may have significance in controlling the expression of the gene (23, 24, 25, 26, 27, 28). A cAMP response element (CRE)-like sequence has been identified in rat and human GnRHR gene (25, 27). In addition, two consensus sequences similar to the GnRH response elements (70% and 75% identity, respectively) found in the gonadotropin {alpha}-subunit promoter were identified in mGnRHR gene at position -354/-335 and -615/-600 (relative to the major transcription start site) (23). In the present study, a progressive 5' deletion analysis revealed that sequence elements located between -331 and -255 of the mouse GnRHR gene are necessary for transcriptional activity of GnRHR gene in GGH3 cells and that the response elements on the GnRHR gene to both GnRH and cAMP appear to reside at two different sites: between -331 and -255 (relative to the major transcription start site) and between -255 and +62 (relative to the major transcription start site). The present results are consistent with the reports (46, 47) that basal activity of mGnRHR promoter is dependent on the steroidogenic factor-1 binding site (SF-1; -183 to -175, relative to the major transcription start site), activator protein-1 (AP-1; -274 to -268, relative to the major transcription start site) binding site and a GnRHR activating sequence (GRAS; -329 to -318, relative to the major transcription start site). These suggest that the transcriptional factors acting through the SF-1, AP-1, and GRAS sites (46, 47) may be involved in the mediation of the transcriptional activation of GnRHR gene by cAMP and GnRH. Because no CRE-like sequence was identified in mGnRHR gene (23, 24) and the supposed GnRH responsive elements are upstream of the 331 bp (relative to the major transcription start site) of the 5'-flanking region of mGnRHR gene, the transcriptional activation of GnRHR gene by cAMP and GnRH may be not mediated by the CRE binding proteins.


    Acknowledgments
 
We are grateful to Drs. W. W. Chin and Tae H. Ji for providing mouse GnRHR reporter gene vector and pCIS-LacZ vector, respectively. We thank Jo Ann Janovick for her help.


    Footnotes
 
1 This study was supported by NIH Grants HD-19899, HD-00163, and HD-18185. Back

Received March 18, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Conn PM 1994 The molecular mechanism of gonadotropin-releasing hormone action in the pituitary. In: Knobil E, Neill JD (eds) The Physiology of Reproduction. Raven Press, NY, pp 1815–1832
  2. Conn PM, Janovick JA, Stanislaus D, Kuphal D, Jennes L 1995 Molecular and cellular basis of gonadotropin-releasing hormone action in the pituitary and central nervous system. In: Litwack G (ed) Vitamins and Hormones, vol 50. Academic Press, New York, pp 151–214
  3. Bauer-Dantoin AC, Hollenberg AN, Jameson JL 1993 Dynamic regulation of gonadotropin-releasing hormone receptor mRNA levels in the anterior pituitary gland during the rat estrous cycle. Endocrinology 133:1911–1914[Abstract]
  4. Brooks J, Taylor PL, Saunders PTK, Eidne KA, Struthers WJ, McNeilly AS 1993 Cloning and sequencing of the sheep pituitary gonadotropin-releasing hormone receptor and changes in expression of its mRNA during the estrous cycle. Mol Cell Endocrinol 94:R23–R27
  5. Haisenleder DJ, Yasin M, Marshall JC 1997 Gonadotropin subunit and gonadotropin-releasing hormone receptor gene expression are regulated by alterations in the frequency of calcium pulsatile signals. Endocrinology 138:5227–5230[Abstract/Free Full Text]
  6. Turgeon JL, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH Receptor in a novel gonadotrope cell line. Mol Endocrinol 10:439–450[Abstract]
  7. Yasin M, Dalkin AC, Haisenleder DJ, Kerrigan JR, Marshall JC 1995 Gonadotropin-releasing hormone (GnRH) pulse pattern regulates GnRH receptor gene expression: augmentation by estradiol. Endocrinology 136:1559–1564[Abstract]
  8. Kaiser UB, Jakubowiak A, Steinberger A, Chin WW 1997 Differential effects of gonadotropin-releasing hormone (GnRH) pulse frequency on gonadotropin subunit and GnRH receptor messenger ribonucleic acid levels in vitro. Endocrinology 138:1224–1231[Abstract/Free Full Text]
  9. Adams BM, Sakurai H, Adams TE 1996 Concentrations of gonadotropin-releasing hormone (GnRH) receptor messenger ribonucleic acid in pituitary tissue of orchidectomized sheep: effect of estradiol and GnRH. Biol Reprod 54:407–412[Abstract]
  10. Vizcarra JA, Wettemann RP, Braden TD, Turzillo AM, Nett TM 1997 Effect of gonadotropin-releasing hormone (GnRH) pulse frequency on serum and pituitary concentrations of luteinizing hormone and follicle-stimulating hormone, GnRH receptors, and messenger ribonucleic acid for gonadotropin subunits in cows. Endocrinology 138:594–601[Abstract/Free Full Text]
  11. Mason DR, Arora KK, Mertz LM, Catt KJ 1994 Homologous down-regulation of gonadotropin-releasing hormone receptor sites and messenger ribonucleic acid transcripts in {alpha}T3–1 cells. Endocrinology 135:1165–1170[Abstract]
  12. Wu JC, Sealfon SC, Miller WL 1993 Gonadal hormones and gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid levels for GnRH receptors in sheep. Endocrinology 134:1846–1850[Abstract]
  13. Kakar SS, Nath S, Bunn J, Jennes L 1997 The inhibition of growth and down-regulation of gonadotropin releasing hormone (GnRH) receptor in {alpha}T3–1 cells by GnRH agonist. Anti-Cancer Drugs 8:369–375[CrossRef][Medline]
  14. Sassone-Corsi P 1995 Transcription factors responsive to cAMP. Ann Rev Cell Dev Biol 11:355–377[CrossRef][Medline]
  15. Ishizaka K, Tsujii T, Winters SJ 1993 Evidence for a role for the cyclic adenosine 3',5'-monophosphate/protein kinase-A pathway in regulation of the gonadotropin subunit messenger ribonucleic acids. Endocrinology 133:2040–2048[Abstract]
  16. Haisenleder DJ, Dalkin AC, Marshall JC 1994 Regulation of gonadotropin gene expression. In: Knobil E, Neill JD (eds) The Physiology of Reproduction. Raven Press, New York, pp 1793–1813
  17. Conn PM, Morrell DV, Dufau ML, Catt KJ 1979 Gonadotropin-releasing hormone action in cultured pituicytes: independence of luteinizing hormone release and adenosine 3',5'-monophosphate production. Endocrinology 104:448–453[Abstract]
  18. Naor Z, Fawcett CP, McCann SM 1979 Differential effects of castration and testosterone replacement on basal and LHRH-stimulated cAMP and cGMP accumulation and on gonadotropin release from the pituitary of the male rat. Mol Cell Endocrinol 14:191–198[CrossRef][Medline]
  19. Borgeat P, Chavancy G, Dupont A, Labrie F, Arimura A, Schally AV 1972 Stimulation of adenosine 3':5'-cyclic monophosphate accumulation in anterior pituitary gland in vitro by synthetic luteinizing hormone-releasing hormone. Proc Natl Acad Sci USA 69:2677–2681[Abstract/Free Full Text]
  20. Bourne GA 1988 Cyclic AMP indirectly mediates the extracellular Ca2+-independent release of LH. Mol Cell Endocrinol 58:155–160[CrossRef][Medline]
  21. Young LS, Naik SI, Clayton RN 1984 Adenosine 3',5'-monophosphate derivatives increase gonadotropin-releasing hormone receptors in cultured pituitary cells. Endocrinology 114:2114–2122[Abstract]
  22. Young LS, Naik SI, Clayton RN 1985 Increased gonadotropin releasing hormone receptors on pituitary gonadotrophs: effect on subsequent LH secretion. Mol Cell Endocrinol 41:69–78[CrossRef][Medline]
  23. Albarracin CT, Kaiser, UB, Chin WW 1994 Isolation and characterization of the 5'-flanking region of the mouse gonadotropin-releasing hormone receptor gene. Endocrinology 135:2300–2306[Abstract]
  24. Clay CM, Nelson SE, DiGregorio GB, Campion CE, Wiedemann AL, Nett RJ 1995 Cell-specific expression of the mouse gonadotropin-releasing hormone (GnRH) receptor gene is conferred by elements residing within 500 bp of proximal 5' flanking region. Endocrine 3:615–622
  25. Reinhart J, Xiao S, Arora KK, Catt KJ 1997 Structural organization and characterization of the promoter region of the rat gonadotropin-releasing hormone receptor gene. Mol Cell Endocrinol 130:1–12[CrossRef][Medline]
  26. Kakar SS 1997 Molecular structure of the human gonadotropin-releasing hormone receptor gene. Euro J Endocrinol 137:183–192[Abstract]
  27. Fan NC, Peng C, Krisinger J, Leung PCK 1995 The human gonadotropin-releasing hormone receptor gene: complete structure including multiple promoters, transcription initiation sites, and polyadenylation signals. Mol Cell Endocrinol 107:R1–R8
  28. Campion CE, Turzillo AM, Clay CM 1996 The gene encoding the ovine gonadotropin-releasing hormone (GnRH) receptor: cloning and initial characterization. Gene 170:277–280[CrossRef][Medline]
  29. Offermanns S, Iida-Klein A, Segre GV, Simon MI 1996 G{alpha}q family members couple parathyroid hormone (PTH)/PTH-related peptide and calcitonin receptors to phospholipase C in COS-7 cells. Mol Endocrinol 10:566–574[Abstract]
  30. Stanislaus D, Janovick JA, Jennes L, Kaiser UB, Chin WW, Conn PM 1994 Functional and morphological characterization of four cell lines derived from GH3 cells stably transfected with gonadotropin-releasing hormone receptor complementary deoxyribonucleic acid. Endocrinology 135:2220–2227[Abstract]
  31. Steiner AL, Parker CW, Kipnis DM 1972 Radioimmunoassay for cyclic nucleotides. J Biol Chem 247:1106–1113[Abstract/Free Full Text]
  32. Harper JF, Brooker G 1975 Femtomole sensitive radioimmunoassay of cyclic AMP and cyclic GMP after 2'0 acetylation by acetic anhydride in aqueous solution. J Cyclic Nucleotide Res 1:207–218[Medline]
  33. Andrews WV, Conn PM 1986 Gonadotropin-releasing hormone stimulates mass changes in phosphoinositides and diacylglycerol accumulation in purified gonadotrope cell cultures. Endocrinology 118:1148–1158[Abstract]
  34. Goldsmith BA, Abrams TW 1991 Reversal of synaptic depression by serotonin at Aplysia sensory neuron synapses involves activation of adenylyl cyclase. Proc Natl Acad Sci USA 88:9021–9025[Abstract/Free Full Text]
  35. Kaiser UB, Conn PM, Chin WW 1997 Studies of gonadotropin-releasing hormone (GnRH) action using GnRH receptor-expressing pituitary cell lines. Endocr Rev 18:46–70[Abstract/Free Full Text]
  36. Braden TD, Conn PM 1990 Altered rate of synthesis of gonadotropin-releasing hormone receptors: effects of homologous hormone appear independent of extracellular calcium. Endocrinology 126:2577–2582[Abstract]
  37. Kay TWH, Chedrese PJ, Jameson JL 1994 Gonadotropin-releasing hormone causes transcriptional stimulation followed by desensitization of the glyco-protein hormone {alpha} promoter in transfected {alpha}T3 gonadotrope cells. Endocrinology 134:568–573[Abstract]
  38. Sealfon SC, Weinstein H, Millar RP 1997 Molecular mechanisms of ligand interaction with the gonadotropin-releasing hormone receptor. Endocr Rev 18:180–205[Abstract/Free Full Text]
  39. Hawes BE, Barnes S, Conn PM 1993 Cholera toxin and pertussis toxin provoke differential effects on luteinizing hormone release, inositol phosphate production, and gonadotropin-releasing hormone (GnRH) receptor binding in the gonadotrope: evidence for multiple guanyl nucleotide binding proteins in GnRH action. Endocrinology 132:2124–2130[Abstract]
  40. Janovick JA, Conn PM 1994 Gonadotropin-releasing hormone (GnRH)-receptor coupling to inositol phosphate and prolactin production in GH3 cells stably transfected with rat GnRH receptor complementary deoxyribonucleic acid. Endocrinology 135:2214–2219[Abstract]
  41. Kuphal D, Janovick JA, Kaiser UB, Chin WW, Conn PM 1994 Stable transfection of GH3 cells with rat gonadotropin-releasing hormone receptor complementary deoxyribonucleic acid results in expression of a receptor coupled to cyclic adenosine 3',5'-monophosphate-dependent prolactin release via a G-protein. Endocrinology 135:315–320[Abstract]
  42. Lin X, Janovick JA, Brothers S, Blomenröhr M, Bogerd J, Conn PM 1998 Addition of catfish gonadotropin-releasing hormone (GnRH) receptor intracellualr carboxyl-terminal tail to rat GnRH receptor alters receptor expression and regulation. Mol Endocrinol 12:161–171[Abstract/Free Full Text]
  43. Stanislaus D, Ponder S, Ji TH, Conn PM GnRH receptor couples to multiple G-proteins in gonadotropes and in GGH3 cells: evidence from palmitoylation and overexpression of G-proteins. Biol Reprod, in press
  44. Bouvier C, Lagacé G, Collu R 1991 G protein modulation by estrogens. Mol Cell Endocrinol 79:65–73[CrossRef][Medline]
  45. Roberson MS, Misra-Press A, Laurance ME, Stork PJS, Maurer RA 1995 A role for mitogen-activated protein kinase in mediating activation of the glycoprotein hormone {alpha}-subunit promoter by gonadotropin-releasing hormone. Mol Cell Biol 15:3531–3539[Abstract]
  46. Duval DL, Nelson SE, Clay CM 1997 The tripartite basal enhancer of the gonadotropin-releasing hormone (GnRH) receptor gene promoter regulates cell-specific expression through a novel GnRH receptor activating sequence. Mol Endocrinol 11:1814–1821[Abstract/Free Full Text]
  47. Duval DL, Nelson SE, Clay CM 1997 A binding site for steroidogenic factor-1 is part of a complex enhancer that mediates expression of the murine gonadotropin-releasing hormone receptor gene. Biol Reprod 56:160–168[Abstract]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
N. J. Westphal and A. F. Seasholtz
Gonadotropin-Releasing Hormone (GnRH) Positively Regulates Corticotropin-Releasing Hormone-Binding Protein Expression via Multiple Intracellular Signaling Pathways and a Multipartite GnRH Response Element in {alpha}T3-1 Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2780 - 2797.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. K. Cheng and P. C. K. Leung
Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans
Endocr. Rev., April 1, 2005; 26(2): 283 - 306.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Sadie, G. Styger, and J. Hapgood
Expression of the Mouse Gonadotropin-Releasing Hormone Receptor Gene in {alpha}T3-1 Gonadotrope Cells Is Stimulated by Cyclic 3',5'-Adenosine Monophosphate and Protein Kinase A, and Is Modulated by Steroidogenic Factor-1 and Nur77
Endocrinology, May 1, 2003; 144(5): 1958 - 1971.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Liu, I. Usui, L. G. Evans, D. A. Austin, P. L. Mellon, J. M. Olefsky, and N. J. G. Webster
Involvement of Both Gq/11 and Gs Proteins in Gonadotropin-releasing Hormone Receptor-mediated Signaling in Lbeta T2 Cells
J. Biol. Chem., August 23, 2002; 277(35): 32099 - 32108.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. W. Cheng and P. C. K. Leung
Human Chorionic Gonadotropin-Activated cAMP Pathway Regulates Human Placental GnRH Receptor Gene Transcription in Choriocarcinoma JEG-3 Cells
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3291 - 3299.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Castro-Fernandez, J. A. Janovick, S. P. Brothers, R. A. Fisher, T. H. Ji, and P. M. Conn
Regulation of RGS3 and RGS10 Palmitoylation by GnRH
Endocrinology, April 1, 2002; 143(4): 1310 - 1317.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. Maya-Nunez and P. Michael Conn
Cyclic Adenosine 3',5'-Monophosphate (cAMP) and cAMP Responsive Element-Binding Protein Are Involved in the Transcriptional Regulation of Gonadotropin-Releasing Hormone (GnRH) Receptor by GnRH and Mitogen-Activated Protein Kinase Signal Transduction Pathway in GGH3 Cells
Biol Reprod, August 1, 2001; 65(2): 561 - 567.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Lin, J. A. Janovick, S. Brothers, P. M. Conn, and R. E. Peter
Molecular Cloning and Expression of Two Type One Somatostatin Receptors in Goldfish Brain
Endocrinology, November 1, 1999; 140(11): 5211 - 5219.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
G. Maya-Núñez and P. M. Conn
Transcriptional Regulation of the Gonadotropin-Releasing Hormone Receptor Gene Is Mediated in Part by a Putative Repressor Element and by the Cyclic Adenosine 3',5'-Monophosphate Response Element
Endocrinology, August 1, 1999; 140(8): 3452 - 3458.
[Abstract] [Full Text]


Home page
Reproductive SciencesHome page
E. R. Norwitz, K.-H. Jeong, and W. W. Chin
Molecular Mechanisms of Gonadotropin-Releasing Hormone Receptor Gene Regulation
Reproductive Sciences, July 1, 1999; 6(4): 169 - 178.
[Abstract] [PDF]


Home page
Mol. Endocrinol.Home page
B. R. White, D. L. Duval, J. M. Mulvaney, M. S. Roberson, and C. M. Clay
Homologous Regulation of the Gonadotropin-Releasing Hormone Receptor Gene Is Partially Mediated by Protein Kinase C Activation of an Activator Protein-1 Element
Mol. Endocrinol., April 1, 1999; 13(4): 566 - 577.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. R. Norwitz, G. R. Cardona, K.-H. Jeong, and W. W. Chin
Identification and Characterization of the Gonadotropin-releasing Hormone Response Elements in the Mouse Gonadotropin-releasing Hormone Receptor Gene
J. Biol. Chem., January 8, 1999; 274(2): 867 - 880.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Lin and P. M. Conn
Transcriptional Activation of Gonadotropin-Releasing Hormone (GnRH) Receptor Gene by GnRH: Involvement of Multiple Signal Transduction Pathways
Endocrinology, January 1, 1999; 140(1): 358 - 364.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H. Pincas, J.-N. Laverriere, and R. Counis
Pituitary Adenylate Cyclase-activating Polypeptide and Cyclic Adenosine 3',5'-Monophosphate Stimulate the Promoter Activity of the Rat Gonadotropin-releasing Hormone Receptor Gene via a Bipartite Response Element in Gonadotrope-derived Cells
J. Biol. Chem., June 22, 2001; 276(26): 23562 - 23571.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Schola