| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Oregon Regional Primate Research Center (X.L., P.M.C.), Beaverton, Oregon 97006; Department of Physiology and Pharmacology (P.M.C.), Oregon Health Sciences University, Portland, Oregon 97201
Address all correspondence and requests for reprints to: P. Michael Conn, 505 NW 185th Avenue, Beaverton, Oregon 97006. E-mail: connm{at}ohsu.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
GnRH appears to regulate mRNA levels and synthesis of its own receptor (GnRHR). GnRHR was shown to undergo biphasic (down- and up-regulation) homologous regulation by physiological concentrations of GnRH (3). In addition, pulsatility of GnRH exposure maintains GnRHR levels and subtle increases in the frequency of GnRH pulse sensitize the gonadotrope by increasing GnRHR number (3). Molecular cloning of GnRHR complementary DNA (cDNA) from several species has triggered an extensive study of hormonal regulation of GnRHR gene expression. Results from these studies indicated that pulsatile GnRH up-regulates the expression of its own receptor mRNA (5, 6, 7, 8), whereas high-amplitude pulsatile or continuous treatment with GnRH generally down-regulates the levels of GnRHR mRNA (9, 10, 11, 12, 13). However, it is unclear if homologous regulation of GnRHR gene expression occurs at transcriptional and (or) posttranscriptional levels.
cAMP is an important second messenger in many signal transduction
systems. cAMP activates protein kinase A, which, in turn, mediates
phosphorylation of a number of cytoplasmic and nuclear proteins to
ultimately influence the transcriptional regulation of various genes
through distinct, cAMP-inducible promoter responsive sites (14). There
is evidence that cAMP enhances gene expression and synthesis of 
and
LH and FSH ß subunits and release of LH and FSH (15, 16). However,
GnRH stimulation of gonadotropin secretion appears to be independent of
changes in cAMP (17), although GnRH was shown to be able to induce the
levels of cAMP (18, 19, 20). Moreover, it has been demonstrated that cAMP
or its analogs can mimic GnRH to increase GnRHR levels in cultured rat
pituitary cells (21, 22), suggesting that cAMP may participate in
regulation of GnRHR.
Recently, isolation and characterization of the 5'-flanking region of GnRHR gene from human, mouse, rat, and sheep were accomplished (23, 24, 25, 26, 27, 28), facilitating the study of transcriptional regulation of GnRHR gene. In the present study we examined the regulation of GnRHR gene transcription by GnRH and cAMP and cross-talk between GnRH and cAMP in the GGH3 cell line (GH3 cells stably expressing GnRHR).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Methods
Construction of reporter plasmids. A 1226-bp fragment
(-1164 to +62 relative to the major transcription start site) of
5'-flanking region of mouse GnRHR gene (23) was fused into a luciferase
reporter gene vector (pXP2) and designated as GnRHR-pXP2
reporter gene construct. Promoterless pXP2 vector was generated by
digestion of the GnRHR-pXP2 construct with BamH I and
BglII to delete the GnRHR gene fragment and re-ligation of
the vector. An expression vector (pCIS-LacZ) expressing
ß-galactosidase driven by CMV promoter was used as an internal
control (29).
Progressive 5' deletions in the 5'-flanking region of mouse GnRHR gene were generated by PCR using a sense primer located at the different sites of deletion and an antisense primer (TTGCTCTCCAGCGGTTCCAT) complementary to the sequence of 5'-end of luciferase coding region, with GnRHR-pXP2 reporter gene vector as template. The sequences of the sense primers are: CTAGCTATGGATCCGTCGTGTGAC for deletion at position -456 (relative to the major transcription start site), CAAACAACAGGATCCAAATTGGATCGG for deletion at -381 (relative to the major transcription start site), ATTTCATTTTGGATCCGTCTAGTCAC for deletion at -331 (relative to the major transcription start site), and GTCACTTTCGGGATCCGAATTAGACTC for deletion at -255 (relative to the major transcription start site). A restriction enzyme site (BamHI) was introduced in each of the sense primers (underlined). The resulting DNA fragments contains restriction enzyme sites BamHI and XhoI at their 5'- and 3'-ends, respectively. The DNA fragments were then digested with BamHI and XhoI and subcloned into the same sites in the pXP2 vector.
The identity of all reporter gene constructs and the correctness of all PCR-derived sequences were verified by Dye Terminator Cycle Sequencing according to the manufacturer’s instructions (Perkin Elmer, Foster City, CA). For transfection, large scale of plasmid DNAs were prepared by double banded CsCl gradient centrifugation. The purity and identity of plasmid DNAs were further verified by restriction enzyme analysis.
Transient transfection of GGH3 cells
GnRHR-pXP2 reporter gene vector or control vector pXP2 were
transiently expressed in GGH3 cells (30). GGH3
cells were maintained in growth medium [DMEM containing 10% FCS
(Hyclone Laboratories, Logan, UT) and 20 µg/ml gentamicin (Gemini
Bioproducts, Calabasas, CA)] in a humidified atmosphere (37 C)
containing 5% CO2. 5 x 105 cells/well
were seeded in 6-well plates (Costar, Cambridge, MA). Twenty-four
hours after plating, the cells were transfected with 1.5 µg
GnRHR-pXP2 or promoterless pXP2 plus 0.5 µg pCIS-LacZ per well
using 5 µl lipofectamine in 1 ml OPTI-MEM. Five hours later, 1 ml of
DMEM containing 20% FCS was added to each well. Twenty-four hours
after the start of transfection, the medium was replaced with fresh
growth medium, and the cells were allowed to grow for another 24 h
before treatment and functional assays (luciferase assay,
ß-galactosidase assay and cAMP release) were done.
Luciferase and ß-galactosidase assays
After treatment of GGH3 cells with GnRH or other
compounds for indicated times, the cells were washed twice with PBS and
lysed in 150 µl of Reporter Lysis Buffer (Promega). Luciferase
activity in 20 µl of the cell lysate was determined using the
Luciferase Assay System (Promega) in a LuciCount microplate
luminometer (Packard, Meriden, CT). ß- galactosidase activity in
30 µl of the cell lysate was also measured using ß-Galactosidase
Enzyme Assay System (Promega) in a SpectraCount photometric microplate
counter (Packard) and was used as an internal control. The luciferase
activity was normalized for transfection efficiency of each well by
dividing the luciferase activity by ß-galactosidase activity.
Quantitation of cAMP
Forty-eight hours after the start of transfection, the
GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ were
washed twice with DMEM containing 0.1% BSA (Irvine Scientific, Santa
Ana, CA) and 20 µg/ml gentamicin. The cells were then incubated for
6 h with medium alone or Buserelin
(10-11, 10-9, and
10-7 M) in 2 ml DMEM-0.1% BSA-20 µg/ml
gentamicin containing 0.2 mM methylisobutylxanthine (MIX)
to prevent degradation of cAMP. After stimulation, the medium from each
well was collected in tubes containing sufficient theophylline for a
final concentration of 1 mM. The samples were heated (95 C)
for 5 min to destroy phosphodiesterases. RIA of cAMP was performed by a
modification of the method of Steiner et al. (31), with the
addition of the acetylation step described by Harper and Brooker (32).
cAMP antiserum C-1B (prepared in our laboratory, 33) was used at a
titer of 1:5100. This antiserum showed less than 0.1% cross-reaction
with cGMP, 2',3'-cAMP, 5'-cAMP, 3'-cAMP, ADP, GDP, ATP, CTP, MIX, or
theophylline.
Data analysis
Data shown are the means of triplicate assay wells and are
presented as the mean ± SEM of replicates in each
experiment. The SEM was typically less than 10% of the
mean. The data were analyzed by one-way ANOVA followed by Duncan’s
multiple range test, P < 0.05 being considered
significant. Each experiment was repeated three or more times to ensure
the reproducibility of the findings.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and 2). This result indicated that the 1226
bp GnRHR promoter is highly expressed and transcriptionally active in
GGH3 cells.
|
|
; Fig. 2, upper panel). There were no significant effects of GnRH
or Buserelin on the luciferase activity of GGH3 cells
transfected with promoterless vector pXP2 or on the ß-galactosidase
activity of GGH3 cells cotransfected with pCIS-LacZ. Time
course studies using 10-7 M Buserelin revealed
that GnRHR-Luc activity was increased progressively from 1.5–6 h,
with a peak of 111.5 ± 14% above basal levels at 6 h. The
increase in GnRHR-Luc activity was lower at 12 h (39.7 ±
8%) and at 24 h (38.6 ± 4.2%) (Fig. 2, lower
panel). These results indicated that GnRH activates GnRHR promoter
activity in a dose- and time-dependent manner.
Activation of GnRHR gene transcriptional activity by cAMP
To examine the transcriptional regulation of GnRHR gene by cAMP,
GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ or
pXP2 plus pCIS-LacZ were pretreated with medium alone, cholera toxin
(CTX; 5 µg/ml), pertussis toxin (PTX; 100 ng/ml), or dBcAMP (5
mM) for 18 h. The cells were then stimulated with
medium or Buserelin (10-7 M) for 6 h.
Pretreatment with CTX stimulated GnRHR-Luc activity by 148.1 ±
6.5% above basal levels; this was mimicked by pretreatment with dBcAMP
(167.2 ± 9.7%) (Fig. 3).
Pretreatment with CTX did not affect the extent of stimulation of
GnRHR-Luc activity by Buserelin, whereas pretreatment with dBcAMP
enhanced the extent of stimulation of GnRHR-Luc activity by Buserelin
(Fig. 3). Pretreatment with PTX did not induce basal and
Buserelin-stimulated GnRHR-Luc activity (Fig. 3). There were no
significant effects of pretreatment with either CTX, PTX, or dBcAMP on
the luciferase activity of GGH3 cells transfected with
promoterless vector pXP2 or on the ß-galactosidase activity of
GGH3 cells cotransfected with pCIS-LacZ. These results
indicate that cAMP activates transcriptional activity of GnRHR gene;
cAMP also enhances the transcriptional activation of GnRHR gene by
GnRH.
|
). In
addition, an adenylate cyclase inhibitor SQ 22536
[9-(tetrahydro-2'-furyl)adenine] (34) was used to determine the
contribution of cAMP to the transcriptional regulation of GnRHR gene by
GnRH. GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ
or pXP2 plus pCIS-LacZ were pretreated with medium alone or 0.5
mM SQ 22536 for 1 h. The cells were then incubated
with medium, Buserelin (10-7 M), or Buserelin
(10-7 M) plus 0.5 mM SQ 22536 for
6 h. SQ 22536 did not affect the basal GnRHR-Luc activity (Fig. 5) but significantly reduced
Buserelin-activated GnRHR-Luc activity, which was even lower after
pretreatment with SQ 22536 (Fig. 5). However, SQ 22536 did not
completely abolish the Buserelin activation of GnRHR-Luc activity (Fig. 5). No further inhibition of Buserelin-stimulated GnRHR-Luc activity
was found by pretreatment of the cells with 5 mM SQ 22536
for 1 h followed by incubation with Buserelin (10-7
M) plus 5 mM SQ 22536 for 6 h (data not
shown). There were no significant effects of SQ 22536 on the luciferase
activity of GGH3 cells transfected with promoterless vector
pXP2 or on the ß-galactosidase activity of GGH3 cells
cotransfected with pCIS-LacZ. These results indicate that GnRH is able
to stimulate cAMP production and GnRH activates GnRHR transcriptional
activity, in part, through the cAMP signal transduction pathway.
|
|
). Transient expression of the
constructs containing one of 5'-deleted promoter sequences or original
promoter (1226 bp) in GGH3 cells revealed that basal
GnRHR-Luc activity was retained after 5'-deletion at position
-456, -381 or -331 but was significantly decreased after 5'-deletion
at position -255 (Fig. 6). Similarly, stimulation of GnRHR-Luc
activity by Buserelin (10-7 M, 6 h) or by
dBcAMP (5 mM, 18 h) were consistently retained after
5'-deletion of GnRHR promoter at positions -456, -381, and -331, and
were significantly decreased after 5'-deletion of GnRHR promoter at
positions -255 (Fig. 6). However, the -255 GnRHR promoter construct
still retained the responsiveness to Buserelin and dBcAMP and the
proportions of activity remained were similar under both stimulation
conditions. These results indicate that elements located between -331
and -255 are necessary for transcriptional activity of GnRHR gene in
GGH3 cells and that the response elements on the mouse
GnRHR gene to both GnRH and cAMP appear to reside at two different
sites: between -331 to -255 and between -255 to +62 (relative to the
major transcription start site).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
GnRH was shown to stimulate the synthesis of its own receptor (36). In
addition, GnRH up-regulates or down-regulates the mRNA levels of its
receptor, dependent on the pattern of administration with GnRH (5, 6, 7, 8, 9, 10, 11, 12, 13).
In the present study, both GnRH and a GnRH agonist significantly
stimulated mGnRHR gene promoter activity in GGH3 cells in a
dose-dependent manner, suggesting that homologous regulation of GnRHR
gene expression also occurs at the transcriptional level. In addition,
the present results indicate that GnRH activates GnRHR transcriptional
activity in a time-dependent manner. The GnRHR-Luc activity was
stimulated by Buserelin progressively from 1.5–6 h, and the increase
in GnRHR-Luc activity was significantly lower with longer exposure of
the cells to Buserelin (12 h and 24 h). These results suggest that
short-term treatment with GnRH agonist up-regulates the GnRHR
transcriptional activity, whereas long-term treatment with GnRH agonist
desensitize the GnRHR transcriptional activity in responses to GnRH
agonist. Similarly, GnRH has been shown to cause transcriptional
stimulation of the gonadotropin -subunit promoter in the period of
4–6 h followed by desensitization in a period of 6–24 h in T3
cells (37). In addition, several earlier reports demonstrated that
continuous treatment (hours or days) with GnRH or its agonist
down-regulates the levels of GnRHR mRNA; the same treatment also
down-regulates GnRHR numbers assessed by radioligand binding (9, 10, 11, 12, 13).
Thus the down-regulation of GnRHR receptor number may, in part,
contribute to the homologous desensitization of GnRHR
transcriptional activity.
GnRHR is a member of the G protein-coupled receptor (GPCR) family (38).
The GnRHR appears to couple to multiple G proteins (39). In
GGH3 cells, GnRHR is coupled to Gq/11 as
well as to Gs, which activates adenylate cyclase,
leading to production of cAMP (35, 40, 41, 42). Recently, a study relying
on palmitoylation of G proteins and overexpression of different G
protein subunit cDNAs, showed that GnRHR couples to
Gq/11 as well as to Gs and
Gi in both GGH3 cells and pituitary
gonadotropes, suggesting that similar signal transduction pathways are
employed to mediate GnRH action in GGH3 cells and in
pituitary cells and that adenylate cyclase-cAMP signal transduction
pathway is involved in GnRH action (43). In the earlier studies, GnRH
induced the levels of cAMP in hemipituitary and whole pituitary
(18, 19, 20). However, in some other studies, GnRH agonist had no
significant effect on cAMP levels in primary gonadotropes (17). This
difference may be due to the different estrous cycle stages at which
pituitary was collected, as pituitary levels of G proteins
(Gs, Gi, Go, and ß
subunit) were shown to be significantly modulated during the various
phases of the rat estrous cycle (44). Furthermore, it has been
demonstrated that cAMP or its analogs can mimic GnRH stimulated
increases in GnRHR levels in cultured rat pituitary cells, suggesting
that cAMP may participate in regulation of GnRHR (21, 22). The present
results show that GnRH agonist stimulates cAMP levels in
GGH3 cells, consistent with the previous finding that GnRHR
couples to Gs to activate adenylate cyclase and
subsequent production of cAMP (35, 40, 41, 42). On the other hand, the
present results show that CTX stimulated GnRHR-Luc activity, which was
mimicked by treatment with dBcAMP. In addition, dBcAMP augmented
GnRH stimulation of GnRHR-Luc activity. These results demonstrate that
cAMP can activate GnRHR transcriptional activity and may mediate GnRH
regulation of GnRHR transcriptional activity. Furthermore, an adenylate
cyclase inhibitor SQ 22536 partially blocked GnRH agonist-stimulated
GnRHR promoter activity, supporting the view that GnRH activates GnRHR
promoter activity, in part, through cAMP signal transduction pathway.
SQ 22536 did not affect the influence of overexpression of
mitogen-activated protein kinase (MAPK) kinase (Raf-1) on GnRHR-Luc
activity, suggesting no effect of SQ 22536 on PKC/MAPK pathway
(our unpublished observation). Several earlier studies showed
that pituitary GnRHR number and the levels of GnRHR mRNA change
during the estrous cycle and during pregnancy and lactation and are
associated with changes in sensitivity of gonadotrope to GnRH and
levels of serum gonadotropin (2, 3, 4), suggesting that GnRH may be
involved in the regulation of its own receptor, which, in turn,
mediates regulation of gonadotropin synthesis and release. Indeed GnRH
has been shown to regulate mRNA levels and synthesis of its own
receptor (2). Because GGH3 cells and pituitary primary
cells have similar GnRHR-G protein coupling and signal transduction
pathways, the present results imply that the homologous regulation of
GnRHR at the transcriptional level via cAMP signal transduction pathway
participates in the physiological regulation of pituitary GnRHR during
reproductive cycle. The other pathways involved in GnRH regulation of
GnRHR gene transcription may include Gq/11-mediated
activation of PLC, leading to activation of PKC and MAPK cascade
(unpublished observation). Similarly, PKC and MAPK signal transduction
pathway have been shown to mediate activation of gonadotropin
-subunit promoter activity by GnRH (45). A recent report showed that
frequency of calcium pulsatile signals regulates GnRHR gene expression,
suggesting that GnRH-stimualted intracellular Ca2+ signals
may also be involved in mediation of the transcriptional regulation of
GnRHR gene by GnRH (5).
Sequence analysis of 5'-flanking regions of GnRHR gene from several
species revealed the presence of consensus sequences that may have
significance in controlling the expression of the gene (23, 24, 25, 26, 27, 28). A cAMP
response element (CRE)-like sequence has been identified in rat and
human GnRHR gene (25, 27). In addition, two consensus sequences similar
to the GnRH response elements (70% and 75% identity, respectively)
found in the gonadotropin -subunit promoter were identified in
mGnRHR gene at position -354/-335 and -615/-600 (relative to the
major transcription start site) (23). In the present study, a
progressive 5' deletion analysis revealed that sequence elements
located between -331 and -255 of the mouse GnRHR gene are necessary
for transcriptional activity of GnRHR gene in GGH3 cells
and that the response elements on the GnRHR gene to both GnRH and cAMP
appear to reside at two different sites: between -331 and -255
(relative to the major transcription start site) and between -255 and
+62 (relative to the major transcription start site). The present
results are consistent with the reports (46, 47) that basal activity of
mGnRHR promoter is dependent on the steroidogenic factor-1 binding site
(SF-1; -183 to -175, relative to the major transcription start site),
activator protein-1 (AP-1; -274 to -268, relative to the major
transcription start site) binding site and a GnRHR activating sequence
(GRAS; -329 to -318, relative to the major transcription start site).
These suggest that the transcriptional factors acting through the SF-1,
AP-1, and GRAS sites (46, 47) may be involved in the mediation of the
transcriptional activation of GnRHR gene by cAMP and GnRH. Because no
CRE-like sequence was identified in mGnRHR gene (23, 24) and the
supposed GnRH responsive elements are upstream of the 331 bp (relative
to the major transcription start site) of the 5'-flanking region of
mGnRHR gene, the transcriptional activation of GnRHR gene by cAMP and
GnRH may be not mediated by the CRE binding proteins.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received March 18, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T3–1 cells.
Endocrinology 135:1165–1170[Abstract]
T3–1 cells by GnRH agonist. Anti-Cancer
Drugs 8:369–375[CrossRef][Medline]
q family members couple parathyroid hormone
(PTH)/PTH-related peptide and calcitonin receptors to phospholipase C
in COS-7 cells. Mol Endocrinol 10:566–574[Abstract]
promoter in transfected T3 gonadotrope cells. Endocrinology 134:568–573[Abstract]
-subunit
promoter by gonadotropin-releasing hormone. Mol Cell Biol 15:3531–3539[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  N. J. Westphal and A. F. Seasholtz Gonadotropin-Releasing Hormone (GnRH) Positively Regulates Corticotropin-Releasing Hormone-Binding Protein Expression via Multiple Intracellular Signaling Pathways and a Multipartite GnRH Response Element in {alpha}T3-1 Cells Mol. Endocrinol., November 1, 2005; 19(11): 2780 - 2797. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Cheng and P. C. K. Leung Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans Endocr. Rev., April 1, 2005; 26(2): 283 - 306. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Sadie, G. Styger, and J. Hapgood Expression of the Mouse Gonadotropin-Releasing Hormone Receptor Gene in {alpha}T3-1 Gonadotrope Cells Is Stimulated by Cyclic 3',5'-Adenosine Monophosphate and Protein Kinase A, and Is Modulated by Steroidogenic Factor-1 and Nur77 Endocrinology, May 1, 2003; 144(5): 1958 - 1971. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Liu, I. Usui, L. G. Evans, D. A. Austin, P. L. Mellon, J. M. Olefsky, and N. J. G. Webster Involvement of Both Gq/11 and Gs Proteins in Gonadotropin-releasing Hormone Receptor-mediated Signaling in Lbeta T2 Cells J. Biol. Chem., August 23, 2002; 277(35): 32099 - 32108. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. W. Cheng and P. C. K. Leung Human Chorionic Gonadotropin-Activated cAMP Pathway Regulates Human Placental GnRH Receptor Gene Transcription in Choriocarcinoma JEG-3 Cells J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3291 - 3299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Castro-Fernandez, J. A. Janovick, S. P. Brothers, R. A. Fisher, T. H. Ji, and P. M. Conn Regulation of RGS3 and RGS10 Palmitoylation by GnRH Endocrinology, April 1, 2002; 143(4): 1310 - 1317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Maya-Nunez and P. Michael Conn Cyclic Adenosine 3',5'-Monophosphate (cAMP) and cAMP Responsive Element-Binding Protein Are Involved in the Transcriptional Regulation of Gonadotropin-Releasing Hormone (GnRH) Receptor by GnRH and Mitogen-Activated Protein Kinase Signal Transduction Pathway in GGH3 Cells Biol Reprod, August 1, 2001; 65(2): 561 - 567. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Lin, J. A. Janovick, S. Brothers, P. M. Conn, and R. E. Peter Molecular Cloning and Expression of Two Type One Somatostatin Receptors in Goldfish Brain Endocrinology, November 1, 1999; 140(11): 5211 - 5219. [Abstract] [Full Text]
|
|
|
|
|
|
G. Maya-Núñez and P. M. Conn Transcriptional Regulation of the Gonadotropin-Releasing Hormone Receptor Gene Is Mediated in Part by a Putative Repressor Element and by the Cyclic Adenosine 3',5'-Monophosphate Response Element Endocrinology, August 1, 1999; 140(8): 3452 - 3458. [Abstract] [Full Text]
|
|
|
|
 |
|
 E. R. Norwitz, K.-H. Jeong, and W. W. Chin Molecular Mechanisms of Gonadotropin-Releasing Hormone Receptor Gene Regulation Reproductive Sciences, July 1, 1999; 6(4): 169 - 178. [Abstract] [PDF]
|
|
|
|
|
|
B. R. White, D. L. Duval, J. M. Mulvaney, M. S. Roberson, and C. M. Clay Homologous Regulation of the Gonadotropin-Releasing Hormone Receptor Gene Is Partially Mediated by Protein Kinase C Activation of an Activator Protein-1 Element Mol. Endocrinol., April 1, 1999; 13(4): 566 - 577. [Abstract] [Full Text]
|
|
|
|
|
|
E. R. Norwitz, G. R. Cardona, K.-H. Jeong, and W. W. Chin Identification and Characterization of the Gonadotropin-releasing Hormone Response Elements in the Mouse Gonadotropin-releasing Hormone Receptor Gene J. Biol. Chem., January 8, 1999; 274(2): 867 - 880. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Lin and P. M. Conn Transcriptional Activation of Gonadotropin-Releasing Hormone (GnRH) Receptor Gene by GnRH: Involvement of Multiple Signal Transduction Pathways Endocrinology, January 1, 1999; 140(1): 358 - 364. [Abstract] [Full Text]
|
|
|
|
|
|
H. Pincas, J.-N. Laverriere, and R. Counis Pituitary Adenylate Cyclase-activating Polypeptide and Cyclic Adenosine 3',5'-Monophosphate Stimulate the Promoter Activity of the Rat Gonadotropin-releasing Hormone Receptor Gene via a Bipartite Response Element in Gonadotrope-derived Cells J. Biol. Chem., June 22, 2001; 276(26): 23562 - 23571. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||
