| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Histopathology, St. George’s Hospital Medical School, London SW17 ORE, United Kingdom
Address all correspondence and requests for reprints to: Dr. M. Pondel, Department of Histopathology, St. George’s Hospital Medical School, London SW17 ORE, United Kingdom. E-mail: m.pondel{at}sghms.ac.uk
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Autoradiographic and radioligand-binding techniques with iodinated CT have identified high-affinity CT receptors (CTRs) in breast cancer cell lines (9, 10) and a variety of tissues that include brain (11, 12), testis (13), ovary (14), spermatozoa (15), kidney (16, 17), and osteoclasts (18, 19, 20). Recently, Gillespie et al. (21) showed that CTRs are expressed in primary breast cancer cells.
The CTR is a member of a newly identified subfamily of the seven-membrane domain G protein-coupled receptor superfamily that includes PTH/PTH-related peptide (22), secretin (23), vasoactive intestinal polypeptide (24), glucagon-like peptide 1 (25), GH releasing factor (26), glucagon (27), pituitary adenylate cyclase-activating polypeptide (28), CRF (29), and gastric inhibitory polypeptide receptors (30). Although the members of this subfamily have a similar structure with other seven-membrane-spanning G protein-coupled receptors (i.e. receptors for glycoprotein hormones, biogenic amines, etc), they do not show any similarity at the level of their amino acid sequence.
Despite CTRs’ potential role in diseases, such as osteoporosis and breast cancer, little is known about the transcriptional regulation of the gene. To date, only the porcine CTR (pCTR) promoter has been cloned and sequenced. Zolnierowicz et al. (31) described the isolation, structural organization, chromosomal localization, and promoter sequence of the pCTR gene. The pCTR gene spans 70 kb, encompassing at least 14 exons, with 12 exons encoding the protein. Transient expression of a 657-bp pCTR promoter/luciferase chimera in the CTR-positive kidney cell line LLC-PK1 led to the expression of luciferase activity. Unfortunately, cell lines do not exist for many tissues known to express CTRs in vivo (i.e. osteoclasts, spinal cord), making studies on the transcriptional regulation of the CTR gene in these cells problematic. Furthermore, cell lines cannot be employed for studies on CTR gene regulation during mammalian development.
The transgenic mouse has proven to be an excellent system to study the transcriptional regulation of many mammalian genes. Most cloned genes introduced into the mouse germ line have shown appropriate tissue-specific and developmental stage-specific patterns of expression despite their integration into apparently random sites in the genome (32). In this paper, we employed transgenic mouse technology to study the transcriptional regulation of the pCTR gene in vivo. We show that a 2.1-kb pCTR promoter specifically targets expression of a linked reporter gene to tissues that express endogenous mouse CTR (mCTR). Several of these tissues represent previously unknown sites of CTR gene expression. Lastly, we demonstrate that pCTR/mCTR gene activity is developmentally regulated in a number of these tissues.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) to generate the construct pCTR/lacZ
(Fig. 1B).
|
Histochemical analysis of pCTR/lacZ promoter activity in transgenic
embryos, fetuses, neonates, and adults
Transgenic males from each line were mated to female wild-type
F1 mice. The appearance of a vaginal copulation plug was considered day
0.5. At days 11.5 and 15.5 post fertilization, whole embryos and
fetuses were fixed overnight at 4 C in a solution containing 0.2%
gluteraldehyde, 0.1 M phosphate buffer (pH. 7.3), 2
mM MgCl2, and 5 mM EGTA. Embryos
and fetuses were then washed 3 x 20 min at room temperature in
buffer composed of 0.1 M phosphate buffer (pH 7.3), 2
mM MgCl2, 0.1% sodium desoxycholate, 0.02%
Nonidet P-40, and 0.05% BSA and were assayed for lacZ activity,
employing 5-bromo-4-chloro-3-indol-ß-D-galactopyranoside (X-gal) as
previously described (33). In some cases, fetuses were cut in half
(midsagittal section) after fixation, followed by incubation in X-gal
as above. Embryos and fetuses were photographed on a dissection
microscope. For more detailed histochemical analysis, lacZ-positive
tissues were dissected away from fetuses, embedded in OCT (Ray Lamb,
London, UK), followed by freezing and sectioning on a cryostat.
Sections (6–10 µm) were counterstained with eosin.
To analyze lacZ expression in neonates and adults, the spinal cord, mammary gland, kidney, anterior naris (nostrils), condylar region of humerus, external ear, tibial epiphysis, skin, spleen, and liver were removed from 1-day-old and 8-week-old transgenic lines, fixed overnight, followed by incubation in X-gal, as above. LacZ expression in testis from 8-week-old transgenics was also assayed. To analyze lacZ expression in neonate and adult brain, whole brains were removed from transgenic mice, followed by fixation overnight, as above. Before X-gal staining, the fixed brain was cut in half (midsagittal section) to allow better penetration of X-gal. Whole stained tissues were photographed on a dissection microscope. For more detailed analysis, stained tissues were frozen, as above, and were sectioned, followed by counterstaining with eosin, as above. Nontransgenic littermates and tissues were employed as background controls for all lacZ analysis described in this paper.
RT-PCR on fetal and adult RNA
To analyze mCTR gene expression in tissues from day-15.5 fetuses
and 8-week-old adults, total RNA from mammary gland, anterior naris,
liver, spleen, testis (from adults only), brain, spinal cord, cartilage
primordium (condylar region) of humerus, tibia and tibial epiphysis,
external ear, and skin was isolated as described by Chomczynski and
Sacchi (34). RNA was reverse-transcribed in a 25-µl vol containing
1x RT buffer, 1 mM dNTPs, 15 U AMV reverse transcriptase
(Gibco BRL), 100 ng oligo deoxythymidine, and 10 U
RNasin (Promega Corp.) at 37 C. After 1 h, the
mixture was heated to 95 C to inactivate AMV reverse transcriptase. The
reaction mix (4 µl) was then employed for PCR amplification of mCTR
messenger RNA using the following: 50 pM sense primer
[GTTCTTCAGGCTCCTACCAATCTC; corresponds to sequences 571–586 in mCTR
complementary DNA (cDNA)] and 50 pM antisense primer
(ACCCTCTGGCAGCTAAGGTTC; corresponds to sequences 1029–1049 in mCTR
cDNA), 200 µm dNTPs, 2 U Taq polymerase
(Perkin-Elmer Corp.), and 1x PCR buffer, in a
total vol of 45 µl. Oligos were annealed at 60 C for 45 sec, followed
by extension at 72 C for 5 min and denaturing at 95 C for 45 sec. A
total of 35 cycles were employed. In addition, PCR, employing sense
(GTAACCAACTGGGACGATATGG; corresponds to sequence 147–169 in rat actin
cDNA) and antisense (GATCTTGATCTTCATGGTGC; corresponds to sequences
890–909 in rat actin cDNA) rat actin primers was also performed, as
described above, on all RNA samples. RT-PCR reaction products were then
used for Southern blot analysis using 32P end-labeled
50-mer oligos (corresponds to sequence 911–960 in mCTR cDNA and
551–600 in rat actin cDNA) as probes.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, A and B). The construct was then employed for the
generation of transgenic mice. Seven transgenic founders, containing
the pCTR/lacZ construct, were identified by Southern blot analysis.
Hemizygous lines were established from five of the transgenic founders.
Two transgenic founder mice proved to be mosaic and were not employed
for subsequent lacZ analysis. The pCTR/lacZ copy number in transgenic
lines ranged between 1–15 copies per haploid genome (Fig. 1C).
To assay pCTR promoter activity in transgenic embryos and fetuses, male
transgenic lines were mated to wild-type females. At 11.5 and 15.5 days
post fertilization, whole embryos and fetuses were fixed, followed by
staining with X-gal. Only embryos and fetuses from transgenic lines
pCTR/lacZ-2 and -4 showed detectable lacZ expression (Fig. 1C).
Southern blot analysis did not reveal any rearrangements or gross
deletion of pCTR/lacZ sequences in lines pCTR/lacZ-1, -3, and -5. This
suggested that expression of the transgene in these lines may have been
repressed by the site of its integration in the mouse genome
(position effects). LacZ expression in 11.5-day embryos from transgenic
lines pCTR/lacZ -2 and -4 was evident in the spinal cord, mid- and
hind-brain. Staining could also be seen in the upper portion of the
forelimb bud (Fig. 2A). At 15.5 days post
fertilization, additional sites of pCTR promoter activity were evident.
LacZ expression was detected in the anterior naris (nostrils), external
ear, and mammary glands (Fig. 2, B and C). When sagittal sections of
these fetuses were examined, staining was demonstrated in the spinal
cord and regions of the brain that included medulla oblongata and pons
(Fig. 2D). Surprisingly, no lacZ expression was observed in fetal
kidney, suggesting the pCTR promoter was not active in this tissue. The
results of these experiments are summarized in Table 1.
|
|
). In the mouse, mammary gland development commences at
approximately 10.5 days of development. By day 13.5, the developing
mammary gland consists of a sphere of epithelial cells (mammary bud)
surrounded by mesenchyme (35). Between 14.5–16.5 days of development,
mesenchymal cells expressing androgen receptors form a distinct layer
of cells surrounding the mammary bud (36). The position of
lacZ-positive cells in the developing mammary gland of transgenic
fetuses corresponded well to the known position of androgen
receptor-positive mesenchymal cells in 15.5-day-old fetuses.
Further analysis on lacZ-positive material from the upper forelimb
showed strong staining in the cartilage primordium of the distal part
(condylar region) of the humerus (Fig. 2F). No lacZ activity was
detected in cartilage primordium or ossified centers of the
radius and ulna, suggesting that the pCTR promoter was not active in
osteoclasts.
Histochemical analysis on frozen sections of anterior naris and external ear from transgenic fetuses showed strong sc lacZ expression with punctate lacZ expression deep to X-gal-stained cells, suggestive of sensory nerves (data not shown).
Expression of mCTR in fetal lacZ-positive tissues
The results above demonstrated that embryonic and fetal progeny of
both pCTR-lacZ-2 and -4 transgenic mice displayed an identical pattern
of tissue-specific lacZ expression. The observation that the pCTR
promoter was active in the embryonic and fetal brain was consistent
with studies showing CTRs in the brain of rats (37, 38, 39), although only
adult animals were employed in these studies. However, CTR expression
in anterior naris, external ear, cartilage primordium of the humerus,
and mammary gland has not been reported at any stage of mouse
development. To date, there are no published reports on the
distribution of CTR in the developing and fully developed mouse. This
may be due to the inability of conventional in situ
hybridization techniques to detect the relatively low levels of CTR
expression that occur in vivo. To determine whether
endogenous mCTR gene expression was active in fetal tissues that
previously demonstrated pCTR promoter activity, RNA was isolated from
brain, developing mammary gland, distal cartilage primordium of the
humerus, spinal cord, anterior naris, external ear, skin, and liver of
day-15.5 wild-type fetuses. RNA from whole 15.5-day fetal tiba was
employed as a positive control for mCTR messenger RNA, because this
tissue has been demonstrated to contain osteoclasts (40), a cell known
to contain a large number of CTRs (41, 42, 43). The extracted RNA was
subjected to RT-PCR, employing primers specific to mCTR. The results of
this experiment can be seen in Fig. 3.
mCTR gene expression was evident in all tissues previously shown to
express lacZ. RNA from skin adjacent to mammary gland and liver served
as negative controls and demonstrated no detectable mCTR expression.
These results were significant, in that they identified novel sites of
mCTR expression and suggested that the pCTR promoter was only active in
fetal tissues expressing endogenous mCTR.
|
).
|
). This pattern of lacZ
expression was similar to the distribution of CTR in the rat brain
(37, 38, 39). When sections of spinal cord from transgenics were examined,
lacZ expression was observed in both the dorsal and ventral gray horn
(Fig. 4B).
Silvestroni et al. (15) reported the presence of CTR in
sperm. To determine whether sperm in pCTR/lacZ-2 and -4 male
transgenics demonstrated pCTR promoter activity, testis from 8-week-old
transgenics were frozen, sectioned, and stained with X-gal. LacZ
expression was observed in developing sperm, though not in mature
sperm, within the lumen of the seminiferous tubules (Fig. 4, C and
D).
When 1-day-old neonatal transgenic mice were assayed for pCTR promoter
activity, the tissue-specific pattern of lacZ expression was similar to
that of adults. LacZ expression was detected only in the brain and
spinal cord (data not shown). The results of these experiments are
summarized in Table 1.
The above results suggested that the transcriptional activity of the pCTR promoter in neonates was repressed in mammary gland, anterior naris, the condylar region of humerus, and external ear but was maintained in brain and spinal cord. Similar to findings with transgenic fetuses, no pCTR promoter activity was detected in kidney or osteoclasts. Finally, no additional novel sites of pCTR promoter activity were observed.
Expression of mCTR in adult tissues displaying pCTR promoter
activity
To determine whether mCTR gene expression in the anterior naris,
external ear, mammary gland, and distal part (condylar region) of
humerus was also repressed in adults, RNA from these tissues was
isolated and subjected to RT-PCR using mCTR primers, as previously
described. To serve as a positive control, RT-PCR was also performed on
RNA from adult brain, spinal cord, kidney, testis, and tibial
epiphysis. RT-PCR on RNA from spleen and liver served as a negative
control. The results of this experiment can be seen in Fig. 5. Southern blot analysis, employing a
mCTR specific oligonucleotide probe, demonstrated that mCTR gene
expression (like pCTR promoter activity) was repressed in anterior
naris, external ear, mammary gland, and the distal condylar region of
humerus from 8-week-old mice. However, mCTR gene expression in brain
and spinal cord was maintained. The observation that CTR gene
expression was developmentally regulated in a variety of tissues
in vivo has not previously been reported. These results
further suggest that pCTR promoter activity in the adult was restricted
to tissues that demonstrated endogenous mCTR expression, with the
exception of kidney and bone.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The expression of CTRs in tissues such as cartilage, developing mammary gland, ear, and naris has not previously been reported. These results, combined with our data that demonstrated pCTR/mCTR activity was corepressed in identical tissues from adult transgenics, support the conclusion that the pCTR promoter correctly directed expression of a linked reporter gene specifically to tissues that expressed endogenous mCTR. It is interesting to note that pCTR/mCTR gene expression in all of the novel sites identified in this study was repressed in adult mice. Because most studies on CTR gene regulation employ cell lines or tissues from adult mice, it is not surprising that these novel sites of CTR gene expression have not previously been identified.
Surprisingly, lacZ analysis suggested that 2.1 kb of pCTR 5' flanking region was insufficient to direct expression of a linked reporter gene to kidney. A reasonable hypothesis is that pCTR promoter activity in this tissue requires positive-acting regulatory sequences (i.e. enhancer) not present in the pCTR/lacZ construct. Such sequences may also be required for pCTR promoter activity in osteoclasts. The absence of pCTR promoter activity in the kidney of transgenic mice is inconsistent with Zolnierowicz et al. (31), who demonstrated that a pCTR promoter/luciferase construct was active when transiently transfected into the kidney epithelial cell line LLC-PK1. However, we hypothesize that the large amount of DNA (5 µg) transfected into these cells, as reported by Zolnierowicz et al. (31), and the fact that the DNA construct was not integrated into the genome (thus eliminating possible position effects), may allow low-level pCTR promoter activity to be detected in the absence of important positive regulatory sequences. It is also plausible that pCTR expression in kidney cells and osteoclasts in vivo may be directed by a separate pCTR promoter not present within our 2.1-kb pCTR/lacZ construct. McCuaig et al. (44) demonstrated that expression of the PTH receptor is regulated by two separate promoter regions. The upstream (P1) promoter directs tissue-specific expression of the PTH receptor (principally kidney), whereas the downstream (P2) is more generally used (44, 45). An alternative hypothesis is that species differences between mouse and pig may account for the lack of pCTR promoter activity in osteoclasts and kidney. However, the high degree of tissue specificity demonstrated by the pCTR promoter, combined with the observation that both mCTR and pCTR promoter activity was corepressed in the same tissues in adult mice, suggests that this is not the case. By generating pCTR/lacZ transgenic mice with additional pCTR 5' and/or 3' flanking region, we hope to identify DNA sequences required for pCTR promoter activity in kidney and in osteoclasts of mice. Once such sequences have been identified, it will be of great interest to determine whether they interact with osteoclast/kidney-specific transcription factors. Such transcription factors may play an important role in the regulation of other tissue-specific genes expressed in these tissues.
Detailed analysis of lacZ expression in the developing mammary gland of 15.5-day transgenic fetuses demonstrated that the pCTR promoter was active in cells having the same distribution around the mammary bud as did mesenchymal cells previously shown to express androgen receptors (36). These mesenchymal cells, when activated by testosterone, are responsible for the destruction of the mammary anlaga in male fetuses between days 14.5–16.5 of development (36). Future studies with antiandrogen receptor antibodies, combined with lacZ analysis, will allow us to determine whether CTRs colocalize with these androgen receptor-expressing cells. Because the epithelium that comprises the mammary bud induces the expression of androgen receptors in the surrounding mesenchyme (36), it will be of great interest to determine whether the epithelium also induces CTRs in mesenchymal cells surrounding the mammary bud.
LacZ and RT-PCR analysis demonstrated that pCTR/mCTR gene expression was active in fetal (but not adult) external ear, anterior naris, and mammary glands. Repression of CTR gene expression during mammalian development has not been previously reported. In view of the hypocalcemic properties of CT and the importance of calcium ions in cell aggregation/development (46, 47, 48), it is plausible to hypothesize that CTR may play a role in the process of morphogenesis. A thorough analysis of mCTR gene expression in vivo should be carried out to identify the specific period(s) of development and tissues demonstrating mCTR gene expression. In light of difficulties previously mentioned on in situ hybridization for the detection of CTRs, such a task may be problematic.
Our results that demonstrated pCTR promoter activity was specific to CTR-expressing tissues in transgenic mice have a number of important implications: 1) the pCTR promoter can be employed to target expression of cellular transforming genes (i.e. SV 40 large T antigen) to a variety of CTR-expressing tissues in transgenic mice, to generate novel cell lines expressing CTR; 2) by generating additional transgenic mice with pCTR/lacZ promoter deletion constructs, we will be able to delineate specific DNA sequences within the pCTR promoter that direct its transcriptional activity in tissues such as mammary gland, brain, and developing sperm; 3) once identified, studies on the interaction of these sequences with nuclear regulatory transcription factors can be initiated. It is likely that such tissue-specific transcription factors will play an important role in the differentiation of CTR-expressing tissues, such as the brain/spinal cord, mammary gland, and testis.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received April 17, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-globin gene in
transgenic mice employing ß-galactosidase as a reporter gene.
Nucleic Acids Res 20:5655–5660This article has been cited by other articles:
 |
|
 |
|
  M. Nakamura, B. Han, T. Nishishita, Y. Bai, and K. Kakudo Calcitonin targets extracellular signal-regulated kinase signaling pathway in human cancers J. Mol. Endocrinol., December 1, 2007; 39(6): 375 - 384. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Tverberg, M. F. Gustafson, T. L. Scott, I. V. Arzumanova, E. R. Provost, A. W. Yan, and S. A. Rawie Induction of Calcitonin and Calcitonin Receptor Expression in Rat Mammary Tissue during Pregnancy Endocrinology, October 1, 2000; 141(10): 3696 - 3702. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Anusaksathien, C. Laplace, X. Li, Y. Ren, L. Peng, S. R. Goldring, and D. L. Galson Tissue-specific and Ubiquitous Promoters Direct the Expression of Alternatively Spliced Transcripts from the Calcitonin Receptor Gene J. Biol. Chem., June 15, 2001; 276(25): 22663 - 22674. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
