Endocrinology Vol. 139, No. 9 3896-3902
Copyright © 1998 by The Endocrine Society
Transcriptional Activation of Gonadotropin-Releasing Hormone (GnRH) Receptor Gene by GnRH and Cyclic Adenosine Monophosphate1
Xinwei Lin and
P. Michael Conn
Oregon Regional Primate Research Center (X.L., P.M.C.), Beaverton,
Oregon 97006; Department of Physiology and Pharmacology (P.M.C.),
Oregon Health Sciences University, Portland, Oregon 97201
Address all correspondence and requests for reprints to: P. Michael Conn, 505 NW 185th Avenue, Beaverton, Oregon 97006. E-mail:
connm{at}ohsu.edu
 |
Abstract
|
|---|
GnRH appears to regulate messenger RNA levels and synthesis of its own
receptor (GnRHR). In this study, we examined the regulation of GnRHR
gene transcription by GnRH and cAMP in the GGH3 cell line
(GH3 cells stably expressing GnRHR). Transient transfection
of GGH3 cells with luciferase reporter gene vector
(GnRHR-pXP2) containing a 1226-bp promoter fragment (-1164 to +62,
relative to the major transcription start site) of mouse GnRHR gene
resulted in an increase in reporter gene (GnRHR-Luc) activity (11- to
22-fold) compared with the promoterless vector. GnRH or a GnRH agonist
(Buserelin) significantly stimulated the GnRHR-Luc activity in a
dose-dependent manner. Time-course studies using 10-7
M Buserelin revealed that GnRHR-Luc activity increased
progressively from 1.56 h, with a peak at 6 h. The increase in
GnRHR-Luc activity was lower at 12 and 24 h. Both cholera toxin
and dBcAMP significantly stimulated GnRHR-Luc activity. Pretreatment
with dBcAMP also enhanced the extent of stimulation of GnRHR-Luc
activity in response to Buserelin. Pertussis toxin did not induce basal
or Buserelin-stimulated GnRHR-Luc activity. Treatment of
GGH3 cells with 10-9 or 10-7
M Buserelin for 6 h was sufficient to stimulate a
significant increase in cAMP release. An adenylate cyclase inhibitor SQ
22536 did not affect the basal GnRHR-Luc activity but significantly
reduced Buserelin-activated GnRHR-Luc activity. These results suggest
that GnRH and cAMP activate transcriptional activity of the GnRHR gene
and that GnRH activates GnRHR transcriptional activity, in part,
through the cAMP pathway. Progressive 5'-deletion analysis revealed
that basal and Buserelin- or dBcAMP-stimulated GnRHR-Luc activity were
consistently retained after 5'-deletion at position -456, -381, or
-331 relative to the major transcription start site but were
significantly decreased after subsequent truncation of the promoter
from -331 to -255 relative to the major transcription start site.
However, the -255 construct still retained responsiveness to Buserelin
and dBcAMP, and the relative activity remained similar under both
stimulation conditions. These results suggest that elements located
between -331 and -255 necessary for transcriptional activity of the
GnRHR gene in GGH3 cells, and that the response elements on
the mouse GnRHR gene for both GnRH and cAMP reside at two different
sites: between -331 and -255 and between -255 and +62.
 |
Introduction
|
|---|
GnRH stimulates synthesis and release of pituitary gonadotropins (LH and FSH), acting
through the specific GnRH receptor (GnRHR) on the plasma membrane (1).
The appearance of the GnRHR on the cell surface is a combination of
processes of internalization, degradation, recycling, unmasking, and
new synthesis of the receptor (1). Using a radioactive ligand binding
assay and molecular approaches, it was demonstrated that changes in
GnRHR number (2) and the levels of GnRHR messenger RNA (mRNA) (3, 4)
occur during the estrous cycle and are associated with changes in
sensitivity of gonadotrope to GnRH and levels of serum gonadotropin,
suggesting that GnRHR is an important site for regulation of
gonadotropin release.
GnRH appears to regulate mRNA levels and synthesis of its own receptor
(GnRHR). GnRHR was shown to undergo biphasic (down- and up-regulation)
homologous regulation by physiological concentrations of GnRH (3). In
addition, pulsatility of GnRH exposure maintains GnRHR levels and
subtle increases in the frequency of GnRH pulse sensitize the
gonadotrope by increasing GnRHR number (3). Molecular cloning of GnRHR
complementary DNA (cDNA) from several species has triggered an
extensive study of hormonal regulation of GnRHR gene expression.
Results from these studies indicated that pulsatile GnRH up-regulates
the expression of its own receptor mRNA (5, 6, 7, 8), whereas high-amplitude
pulsatile or continuous treatment with GnRH generally down-regulates
the levels of GnRHR mRNA (9, 10, 11, 12, 13). However, it is unclear if
homologous regulation of GnRHR gene expression occurs at
transcriptional and (or) posttranscriptional levels.
cAMP is an important second messenger in many signal transduction
systems. cAMP activates protein kinase A, which, in turn, mediates
phosphorylation of a number of cytoplasmic and nuclear proteins to
ultimately influence the transcriptional regulation of various genes
through distinct, cAMP-inducible promoter responsive sites (14). There
is evidence that cAMP enhances gene expression and synthesis of
and
LH and FSH ß subunits and release of LH and FSH (15, 16). However,
GnRH stimulation of gonadotropin secretion appears to be independent of
changes in cAMP (17), although GnRH was shown to be able to induce the
levels of cAMP (18, 19, 20). Moreover, it has been demonstrated that cAMP
or its analogs can mimic GnRH to increase GnRHR levels in cultured rat
pituitary cells (21, 22), suggesting that cAMP may participate in
regulation of GnRHR.
Recently, isolation and characterization of the 5'-flanking region of
GnRHR gene from human, mouse, rat, and sheep were accomplished
(23, 24, 25, 26, 27, 28), facilitating the study of transcriptional regulation of GnRHR
gene. In the present study we examined the regulation of GnRHR gene
transcription by GnRH and cAMP and cross-talk between GnRH and cAMP in
the GGH3 cell line (GH3 cells stably expressing
GnRHR).
 |
Materials and Methods
|
|---|
Materials
Luciferase reporter gene vector (GnRHR-pXP2) with a 1226 bp
promoter fragment (-1164 to +62 relative to the major transcription
start site) of mouse GnRHR gene (23) and an expression vector
(pCIS-LacZ) expressing ß-galactosidase driven by cytomegalovirus
(CMV) promoter (29) were generously provided by Dr. W. W. Chin and
Dr. Tae H. Ji, respectively. Natural sequence GnRH was provided
by the National Pituitary Agency. A GnRH agonist, Buserelin
(D-tert-butyl-Ser6-des-Gly10-Pro9-ethylamide-GnRH),
was a kind gift from Hoechst-Roussel Phamaceuticals (Somerville, NJ).
Cholera toxin and pertussis toxin (List Biological Laboratories,
Campbell, CA), dibutyryl cAMP (Sigma Chemical Co., St. Louis, MO), and
SQ 22536 (Calbiochem, La Jolla, CA) were obtained from the sources
indicated. DMEM, OPTI-MEM, lipofectamine and PCR reagents were
purchased from Life Technologies (Grand Island, NY). Restriction
enzymes, modified enzymes and competent cells for subcloning were
purchased from Promega (Madison, WI). Other reagents were of the
highest degree of purity available from commercial sources.
Methods
Construction of reporter plasmids. A 1226-bp fragment
(-1164 to +62 relative to the major transcription start site) of
5'-flanking region of mouse GnRHR gene (23) was fused into a luciferase
reporter gene vector (pXP2) and designated as GnRHR-pXP2
reporter gene construct. Promoterless pXP2 vector was generated by
digestion of the GnRHR-pXP2 construct with BamH I and
BglII to delete the GnRHR gene fragment and re-ligation of
the vector. An expression vector (pCIS-LacZ) expressing
ß-galactosidase driven by CMV promoter was used as an internal
control (29).
Progressive 5' deletions in the 5'-flanking region of mouse GnRHR gene
were generated by PCR using a sense primer located at the different
sites of deletion and an antisense primer (TTGCTCTCCAGCGGTTCCAT)
complementary to the sequence of 5'-end of luciferase coding region,
with GnRHR-pXP2 reporter gene vector as template. The sequences of the
sense primers are: CTAGCTATGGATCCGTCGTGTGAC for deletion at
position -456 (relative to the major transcription start site),
CAAACAACAGGATCCAAATTGGATCGG for deletion at -381 (relative
to the major transcription start site),
ATTTCATTTTGGATCCGTCTAGTCAC for deletion at -331 (relative
to the major transcription start site), and
GTCACTTTCGGGATCCGAATTAGACTC for deletion at -255 (relative
to the major transcription start site). A restriction enzyme site
(BamHI) was introduced in each of the sense primers
(underlined). The resulting DNA fragments contains
restriction enzyme sites BamHI and XhoI at their
5'- and 3'-ends, respectively. The DNA fragments were then digested
with BamHI and XhoI and subcloned into the same
sites in the pXP2 vector.
The identity of all reporter gene constructs and the correctness of all
PCR-derived sequences were verified by Dye Terminator Cycle Sequencing
according to the manufacturers instructions (Perkin Elmer, Foster
City, CA). For transfection, large scale of plasmid DNAs were prepared
by double banded CsCl gradient centrifugation. The purity and identity
of plasmid DNAs were further verified by restriction enzyme
analysis.
Transient transfection of GGH3 cells
GnRHR-pXP2 reporter gene vector or control vector pXP2 were
transiently expressed in GGH3 cells (30). GGH3
cells were maintained in growth medium [DMEM containing 10% FCS
(Hyclone Laboratories, Logan, UT) and 20 µg/ml gentamicin (Gemini
Bioproducts, Calabasas, CA)] in a humidified atmosphere (37 C)
containing 5% CO2. 5 x 105 cells/well
were seeded in 6-well plates (Costar, Cambridge, MA). Twenty-four
hours after plating, the cells were transfected with 1.5 µg
GnRHR-pXP2 or promoterless pXP2 plus 0.5 µg pCIS-LacZ per well
using 5 µl lipofectamine in 1 ml OPTI-MEM. Five hours later, 1 ml of
DMEM containing 20% FCS was added to each well. Twenty-four hours
after the start of transfection, the medium was replaced with fresh
growth medium, and the cells were allowed to grow for another 24 h
before treatment and functional assays (luciferase assay,
ß-galactosidase assay and cAMP release) were done.
Luciferase and ß-galactosidase assays
After treatment of GGH3 cells with GnRH or other
compounds for indicated times, the cells were washed twice with PBS and
lysed in 150 µl of Reporter Lysis Buffer (Promega). Luciferase
activity in 20 µl of the cell lysate was determined using the
Luciferase Assay System (Promega) in a LuciCount microplate
luminometer (Packard, Meriden, CT). ß- galactosidase activity in
30 µl of the cell lysate was also measured using ß-Galactosidase
Enzyme Assay System (Promega) in a SpectraCount photometric microplate
counter (Packard) and was used as an internal control. The luciferase
activity was normalized for transfection efficiency of each well by
dividing the luciferase activity by ß-galactosidase activity.
Quantitation of cAMP
Forty-eight hours after the start of transfection, the
GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ were
washed twice with DMEM containing 0.1% BSA (Irvine Scientific, Santa
Ana, CA) and 20 µg/ml gentamicin. The cells were then incubated for
6 h with medium alone or Buserelin
(10-11, 10-9, and
10-7 M) in 2 ml DMEM-0.1% BSA-20 µg/ml
gentamicin containing 0.2 mM methylisobutylxanthine (MIX)
to prevent degradation of cAMP. After stimulation, the medium from each
well was collected in tubes containing sufficient theophylline for a
final concentration of 1 mM. The samples were heated (95 C)
for 5 min to destroy phosphodiesterases. RIA of cAMP was performed by a
modification of the method of Steiner et al. (31), with the
addition of the acetylation step described by Harper and Brooker (32).
cAMP antiserum C-1B (prepared in our laboratory, 33) was used at a
titer of 1:5100. This antiserum showed less than 0.1% cross-reaction
with cGMP, 2',3'-cAMP, 5'-cAMP, 3'-cAMP, ADP, GDP, ATP, CTP, MIX, or
theophylline.
Data analysis
Data shown are the means of triplicate assay wells and are
presented as the mean ± SEM of replicates in each
experiment. The SEM was typically less than 10% of the
mean. The data were analyzed by one-way ANOVA followed by Duncans
multiple range test, P < 0.05 being considered
significant. Each experiment was repeated three or more times to ensure
the reproducibility of the findings.
 |
Results
|
|---|
Activation of GnRHR gene transcriptional activity by GnRH
Transient transfection of GGH3 cells with GnRHR-pXP2,
a luciferase reporter gene vector containing a 1226 bp promoter
fragment (-1164 to +62, relative to the major transcription start
site) of the mouse GnRHR (mGnRHR) gene, resulted in an increase in
GnRHR-luciferase reporter gene (GnRHR-Luc) activity (11- to 22-fold)
compared with the GGH3 cells transfected with promoterless
pXP2 vector (Figs. 1
and 2
). This result indicated that the 1226
bp GnRHR promoter is highly expressed and transcriptionally active in
GGH3 cells.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1. Dose-response of GnRH activation of GnRHR-Luc
activity. Forty-eight hours after transfection of GGH3
cells with GnRHR-pXP2 plus pCIS-LacZ or pXP2 plus pCIS-LacZ, the cells
were incubated with medium or the indicated doses of GnRH for 6 h.
The cells were then washed twice with PBS and lysed in Reporter lysis
buffer. Luciferase activity in 20 µl of the cell lysate and
ß-galactosidase activity in 30 µl of the cell lysate were measured.
Luciferase activity was calculated as luciferase
activity/ß-galactosidase activity assayed from each well. The
luciferase activity was then normalized as fold-induction of luciferase
activity from GGH3 cells transfected with GnRHR-pXP2 plus
pCIS-LacZ over that from GGH3 cells transfected with
promoterless pXP2 plus pCIS-LacZ. The data shown are the means of
triplicate determinations. Error bars show the
SEM. Significant differences at P <
0.05 between groups are designated by different lower case
letters above the bars.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Figure 2. Dose-response (upper panel) and
time-course (lower panel) of activation of GnRHR-Luc
activity by GnRH agonist Buserelin. Forty-eight hours after
transfection of GGH3 cells with GnRHR-pXP2 plus pCIS-LacZ
or pXP2 plus pCIS-LacZ, the cells were incubated with medium or the
indicated doses of Buserelin for 6 h. For time course studies, the
cells were treated with medium or Buserelin (10-7
M) for different periods of time and harvested at the same
time. The cells were then lysed, and luciferase and ß-galactosidase
activities were measured. Luciferase activity was calculated as
luciferase activity/ß-galactosidase activity and then normalized as
fold induction over that of pXP2. The data shown are the means of
triplicate determinations. Error bars show the
SEM. Significant differences at P <
0.05 between groups are designated by different lower case
letters above the bars.
|
|
To examine the transcriptional regulation of GnRHR gene by GnRH,
GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ or
promoterless pXP2 plus pCIS-LacZ were treated with medium, GnRH
(10-11, 10-9 and 10-7
M) or a metabolically stable GnRH agonist Buserelin
(10-11, 10-9 and 10-7
M) for 6 h. Both GnRH and Buserelin stimulated a
significant increase in the GnRHR-Luc activity in a dose-dependent
manner, with 128.4 ± 9.3% and 120 ± 5.9% above
basal levels with 10-7 M GnRH and
10-7 M Buserelin, respectively (Fig. 1
; Fig. 2
, upper panel). There were no significant effects of GnRH
or Buserelin on the luciferase activity of GGH3 cells
transfected with promoterless vector pXP2 or on the ß-galactosidase
activity of GGH3 cells cotransfected with pCIS-LacZ. Time
course studies using 10-7 M Buserelin revealed
that GnRHR-Luc activity was increased progressively from 1.56 h,
with a peak of 111.5 ± 14% above basal levels at 6 h. The
increase in GnRHR-Luc activity was lower at 12 h (39.7 ±
8%) and at 24 h (38.6 ± 4.2%) (Fig. 2
, lower
panel). These results indicated that GnRH activates GnRHR promoter
activity in a dose- and time-dependent manner.
Activation of GnRHR gene transcriptional activity by cAMP
To examine the transcriptional regulation of GnRHR gene by cAMP,
GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ or
pXP2 plus pCIS-LacZ were pretreated with medium alone, cholera toxin
(CTX; 5 µg/ml), pertussis toxin (PTX; 100 ng/ml), or dBcAMP (5
mM) for 18 h. The cells were then stimulated with
medium or Buserelin (10-7 M) for 6 h.
Pretreatment with CTX stimulated GnRHR-Luc activity by 148.1 ±
6.5% above basal levels; this was mimicked by pretreatment with dBcAMP
(167.2 ± 9.7%) (Fig. 3
).
Pretreatment with CTX did not affect the extent of stimulation of
GnRHR-Luc activity by Buserelin, whereas pretreatment with dBcAMP
enhanced the extent of stimulation of GnRHR-Luc activity by Buserelin
(Fig. 3
). Pretreatment with PTX did not induce basal and
Buserelin-stimulated GnRHR-Luc activity (Fig. 3
). There were no
significant effects of pretreatment with either CTX, PTX, or dBcAMP on
the luciferase activity of GGH3 cells transfected with
promoterless vector pXP2 or on the ß-galactosidase activity of
GGH3 cells cotransfected with pCIS-LacZ. These results
indicate that cAMP activates transcriptional activity of GnRHR gene;
cAMP also enhances the transcriptional activation of GnRHR gene by
GnRH.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 3. Activation of GnRHR-Luc by cAMP. Forty-eight hours
after transfection of GGH3 cells with GnRHR-pXP2 plus
pCIS-LacZ or pXP2 plus pCIS-LacZ, the cells were pretreated with medium
alone, cholera toxin (CTX; 5 ug/ml), pertussis toxin (PTX; 100 ng/ml),
or a cAMP analog dibutyryl cAMP (dBcAMP; 5 mM) for 18
h. The cells were then stimulated with medium or Buserelin
(10-7 M) for 6 h. The cells were then
lysed, and luciferase and ß-galactosidase activities were measured.
Luciferase activity was calculated as luciferase
activity/ß-galactosidase activity and then normalized as fold
induction over that of pXP2. The data shown are the means of triplicate
determinations. Error bars show the SEM.
Significant differences at P < 0.05 between groups
are designated by different lower case letters above the
bars.
|
|
Cross-talk between GnRH and cAMP in transcriptional regulation of
GnRHR gene
GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ
were used to examine the influence of GnRH on the cAMP production.
Treatment with 10-9 or 10-7 M
Buserelin for 6 h was sufficient to stimulate a significant
increase in cAMP release (Fig. 4
). In
addition, an adenylate cyclase inhibitor SQ 22536
[9-(tetrahydro-2'-furyl)adenine] (34) was used to determine the
contribution of cAMP to the transcriptional regulation of GnRHR gene by
GnRH. GGH3 cells transfected with GnRHR-pXP2 plus pCIS-LacZ
or pXP2 plus pCIS-LacZ were pretreated with medium alone or 0.5
mM SQ 22536 for 1 h. The cells were then incubated
with medium, Buserelin (10-7 M), or Buserelin
(10-7 M) plus 0.5 mM SQ 22536 for
6 h. SQ 22536 did not affect the basal GnRHR-Luc activity (Fig. 5
) but significantly reduced
Buserelin-activated GnRHR-Luc activity, which was even lower after
pretreatment with SQ 22536 (Fig. 5
). However, SQ 22536 did not
completely abolish the Buserelin activation of GnRHR-Luc activity (Fig. 5
). No further inhibition of Buserelin-stimulated GnRHR-Luc activity
was found by pretreatment of the cells with 5 mM SQ 22536
for 1 h followed by incubation with Buserelin (10-7
M) plus 5 mM SQ 22536 for 6 h (data not
shown). There were no significant effects of SQ 22536 on the luciferase
activity of GGH3 cells transfected with promoterless vector
pXP2 or on the ß-galactosidase activity of GGH3 cells
cotransfected with pCIS-LacZ. These results indicate that GnRH is able
to stimulate cAMP production and GnRH activates GnRHR transcriptional
activity, in part, through the cAMP signal transduction pathway.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 4. Dose-response of Buserelin-stimualted cAMP
release. Forty-eight hours after transfection of GGH3 cells
with GnRHR-pXP2 plus pCIS-LacZ, the cells were incubated with medium or
indicated concentrations of Buserelin and 0.2 mM MIX for
6 h. The media were collected and were then heated at 95 C for 5
min with 1 mM theophylline, and their cAMP contents were
determined by RIA. The data shown are the means of triplicate
determinations. Error bars show the SEM.
Significant differences at P < 0.05 between groups
are designated by different lower case letters above the
bars.
|
|

View larger version (48K):
[in this window]
[in a new window]
|
Figure 5. Effect of an adenylate cyclase inhibitor SQ 22536
on basal and Buserelin-stimulated GnRHR-Luc activity. Forty-eight hours
after transfection of GGH3 cells with GnRHR-pXP2 plus
pCIS-LacZ or pXP2 plus pCIS-LacZ, the cells were pretreated with medium
alone or 0.5 mM SQ 22536 for 1 h. The cells were then
incubated with medium, Buserelin (10-7 M), or
Buserelin (10-7 M) plus 0.5 mM SQ
22536 for 6 h. The cells were then lysed, and luciferase and
ß-galactosidase activities were measured. Luciferase activity was
calculated as luciferase activity/ß-galactosidase activity and then
normalized as fold induction over that of pXP2. The data shown are the
means of triplicate determinations. Error bars show the
SEM. Significant differences at P <
0.05 between groups are designated by different lower case
letters above the bars.
|
|
Progressive 5' deletion analysis of sequence required for basal and
GnRH- or cAMP-activated transcriptional activity of GnRHR gene
To determine the GnRH or cAMP responsive sequence, four 5'
deletions in the 1226 bp 5'-flanking region of mouse GnRHR gene was
generated at positions -456, -381, -331, and -255 (relative to the
major transcription start site), respectively (Fig. 6
). Transient expression of the
constructs containing one of 5'-deleted promoter sequences or original
promoter (1226 bp) in GGH3 cells revealed that basal
GnRHR-Luc activity was retained after 5'-deletion at position
-456, -381 or -331 but was significantly decreased after 5'-deletion
at position -255 (Fig. 6
). Similarly, stimulation of GnRHR-Luc
activity by Buserelin (10-7 M, 6 h) or by
dBcAMP (5 mM, 18 h) were consistently retained after
5'-deletion of GnRHR promoter at positions -456, -381, and -331, and
were significantly decreased after 5'-deletion of GnRHR promoter at
positions -255 (Fig. 6
). However, the -255 GnRHR promoter construct
still retained the responsiveness to Buserelin and dBcAMP and the
proportions of activity remained were similar under both stimulation
conditions. These results indicate that elements located between -331
and -255 are necessary for transcriptional activity of GnRHR gene in
GGH3 cells and that the response elements on the mouse
GnRHR gene to both GnRH and cAMP appear to reside at two different
sites: between -331 to -255 and between -255 to +62 (relative to the
major transcription start site).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 6. Progressive 5' deletion analysis of sequence
required for basal and GnRH- or cAMP-activated transcriptional activity
of GnRHR gene. Four 5' deletions in the 1226 bp promoter fragment
(-1164 to +62, relative to the major transcription start site) of
mouse GnRHR gene was generated at positions -456, -381, -331, and
-255 (relative to the major transcription start site), respectively.
The major transcription start site is indicated by a bent
arrow. Forty-eight hours after transfection of GGH3
cells with GnRHR-pXP2 containing one of 5'-deleted promoter sequences
or original promoter (1226 bp) plus pCIS-LacZ or pXP2 plus pCIS-LacZ,
the cells were treated with medium or Buserelin (10-7
M) for 6 h, or were treated with medium or dBcAMP (5
mM) for 18 h. The cells were then lysed, and
luciferase and ß-galactosidase activities were measured. Luciferase
activity was calculated as luciferase activity/ß-galactosidase
activity and then normalized as fold induction over that of pXP2. The
data shown are the means of triplicate determinations. Error
bars show the SEM. Significant differences at
P < 0.05 between groups are designated by
different lower case letters above the bars.
|
|
 |
Discussion
|
|---|
In the present study, a luciferase reporter gene vector
(GnRHR-pXP2) containing a 1226 bp promoter fragment (-1164 to +62
relative to the major transcription start site) of mGnRHR gene (23) was
used to examine the regulation of GnRHR gene transcription by GnRH and
cAMP in the GGH3 cells, a GH3 cell line stably
expressing GnRHR that has been demonstrated to be a useful model system
for study of GnRH action (35). GnRH or its agonist Buserelin activates
GnRHR promoter activity in dose- and time-dependent manners; GnRH is
also able to stimulate cAMP production. On the other hand, cAMP
activates GnRHR promoter activity and enhances the transcriptional
activation of GnRHR gene by GnRH. In addition, a competitive inhibitor
of adenylate cyclase, SQ 22536, partially blocked the GnRH stimulation
of GnRHR gene transcriptional activity, suggesting that GnRH activates
GnRHR transcriptional activity, in part, through the cAMP signal
transduction pathway.
GnRH was shown to stimulate the synthesis of its own receptor (36). In
addition, GnRH up-regulates or down-regulates the mRNA levels of its
receptor, dependent on the pattern of administration with GnRH (5, 6, 7, 8, 9, 10, 11, 12, 13).
In the present study, both GnRH and a GnRH agonist significantly
stimulated mGnRHR gene promoter activity in GGH3 cells in a
dose-dependent manner, suggesting that homologous regulation of GnRHR
gene expression also occurs at the transcriptional level. In addition,
the present results indicate that GnRH activates GnRHR transcriptional
activity in a time-dependent manner. The GnRHR-Luc activity was
stimulated by Buserelin progressively from 1.56 h, and the increase
in GnRHR-Luc activity was significantly lower with longer exposure of
the cells to Buserelin (12 h and 24 h). These results suggest that
short-term treatment with GnRH agonist up-regulates the GnRHR
transcriptional activity, whereas long-term treatment with GnRH agonist
desensitize the GnRHR transcriptional activity in responses to GnRH
agonist. Similarly, GnRH has been shown to cause transcriptional
stimulation of the gonadotropin
-subunit promoter in the period of
46 h followed by desensitization in a period of 624 h in
T3
cells (37). In addition, several earlier reports demonstrated that
continuous treatment (hours or days) with GnRH or its agonist
down-regulates the levels of GnRHR mRNA; the same treatment also
down-regulates GnRHR numbers assessed by radioligand binding (9, 10, 11, 12, 13).
Thus the down-regulation of GnRHR receptor number may, in part,
contribute to the homologous desensitization of GnRHR
transcriptional activity.
GnRHR is a member of the G protein-coupled receptor (GPCR) family (38).
The GnRHR appears to couple to multiple G proteins (39). In
GGH3 cells, GnRHR is coupled to Gq/11
as
well as to Gs
, which activates adenylate cyclase,
leading to production of cAMP (35, 40, 41, 42). Recently, a study relying
on palmitoylation of G proteins and overexpression of different G
protein
subunit cDNAs, showed that GnRHR couples to
Gq/11
as well as to Gs
and
Gi
in both GGH3 cells and pituitary
gonadotropes, suggesting that similar signal transduction pathways are
employed to mediate GnRH action in GGH3 cells and in
pituitary cells and that adenylate cyclase-cAMP signal transduction
pathway is involved in GnRH action (43). In the earlier studies, GnRH
induced the levels of cAMP in hemipituitary and whole pituitary
(18, 19, 20). However, in some other studies, GnRH agonist had no
significant effect on cAMP levels in primary gonadotropes (17). This
difference may be due to the different estrous cycle stages at which
pituitary was collected, as pituitary levels of G proteins
(Gs
, Gi
, Go
, and ß
subunit) were shown to be significantly modulated during the various
phases of the rat estrous cycle (44). Furthermore, it has been
demonstrated that cAMP or its analogs can mimic GnRH stimulated
increases in GnRHR levels in cultured rat pituitary cells, suggesting
that cAMP may participate in regulation of GnRHR (21, 22). The present
results show that GnRH agonist stimulates cAMP levels in
GGH3 cells, consistent with the previous finding that GnRHR
couples to Gs
to activate adenylate cyclase and
subsequent production of cAMP (35, 40, 41, 42). On the other hand, the
present results show that CTX stimulated GnRHR-Luc activity, which was
mimicked by treatment with dBcAMP. In addition, dBcAMP augmented
GnRH stimulation of GnRHR-Luc activity. These results demonstrate that
cAMP can activate GnRHR transcriptional activity and may mediate GnRH
regulation of GnRHR transcriptional activity. Furthermore, an adenylate
cyclase inhibitor SQ 22536 partially blocked GnRH agonist-stimulated
GnRHR promoter activity, supporting the view that GnRH activates GnRHR
promoter activity, in part, through cAMP signal transduction pathway.
SQ 22536 did not affect the influence of overexpression of
mitogen-activated protein kinase (MAPK) kinase (Raf-1) on GnRHR-Luc
activity, suggesting no effect of SQ 22536 on PKC/MAPK pathway
(our unpublished observation). Several earlier studies showed
that pituitary GnRHR number and the levels of GnRHR mRNA change
during the estrous cycle and during pregnancy and lactation and are
associated with changes in sensitivity of gonadotrope to GnRH and
levels of serum gonadotropin (2, 3, 4), suggesting that GnRH may be
involved in the regulation of its own receptor, which, in turn,
mediates regulation of gonadotropin synthesis and release. Indeed GnRH
has been shown to regulate mRNA levels and synthesis of its own
receptor (2). Because GGH3 cells and pituitary primary
cells have similar GnRHR-G protein coupling and signal transduction
pathways, the present results imply that the homologous regulation of
GnRHR at the transcriptional level via cAMP signal transduction pathway
participates in the physiological regulation of pituitary GnRHR during
reproductive cycle. The other pathways involved in GnRH regulation of
GnRHR gene transcription may include Gq/11
-mediated
activation of PLC, leading to activation of PKC and MAPK cascade
(unpublished observation). Similarly, PKC and MAPK signal transduction
pathway have been shown to mediate activation of gonadotropin
-subunit promoter activity by GnRH (45). A recent report showed that
frequency of calcium pulsatile signals regulates GnRHR gene expression,
suggesting that GnRH-stimualted intracellular Ca2+ signals
may also be involved in mediation of the transcriptional regulation of
GnRHR gene by GnRH (5).
Sequence analysis of 5'-flanking regions of GnRHR gene from several
species revealed the presence of consensus sequences that may have
significance in controlling the expression of the gene (23, 24, 25, 26, 27, 28). A cAMP
response element (CRE)-like sequence has been identified in rat and
human GnRHR gene (25, 27). In addition, two consensus sequences similar
to the GnRH response elements (70% and 75% identity, respectively)
found in the gonadotropin
-subunit promoter were identified in
mGnRHR gene at position -354/-335 and -615/-600 (relative to the
major transcription start site) (23). In the present study, a
progressive 5' deletion analysis revealed that sequence elements
located between -331 and -255 of the mouse GnRHR gene are necessary
for transcriptional activity of GnRHR gene in GGH3 cells
and that the response elements on the GnRHR gene to both GnRH and cAMP
appear to reside at two different sites: between -331 and -255
(relative to the major transcription start site) and between -255 and
+62 (relative to the major transcription start site). The present
results are consistent with the reports (46, 47) that basal activity of
mGnRHR promoter is dependent on the steroidogenic factor-1 binding site
(SF-1; -183 to -175, relative to the major transcription start site),
activator protein-1 (AP-1; -274 to -268, relative to the major
transcription start site) binding site and a GnRHR activating sequence
(GRAS; -329 to -318, relative to the major transcription start site).
These suggest that the transcriptional factors acting through the SF-1,
AP-1, and GRAS sites (46, 47) may be involved in the mediation of the
transcriptional activation of GnRHR gene by cAMP and GnRH. Because no
CRE-like sequence was identified in mGnRHR gene (23, 24) and the
supposed GnRH responsive elements are upstream of the 331 bp (relative
to the major transcription start site) of the 5'-flanking region of
mGnRHR gene, the transcriptional activation of GnRHR gene by cAMP and
GnRH may be not mediated by the CRE binding proteins.
 |
Acknowledgments
|
|---|
We are grateful to Drs. W. W. Chin and Tae H. Ji for
providing mouse GnRHR reporter gene vector and pCIS-LacZ vector,
respectively. We thank Jo Ann Janovick for her help.
 |
Footnotes
|
|---|
1 This study was supported by NIH Grants HD-19899, HD-00163, and
HD-18185. 
Received March 18, 1998.
 |
References
|
|---|
-
Conn PM 1994 The molecular mechanism of
gonadotropin-releasing hormone action in the pituitary. In: Knobil E,
Neill JD (eds) The Physiology of Reproduction. Raven Press, NY, pp
18151832
-
Conn PM, Janovick JA, Stanislaus D, Kuphal D, Jennes
L 1995 Molecular and cellular basis of gonadotropin-releasing
hormone action in the pituitary and central nervous system. In: Litwack
G (ed) Vitamins and Hormones, vol 50. Academic Press, New York, pp
151214
-
Bauer-Dantoin AC, Hollenberg AN, Jameson JL 1993 Dynamic regulation of gonadotropin-releasing hormone receptor mRNA
levels in the anterior pituitary gland during the rat estrous cycle.
Endocrinology 133:19111914[Abstract/Free Full Text]
-
Brooks J, Taylor PL, Saunders PTK, Eidne KA, Struthers
WJ, McNeilly AS 1993 Cloning and sequencing of the sheep pituitary
gonadotropin-releasing hormone receptor and changes in expression of
its mRNA during the estrous cycle. Mol Cell Endocrinol 94:R23R27
-
Haisenleder DJ, Yasin M, Marshall JC 1997 Gonadotropin subunit and gonadotropin-releasing hormone receptor gene
expression are regulated by alterations in the frequency of calcium
pulsatile signals. Endocrinology 138:52275230[Abstract/Free Full Text]
-
Turgeon JL, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation
of luteinizing hormone and GnRH Receptor in a novel gonadotrope cell
line. Mol Endocrinol 10:439450[Abstract/Free Full Text]
-
Yasin M, Dalkin AC, Haisenleder DJ, Kerrigan JR,
Marshall JC 1995 Gonadotropin-releasing hormone (GnRH) pulse
pattern regulates GnRH receptor gene expression: augmentation by
estradiol. Endocrinology 136:15591564[Abstract]
-
Kaiser UB, Jakubowiak A, Steinberger A, Chin WW 1997 Differential effects of gonadotropin-releasing hormone (GnRH)
pulse frequency on gonadotropin subunit and GnRH receptor messenger
ribonucleic acid levels in vitro. Endocrinology 138:12241231[Abstract/Free Full Text]
-
Adams BM, Sakurai H, Adams TE 1996 Concentrations
of gonadotropin-releasing hormone (GnRH) receptor messenger ribonucleic
acid in pituitary tissue of orchidectomized sheep: effect of estradiol
and GnRH. Biol Reprod 54:407412[Abstract]
-
Vizcarra JA, Wettemann RP, Braden TD, Turzillo AM, Nett
TM 1997 Effect of gonadotropin-releasing hormone (GnRH) pulse
frequency on serum and pituitary concentrations of luteinizing hormone
and follicle-stimulating hormone, GnRH receptors, and messenger
ribonucleic acid for gonadotropin subunits in cows. Endocrinology 138:594601[Abstract/Free Full Text]
-
Mason DR, Arora KK, Mertz LM, Catt KJ 1994 Homologous down-regulation of gonadotropin-releasing hormone receptor
sites and messenger ribonucleic acid transcripts in
T31 cells.
Endocrinology 135:11651170[Abstract]
-
Wu JC, Sealfon SC, Miller WL 1993 Gonadal hormones
and gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic
acid levels for GnRH receptors in sheep. Endocrinology 134:18461850[Abstract/Free Full Text]
-
Kakar SS, Nath S, Bunn J, Jennes L 1997 The
inhibition of growth and down-regulation of gonadotropin releasing
hormone (GnRH) receptor in
T31 cells by GnRH agonist. Anti-Cancer
Drugs 8:369375[CrossRef][Medline]
-
Sassone-Corsi P 1995 Transcription factors
responsive to cAMP. Ann Rev Cell Dev Biol 11:355377[CrossRef][Medline]
-
Ishizaka K, Tsujii T, Winters SJ 1993 Evidence for
a role for the cyclic adenosine 3',5'-monophosphate/protein kinase-A
pathway in regulation of the gonadotropin subunit messenger ribonucleic
acids. Endocrinology 133:20402048[Abstract/Free Full Text]
-
Haisenleder DJ, Dalkin AC, Marshall JC 1994 Regulation of gonadotropin gene expression. In: Knobil E, Neill JD
(eds) The Physiology of Reproduction. Raven Press, New York, pp
17931813
-
Conn PM, Morrell DV, Dufau ML, Catt KJ 1979 Gonadotropin-releasing hormone action in cultured pituicytes:
independence of luteinizing hormone release and adenosine
3',5'-monophosphate production. Endocrinology 104:448453[Abstract/Free Full Text]
-
Naor Z, Fawcett CP, McCann SM 1979 Differential
effects of castration and testosterone replacement on basal and
LHRH-stimulated cAMP and cGMP accumulation and on gonadotropin release
from the pituitary of the male rat. Mol Cell Endocrinol 14:191198[CrossRef][Medline]
-
Borgeat P, Chavancy G, Dupont A, Labrie F, Arimura A,
Schally AV 1972 Stimulation of adenosine 3':5'-cyclic
monophosphate accumulation in anterior pituitary gland in
vitro by synthetic luteinizing hormone-releasing hormone. Proc
Natl Acad Sci USA 69:26772681[Abstract/Free Full Text]
-
Bourne GA 1988 Cyclic AMP indirectly mediates the
extracellular Ca2+-independent release of LH. Mol Cell
Endocrinol 58:155160[CrossRef][Medline]
-
Young LS, Naik SI, Clayton RN 1984 Adenosine
3',5'-monophosphate derivatives increase gonadotropin-releasing hormone
receptors in cultured pituitary cells. Endocrinology 114:21142122[Abstract/Free Full Text]
-
Young LS, Naik SI, Clayton RN 1985 Increased
gonadotropin releasing hormone receptors on pituitary gonadotrophs:
effect on subsequent LH secretion. Mol Cell Endocrinol 41:6978[CrossRef][Medline]
-
Albarracin CT, Kaiser, UB, Chin WW 1994 Isolation
and characterization of the 5'-flanking region of the mouse
gonadotropin-releasing hormone receptor gene. Endocrinology 135:23002306[Abstract]
-
Clay CM, Nelson SE, DiGregorio GB, Campion CE, Wiedemann
AL, Nett RJ 1995 Cell-specific expression of the mouse
gonadotropin-releasing hormone (GnRH) receptor gene is conferred by
elements residing within 500 bp of proximal 5' flanking region.
Endocrine 3:615622[CrossRef]
-
Reinhart J, Xiao S, Arora KK, Catt KJ 1997 Structural organization and characterization of the promoter region of
the rat gonadotropin-releasing hormone receptor gene. Mol Cell
Endocrinol 130:112[CrossRef][Medline]
-
Kakar SS 1997 Molecular structure of the human
gonadotropin-releasing hormone receptor gene. Euro J Endocrinol 137:183192[Abstract]
-
Fan NC, Peng C, Krisinger J, Leung PCK 1995 The
human gonadotropin-releasing hormone receptor gene: complete structure
including multiple promoters, transcription initiation sites, and
polyadenylation signals. Mol Cell Endocrinol 107:R1R8
-
Campion CE, Turzillo AM, Clay CM 1996 The gene
encoding the ovine gonadotropin-releasing hormone (GnRH) receptor:
cloning and initial characterization. Gene 170:277280[CrossRef][Medline]
-
Offermanns S, Iida-Klein A, Segre GV, Simon MI 1996 G
q family members couple parathyroid hormone
(PTH)/PTH-related peptide and calcitonin receptors to phospholipase C
in COS-7 cells. Mol Endocrinol 10:566574[Abstract/Free Full Text]
-
Stanislaus D, Janovick JA, Jennes L, Kaiser UB, Chin WW,
Conn PM 1994 Functional and morphological characterization of four
cell lines derived from GH3 cells stably transfected with
gonadotropin-releasing hormone receptor complementary deoxyribonucleic
acid. Endocrinology 135:22202227[Abstract]
-
Steiner AL, Parker CW, Kipnis DM 1972 Radioimmunoassay for cyclic nucleotides. J Biol Chem 247:11061113[Abstract/Free Full Text]
-
Harper JF, Brooker G 1975 Femtomole sensitive
radioimmunoassay of cyclic AMP and cyclic GMP after 2'0 acetylation by
acetic anhydride in aqueous solution. J Cyclic Nucleotide Res 1:207218[Medline]
-
Andrews WV, Conn PM 1986 Gonadotropin-releasing
hormone stimulates mass changes in phosphoinositides and diacylglycerol
accumulation in purified gonadotrope cell cultures. Endocrinology 118:11481158[Abstract/Free Full Text]
-
Goldsmith BA, Abrams TW 1991 Reversal of synaptic
depression by serotonin at Aplysia sensory neuron synapses involves
activation of adenylyl cyclase. Proc Natl Acad Sci USA 88:90219025[Abstract/Free Full Text]
-
Kaiser UB, Conn PM, Chin WW 1997 Studies of
gonadotropin-releasing hormone (GnRH) action using GnRH
receptor-expressing pituitary cell lines. Endocr Rev 18:4670[Abstract/Free Full Text]
-
Braden TD, Conn PM 1990 Altered rate of synthesis
of gonadotropin-releasing hormone receptors: effects of homologous
hormone appear independent of extracellular calcium. Endocrinology 126:25772582[Abstract/Free Full Text]
-
Kay TWH, Chedrese PJ, Jameson JL 1994 Gonadotropin-releasing hormone causes transcriptional stimulation
followed by desensitization of the glyco-protein hormone
promoter in transfected
T3 gonadotrope cells. Endocrinology 134:568573[Abstract/Free Full Text]
-
Sealfon SC, Weinstein H, Millar RP 1997 Molecular
mechanisms of ligand interaction with the gonadotropin-releasing
hormone receptor. Endocr Rev 18:180205[Abstract/Free Full Text]
-
Hawes BE, Barnes S, Conn PM 1993 Cholera toxin and
pertussis toxin provoke differential effects on luteinizing hormone
release, inositol phosphate production, and gonadotropin-releasing
hormone (GnRH) receptor binding in the gonadotrope: evidence for
multiple guanyl nucleotide binding proteins in GnRH action.
Endocrinology 132:21242130[Abstract/Free Full Text]
-
Janovick JA, Conn PM 1994 Gonadotropin-releasing
hormone (GnRH)-receptor coupling to inositol phosphate and prolactin
production in GH3 cells stably transfected with rat GnRH
receptor complementary deoxyribonucleic acid. Endocrinology 135:22142219[Abstract]
-
Kuphal D, Janovick JA, Kaiser UB, Chin WW, Conn PM 1994 Stable transfection of GH3 cells with rat
gonadotropin-releasing hormone receptor complementary deoxyribonucleic
acid results in expression of a receptor coupled to cyclic adenosine
3',5'-monophosphate-dependent prolactin release via a G-protein.
Endocrinology 135:315320[Abstract]
-
Lin X, Janovick JA, Brothers S, Blomenröhr M,
Bogerd J, Conn PM 1998 Addition of catfish gonadotropin-releasing
hormone (GnRH) receptor intracellualr carboxyl-terminal tail to rat
GnRH receptor alters receptor expression and regulation. Mol Endocrinol 12:161171[Abstract/Free Full Text]
-
Stanislaus D, Ponder S, Ji TH, Conn PM GnRH
receptor couples to multiple G-proteins in gonadotropes and in
GGH3 cells: evidence from palmitoylation and overexpression
of G-proteins. Biol Reprod, in press
-
Bouvier C, Lagacé G, Collu R 1991 G protein
modulation by estrogens. Mol Cell Endocrinol 79:6573[CrossRef][Medline]
-
Roberson MS, Misra-Press A, Laurance ME, Stork PJS,
Maurer RA 1995 A role for mitogen-activated protein kinase in
mediating activation of the glycoprotein hormone
-subunit
promoter by gonadotropin-releasing hormone. Mol Cell Biol 15:35313539[Abstract]
-
Duval DL, Nelson SE, Clay CM 1997 The tripartite
basal enhancer of the gonadotropin-releasing hormone (GnRH) receptor
gene promoter regulates cell-specific expression through a novel GnRH
receptor activating sequence. Mol Endocrinol 11:18141821[Abstract/Free Full Text]
-
Duval DL, Nelson SE, Clay CM 1997 A binding site
for steroidogenic factor-1 is part of a complex enhancer that mediates
expression of the murine gonadotropin-releasing hormone receptor gene.
Biol Reprod 56:160168[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
N. J. Westphal and A. F. Seasholtz
Gonadotropin-Releasing Hormone (GnRH) Positively Regulates Corticotropin-Releasing Hormone-Binding Protein Expression via Multiple Intracellular Signaling Pathways and a Multipartite GnRH Response Element in {alpha}T3-1 Cells
Mol. Endocrinol.,
November 1, 2005;
19(11):
2780 - 2797.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. K. Cheng and P. C. K. Leung
Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans
Endocr. Rev.,
April 1, 2005;
26(2):
283 - 306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Sadie, G. Styger, and J. Hapgood
Expression of the Mouse Gonadotropin-Releasing Hormone Receptor Gene in {alpha}T3-1 Gonadotrope Cells Is Stimulated by Cyclic 3',5'-Adenosine Monophosphate and Protein Kinase A, and Is Modulated by Steroidogenic Factor-1 and Nur77
Endocrinology,
May 1, 2003;
144(5):
1958 - 1971.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Liu, I. Usui, L. G. Evans, D. A. Austin, P. L. Mellon, J. M. Olefsky, and N. J. G. Webster
Involvement of Both Gq/11 and Gs Proteins in Gonadotropin-releasing Hormone Receptor-mediated Signaling in Lbeta T2 Cells
J. Biol. Chem.,
August 23, 2002;
277(35):
32099 - 32108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. W. Cheng and P. C. K. Leung
Human Chorionic Gonadotropin-Activated cAMP Pathway Regulates Human Placental GnRH Receptor Gene Transcription in Choriocarcinoma JEG-3 Cells
J. Clin. Endocrinol. Metab.,
July 1, 2002;
87(7):
3291 - 3299.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Castro-Fernandez, J. A. Janovick, S. P. Brothers, R. A. Fisher, T. H. Ji, and P. M. Conn
Regulation of RGS3 and RGS10 Palmitoylation by GnRH
Endocrinology,
April 1, 2002;
143(4):
1310 - 1317.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Maya-Nunez and P. Michael Conn
Cyclic Adenosine 3',5'-Monophosphate (cAMP) and cAMP Responsive Element-Binding Protein Are Involved in the Transcriptional Regulation of Gonadotropin-Releasing Hormone (GnRH) Receptor by GnRH and Mitogen-Activated Protein Kinase Signal Transduction Pathway in GGH3 Cells
Biol Reprod,
August 1, 2001;
65(2):
561 - 567.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Lin, J. A. Janovick, S. Brothers, P. M. Conn, and R. E. Peter
Molecular Cloning and Expression of Two Type One Somatostatin Receptors in Goldfish Brain
Endocrinology,
November 1, 1999;
140(11):
5211 - 5219.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Maya-Núñez and P. M. Conn
Transcriptional Regulation of the Gonadotropin-Releasing Hormone Receptor Gene Is Mediated in Part by a Putative Repressor Element and by the Cyclic Adenosine 3',5'-Monophosphate Response Element
Endocrinology,
August 1, 1999;
140(8):
3452 - 3458.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. R. Norwitz, K.-H. Jeong, and W. W. Chin
Molecular Mechanisms of Gonadotropin-Releasing Hormone Receptor Gene Regulation
Reproductive Sciences,
July 1, 1999;
6(4):
169 - 178.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
B. R. White, D. L. Duval, J. M. Mulvaney, M. S. Roberson, and C. M. Clay
Homologous Regulation of the Gonadotropin-Releasing Hormone Receptor Gene Is Partially Mediated by Protein Kinase C Activation of an Activator Protein-1 Element
Mol. Endocrinol.,
April 1, 1999;
13(4):
566 - 577.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. R. Norwitz, G. R. Cardona, K.-H. Jeong, and W. W. Chin
Identification and Characterization of the Gonadotropin-releasing Hormone Response Elements in the Mouse Gonadotropin-releasing Hormone Receptor Gene
J. Biol. Chem.,
January 8, 1999;
274(2):
867 - 880.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Lin and P. M. Conn
Transcriptional Activation of Gonadotropin-Releasing Hormone (GnRH) Receptor Gene by GnRH: Involvement of Multiple Signal Transduction Pathways
Endocrinology,
January 1, 1999;
140(1):
358 - 364.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Pincas, J.-N. Laverriere, and R. Counis
Pituitary Adenylate Cyclase-activating Polypeptide and Cyclic Adenosine 3',5'-Monophosphate Stimulate the Promoter Activity of the Rat Gonadotropin-releasing Hormone Receptor Gene via a Bipartite Response Element in Gonadotrope-derived Cells
J. Biol. Chem.,
June 22, 2001;
276(26):
23562 - 23571.
[Abstract]
[Full Text]
[PDF]
|
 |
|