Endocrinology Vol. 140, No. 1 492-499
Copyright © 1999 by The Endocrine Society
The Porcine Calcitonin Receptor Promoter Directs Expression of a Linked Reporter Gene in a Tissue and Developmental Specific Manner in Transgenic Mice1
C. Jagger,
A. Gallagher,
T. Chambers and
M. Pondel
Department of Histopathology, St. Georges Hospital Medical
School, London SW17 ORE, United Kingdom
Address all correspondence and requests for reprints to: Dr. M. Pondel, Department of Histopathology, St. Georges Hospital Medical School, London SW17 ORE, United Kingdom. E-mail:
m.pondel{at}sghms.ac.uk
 |
Abstract
|
|---|
We have investigated the transcriptional regulation of the porcine
calcitonin (CT) receptor (pCTR) promoter in transgenic mice. A
construct containing 2.1 kb pCTR 5' flanking region, fused to a
ß-galactosidase (lacZ) gene, was employed for the production of
transgenic mice. At 11.5 days of development lacZ expression was
observed in the embryonic brain and spinal cord. By 15.5 days post
fertilization, lacZ expression was detected in the developing mammary
gland, external ear, cartilage primordium of the humerus, and anterior
naris (nostril). RT-PCR on RNA from these fetal tissues showed
endogenous mouse CTR (mCTR) expression. In neonatal and adult
transgenics, lacZ expression was silenced, except in brain, spinal
cord, and testis (adults only). Endogenous mCTR gene expression and
pCTR promoter activity were corepressed in the same tissues from adult
mice. No pCTR promoter activity was detected in the kidney or bone of
transgenic animals. This suggests that additional DNA sequences may be
required for pCTR promoter activity in these tissues. From these
results, we conclude that the pCTR promoter is active only in tissues
expressing endogenous mCTR. Many of the these tissues represent
previously unknown sites of CTR gene expression. Finally, the
developmental regulation of pCTR/mCTR in tissues such as breast and
cartilage primordium suggests that CTRs may play a role in the
morphogenesis of these tissues.
 |
Introduction
|
|---|
CALCITONIN (CT) is a 32-amino acid peptide
hormone produced by parafollicular cells of the thyroid gland in
response to elevations in extracellular calcium levels (1, 2). The
hypocalcemic effects of CT are caused by its ability to inhibit
osteoclast-mediated bone resorption and enhance calcium excretion by
the kidney (3, 4, 5). CT is, therefore, an important therapeutic agent for
the treatment of hypercalcemia of malignancy and Pagets disease (6, 7). CT has also been shown to strongly inhibit the growth of human
breast cancer cell lines (8), suggesting that it may also be useful as
a therapeutic agent for the treatment of breast cancer.
Autoradiographic and radioligand-binding techniques with iodinated CT
have identified high-affinity CT receptors (CTRs) in breast cancer cell
lines (9, 10) and a variety of tissues that include brain (11, 12),
testis (13), ovary (14), spermatozoa (15), kidney (16, 17), and
osteoclasts (18, 19, 20). Recently, Gillespie et al. (21) showed
that CTRs are expressed in primary breast cancer cells.
The CTR is a member of a newly identified subfamily of the
seven-membrane domain G protein-coupled receptor superfamily that
includes PTH/PTH-related peptide (22), secretin (23), vasoactive
intestinal polypeptide (24), glucagon-like peptide 1 (25), GH releasing
factor (26), glucagon (27), pituitary adenylate cyclase-activating
polypeptide (28), CRF (29), and gastric inhibitory polypeptide
receptors (30). Although the members of this subfamily have a
similar structure with other seven-membrane-spanning G
protein-coupled receptors (i.e. receptors for glycoprotein
hormones, biogenic amines, etc), they do not show any similarity at the
level of their amino acid sequence.
Despite CTRs potential role in diseases, such as osteoporosis and
breast cancer, little is known about the transcriptional regulation of
the gene. To date, only the porcine CTR (pCTR) promoter has been cloned
and sequenced. Zolnierowicz et al. (31) described the
isolation, structural organization, chromosomal localization, and
promoter sequence of the pCTR gene. The pCTR gene spans 70 kb,
encompassing at least 14 exons, with 12 exons encoding the protein.
Transient expression of a 657-bp pCTR promoter/luciferase chimera in
the CTR-positive kidney cell line LLC-PK1 led to the
expression of luciferase activity. Unfortunately, cell lines do not
exist for many tissues known to express CTRs in vivo
(i.e. osteoclasts, spinal cord), making studies on the
transcriptional regulation of the CTR gene in these cells problematic.
Furthermore, cell lines cannot be employed for studies on CTR gene
regulation during mammalian development.
The transgenic mouse has proven to be an excellent system to study the
transcriptional regulation of many mammalian genes. Most cloned genes
introduced into the mouse germ line have shown appropriate
tissue-specific and developmental stage-specific patterns of expression
despite their integration into apparently random sites in the genome
(32). In this paper, we employed transgenic mouse technology to study
the transcriptional regulation of the pCTR gene in vivo. We
show that a 2.1-kb pCTR promoter specifically targets expression of a
linked reporter gene to tissues that express endogenous mouse CTR
(mCTR). Several of these tissues represent previously unknown sites of
CTR gene expression. Lastly, we demonstrate that pCTR/mCTR gene
activity is developmentally regulated in a number of these tissues.
 |
Materials and Methods
|
|---|
pCTR/lacZ transgenic construct
A pCTR promoter fragment containing 2114 bp of 5' flanking
region (cap = 0) and 19 bp of exon 1 was generated by PCR of pig
genomic DNA with an antisense primer containing a HindIII
restriction site at its 3' end (ACAAGCTTGCGCCTTCCTTCCCAGCTG;
corresponds to +2 to + 20 in pCTR gene) and a sense primer containing a
BglII site at its 5' end (ACAGATCTCCCTGTGCTTCCTCG;
corresponds to -2114 to -2094 in pCTR promoter). PCR reactions
contained 100 pM of each primer, 200 µM of
deoxynucleotide triphosphates (dNTPs), 100 ng porcine genomic DNA, 1x
PCR reaction buffer, and 5 U of Pfu DNA polymerase, in a total vol of
100 µl. The mix was denatured at 95 C for 45 sec, annealed at 60 C
for 45 sec, and extended at 72 C for 8 min, for a total of 30 cycles.
The sequence of the pCTR promoter fragment was confirmed by DNA
sequence analysis, employing a Pharmacia ALF Express sequencer
(performed by Cambridge Bioscience). The PCR product was then
blunt ended with T4 DNA polymerase and cloned into the blunt ended
PstI site of the vector pSDKlacZpa (Fig. 1A
) to generate the construct pCTR/lacZ
(Fig. 1B
).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 1. A, Expression construct pSDKlacZpa, containing an
SV 40 polyadenylation site, H3 (HindIII); B,
expression construct pCTR/lacZ, containing 2.1 kb of pCTR 5' flanking
region, 19 bp of exon 1; C, transgenic lines pCTR/lacZ 15 copy number
and presence (+) or absence (-) of lacZ expression in transgenic
embryos, fetuses, neonates, and adult mice.
|
|
Generation and screening of transgenic mice
The construct pCTR/lacZ was cut with BglII and
BamHI followed by purification of the linearized pCTR/lacZ
construct away from plasmid DNA sequences, as previously described
(33). Transgenic mice were generated by microinjection of the purified
linear DNA fragment into pronuclei of fertilized eggs from CBA X C57
crosses. To identify transgenic founder mice, tail DNA from 3- to
4-week-old pups was digested with EcoRV-EcoRI and
was subjected to Southern blot analysis using a 32P-labeled
1.8-kb EcoRV-EcoRI lacZ gene fragment as a probe.
Transgenic founder mice were mated and pups screened in the same manner
to identify transgenic lines. Gene copy number was determined by
methods outlined in Pondel et al. (33).
Histochemical analysis of pCTR/lacZ promoter activity in transgenic
embryos, fetuses, neonates, and adults
Transgenic males from each line were mated to female wild-type
F1 mice. The appearance of a vaginal copulation plug was considered day
0.5. At days 11.5 and 15.5 post fertilization, whole embryos and
fetuses were fixed overnight at 4 C in a solution containing 0.2%
gluteraldehyde, 0.1 M phosphate buffer (pH. 7.3), 2
mM MgCl2, and 5 mM EGTA. Embryos
and fetuses were then washed 3 x 20 min at room temperature in
buffer composed of 0.1 M phosphate buffer (pH 7.3), 2
mM MgCl2, 0.1% sodium desoxycholate, 0.02%
Nonidet P-40, and 0.05% BSA and were assayed for lacZ activity,
employing 5-bromo-4-chloro-3-indol-ß-D-galactopyranoside (X-gal) as
previously described (33). In some cases, fetuses were cut in half
(midsagittal section) after fixation, followed by incubation in X-gal
as above. Embryos and fetuses were photographed on a dissection
microscope. For more detailed histochemical analysis, lacZ-positive
tissues were dissected away from fetuses, embedded in OCT (Ray Lamb,
London, UK), followed by freezing and sectioning on a cryostat.
Sections (610 µm) were counterstained with eosin.
To analyze lacZ expression in neonates and adults, the spinal cord,
mammary gland, kidney, anterior naris (nostrils), condylar region of
humerus, external ear, tibial epiphysis, skin, spleen, and liver were
removed from 1-day-old and 8-week-old transgenic lines, fixed
overnight, followed by incubation in X-gal, as above. LacZ expression
in testis from 8-week-old transgenics was also assayed. To analyze lacZ
expression in neonate and adult brain, whole brains were removed from
transgenic mice, followed by fixation overnight, as above. Before X-gal
staining, the fixed brain was cut in half (midsagittal section) to
allow better penetration of X-gal. Whole stained tissues were
photographed on a dissection microscope. For more detailed analysis,
stained tissues were frozen, as above, and were sectioned, followed by
counterstaining with eosin, as above. Nontransgenic littermates and
tissues were employed as background controls for all lacZ analysis
described in this paper.
RT-PCR on fetal and adult RNA
To analyze mCTR gene expression in tissues from day-15.5 fetuses
and 8-week-old adults, total RNA from mammary gland, anterior naris,
liver, spleen, testis (from adults only), brain, spinal cord, cartilage
primordium (condylar region) of humerus, tibia and tibial epiphysis,
external ear, and skin was isolated as described by Chomczynski and
Sacchi (34). RNA was reverse-transcribed in a 25-µl vol containing
1x RT buffer, 1 mM dNTPs, 15 U AMV reverse transcriptase
(Gibco BRL), 100 ng oligo deoxythymidine, and 10 U
RNasin (Promega Corp.) at 37 C. After 1 h, the
mixture was heated to 95 C to inactivate AMV reverse transcriptase. The
reaction mix (4 µl) was then employed for PCR amplification of mCTR
messenger RNA using the following: 50 pM sense primer
[GTTCTTCAGGCTCCTACCAATCTC; corresponds to sequences 571586 in mCTR
complementary DNA (cDNA)] and 50 pM antisense primer
(ACCCTCTGGCAGCTAAGGTTC; corresponds to sequences 10291049 in mCTR
cDNA), 200 µm dNTPs, 2 U Taq polymerase
(Perkin-Elmer Corp.), and 1x PCR buffer, in a
total vol of 45 µl. Oligos were annealed at 60 C for 45 sec, followed
by extension at 72 C for 5 min and denaturing at 95 C for 45 sec. A
total of 35 cycles were employed. In addition, PCR, employing sense
(GTAACCAACTGGGACGATATGG; corresponds to sequence 147169 in rat actin
cDNA) and antisense (GATCTTGATCTTCATGGTGC; corresponds to sequences
890909 in rat actin cDNA) rat actin primers was also performed, as
described above, on all RNA samples. RT-PCR reaction products were then
used for Southern blot analysis using 32P end-labeled
50-mer oligos (corresponds to sequence 911960 in mCTR cDNA and
551600 in rat actin cDNA) as probes.
 |
Results
|
|---|
pCTR/lacZ expression in day-11.5 and day-15.5 transgenic embryos
and fetuses
We used transgenic mouse technology to examine the tissue-specific
pattern of pCTR promoter activity at embryonic, fetal, neonatal, and
adult stages of mouse development. By linking pCTR promoter sequences
to a lacZ reporter gene, pCTR promoter activity could be assayed in a
wide variety of tissues using simple histochemical procedures. We
therefore generated a 2.1-kb pCTR promoter by PCR and linked it to the
lacZ gene (Fig. 1
, A and B). The construct was then employed for the
generation of transgenic mice. Seven transgenic founders, containing
the pCTR/lacZ construct, were identified by Southern blot analysis.
Hemizygous lines were established from five of the transgenic founders.
Two transgenic founder mice proved to be mosaic and were not employed
for subsequent lacZ analysis. The pCTR/lacZ copy number in transgenic
lines ranged between 115 copies per haploid genome (Fig. 1C
).
To assay pCTR promoter activity in transgenic embryos and fetuses, male
transgenic lines were mated to wild-type females. At 11.5 and 15.5 days
post fertilization, whole embryos and fetuses were fixed, followed by
staining with X-gal. Only embryos and fetuses from transgenic lines
pCTR/lacZ-2 and -4 showed detectable lacZ expression (Fig. 1C
).
Southern blot analysis did not reveal any rearrangements or gross
deletion of pCTR/lacZ sequences in lines pCTR/lacZ-1, -3, and -5. This
suggested that expression of the transgene in these lines may have been
repressed by the site of its integration in the mouse genome
(position effects). LacZ expression in 11.5-day embryos from transgenic
lines pCTR/lacZ -2 and -4 was evident in the spinal cord, mid- and
hind-brain. Staining could also be seen in the upper portion of the
forelimb bud (Fig. 2A
). At 15.5 days post
fertilization, additional sites of pCTR promoter activity were evident.
LacZ expression was detected in the anterior naris (nostrils), external
ear, and mammary glands (Fig. 2
, B and C). When sagittal sections of
these fetuses were examined, staining was demonstrated in the spinal
cord and regions of the brain that included medulla oblongata and pons
(Fig. 2D
). Surprisingly, no lacZ expression was observed in fetal
kidney, suggesting the pCTR promoter was not active in this tissue. The
results of these experiments are summarized in Table 1
.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 2. Histochemical analysis of pCTR lacZ expression in
transgenic whole embryos, fetuses, and fetal tissues. A, Embryo
(11.5-day): MB, midbrain; HB, hind brain; H, heart; HLB, hindlimb bud;
FLB, forelimb bud; SC, spinal cord. B and C, Lateral and anterior view
of a 15.5 day pCTR lacZ transgenic fetus: AN, anterior naris; EE,
external ear; UF, upper forelimb; MG, mammary gland. D, Sagittal
section of a 15.5-day-old pCTR/lacZ transgenic fetus: P, pons; MO,
medula oblongata; H, heart; L, liver; SC, spinal cord. Panel E,
Ten-micrometer frozen section of mammary gland from 15.5-day-old
fetuses: E, surface ectoderm; MBD, mammary bud; M, mesenchyme. F,
Ten-micrometer frozen section of upper forelimb of a 15.5-day-old
fetus: CPH, cartilage primordium of humerus; CPR, cartilage primordium
of radius. These data are representative of six separate X-gal
stainings of embryos, fetuses, and fetal tissues showing an identical
pattern of lacZ expression. Scale bars: A, 1.0 mm; B, C,
and D, 3.5 mm; E, 0.1 mm; F, 70 µm.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1. LacZ expression pattern in embryos, fetuses,
neonates, and adults from transgenic lines pCTR/LacZ-2 and -4
|
|
Detailed histochemical analysis of fetal lacZ-positive tissues
The results above demonstrated that, between 11.5 (embryonic) and
15.5 (fetal) days of development, the pCTR promoter becomes
transcriptionally active in several tissues not previously demonstrated
to express CTRs: mammary gland, anterior naris, and external ear.
Further histochemical analysis on the developing mammary gland from
day-15.5 lacZ-positive transgenic fetuses demonstrated lacZ expression
in a distinct population of mesenchymal cells surrounding the mammary
bud (Fig. 2E
). In the mouse, mammary gland development commences at
approximately 10.5 days of development. By day 13.5, the developing
mammary gland consists of a sphere of epithelial cells (mammary bud)
surrounded by mesenchyme (35). Between 14.516.5 days of development,
mesenchymal cells expressing androgen receptors form a distinct layer
of cells surrounding the mammary bud (36). The position of
lacZ-positive cells in the developing mammary gland of transgenic
fetuses corresponded well to the known position of androgen
receptor-positive mesenchymal cells in 15.5-day-old fetuses.
Further analysis on lacZ-positive material from the upper forelimb
showed strong staining in the cartilage primordium of the distal part
(condylar region) of the humerus (Fig. 2F
). No lacZ activity was
detected in cartilage primordium or ossified centers of the
radius and ulna, suggesting that the pCTR promoter was not active in
osteoclasts.
Histochemical analysis on frozen sections of anterior naris and
external ear from transgenic fetuses showed strong sc lacZ expression
with punctate lacZ expression deep to X-gal-stained cells, suggestive
of sensory nerves (data not shown).
Expression of mCTR in fetal lacZ-positive tissues
The results above demonstrated that embryonic and fetal progeny of
both pCTR-lacZ-2 and -4 transgenic mice displayed an identical pattern
of tissue-specific lacZ expression. The observation that the pCTR
promoter was active in the embryonic and fetal brain was consistent
with studies showing CTRs in the brain of rats (37, 38, 39), although only
adult animals were employed in these studies. However, CTR expression
in anterior naris, external ear, cartilage primordium of the humerus,
and mammary gland has not been reported at any stage of mouse
development. To date, there are no published reports on the
distribution of CTR in the developing and fully developed mouse. This
may be due to the inability of conventional in situ
hybridization techniques to detect the relatively low levels of CTR
expression that occur in vivo. To determine whether
endogenous mCTR gene expression was active in fetal tissues that
previously demonstrated pCTR promoter activity, RNA was isolated from
brain, developing mammary gland, distal cartilage primordium of the
humerus, spinal cord, anterior naris, external ear, skin, and liver of
day-15.5 wild-type fetuses. RNA from whole 15.5-day fetal tiba was
employed as a positive control for mCTR messenger RNA, because this
tissue has been demonstrated to contain osteoclasts (40), a cell known
to contain a large number of CTRs (41, 42, 43). The extracted RNA was
subjected to RT-PCR, employing primers specific to mCTR. The results of
this experiment can be seen in Fig. 3
.
mCTR gene expression was evident in all tissues previously shown to
express lacZ. RNA from skin adjacent to mammary gland and liver served
as negative controls and demonstrated no detectable mCTR expression.
These results were significant, in that they identified novel sites of
mCTR expression and suggested that the pCTR promoter was only active in
fetal tissues expressing endogenous mCTR.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 3. RT-PCR on RNA from wild-type 15.5-day-old fetal
tissues. mCTR and rat actin specific primers were employed for RT-PCR,
followed by Southern blot analysis with a 32P end-labeled
mCTR and rat actin 50-mer oligo probes. 1, Brain; 2, spinal cord; 3,
mammary gland; 4, skin; 5, whole tibia; 6, liver; 7, anterior naris; 8,
cartilage primordium of distal part (condylar region) of humerus; 9,
external ear. This figure is representative of three separate
experiments, all showing identical results.
|
|
pCTR/lacZ expression in adult and neonatal transgenic mice
We wished to determine whether the tissue-specific pattern of
pCTR/lacZ expression in fetal transgenics was maintained in adult
transgenic mice. External ear, anterior naris, mammary gland, testis,
brain, spinal cord, kidney, spleen, liver, distal part (condylar) of
humerus, and epiphysis of tibia were removed from 8-week-old transgenic
lines pCTR/lacZ-2 and -4 and were fixed and incubated in X-gal. LacZ
expression was evident only in brain, spinal cord, and testis (Fig. 4
).

View larger version (105K):
[in this window]
[in a new window]
|
Figure 4. Histochemical analysis of pCTR/lacZ expression in
tissues from 8-week-old transgenic mice. A, Midsagittal section of
brain: CB, cerebellum; CR, cerebrum; MO, medulla oblongata; OB,
olfactory bulb; P, pons; NA, nucleus accumbens. B, Coronal section of
spinal cord: DGH, dorsal gray horn; VGH, ventral gray horn. C, Whole
testis. D, Ten-micrometer frozen section of testis; L, lumen
seminiferous tubule; S, developing sperm; SP, fully developed sperm.
This figure is representative of six separate X-gal stainings of
tissues from 8-week-old transgenic lines pCTR/lacZ-2 and -4.
Scale bars: A, 5.0 mm; B, 0.3 mm; C, 1 mm; D, 0.1 mm.
|
|
Midsagittal sections of brain from adult transgenics showed pCTR
promoter activity in a number of structures that included the medulla,
pons, and olfactory bulb. The nucleus accumbens demonstrated
particularly high levels of pCTR promoter activity, as indicated by
strong X-gal staining of this region (Fig. 4A
). This pattern of lacZ
expression was similar to the distribution of CTR in the rat brain
(37, 38, 39). When sections of spinal cord from transgenics were examined,
lacZ expression was observed in both the dorsal and ventral gray horn
(Fig. 4B
).
Silvestroni et al. (15) reported the presence of CTR in
sperm. To determine whether sperm in pCTR/lacZ-2 and -4 male
transgenics demonstrated pCTR promoter activity, testis from 8-week-old
transgenics were frozen, sectioned, and stained with X-gal. LacZ
expression was observed in developing sperm, though not in mature
sperm, within the lumen of the seminiferous tubules (Fig. 4
, C and
D).
When 1-day-old neonatal transgenic mice were assayed for pCTR promoter
activity, the tissue-specific pattern of lacZ expression was similar to
that of adults. LacZ expression was detected only in the brain and
spinal cord (data not shown). The results of these experiments are
summarized in Table 1
.
The above results suggested that the transcriptional activity of the
pCTR promoter in neonates was repressed in mammary gland, anterior
naris, the condylar region of humerus, and external ear but was
maintained in brain and spinal cord. Similar to findings with
transgenic fetuses, no pCTR promoter activity was detected in kidney or
osteoclasts. Finally, no additional novel sites of pCTR promoter
activity were observed.
Expression of mCTR in adult tissues displaying pCTR promoter
activity
To determine whether mCTR gene expression in the anterior naris,
external ear, mammary gland, and distal part (condylar region) of
humerus was also repressed in adults, RNA from these tissues was
isolated and subjected to RT-PCR using mCTR primers, as previously
described. To serve as a positive control, RT-PCR was also performed on
RNA from adult brain, spinal cord, kidney, testis, and tibial
epiphysis. RT-PCR on RNA from spleen and liver served as a negative
control. The results of this experiment can be seen in Fig. 5
. Southern blot analysis, employing a
mCTR specific oligonucleotide probe, demonstrated that mCTR gene
expression (like pCTR promoter activity) was repressed in anterior
naris, external ear, mammary gland, and the distal condylar region of
humerus from 8-week-old mice. However, mCTR gene expression in brain
and spinal cord was maintained. The observation that CTR gene
expression was developmentally regulated in a variety of tissues
in vivo has not previously been reported. These results
further suggest that pCTR promoter activity in the adult was restricted
to tissues that demonstrated endogenous mCTR expression, with the
exception of kidney and bone.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 5. RT-PCR on RNA from tissues of 8-week-old wild-type
mice. mCTR and rat actin-specific primers were employed for RT-PCR,
followed by Southern blot analysis with 32P end-labeled
mCTR and rat actin 50-mer oligo probes. 1, Brain; 2, spinal cord; 3,
kidney; 4, testis; 5, mammary gland; 6, liver; 7, spleen; 8, tibial
epiphysis; 9, anterior naris; 10, distal part (condylar region) of
humerus; 11, external ear. This figure is representative of three
separate experiments, all showing identical results.
|
|
 |
Discussion
|
|---|
We employed the transgenic mouse as a model system for studies on
the transcriptional regulation of the pCTR gene. LacZ analysis on
embryonic and fetal transgenics demonstrated that the pCTR promoter
correctly targeted expression of a linked lacZ reporter gene to brain
and spinal cord. In the fetus, the pCTR promoter was also active in the
developing mammary gland, anterior naris, and external ear (tissues we
demonstrated to express endogenous mCTR). The presence of pCTR promoter
activity in only one cartilaginous site of the developing skeletal
system (condylar region of humerus) is surprising. However, preliminary
data from pCTR/lacZ transgenic fetuses at 14.5 days of development
(unpublished results) demonstrated pCTR/lacZ expression in additional
cartilaginous sites, such as the cartilage primordium of the femur,
ribs, ulna, and skull. This suggests that the temporal pattern of pCTR
promoter activity in the developing skeletal system is not uniform. A
thorough analysis of pCTR/mCTR gene expression in the skeletal system,
at a variety of developmental stages, is currently underway.
The expression of CTRs in tissues such as cartilage, developing mammary
gland, ear, and naris has not previously been reported. These results,
combined with our data that demonstrated pCTR/mCTR activity was
corepressed in identical tissues from adult transgenics, support the
conclusion that the pCTR promoter correctly directed expression of a
linked reporter gene specifically to tissues that expressed endogenous
mCTR. It is interesting to note that pCTR/mCTR gene expression in all
of the novel sites identified in this study was repressed in adult
mice. Because most studies on CTR gene regulation employ cell lines or
tissues from adult mice, it is not surprising that these novel sites of
CTR gene expression have not previously been identified.
Surprisingly, lacZ analysis suggested that 2.1 kb of pCTR 5' flanking
region was insufficient to direct expression of a linked reporter gene
to kidney. A reasonable hypothesis is that pCTR promoter activity in
this tissue requires positive-acting regulatory sequences
(i.e. enhancer) not present in the pCTR/lacZ construct. Such
sequences may also be required for pCTR promoter activity in
osteoclasts. The absence of pCTR promoter activity in the kidney of
transgenic mice is inconsistent with Zolnierowicz et al.
(31), who demonstrated that a pCTR promoter/luciferase construct was
active when transiently transfected into the kidney epithelial cell
line LLC-PK1. However, we hypothesize that the large amount
of DNA (5 µg) transfected into these cells, as reported by
Zolnierowicz et al. (31), and the fact that the DNA
construct was not integrated into the genome (thus eliminating possible
position effects), may allow low-level pCTR promoter activity to be
detected in the absence of important positive regulatory sequences. It
is also plausible that pCTR expression in kidney cells and osteoclasts
in vivo may be directed by a separate pCTR promoter not
present within our 2.1-kb pCTR/lacZ construct. McCuaig et
al. (44) demonstrated that expression of the PTH receptor
is regulated by two separate promoter regions. The upstream (P1)
promoter directs tissue-specific expression of the PTH receptor
(principally kidney), whereas the downstream (P2) is more generally
used (44, 45). An alternative hypothesis is that species differences
between mouse and pig may account for the lack of pCTR promoter
activity in osteoclasts and kidney. However, the high degree of tissue
specificity demonstrated by the pCTR promoter, combined with the
observation that both mCTR and pCTR promoter activity was corepressed
in the same tissues in adult mice, suggests that this is not the case.
By generating pCTR/lacZ transgenic mice with additional pCTR 5' and/or
3' flanking region, we hope to identify DNA sequences required for pCTR
promoter activity in kidney and in osteoclasts of mice. Once such
sequences have been identified, it will be of great interest to
determine whether they interact with osteoclast/kidney-specific
transcription factors. Such transcription factors may play an important
role in the regulation of other tissue-specific genes expressed in
these tissues.
Detailed analysis of lacZ expression in the developing mammary gland of
15.5-day transgenic fetuses demonstrated that the pCTR promoter was
active in cells having the same distribution around the mammary bud as
did mesenchymal cells previously shown to express androgen receptors
(36). These mesenchymal cells, when activated by testosterone, are
responsible for the destruction of the mammary anlaga in male fetuses
between days 14.516.5 of development (36). Future studies with
antiandrogen receptor antibodies, combined with lacZ analysis, will
allow us to determine whether CTRs colocalize with these androgen
receptor-expressing cells. Because the epithelium that comprises the
mammary bud induces the expression of androgen receptors in the
surrounding mesenchyme (36), it will be of great interest to determine
whether the epithelium also induces CTRs in mesenchymal cells
surrounding the mammary bud.
LacZ and RT-PCR analysis demonstrated that pCTR/mCTR gene expression
was active in fetal (but not adult) external ear, anterior naris, and
mammary glands. Repression of CTR gene expression during mammalian
development has not been previously reported. In view of the
hypocalcemic properties of CT and the importance of calcium ions in
cell aggregation/development (46, 47, 48), it is plausible to hypothesize
that CTR may play a role in the process of morphogenesis. A thorough
analysis of mCTR gene expression in vivo should be carried
out to identify the specific period(s) of development and tissues
demonstrating mCTR gene expression. In light of difficulties previously
mentioned on in situ hybridization for the detection of
CTRs, such a task may be problematic.
Our results that demonstrated pCTR promoter activity was specific to
CTR-expressing tissues in transgenic mice have a number of important
implications: 1) the pCTR promoter can be employed to target expression
of cellular transforming genes (i.e. SV 40 large T antigen)
to a variety of CTR-expressing tissues in transgenic mice, to generate
novel cell lines expressing CTR; 2) by generating additional transgenic
mice with pCTR/lacZ promoter deletion constructs, we will be able to
delineate specific DNA sequences within the pCTR promoter that direct
its transcriptional activity in tissues such as mammary gland, brain,
and developing sperm; 3) once identified, studies on the interaction of
these sequences with nuclear regulatory transcription factors can be
initiated. It is likely that such tissue-specific transcription factors
will play an important role in the differentiation of CTR-expressing
tissues, such as the brain/spinal cord, mammary gland, and testis.
 |
Acknowledgments
|
|---|
We are grateful to Brian Hemmings for useful discussions about
this project.
 |
Footnotes
|
|---|
1 This work was supported by a grant from the Arthritis and Rheumatism
Council. 
Received April 17, 1998.
 |
References
|
|---|
-
Copp DH, Cameron EC, Cheney BA, Davidson GF, Henze
KG 1962 Evidence for calcitonin-a new hormone from the parathyroid
that lowers blood calcium. Endocrinology 70:638649
-
Hirsch PF, Voelkel EF, Munson PL 1964 Thyrocalcitonin: hypocalcemic, hypophosphatemic principle of the
thyroid gland. Science 146:412413[Abstract/Free Full Text]
-
Friedman J, Raisz LG 1965 Thyrocalcitonin:
inhibitor of bone resorption in tissue culture. Science 150:14651467[Abstract/Free Full Text]
-
Raisz LG, Nieman I 1967 The effects of parathyroid
hormone and thyrocalcitonin on bone in organ culture. Nature 214:486487[CrossRef][Medline]
-
Warshawsky H, Goltzman D, Rouleau MF, Bergeron JM 1980 Direct in vivo demonstration by radioautography of
specific binding sites for calcitonin in skeletal and renal tissues of
the rat. J Cell Biol 85:682694[Abstract/Free Full Text]
-
Mundy GR, Wilkinson R, Heath DA 1984 Comparative
study of medical therapy for hypercalcemia of malignancy. Am J Med 74:421437
-
Binstock M, Mundy GR 1980 Effect of calcitonin and
glucocorticoids in combination on the hypercalcemia of malignancy. Ann
Intern Med 93:269272
-
Ng KW, Livesey SA, Larkins RG, Martin TJ 1983 Calcitonin effects on growth and on selective activation of type II
isoenzyme of cyclic adenosine 3':5-monophosphate-dependent protein
kinase in T-47D human breast cancer cells. Cancer Res 43:794800[Abstract/Free Full Text]
-
Findlay DM, Michelangeli VP, Eisman JA, Frampton RJ,
Moseley JM, MacIntyre I, Whitehead R, Martin TJ 1980 Calcitonin
and 1,25-dihydroxy-vitamin D3 receptors in human breast cancer lines.
Cancer Res 40:47644767[Abstract/Free Full Text]
-
Martin TJ, Findlay DM, MacIntyre I, Eisman JA,
Michelangeli VP, Moseley JM, Partridge NC 1980 Calcitonin
receptors in a cloned human breast cancer cell line (MCF-7). Biochem
Biophys Res Commun 96:150156[CrossRef][Medline]
-
Goltzman D 1985 Interaction of calcitonin and
calcitonin gene-related peptide at receptor sites in target tissues.
Science 227:13431345[Abstract/Free Full Text]
-
Fischer JA, Tobler PH, Kaufmann M, Born W, Henke H,
Cooper PE, Sagar SM, Martin JB 1981 Calcitonin: regional
distribution of the hormone and its binding sites in the human brain
and pituitary. Proc Natl Acad Sci USA 78:78017805[Abstract/Free Full Text]
-
Chausmer A, Stuarat C, Stevens M 1980 Identification of testicular cell plasma membrane receptors for
calcitonin. J Lab Clin Med 96:933938[Medline]
-
Upchurch KS, Parker LM, Scully RE, Krane SM 1986 Differential cyclic AMP responses to calcitonin among human ovarian
carcinoma cell lines: a calcitonin-responsive line derived from a rare
tumor type. J Bone Miner Res 1:299304[Medline]
-
Silvestroni L, Menditto A, Frajese G, Gnessi L 1987 Identification of calcitonin receptors in human spermatozoa. J
Clin Endocrinol Metab 65:742746[Abstract/Free Full Text]
-
Lin HY, Harris TL, Flannery MS, Aruffo A, Kaji EH, Gorn
A, Kolakowski Jr LF, Yamin M, Lodish HF, Goldring SR 1991 Expression cloning and characterization of a porcine renal calcitonin
receptor. Trans Assoc Am Physicians CIV:265272
-
Goldring SR, Dayer DM, Ausiello DA, Krane SM 1978 A
cell strain cultured from porcine kidney increase cyclic AMP content
upon exposure to calcitonin or vasopressin. Biochem Biophys Res Commun 83:434440[CrossRef][Medline]
-
Nicholson CG, Mosley JM, Sexton PM, Mendelsohn FAO,
Martin TJ 1986 Abundant calcitonin receptors in isolated rat
osteoclasts. J Clin Invest 78:355360
-
Nicholson GC, Horton MA, Sexton PM, DSantos CS,
Moseley JM, Kemp BE, Pringle JAS, Martin TJ 1987 Calcitonin
receptors of human osteoclastoma. Horm Metab Res 19:585589[Medline]
-
Takahashi N, Yamana H, Yoshiki S, Roodman GD, Mundy GR,
Jones SJ, Boyde A, Suda T 1988 Osteoclast-like cell formation and
its regulation by osteotropic hormones in mouse bone marrow cultures.
Endocrinology 122:13711382
-
Gillespie MT, Thomas RJ, Pu ZY, Zhou H, Martin TJ,
Findlay DM 1997 Calcitonin receptors, bone sialoprotein and
osteopontin are expressed in primary breast cancers. Int J Cancer 73:812815[CrossRef][Medline]
-
Juppner H, Abou-Samra AB, Freeman M, Kong XF, Schipani
E, Richards J, Kolakowski Jr LF, Gock J, Pots JT, Kronenberg HM, Segre
GV 1991 A G protein-linked receptor for parathyroid hormone and
parathyroid hormone-related peptide. Science 254:10241026[Abstract/Free Full Text]
-
Ishihara T, Nakamura S, Kaziro Y, Takahashi T, Takahashi
K, Nagata S 1991 Molecular cloning and expression of a cDNA
encoding the secretin receptor. EMBO J 10:16351641[Medline]
-
Ishihara T, Shigemoto R, Mori K, Takahashi K, Nagata
S 1992 Functional expression and tissue distribution of a novel
receptor for vasoactive intestinal polypeptide. Neuron 8:811819[CrossRef][Medline]
-
Thorens B 1992 Expression cloning of the pancreatic
ß cell receptor for the gluco-incretin hormone glucagon-like peptide
1. Proc Natl Acad Sci USA 89:86418645[Abstract/Free Full Text]
-
Mayo KE 1992 Molecular cloning and expression of a
pituitary-specific receptor for growth hormone-releasing hormone. Mol
Endocrinol 6:17341744[Abstract/Free Full Text]
-
Jelinek LJ, Lok S, Rosenberg GB, Smith RA, Grant FJ,
Biggs S, Bensch PA, Kuijper JL, Sheppard PO, Sprecher CA, OHara PJ,
Foster D, Walker KM, Chen LHJ, McKernan PA, Kindsvogel W 1993 Expression cloning and signalling properties of the rat glucagon
receptor. Science 259:16141616[Abstract/Free Full Text]
-
Pisegna JR, Wank SA 1993 Molecular cloning and
functional expression of the pituitary adenylate cyclase-activating
polypeptide type 1 receptor. Proc Natl Acad Sci USA 90:63456349[Abstract/Free Full Text]
-
Chen R, Lewis KA, Perrin MH, Vale WW 1993 Expression cloning of a human corticotropin-releasing-factor receptor.
Proc Natl Acad Sci USA 90:89678971[Abstract/Free Full Text]
-
Usdin TB, Mezey E, Button DC, Brownstein MJ, Bonner
TI 1993 Gastric inhibitory polypeptide receptor, a member of the
secretin-vasoactive intestinal peptide receptor family, is widely
distributed in peripheral organs and the brain. Endocrinology 133:28612870[Abstract/Free Full Text]
-
Zolnierowicz S, Cron P, Solinas-Toldo S, Fries R, Lin
HY, Hemmings BA 1994 Isolation, characterization and chromosomal
localization of the porcine calcitonin receptor gene. J Biol Chem 30:1953019538
-
Wight DC, Wagner TE 1994 Transgenic mice: a decade
of progress in technology and research. Mutat Res 307:429444[Medline]
-
Pondel MD, Proudfoot NJ, Whitelaw C, Whitelaw E 1992 The developmental regulation of the human
-globin gene in
transgenic mice employing ß-galactosidase as a reporter gene.
Nucleic Acids Res 20:56555660[Abstract/Free Full Text]
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem 161:156159[CrossRef]
-
Anderson RR 1978 Embryonic and fetal development of
the mammary apparatus. In: Carson M (ed) Lactation. Academic Press, New
York, vol 4, pp 339
-
Heuberger B, Fitzka I, Wasner G, Kratochwil
K 1982 Induction of androgen receptor formation by epithelium
mesenchyme interaction in embryonic mouse mammary gland. Proc Natl Acad
Sci USA 79:29572961[Abstract/Free Full Text]
-
Henke H, Tobler PH, Fischer JA 1983 Localization of
salmon calcitonin binding sites in rat brain by autoradiography. Brain
Res 272:373377[CrossRef][Medline]
-
Hilton JM, Chai SY, Sexton PM 1995 In
vitro autoradiographic localization of the calcitonin receptor
isoforms, C1a and C1b in rat brain. Neuroscience 69:12231237[CrossRef][Medline]
-
Sheward WJ, Lutz EM, Harmar AJ 1994 The
expression of the calcitonin receptor gene in brain and pituitary gland
of the rat. Neurosci Lett 181:3134[CrossRef][Medline]
-
Jemtland R, Lee K, Segre GV 1998 Heterogeneity among cells that express osteoclast associated genes in
developing bone. Endocrinology 139:340349[Abstract/Free Full Text]
-
Nicholson CG, Moseley JM, Sexton PM, Mendelsohn FAO,
Martin TJ 1986 Abundant calcitonin receptors in isolated rat
osteoclasts. J Clin Invest 78:355360
-
Goldring SR, Roelke MS, Petrison K, Bhan AK 1987 Human giant cell tumors of bone. Identification and characterization of
cell types. J Clin Invest 79:483491
-
Nicholson GC, Horton MA, Sexton PM, DSantos CS,
Moseley JM, Kemp BE, Pringle JAS, Martin TJ 1987 Calcitonin
receptors of human osteoclastoma. Horm Metab Res 19:585589
-
McCuaig KA, Lee HG, Clarke JC, Assar H, Horsford J,
White JH 1995 PTH/PTHrP receptor gene transcripts are expressed
from tissue specific and ubiquitous promoters. Nucleic Acids Res 23:19481955[Abstract/Free Full Text]
-
Amizuka N, Lee HH, Kwan MY, Arzani A, Warshawsky H,
Gendy GN, Ozawa H, White JH, Goltzman D 1997 Cell specific
expression of the PTH/PTHrP receptor gene in kidney from
kidney-specific and ubiquitous promoters. Endocrinology 138:469481[Abstract/Free Full Text]
-
Curtis ASG 1957 The role of calcium in cell
aggregation of Xenopus embryos. Proc Roy Phys Soc of Edinburgh 26:2532
-
Steinberg MA 1962 On the chemical bonds between
animal cells. A mechanism for type specific association. Am Nat 92:6881
-
Jones KW, Elsdale TR 1963 The culture of small
aggregates of amphibian embryonic cels in vitro. J Embryol Exp Morphol 11:135154
This article has been cited by other articles:

|
 |

|
 |
 
M. Nakamura, B. Han, T. Nishishita, Y. Bai, and K. Kakudo
Calcitonin targets extracellular signal-regulated kinase signaling pathway in human cancers
J. Mol. Endocrinol.,
December 1, 2007;
39(6):
375 - 384.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Tverberg, M. F. Gustafson, T. L. Scott, I. V. Arzumanova, E. R. Provost, A. W. Yan, and S. A. Rawie
Induction of Calcitonin and Calcitonin Receptor Expression in Rat Mammary Tissue during Pregnancy
Endocrinology,
October 1, 2000;
141(10):
3696 - 3702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Anusaksathien, C. Laplace, X. Li, Y. Ren, L. Peng, S. R. Goldring, and D. L. Galson
Tissue-specific and Ubiquitous Promoters Direct the Expression of Alternatively Spliced Transcripts from the Calcitonin Receptor Gene
J. Biol. Chem.,
June 15, 2001;
276(25):
22663 - 22674.
[Abstract]
[Full Text]
[PDF]
|
 |
|