| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Medicine (P.M.W., M.A.P., A.D., G.A., T.W.G.) and Biochemistry and Molecular Biology (S.P.C., T.W.G.), Division of Gastroenterology and Hepatology, Medical University of South Carolina, Charleston, South Carolina 29425
Address all correspondence and requests for reprints to: Dr. Thomas W. Gettys, 916G Clinical Science Building, Medical University of South Carolina, 171 Ashley Avenue, Charleston, South Carolina 29425. E-mail: gettystw{at}musc.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recent evidence that leptin increases core temperature (7), stimulates sympathetic nerve activity (8), and increases norepinephrine turnover in brown adipose tissue (BAT) (9) is consistent with the idea that leptin increases thermogenic activity in adipose tissue. The ability of BAT to conduct thermogenesis is conferred by the presence of uncoupling protein-1 (UCP1) on the inner mitochondrial membrane, where it serves to short circuit the proton gradient that normally drives ATP synthesis (10, 11, 12). The release of norepinephrine from sympathetic nerves acutely activates UCP1 through a ß3-adrenergic receptor (ß3-AR)- and cAMP-dependent mechanism and simultaneously increases the thermogenic capacity of BAT through transcriptional activation of the UCP1 gene (13, 14). The consensus has been that UCP1 is expressed solely in BAT until several recent reports demonstrated inducible ectopic expression of UCP1 in WAT (15, 16). In addition, two novel uncoupling proteins (UCP2 and UCP3) were recently cloned in the mouse (17, 18, 19, 20). Both UCP2 and UCP3 are highly homologous to UCP1 and are thought to be involved in thermogenesis. Coupled with the observation that exogenous leptin selectively reduces WAT (5, 6, 7), the recent finding that central (intracerbroventricular) or peripheral administration of leptin selectively increases fat oxidation (21, 22) raises the interesting possibility that leptin reduces WAT mass by increasing UCP1 expression and/or function. Using 5- to 6-week-old lean and ob/ob mice, it is shown that leptin treatment produced robust increases and corrected the deficit in both UCP1 messenger RNA (mRNA) and protein expression in isolated BAT and retroperitoneal WAT from ob/ob mice. It is further shown that UCP2 mRNA levels did not differ between lean and ob/ob mice, and leptin had little or no effect on UCP2 mRNA in the WAT depot sites surveyed.
| Materials and Methods |
|---|
|
|
|---|
-32P]CTP were purchased
from DuPont-New England Nuclear Radiochemicals (Boston,
MA). Immobilon-P polyvinylidene difluoride membranes were obtained from
Millipore Corp. (Bedford, MA). Recombinant methionyl
mouse leptin was provided by Amgen, Inc. (Thousand Oaks,
CA).
Experimental animal protocol
Male lean (+/?) and obese (ob/ob) C57BL/6J mice were
obtained from The Jackson Laboratory (Bar Harbor, ME) at 56 weeks of
age and randomly assigned to one of two treatment groups. The mice were
housed in solid bottom cages with bedding (three mice per cage) and
equilibrated at 23 C on a 12-h light, 12-h dark cycle for 5 days before
beginning the experiment. On the morning of the sixth day and for 2
mornings thereafter, the mice in each group received ip injections of
either saline or recombinant mouse leptin (20 µg/g BW·day) 1 h
after the beginning of the light cycle. Three hours after their final
injection on day 8, the mice were killed, and tissues were harvested.
Interscapular BAT as well as epididymal and retroperitoneal WAT were
removed from each animal and carefully dissected free of vessels and
connective tissue. The ipsilateral fat pad from each site was used to
prepare total RNA, whereas the contralateral fat pad from each site was
used for isolation of mitochondria. Mice were weighed at the start of
the study and each day thereafter for the duration of the experiment,
and received Purina mouse chow (Ralston Purina Co., St.
Louis, MO) and water ad libitum.
Preparation of total RNA from adipose tissue depots
After dissection, the interscapular, epididymal, and
retroperitoneal fat pads were homogenized with Trizol LS reagent using
an Ultraturax (Tekmar, Cincinnati, OH) according to the manufacturers
specifications. Total RNA was isolated and purified as previously
described (23).
Ribonuclease protection assay of UCP1 and UCP2
RNA probes complementary to mRNA were produced by RT-PCR, using
total RNA from interscapular BAT for UCP1 (5' to 3'; forward,
caatctgggcttaacgggt; reverse, tgaaactccggctgagaag) and epididymal WAT
for UCP2 (5' to 3'; forward, cagttctacaccaagggct; reverse,
aggtcaccagctcagcacagt). The PCR product amplified with the UCP2 primers
was shortened to 143 bp using a SmaI digest that cut the
fragment at a site corresponding to bp 741. The respective fragments
were purified and cloned into the pGEM-3Z riboprobe vector containing
transcriptional start sites 5' and 3' to the multiple cloning site
(Promega Corp.). The identities of the cloned fragments
were confirmed by sequencing, and the probes corresponded to
nucleotides 7300 for UCP1 and nucleotides 741884 for UCP2. The
respective probes were labeled by T7 RNA polymerase in the presence of
[32P]CTP and used in our modification (23) of the
ribonuclease protection assay described by Granneman et al.
(24). The protected fragments were quantitated by comparison to known
amounts of sense strand RNA produced by SP6 transcription of the
linearized plasmids. The sense strand standards and protected fragments
were visualized by autoradiography after fractionation on 6%
polyacrylamide-8 M urea gels. A riboprobe complementary to
the 18S ribosomal RNA (rRNA; nucleotides 715794) was included in the
hybridization to correct for differences in the amount of total RNA
loaded on the gel.
Mitochondrial preparation
After dissection, the contralateral fat pad from each depot site
was minced in ice-cold sucrose buffer (0.25 M sucrose and
5.0 mM
N-Tris(hydroxlymethyl)methyl-2-aminoethanesulfonic acid
buffer, pH 7.2), diluted to 5% (wt/vol) in the sucrose buffer, and
homogenized with a glass Dounce homogenizer (Kontes Co., Vineland, NJ).
The homogenate was centrifuged at 22,500 x g for 20
min, and the pellet was resuspended in cold sucrose buffer. After a low
speed spin at 850 x g for 10 min, the supernatant
containing the mitochondria was decanted to a fresh tube and spun for
20 min at 48,000 x g. The pelleted mitochondria were
resuspended in 2 ml solubilization buffer containing 20 mM
Tris (pH 8.0), 1 mM EDTA, 100 mM NaCl, and
0.9% sodium cholate; incubated on ice for 30 min; and respun at
48,000 x g for 30 min. The pellet was resuspended in
solubilization buffer containing 1% Triton X-100 and incubated on ice
for 30 min. The suspension was respun at 48,000 x g,
and the supernatant was retained for protein assay and Western blotting
of UCP1.
Western blotting of UCP1
The protein concentration in the mitochondrial extracts was
determined using the Bio-Rad Laboratories, Inc.,
detergent-compatible protein assay (Hercules, CA), and the UCP1
concentration in the extracts was determined by Western blotting using
an affinity-purified antibody raised against the peptide sequence
corresponding to amino acids 145159 in mouse UCP1 (25). The
mitochondrial extracts from BAT (2.5 µg/lane) and WAT (20 µg/lane)
were resolved by SDS-PAGE (12.5% acrylamide and 0.51%
N,N'-diallyltartardiamide), transferred to
polyvinylidene difluoride membranes, and probed with UCP1 IgG. Detected
protein was visualized using 125I-labeled goat antirabbit
IgG and was quantitated by scanning laser densitometry (Molecular Dynamics, Inc., Sunnyvale, CA).
Methods of analysis
The estimated concentrations of UCP1 and UCP2 mRNA were obtained
by reverse calibration from standard curves as described inMaterials and Methods, and group means were compared between
treatments by one-way ANOVA. The level of protection against type I
errors was set at 5%, and the P values for specific
treatment comparisons of interest are presented in
Results.
| Results |
|---|
|
|
|---|
|
|
Effect of leptin on UCP1 in BAT of ob/ob mice
UCP1 mRNA levels were next compared in lean, ob/ob, and
leptin-treated ob/ob mice. The rationale for these
experiments comes from the observation that metabolic efficiency is
higher and core temperature is lower in ob/ob mice compared
with those in lean littermates, and the expectation that differences in
BAT UCP1 expression are the basis of this difference. These experiments
were also motivated by the observation that exogenous leptin corrects
these defects. As predicted (Fig. 2A
),
BAT UCP1 mRNA levels were significantly lower (P <
0.01) in ob/ob mice (0.3 ± 0.06 fmol mRNA/µg RNA)
than those in their lean littermates (1.7 ± 0.6 fmol mRNA/µg
RNA). Compared with that in vehicle-treated controls, treatment of
ob/ob mice with leptin for 3 days produced a significant
increase (P < 0.01) in BAT UCP1 mRNA (1.4 ± 0.4
fmol mRNA/µg RNA) to levels comparable to those in lean mice (Fig. 2A
). Conducting similar experiments at higher ambient temperatures
(2735 C) had little effect on UCP1 mRNA levels in control
ob/ob mice, but significantly blunted the response of
ob/ob mice to leptin (data not shown). In addition, the
higher temperatures lowered UCP1 mRNA expression in lean mice to levels
similar to those in ob/ob mice (not shown). Overall, these
data demonstrate that phenotypic differences between lean and
ob/ob mice are in part dependent on ambient temperature.
Moreover, ambient temperature influenced the ability of
ob/ob mice to respond to exogenous leptin.
|
Mitochondrial extracts from the brown fat pads that were contralateral
to the fat pads used to measure UCP1 mRNA levels were used to measure
UCP1 protein expression by Western blot. Figure 2B
illustrates that in
control ob/ob mice, BAT UCP1 levels were 20 ± 6% of
the levels expressed in lean mice (P < 0.01). This
corresponds to a 4- to 5-fold reduction in UCP1 protein and corresponds
to the 4.9-fold reduction in mRNA levels that was observed between lean
and ob/ob mice (Fig. 2A
). As predicted, treatment of
ob/ob mice with leptin produced a 4-fold increase in BAT
UCP1 expression (P < 0.01; Fig. 2B
), and this increase
is comparable to the leptin-mediated increase in message levels between
these groups (Fig. 2A
). Considered together, these data demonstrate
that UCP1 mRNA and protein levels are lower in BAT of ob/ob
mice compared with those in their lean littermates, and that leptin
treatment of ob/ob mice restores UCP1 mRNA and protein
expression in these animals.
Effect of leptin on UCP1 in retroperitoneal WAT of ob/ob
mice
The rationale for this set of experiments comes from observations
that UCP1 expression can be induced in WAT depots under conditions that
increase or mimic increased sympathetic nervous system activity. Given
that leptin treatment of ob/ob mice produces a specific
decrease in WAT mass and a selective increase in fat oxidation, we
tested the hypothesis that leptin increases UCP1 mRNA and protein
expression in WAT depots as a mechanism to increase local fatty acid
oxidation at these sites. Because of the increased propensity to
deposit triglyceride in these sites, a second aim was to determine
whether UCP1 mRNA was lower in ob/ob compared with lean
mice. We chose to examine the retroperitoneal WAT depot, and Fig. 3
illustrates that lean mice have readily
detectable levels of UCP1 mRNA (0.390 ± 0.010 fmol mRNA/µg RNA)
that are approximately 3- to 4-fold higher than levels measured in
ob/ob mice (0.103 ± 0.011 fmol mRNA/µg RNA).
However, treatment of ob/ob mice for 3 days with leptin
produced a 5- to 6-fold increase in UCP1 mRNA to 0.560 ± 0.011
fmol mRNA/µg RNA in the retroperitoneal WAT depot (Fig. 3
).
Mitochondrial extracts from the latter two groups were probed with UCP1
antibody, and Fig. 4
illustrates that
leptin produced a 10- to 15-fold increase in UCP1 expression in the
ob/ob group. Although the data are not shown, UCP1 levels in
mitochondrial extracts from retroperitoneal WAT of lean mice were
similar to those observed in the leptin-treated ob/ob
group.
|
|
Effect of leptin on UCP2 in retroperitoneal and epididymal WAT of
ob/ob mice
The role of leptin in regulating expression of UCP2 has not been
clearly defined. Therefore, we used lean and ob/ob mice from
the present study to evaluate the effect of leptins absence and its
replacement on UCP2 mRNA levels in retroperitoneal and epididymal WAT.
In retroperitoneal WAT, UCP2 mRNA levels were similar in lean
(0.022 ± 0.008 fmol/µg RNA) and ob/ob (0.026 ±
0.004 fmol/µg RNA) mice. As shown in Fig. 5A
, leptin had no effect on UCP2 mRNA in
either group (lean plus leptin, 0.036 ± 0.013 fmol/µg RNA;
ob/ob plus leptin, 0.043 ± 0.011 fmol/µg RNA). A
similar pattern was observed in epididymal WAT (Fig. 5B
), where UCP2
mRNA levels were comparable between lean (0.073 ± 0.005 fmol/µg
RNA) and ob/ob (0.086 ± 0.005 fmol/µg RNA) mice.
However, in contrast to the retroperitoneal depot, leptin produced a
small, but significant (P < 0.05), increase in
epididymal WAT UCP2 mRNA levels in both lean (0.098 ± 0.005
fmol/µg RNA) and ob/ob (0.121 ± 0.011 fmol/µg RNA)
mice. This apparent difference in response between the depot sites
probably reflects the greater relative precision of the UCP2 mRNA
estimates in the epididymal WAT depot. It should also be noted that
UCP2 mRNA levels were uniformly higher in the epididymal compared with
the retroperitoneal WAT depot. This contrasts with UCP1 in these two
sites, where the rank order of expression was reversed. This
relationship also applies to BAT, where the expression of UCP1 is very
high, whereas UCP2 mRNA is well below the levels observed in
retroperitoneal WAT (data not shown). Collectively, these experiments
illustrate that UCP2 and UCP1 are regulated differently among adipose
tissue depots, and the presence or absence of leptin has far greater
impact on UCP1 expression.
|
| Discussion |
|---|
|
|
|---|
Given its high capacity for facultative energy expenditure, a consensus has developed to support the view that BAT may also function to prevent obesity during periods of high caloric intake (30, 31, 32). Direct evidence that BAT serves this function was provided by Lowell et al. (31, 33), who showed that toxigene-mediated ablation of BAT produced obesity that was exacerbated by a high fat diet. In contrast, Enerback et al. (34) found that transgenic mice lacking UCP1 were cold sensitive but not obese. Similar observations were made by Thomas et al. (35), who found that transgenic mice lacking the enzyme responsible for converting dopamine into norepinephrine (dopamine ß-hydroxylase) were not obese. However, it should be noted that comparisons of wild-type and transgenic mice made at higher ambient temperatures would lower UCP1 expression in wild-type mice and minimize its expected contribution to differences in energetic efficiency between the two phenotypes (34, 35). This point is underscored by recent studies showing that rearing the toxigene UCP1 knockouts of Lowell et al. (31) at thermoneutrality minimized the difference in fat deposition between control and transgenic mice (36). Lastly, both Enerback et al. (34) and Thomas et al. (35) noted increased expression of the UCP1 homolog, UCP2, in adipose tissue from their respective transgenic mice. This observation raises the possibility that thermogenic capacity was enhanced through this or other adaptive mechanisms and masked the significance of the loss of UCP1 expression in these models. This suggestion is supported by observations from the latter study showing paradoxically elevated rates of oxygen consumption in the dopamine ß-hydroxylase knockout mice (35). Additional data relevant to this issue come from studies where UCP1 expression was induced. For instance, targeted disruption of the more poorly activated isoform of protein kinase A (RIIß) in adipose tissue and replacement with the more sensitive protein kinase A isoform produced genetically lean mice (30). Characterization of the mice revealed induction of UCP1, resistance to diet-induced obesity, and reductions in WAT mass. A similar resistance to obesity was noted in transgenic mice with UCP1 expression directed by the aP2 promoter, where enhanced UCP1 expression was documented in both BAT and WAT (37). Collectively, these studies and the present work indicate that variation in UCP1 expression can have a significant impact on energetic efficiency and adipose tissue deposition. Moreover, it seems likely that the compromised expression of UCP1 contributes to the thriftiness of the ob/ob mouse and its propensity to accumulate adipose tissue.
In the present study, injection of ob/ob mice with doses of leptin similar to those previously shown to induce weight loss and adipose tissue depletion (5, 6, 7) produced a 5- to 10-fold increase in UCP1 mRNA and protein in both BAT and retroperitoneal WAT. Similar, albeit smaller, effects of leptin on UCP1 have been reported in BAT of lean rats (38) and ob/ob mice (20) as well as in BAT and WAT of lean C57BL6/J mice (39). In the latter study, UCP1 mRNA levels were 10-fold higher in epididymal WAT compared with retroperitoneal WAT. In addition, the researchers observed a more significant leptin-mediated induction of UCP1 in epididymal compared with retroperitoneal WAT (39). Although we also used a sensitive RPA to quantitate UCP1 mRNA, we have never detected message levels for this protein in epididymal WAT except under extreme conditions (cold exposure or ß3-AR agonists). In contrast, we found significant amounts of UCP1 mRNA and protein in retroperitoneal WAT that were readily increased after 3 days of leptin treatment. In that 5-week-old C57BL6/J mice were used in the same experimental protocol in both studies, the reasons for these differences in UCP1 expression patterns and leptin sensitivity are not clear.
It is generally accepted that expression of UCP1 is restricted to brown adipocytes, but recent evidence has clearly established that cold exposure or ß3-AR agonists induce ectopic expression of UCP1 in WAT depots (15, 16, 40, 41). Examination of WAT from rodents after cold exposure reveals an increased number of adipocytes with morphological characteristics of brown adipocytes (42, 43, 44). Although the origins of these cells have not been established, it is possible that ß-adrenergic stimulation reawakened brown preadipocytes or promoted the transdifferentiation of pluripotent preadipocytes that reside within the WAT depot. Inasmuch as the capacity of a cell to conduct thermogenesis is directly related to the amount of UCP expressed in it, our finding that leptin increased UCP1 mRNA and protein in retroperitoneal WAT is the first to demonstrate that leptin can increase the thermogenic capacity of WAT. It will be important to establish whether the observed changes in UCP1 expression and cell morphology are accompanied by increased thermogenic activity in this tissue.
The ability of UCP1 to uncouple oxidative phosphorylation is conferred by its ability to short circuit the proton gradient established across the inner mitochondrial matrix by the electron transport chain (10, 11, 12). The release of norepinephrine from sympathetic nerves directly activates UCP1 through a ß3-AR- and cAMP-dependent process (13, 27) and simultaneously increases thermogenic capacity in brown adipocytes by transcriptional activation of the UCP1 gene (13, 45, 46). Thus, the recent findings that leptin increases sympathetic nervous system outflow (8) and norepinephrine turnover in BAT and WAT (9) suggest that leptin increases UCP1 expression in these tissues through modulation of sympathetic tone. This conclusion is also supported by the findings of Hwa et al. (21, 22), who showed that peripheral or central administration of leptin produced identical changes in respiratory quotient, indicating a specific decrease in carbohydrate oxidation and a concomitant increase in fat oxidation. The combination of increased fat oxidation, oxygen consumption, and serum FFAs in these studies makes a strong case that leptin increased energy utilization through acute activation of thermogenesis. Results from the present work support the conclusion that leptin also increases thermogenic capacity by increasing UCP1 expression, but it is unclear whether the increased UCP1 in retroperitoneal WAT allows significant fat oxidation to occur within this site. A recent study by Harris et al. (47) showed that leptin produced a rather uniform decrease in the size of WAT depot sites. These findings would argue against the suggestion that UCP1 induction in particular depot sites would make them more sensitive to the fat-depleting effects of leptin. However, it may be possible that changes in the expression of UCP2 or UCP3 could compensate in depot sites where UCP1 expression was not modified. Alternatively, the leptin-mediated increase in fat oxidation observed by Hwa et al. (21, 22) may be occurring primarily in BAT after mobilization and transfer of FFAs from WAT depots. Grujic et al. (48) provided data relevant to this point by showing that transgenic reexpression of ß3-ARs in both BAT and WAT was necessary to restore the increase in oxygen consumption seen in animals treated with a ß3-AR agonist. Interestingly, reexpression of the ß3-AR in only BAT failed to restore this effect on oxygen consumption. Although this model does not address the question of whether significant fat oxidation is occurring within WAT, it does illustrate that WAT is an obligatory participant in the thermogenic process. It will be interesting to examine these issues in transgenic mice, in which ß3-AR expression is rescued solely in WAT.
The cloning of UCP2 (17) and its reported linkage to markers of obesity (17, 20, 49) suggest that this UCP may play a role in determining metabolic efficiency. A number of studies have since addressed the physiological role and regulation of UCP2, but a clear consensus has not emerged from this work. For instance, using a rat leptin complementary DNA-containing adenovirus to make rats hyperleptinemic, Zhou et al. (50) showed that leptin increased UCP2 mRNA in WAT from lean Zucker rats, but not in fatty Zucker rats. Moreover, despite high circulating levels of endogenous leptin, UCP2 mRNA was not elevated in control fatty Zucker rats compared with lean littermates (50). Given our present understanding of the genetic defect in fatty Zucker rats (51), these results argue against a direct effect of leptin on adipose tissue and indicate that the centrally expressed long form of the leptin receptor is necessary for leptin to regulate UCP2 expression. In contrast, Gimeno et al. (18) reported that UCP2 was elevated 5-fold in WAT from both ob/ob and db/db mice compared with that in lean littermates. The results of Gimeno et al. (18) are at odds with those of Zhou et al. (50) in that they argue that the absence of a leptin signal (ob/ob and db/db) leads to up-regulation of UCP2 expression. We examined both retroperitoneal and epididymal WAT and found no evidence that UCP2 mRNA was elevated in ob/ob compared with lean mice at either site. Our results also differed from those of Zhou et al. (50) in that leptin failed to increase UCP2 mRNA in retroperitoneal WAT of either lean or ob/ob mice. The reason for these differences is unclear, although it should be noted that different species (rat vs. mouse) and methods of leptin administration (leptin adenovirus vs. ip injection of recombinant leptin) were used in the two studies. Our finding is strengthened by the observation that leptin produced a robust increase in UCP1 expression at this site and is also consistent with previous work that reported that cold exposure or ß3-AR agonists did not alter UCP2 expression in WAT, but produced a robust increase in UCP1 (17) (Gettys, T. W., unpublished data). Considered together, the results make a strong case that leptin does not regulate UCP1 and UCP2 through a common mechanism and suggest that if leptin does influence UCP2 expression, it does so through an indirect mechanism not involving modulation of sympathetic tone or cAMP.
In conclusion, the present studies demonstrate that UCP1 mRNA and protein levels are lower in both BAT and retroperitoneal WAT from ob/ob mice compared with those in lean littermates. It addition, it is shown that leptin restores the expression of UCP1 (mRNA and protein) in tissues from young ob/ob mice, but produces little or no effect on UCP2 mRNA in WAT. Our findings are consistent with the hypothesis that leptin stimulates energy utilization and fat oxidation by acutely activating thermogenesis and enhancing thermogenic capacity through increased UCP1 expression.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received July 1, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. Medina-Gomez, R. M. Calvo, and M.-J. Obregon Thermogenic effect of triiodothyroacetic acid at low doses in rat adipose tissue without adverse side effects in the thyroid axis Am J Physiol Endocrinol Metab, April 1, 2008; 294(4): E688 - E697. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Jakus, A. Sandor, T. Janaky, and V. Farkas Cooperation between BAT and WAT of rats in thermogenesis in response to cold, and the mechanism of glycogen accumulation in BAT during reacclimation J. Lipid Res., February 1, 2008; 49(2): 332 - 339. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Q. Xiao, S. M. Williams, B. E. Grayson, M. M. Glavas, M. A. Cowley, M. S. Smith, and K. L. Grove Excess Weight Gain during the Early Postnatal Period Is Associated with Permanent Reprogramming of Brown Adipose Tissue Adaptive Thermogenesis Endocrinology, September 1, 2007; 148(9): 4150 - 4159. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. H. Jethwa, A. Warner, K. N. Nilaweera, J. M. Brameld, J. W. Keyte, W. G. Carter, N. Bolton, M. Bruggraber, P. J. Morgan, P. Barrett, et al. VGF-Derived Peptide, TLQP-21, Regulates Food Intake and Body Weight in Siberian Hamsters Endocrinology, August 1, 2007; 148(8): 4044 - 4055. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Somoza, R. Guzman, V. Cano, B. Merino, P. Ramos, C. Diez-Fernandez, M. S. Fernandez-Alfonso, and M. Ruiz-Gayo Induction of Cardiac Uncoupling Protein-2 Expression and Adenosine 5'-Monophosphate-Activated Protein Kinase Phosphorylation during Early States of Diet-Induced Obesity in Mice Endocrinology, March 1, 2007; 148(3): 924 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Frontini, S. Rousset, A.-M. Cassard-Doulcier, C. Zingaretti, D. Ricquier, and S. Cinti Thymus Uncoupling Protein 1 Is Exclusive to Typical Brown Adipocytes and Is Not Found in Thymocytes J. Histochem. Cytochem., February 1, 2007; 55(2): 183 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fry, T. D. Hoyda, and A. V. Ferguson Making Sense of It: Roles of the Sensory Circumventricular Organs in Feeding and Regulation of Energy Homeostasis Experimental Biology and Medicine, January 1, 2007; 232(1): 14 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gelegen, D. A. Collier, I. C. Campbell, H. Oppelaar, and M. J. H. Kas Behavioral, physiological, and molecular differences in response to dietary restriction in three inbred mouse strains Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E574 - E581. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ukropec, R. V. P. Anunciado, Y. Ravussin, and L. P. Kozak Leptin Is Required for Uncoupling Protein-1-Independent Thermogenesis during Cold Stress Endocrinology, May 1, 2006; 147(5): 2468 - 2480. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, G. E Kilroy, T. M. Henagan, V. Prpic-Uhing, W. G. Richards, A. W. Bannon, R. L. Mynatt, and T. W. Gettys Targeted deletion of melanocortin receptor subtypes 3 and 4, but not CART, alters nutrient partitioning and compromises behavioral and metabolic responses to leptin FASEB J, September 1, 2005; 19(11): 1482 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Newhall, D. E. Cummings, M. A. Nolan, and G. S. McKnight Deletion of the RII{beta}-Subunit of Protein Kinase A Decreases Body Weight and Increases Energy Expenditure in the Obese, Leptin-Deficient ob/ob Mouse Mol. Endocrinol., April 1, 2005; 19(4): 982 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kang, L. Bajnok, K. A. Longo, R. K. Petersen, J. B. Hansen, K. Kristiansen, and O. A. MacDougald Effects of Wnt Signaling on Brown Adipocyte Differentiation and Metabolism Mediated by PGC-1{alpha} Mol. Cell. Biol., February 15, 2005; 25(4): 1272 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
|