help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jagger, C.
Right arrow Articles by Pondel, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jagger, C.
Right arrow Articles by Pondel, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
Endocrinology Vol. 140, No. 1 492-499
Copyright © 1999 by The Endocrine Society


ARTICLES

The Porcine Calcitonin Receptor Promoter Directs Expression of a Linked Reporter Gene in a Tissue and Developmental Specific Manner in Transgenic Mice1

C. Jagger, A. Gallagher, T. Chambers and M. Pondel

Department of Histopathology, St. George’s Hospital Medical School, London SW17 ORE, United Kingdom

Address all correspondence and requests for reprints to: Dr. M. Pondel, Department of Histopathology, St. George’s Hospital Medical School, London SW17 ORE, United Kingdom. E-mail: m.pondel{at}sghms.ac.uk


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have investigated the transcriptional regulation of the porcine calcitonin (CT) receptor (pCTR) promoter in transgenic mice. A construct containing 2.1 kb pCTR 5' flanking region, fused to a ß-galactosidase (lacZ) gene, was employed for the production of transgenic mice. At 11.5 days of development lacZ expression was observed in the embryonic brain and spinal cord. By 15.5 days post fertilization, lacZ expression was detected in the developing mammary gland, external ear, cartilage primordium of the humerus, and anterior naris (nostril). RT-PCR on RNA from these fetal tissues showed endogenous mouse CTR (mCTR) expression. In neonatal and adult transgenics, lacZ expression was silenced, except in brain, spinal cord, and testis (adults only). Endogenous mCTR gene expression and pCTR promoter activity were corepressed in the same tissues from adult mice. No pCTR promoter activity was detected in the kidney or bone of transgenic animals. This suggests that additional DNA sequences may be required for pCTR promoter activity in these tissues. From these results, we conclude that the pCTR promoter is active only in tissues expressing endogenous mCTR. Many of the these tissues represent previously unknown sites of CTR gene expression. Finally, the developmental regulation of pCTR/mCTR in tissues such as breast and cartilage primordium suggests that CTRs may play a role in the morphogenesis of these tissues.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CALCITONIN (CT) is a 32-amino acid peptide hormone produced by parafollicular cells of the thyroid gland in response to elevations in extracellular calcium levels (1, 2). The hypocalcemic effects of CT are caused by its ability to inhibit osteoclast-mediated bone resorption and enhance calcium excretion by the kidney (3, 4, 5). CT is, therefore, an important therapeutic agent for the treatment of hypercalcemia of malignancy and Paget’s disease (6, 7). CT has also been shown to strongly inhibit the growth of human breast cancer cell lines (8), suggesting that it may also be useful as a therapeutic agent for the treatment of breast cancer.

Autoradiographic and radioligand-binding techniques with iodinated CT have identified high-affinity CT receptors (CTRs) in breast cancer cell lines (9, 10) and a variety of tissues that include brain (11, 12), testis (13), ovary (14), spermatozoa (15), kidney (16, 17), and osteoclasts (18, 19, 20). Recently, Gillespie et al. (21) showed that CTRs are expressed in primary breast cancer cells.

The CTR is a member of a newly identified subfamily of the seven-membrane domain G protein-coupled receptor superfamily that includes PTH/PTH-related peptide (22), secretin (23), vasoactive intestinal polypeptide (24), glucagon-like peptide 1 (25), GH releasing factor (26), glucagon (27), pituitary adenylate cyclase-activating polypeptide (28), CRF (29), and gastric inhibitory polypeptide receptors (30). Although the members of this subfamily have a similar structure with other seven-membrane-spanning G protein-coupled receptors (i.e. receptors for glycoprotein hormones, biogenic amines, etc), they do not show any similarity at the level of their amino acid sequence.

Despite CTRs’ potential role in diseases, such as osteoporosis and breast cancer, little is known about the transcriptional regulation of the gene. To date, only the porcine CTR (pCTR) promoter has been cloned and sequenced. Zolnierowicz et al. (31) described the isolation, structural organization, chromosomal localization, and promoter sequence of the pCTR gene. The pCTR gene spans 70 kb, encompassing at least 14 exons, with 12 exons encoding the protein. Transient expression of a 657-bp pCTR promoter/luciferase chimera in the CTR-positive kidney cell line LLC-PK1 led to the expression of luciferase activity. Unfortunately, cell lines do not exist for many tissues known to express CTRs in vivo (i.e. osteoclasts, spinal cord), making studies on the transcriptional regulation of the CTR gene in these cells problematic. Furthermore, cell lines cannot be employed for studies on CTR gene regulation during mammalian development.

The transgenic mouse has proven to be an excellent system to study the transcriptional regulation of many mammalian genes. Most cloned genes introduced into the mouse germ line have shown appropriate tissue-specific and developmental stage-specific patterns of expression despite their integration into apparently random sites in the genome (32). In this paper, we employed transgenic mouse technology to study the transcriptional regulation of the pCTR gene in vivo. We show that a 2.1-kb pCTR promoter specifically targets expression of a linked reporter gene to tissues that express endogenous mouse CTR (mCTR). Several of these tissues represent previously unknown sites of CTR gene expression. Lastly, we demonstrate that pCTR/mCTR gene activity is developmentally regulated in a number of these tissues.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
pCTR/lacZ transgenic construct
A pCTR promoter fragment containing 2114 bp of 5' flanking region (cap = 0) and 19 bp of exon 1 was generated by PCR of pig genomic DNA with an antisense primer containing a HindIII restriction site at its 3' end (ACAAGCTTGCGCCTTCCTTCCCAGCTG; corresponds to +2 to + 20 in pCTR gene) and a sense primer containing a BglII site at its 5' end (ACAGATCTCCCTGTGCTTCCTCG; corresponds to -2114 to -2094 in pCTR promoter). PCR reactions contained 100 pM of each primer, 200 µM of deoxynucleotide triphosphates (dNTPs), 100 ng porcine genomic DNA, 1x PCR reaction buffer, and 5 U of Pfu DNA polymerase, in a total vol of 100 µl. The mix was denatured at 95 C for 45 sec, annealed at 60 C for 45 sec, and extended at 72 C for 8 min, for a total of 30 cycles. The sequence of the pCTR promoter fragment was confirmed by DNA sequence analysis, employing a Pharmacia ALF Express sequencer (performed by Cambridge Bioscience). The PCR product was then blunt ended with T4 DNA polymerase and cloned into the blunt ended PstI site of the vector pSDKlacZpa (Fig. 1AGo) to generate the construct pCTR/lacZ (Fig. 1BGo).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. A, Expression construct pSDKlacZpa, containing an SV 40 polyadenylation site, H3 (HindIII); B, expression construct pCTR/lacZ, containing 2.1 kb of pCTR 5' flanking region, 19 bp of exon 1; C, transgenic lines pCTR/lacZ 1–5 copy number and presence (+) or absence (-) of lacZ expression in transgenic embryos, fetuses, neonates, and adult mice.

 
Generation and screening of transgenic mice
The construct pCTR/lacZ was cut with BglII and BamHI followed by purification of the linearized pCTR/lacZ construct away from plasmid DNA sequences, as previously described (33). Transgenic mice were generated by microinjection of the purified linear DNA fragment into pronuclei of fertilized eggs from CBA X C57 crosses. To identify transgenic founder mice, tail DNA from 3- to 4-week-old pups was digested with EcoRV-EcoRI and was subjected to Southern blot analysis using a 32P-labeled 1.8-kb EcoRV-EcoRI lacZ gene fragment as a probe. Transgenic founder mice were mated and pups screened in the same manner to identify transgenic lines. Gene copy number was determined by methods outlined in Pondel et al. (33).

Histochemical analysis of pCTR/lacZ promoter activity in transgenic embryos, fetuses, neonates, and adults
Transgenic males from each line were mated to female wild-type F1 mice. The appearance of a vaginal copulation plug was considered day 0.5. At days 11.5 and 15.5 post fertilization, whole embryos and fetuses were fixed overnight at 4 C in a solution containing 0.2% gluteraldehyde, 0.1 M phosphate buffer (pH. 7.3), 2 mM MgCl2, and 5 mM EGTA. Embryos and fetuses were then washed 3 x 20 min at room temperature in buffer composed of 0.1 M phosphate buffer (pH 7.3), 2 mM MgCl2, 0.1% sodium desoxycholate, 0.02% Nonidet P-40, and 0.05% BSA and were assayed for lacZ activity, employing 5-bromo-4-chloro-3-indol-ß-D-galactopyranoside (X-gal) as previously described (33). In some cases, fetuses were cut in half (midsagittal section) after fixation, followed by incubation in X-gal as above. Embryos and fetuses were photographed on a dissection microscope. For more detailed histochemical analysis, lacZ-positive tissues were dissected away from fetuses, embedded in OCT (Ray Lamb, London, UK), followed by freezing and sectioning on a cryostat. Sections (6–10 µm) were counterstained with eosin.

To analyze lacZ expression in neonates and adults, the spinal cord, mammary gland, kidney, anterior naris (nostrils), condylar region of humerus, external ear, tibial epiphysis, skin, spleen, and liver were removed from 1-day-old and 8-week-old transgenic lines, fixed overnight, followed by incubation in X-gal, as above. LacZ expression in testis from 8-week-old transgenics was also assayed. To analyze lacZ expression in neonate and adult brain, whole brains were removed from transgenic mice, followed by fixation overnight, as above. Before X-gal staining, the fixed brain was cut in half (midsagittal section) to allow better penetration of X-gal. Whole stained tissues were photographed on a dissection microscope. For more detailed analysis, stained tissues were frozen, as above, and were sectioned, followed by counterstaining with eosin, as above. Nontransgenic littermates and tissues were employed as background controls for all lacZ analysis described in this paper.

RT-PCR on fetal and adult RNA
To analyze mCTR gene expression in tissues from day-15.5 fetuses and 8-week-old adults, total RNA from mammary gland, anterior naris, liver, spleen, testis (from adults only), brain, spinal cord, cartilage primordium (condylar region) of humerus, tibia and tibial epiphysis, external ear, and skin was isolated as described by Chomczynski and Sacchi (34). RNA was reverse-transcribed in a 25-µl vol containing 1x RT buffer, 1 mM dNTPs, 15 U AMV reverse transcriptase (Gibco BRL), 100 ng oligo deoxythymidine, and 10 U RNasin (Promega Corp.) at 37 C. After 1 h, the mixture was heated to 95 C to inactivate AMV reverse transcriptase. The reaction mix (4 µl) was then employed for PCR amplification of mCTR messenger RNA using the following: 50 pM sense primer [GTTCTTCAGGCTCCTACCAATCTC; corresponds to sequences 571–586 in mCTR complementary DNA (cDNA)] and 50 pM antisense primer (ACCCTCTGGCAGCTAAGGTTC; corresponds to sequences 1029–1049 in mCTR cDNA), 200 µm dNTPs, 2 U Taq polymerase (Perkin-Elmer Corp.), and 1x PCR buffer, in a total vol of 45 µl. Oligos were annealed at 60 C for 45 sec, followed by extension at 72 C for 5 min and denaturing at 95 C for 45 sec. A total of 35 cycles were employed. In addition, PCR, employing sense (GTAACCAACTGGGACGATATGG; corresponds to sequence 147–169 in rat actin cDNA) and antisense (GATCTTGATCTTCATGGTGC; corresponds to sequences 890–909 in rat actin cDNA) rat actin primers was also performed, as described above, on all RNA samples. RT-PCR reaction products were then used for Southern blot analysis using 32P end-labeled 50-mer oligos (corresponds to sequence 911–960 in mCTR cDNA and 551–600 in rat actin cDNA) as probes.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
pCTR/lacZ expression in day-11.5 and day-15.5 transgenic embryos and fetuses
We used transgenic mouse technology to examine the tissue-specific pattern of pCTR promoter activity at embryonic, fetal, neonatal, and adult stages of mouse development. By linking pCTR promoter sequences to a lacZ reporter gene, pCTR promoter activity could be assayed in a wide variety of tissues using simple histochemical procedures. We therefore generated a 2.1-kb pCTR promoter by PCR and linked it to the lacZ gene (Fig. 1Go, A and B). The construct was then employed for the generation of transgenic mice. Seven transgenic founders, containing the pCTR/lacZ construct, were identified by Southern blot analysis. Hemizygous lines were established from five of the transgenic founders. Two transgenic founder mice proved to be mosaic and were not employed for subsequent lacZ analysis. The pCTR/lacZ copy number in transgenic lines ranged between 1–15 copies per haploid genome (Fig. 1CGo).

To assay pCTR promoter activity in transgenic embryos and fetuses, male transgenic lines were mated to wild-type females. At 11.5 and 15.5 days post fertilization, whole embryos and fetuses were fixed, followed by staining with X-gal. Only embryos and fetuses from transgenic lines pCTR/lacZ-2 and -4 showed detectable lacZ expression (Fig. 1CGo). Southern blot analysis did not reveal any rearrangements or gross deletion of pCTR/lacZ sequences in lines pCTR/lacZ-1, -3, and -5. This suggested that expression of the transgene in these lines may have been repressed by the site of its integration in the mouse genome (position effects). LacZ expression in 11.5-day embryos from transgenic lines pCTR/lacZ -2 and -4 was evident in the spinal cord, mid- and hind-brain. Staining could also be seen in the upper portion of the forelimb bud (Fig. 2AGo). At 15.5 days post fertilization, additional sites of pCTR promoter activity were evident. LacZ expression was detected in the anterior naris (nostrils), external ear, and mammary glands (Fig. 2Go, B and C). When sagittal sections of these fetuses were examined, staining was demonstrated in the spinal cord and regions of the brain that included medulla oblongata and pons (Fig. 2DGo). Surprisingly, no lacZ expression was observed in fetal kidney, suggesting the pCTR promoter was not active in this tissue. The results of these experiments are summarized in Table 1Go.



View larger version (75K):
[in this window]
[in a new window]
 
Figure 2. Histochemical analysis of pCTR lacZ expression in transgenic whole embryos, fetuses, and fetal tissues. A, Embryo (11.5-day): MB, midbrain; HB, hind brain; H, heart; HLB, hindlimb bud; FLB, forelimb bud; SC, spinal cord. B and C, Lateral and anterior view of a 15.5 day pCTR lacZ transgenic fetus: AN, anterior naris; EE, external ear; UF, upper forelimb; MG, mammary gland. D, Sagittal section of a 15.5-day-old pCTR/lacZ transgenic fetus: P, pons; MO, medula oblongata; H, heart; L, liver; SC, spinal cord. Panel E, Ten-micrometer frozen section of mammary gland from 15.5-day-old fetuses: E, surface ectoderm; MBD, mammary bud; M, mesenchyme. F, Ten-micrometer frozen section of upper forelimb of a 15.5-day-old fetus: CPH, cartilage primordium of humerus; CPR, cartilage primordium of radius. These data are representative of six separate X-gal stainings of embryos, fetuses, and fetal tissues showing an identical pattern of lacZ expression. Scale bars: A, 1.0 mm; B, C, and D, 3.5 mm; E, 0.1 mm; F, 70 µm.

 

View this table:
[in this window]
[in a new window]
 
Table 1. LacZ expression pattern in embryos, fetuses, neonates, and adults from transgenic lines pCTR/LacZ-2 and -4

 
Detailed histochemical analysis of fetal lacZ-positive tissues
The results above demonstrated that, between 11.5 (embryonic) and 15.5 (fetal) days of development, the pCTR promoter becomes transcriptionally active in several tissues not previously demonstrated to express CTRs: mammary gland, anterior naris, and external ear. Further histochemical analysis on the developing mammary gland from day-15.5 lacZ-positive transgenic fetuses demonstrated lacZ expression in a distinct population of mesenchymal cells surrounding the mammary bud (Fig. 2EGo). In the mouse, mammary gland development commences at approximately 10.5 days of development. By day 13.5, the developing mammary gland consists of a sphere of epithelial cells (mammary bud) surrounded by mesenchyme (35). Between 14.5–16.5 days of development, mesenchymal cells expressing androgen receptors form a distinct layer of cells surrounding the mammary bud (36). The position of lacZ-positive cells in the developing mammary gland of transgenic fetuses corresponded well to the known position of androgen receptor-positive mesenchymal cells in 15.5-day-old fetuses.

Further analysis on lacZ-positive material from the upper forelimb showed strong staining in the cartilage primordium of the distal part (condylar region) of the humerus (Fig. 2FGo). No lacZ activity was detected in cartilage primordium or ossified centers of the radius and ulna, suggesting that the pCTR promoter was not active in osteoclasts.

Histochemical analysis on frozen sections of anterior naris and external ear from transgenic fetuses showed strong sc lacZ expression with punctate lacZ expression deep to X-gal-stained cells, suggestive of sensory nerves (data not shown).

Expression of mCTR in fetal lacZ-positive tissues
The results above demonstrated that embryonic and fetal progeny of both pCTR-lacZ-2 and -4 transgenic mice displayed an identical pattern of tissue-specific lacZ expression. The observation that the pCTR promoter was active in the embryonic and fetal brain was consistent with studies showing CTRs in the brain of rats (37, 38, 39), although only adult animals were employed in these studies. However, CTR expression in anterior naris, external ear, cartilage primordium of the humerus, and mammary gland has not been reported at any stage of mouse development. To date, there are no published reports on the distribution of CTR in the developing and fully developed mouse. This may be due to the inability of conventional in situ hybridization techniques to detect the relatively low levels of CTR expression that occur in vivo. To determine whether endogenous mCTR gene expression was active in fetal tissues that previously demonstrated pCTR promoter activity, RNA was isolated from brain, developing mammary gland, distal cartilage primordium of the humerus, spinal cord, anterior naris, external ear, skin, and liver of day-15.5 wild-type fetuses. RNA from whole 15.5-day fetal tiba was employed as a positive control for mCTR messenger RNA, because this tissue has been demonstrated to contain osteoclasts (40), a cell known to contain a large number of CTRs (41, 42, 43). The extracted RNA was subjected to RT-PCR, employing primers specific to mCTR. The results of this experiment can be seen in Fig. 3Go. mCTR gene expression was evident in all tissues previously shown to express lacZ. RNA from skin adjacent to mammary gland and liver served as negative controls and demonstrated no detectable mCTR expression. These results were significant, in that they identified novel sites of mCTR expression and suggested that the pCTR promoter was only active in fetal tissues expressing endogenous mCTR.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. RT-PCR on RNA from wild-type 15.5-day-old fetal tissues. mCTR and rat actin specific primers were employed for RT-PCR, followed by Southern blot analysis with a 32P end-labeled mCTR and rat actin 50-mer oligo probes. 1, Brain; 2, spinal cord; 3, mammary gland; 4, skin; 5, whole tibia; 6, liver; 7, anterior naris; 8, cartilage primordium of distal part (condylar region) of humerus; 9, external ear. This figure is representative of three separate experiments, all showing identical results.

 
pCTR/lacZ expression in adult and neonatal transgenic mice
We wished to determine whether the tissue-specific pattern of pCTR/lacZ expression in fetal transgenics was maintained in adult transgenic mice. External ear, anterior naris, mammary gland, testis, brain, spinal cord, kidney, spleen, liver, distal part (condylar) of humerus, and epiphysis of tibia were removed from 8-week-old transgenic lines pCTR/lacZ-2 and -4 and were fixed and incubated in X-gal. LacZ expression was evident only in brain, spinal cord, and testis (Fig. 4Go).



View larger version (105K):
[in this window]
[in a new window]
 
Figure 4. Histochemical analysis of pCTR/lacZ expression in tissues from 8-week-old transgenic mice. A, Midsagittal section of brain: CB, cerebellum; CR, cerebrum; MO, medulla oblongata; OB, olfactory bulb; P, pons; NA, nucleus accumbens. B, Coronal section of spinal cord: DGH, dorsal gray horn; VGH, ventral gray horn. C, Whole testis. D, Ten-micrometer frozen section of testis; L, lumen seminiferous tubule; S, developing sperm; SP, fully developed sperm. This figure is representative of six separate X-gal stainings of tissues from 8-week-old transgenic lines pCTR/lacZ-2 and -4. Scale bars: A, 5.0 mm; B, 0.3 mm; C, 1 mm; D, 0.1 mm.

 
Midsagittal sections of brain from adult transgenics showed pCTR promoter activity in a number of structures that included the medulla, pons, and olfactory bulb. The nucleus accumbens demonstrated particularly high levels of pCTR promoter activity, as indicated by strong X-gal staining of this region (Fig. 4AGo). This pattern of lacZ expression was similar to the distribution of CTR in the rat brain (37, 38, 39). When sections of spinal cord from transgenics were examined, lacZ expression was observed in both the dorsal and ventral gray horn (Fig. 4BGo).

Silvestroni et al. (15) reported the presence of CTR in sperm. To determine whether sperm in pCTR/lacZ-2 and -4 male transgenics demonstrated pCTR promoter activity, testis from 8-week-old transgenics were frozen, sectioned, and stained with X-gal. LacZ expression was observed in developing sperm, though not in mature sperm, within the lumen of the seminiferous tubules (Fig. 4Go, C and D).

When 1-day-old neonatal transgenic mice were assayed for pCTR promoter activity, the tissue-specific pattern of lacZ expression was similar to that of adults. LacZ expression was detected only in the brain and spinal cord (data not shown). The results of these experiments are summarized in Table 1Go.

The above results suggested that the transcriptional activity of the pCTR promoter in neonates was repressed in mammary gland, anterior naris, the condylar region of humerus, and external ear but was maintained in brain and spinal cord. Similar to findings with transgenic fetuses, no pCTR promoter activity was detected in kidney or osteoclasts. Finally, no additional novel sites of pCTR promoter activity were observed.

Expression of mCTR in adult tissues displaying pCTR promoter activity
To determine whether mCTR gene expression in the anterior naris, external ear, mammary gland, and distal part (condylar region) of humerus was also repressed in adults, RNA from these tissues was isolated and subjected to RT-PCR using mCTR primers, as previously described. To serve as a positive control, RT-PCR was also performed on RNA from adult brain, spinal cord, kidney, testis, and tibial epiphysis. RT-PCR on RNA from spleen and liver served as a negative control. The results of this experiment can be seen in Fig. 5Go. Southern blot analysis, employing a mCTR specific oligonucleotide probe, demonstrated that mCTR gene expression (like pCTR promoter activity) was repressed in anterior naris, external ear, mammary gland, and the distal condylar region of humerus from 8-week-old mice. However, mCTR gene expression in brain and spinal cord was maintained. The observation that CTR gene expression was developmentally regulated in a variety of tissues in vivo has not previously been reported. These results further suggest that pCTR promoter activity in the adult was restricted to tissues that demonstrated endogenous mCTR expression, with the exception of kidney and bone.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. RT-PCR on RNA from tissues of 8-week-old wild-type mice. mCTR and rat actin-specific primers were employed for RT-PCR, followed by Southern blot analysis with 32P end-labeled mCTR and rat actin 50-mer oligo probes. 1, Brain; 2, spinal cord; 3, kidney; 4, testis; 5, mammary gland; 6, liver; 7, spleen; 8, tibial epiphysis; 9, anterior naris; 10, distal part (condylar region) of humerus; 11, external ear. This figure is representative of three separate experiments, all showing identical results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We employed the transgenic mouse as a model system for studies on the transcriptional regulation of the pCTR gene. LacZ analysis on embryonic and fetal transgenics demonstrated that the pCTR promoter correctly targeted expression of a linked lacZ reporter gene to brain and spinal cord. In the fetus, the pCTR promoter was also active in the developing mammary gland, anterior naris, and external ear (tissues we demonstrated to express endogenous mCTR). The presence of pCTR promoter activity in only one cartilaginous site of the developing skeletal system (condylar region of humerus) is surprising. However, preliminary data from pCTR/lacZ transgenic fetuses at 14.5 days of development (unpublished results) demonstrated pCTR/lacZ expression in additional cartilaginous sites, such as the cartilage primordium of the femur, ribs, ulna, and skull. This suggests that the temporal pattern of pCTR promoter activity in the developing skeletal system is not uniform. A thorough analysis of pCTR/mCTR gene expression in the skeletal system, at a variety of developmental stages, is currently underway.

The expression of CTRs in tissues such as cartilage, developing mammary gland, ear, and naris has not previously been reported. These results, combined with our data that demonstrated pCTR/mCTR activity was corepressed in identical tissues from adult transgenics, support the conclusion that the pCTR promoter correctly directed expression of a linked reporter gene specifically to tissues that expressed endogenous mCTR. It is interesting to note that pCTR/mCTR gene expression in all of the novel sites identified in this study was repressed in adult mice. Because most studies on CTR gene regulation employ cell lines or tissues from adult mice, it is not surprising that these novel sites of CTR gene expression have not previously been identified.

Surprisingly, lacZ analysis suggested that 2.1 kb of pCTR 5' flanking region was insufficient to direct expression of a linked reporter gene to kidney. A reasonable hypothesis is that pCTR promoter activity in this tissue requires positive-acting regulatory sequences (i.e. enhancer) not present in the pCTR/lacZ construct. Such sequences may also be required for pCTR promoter activity in osteoclasts. The absence of pCTR promoter activity in the kidney of transgenic mice is inconsistent with Zolnierowicz et al. (31), who demonstrated that a pCTR promoter/luciferase construct was active when transiently transfected into the kidney epithelial cell line LLC-PK1. However, we hypothesize that the large amount of DNA (5 µg) transfected into these cells, as reported by Zolnierowicz et al. (31), and the fact that the DNA construct was not integrated into the genome (thus eliminating possible position effects), may allow low-level pCTR promoter activity to be detected in the absence of important positive regulatory sequences. It is also plausible that pCTR expression in kidney cells and osteoclasts in vivo may be directed by a separate pCTR promoter not present within our 2.1-kb pCTR/lacZ construct. McCuaig et al. (44) demonstrated that expression of the PTH receptor is regulated by two separate promoter regions. The upstream (P1) promoter directs tissue-specific expression of the PTH receptor (principally kidney), whereas the downstream (P2) is more generally used (44, 45). An alternative hypothesis is that species differences between mouse and pig may account for the lack of pCTR promoter activity in osteoclasts and kidney. However, the high degree of tissue specificity demonstrated by the pCTR promoter, combined with the observation that both mCTR and pCTR promoter activity was corepressed in the same tissues in adult mice, suggests that this is not the case. By generating pCTR/lacZ transgenic mice with additional pCTR 5' and/or 3' flanking region, we hope to identify DNA sequences required for pCTR promoter activity in kidney and in osteoclasts of mice. Once such sequences have been identified, it will be of great interest to determine whether they interact with osteoclast/kidney-specific transcription factors. Such transcription factors may play an important role in the regulation of other tissue-specific genes expressed in these tissues.

Detailed analysis of lacZ expression in the developing mammary gland of 15.5-day transgenic fetuses demonstrated that the pCTR promoter was active in cells having the same distribution around the mammary bud as did mesenchymal cells previously shown to express androgen receptors (36). These mesenchymal cells, when activated by testosterone, are responsible for the destruction of the mammary anlaga in male fetuses between days 14.5–16.5 of development (36). Future studies with antiandrogen receptor antibodies, combined with lacZ analysis, will allow us to determine whether CTRs colocalize with these androgen receptor-expressing cells. Because the epithelium that comprises the mammary bud induces the expression of androgen receptors in the surrounding mesenchyme (36), it will be of great interest to determine whether the epithelium also induces CTRs in mesenchymal cells surrounding the mammary bud.

LacZ and RT-PCR analysis demonstrated that pCTR/mCTR gene expression was active in fetal (but not adult) external ear, anterior naris, and mammary glands. Repression of CTR gene expression during mammalian development has not been previously reported. In view of the hypocalcemic properties of CT and the importance of calcium ions in cell aggregation/development (46, 47, 48), it is plausible to hypothesize that CTR may play a role in the process of morphogenesis. A thorough analysis of mCTR gene expression in vivo should be carried out to identify the specific period(s) of development and tissues demonstrating mCTR gene expression. In light of difficulties previously mentioned on in situ hybridization for the detection of CTRs, such a task may be problematic.

Our results that demonstrated pCTR promoter activity was specific to CTR-expressing tissues in transgenic mice have a number of important implications: 1) the pCTR promoter can be employed to target expression of cellular transforming genes (i.e. SV 40 large T antigen) to a variety of CTR-expressing tissues in transgenic mice, to generate novel cell lines expressing CTR; 2) by generating additional transgenic mice with pCTR/lacZ promoter deletion constructs, we will be able to delineate specific DNA sequences within the pCTR promoter that direct its transcriptional activity in tissues such as mammary gland, brain, and developing sperm; 3) once identified, studies on the interaction of these sequences with nuclear regulatory transcription factors can be initiated. It is likely that such tissue-specific transcription factors will play an important role in the differentiation of CTR-expressing tissues, such as the brain/spinal cord, mammary gland, and testis.


    Acknowledgments
 
We are grateful to Brian Hemmings for useful discussions about this project.


    Footnotes
 
1 This work was supported by a grant from the Arthritis and Rheumatism Council. Back

Received April 17, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Copp DH, Cameron EC, Cheney BA, Davidson GF, Henze KG 1962 Evidence for calcitonin-a new hormone from the parathyroid that lowers blood calcium. Endocrinology 70:638–649
  2. Hirsch PF, Voelkel EF, Munson PL 1964 Thyrocalcitonin: hypocalcemic, hypophosphatemic principle of the thyroid gland. Science 146:412–413[Abstract/Free Full Text]
  3. Friedman J, Raisz LG 1965 Thyrocalcitonin: inhibitor of bone resorption in tissue culture. Science 150:1465–1467[Abstract/Free Full Text]
  4. Raisz LG, Nieman I 1967 The effects of parathyroid hormone and thyrocalcitonin on bone in organ culture. Nature 214:486–487[CrossRef][Medline]
  5. Warshawsky H, Goltzman D, Rouleau MF, Bergeron JM 1980 Direct in vivo demonstration by radioautography of specific binding sites for calcitonin in skeletal and renal tissues of the rat. J Cell Biol 85:682–694[Abstract/Free Full Text]
  6. Mundy GR, Wilkinson R, Heath DA 1984 Comparative study of medical therapy for hypercalcemia of malignancy. Am J Med 74:421–437
  7. Binstock M, Mundy GR 1980 Effect of calcitonin and glucocorticoids in combination on the hypercalcemia of malignancy. Ann Intern Med 93:269–272
  8. Ng KW, Livesey SA, Larkins RG, Martin TJ 1983 Calcitonin effects on growth and on selective activation of type II isoenzyme of cyclic adenosine 3':5-monophosphate-dependent protein kinase in T-47D human breast cancer cells. Cancer Res 43:794–800[Abstract/Free Full Text]
  9. Findlay DM, Michelangeli VP, Eisman JA, Frampton RJ, Moseley JM, MacIntyre I, Whitehead R, Martin TJ 1980 Calcitonin and 1,25-dihydroxy-vitamin D3 receptors in human breast cancer lines. Cancer Res 40:4764–4767[Abstract/Free Full Text]
  10. Martin TJ, Findlay DM, MacIntyre I, Eisman JA, Michelangeli VP, Moseley JM, Partridge NC 1980 Calcitonin receptors in a cloned human breast cancer cell line (MCF-7). Biochem Biophys Res Commun 96:150–156[CrossRef][Medline]
  11. Goltzman D 1985 Interaction of calcitonin and calcitonin gene-related peptide at receptor sites in target tissues. Science 227:1343–1345[Abstract/Free Full Text]
  12. Fischer JA, Tobler PH, Kaufmann M, Born W, Henke H, Cooper PE, Sagar SM, Martin JB 1981 Calcitonin: regional distribution of the hormone and its binding sites in the human brain and pituitary. Proc Natl Acad Sci USA 78:7801–7805[Abstract/Free Full Text]
  13. Chausmer A, Stuarat C, Stevens M 1980 Identification of testicular cell plasma membrane receptors for calcitonin. J Lab Clin Med 96:933–938[Medline]
  14. Upchurch KS, Parker LM, Scully RE, Krane SM 1986 Differential cyclic AMP responses to calcitonin among human ovarian carcinoma cell lines: a calcitonin-responsive line derived from a rare tumor type. J Bone Miner Res 1:299–304[Medline]
  15. Silvestroni L, Menditto A, Frajese G, Gnessi L 1987 Identification of calcitonin receptors in human spermatozoa. J Clin Endocrinol Metab 65:742–746[Abstract/Free Full Text]
  16. Lin HY, Harris TL, Flannery MS, Aruffo A, Kaji EH, Gorn A, Kolakowski Jr LF, Yamin M, Lodish HF, Goldring SR 1991 Expression cloning and characterization of a porcine renal calcitonin receptor. Trans Assoc Am Physicians CIV:265–272
  17. Goldring SR, Dayer DM, Ausiello DA, Krane SM 1978 A cell strain cultured from porcine kidney increase cyclic AMP content upon exposure to calcitonin or vasopressin. Biochem Biophys Res Commun 83:434–440[CrossRef][Medline]
  18. Nicholson CG, Mosley JM, Sexton PM, Mendelsohn FAO, Martin TJ 1986 Abundant calcitonin receptors in isolated rat osteoclasts. J Clin Invest 78:355–360
  19. Nicholson GC, Horton MA, Sexton PM, D’Santos CS, Moseley JM, Kemp BE, Pringle JAS, Martin TJ 1987 Calcitonin receptors of human osteoclastoma. Horm Metab Res 19:585–589[Medline]
  20. Takahashi N, Yamana H, Yoshiki S, Roodman GD, Mundy GR, Jones SJ, Boyde A, Suda T 1988 Osteoclast-like cell formation and its regulation by osteotropic hormones in mouse bone marrow cultures. Endocrinology 122:1371–1382
  21. Gillespie MT, Thomas RJ, Pu ZY, Zhou H, Martin TJ, Findlay DM 1997 Calcitonin receptors, bone sialoprotein and osteopontin are expressed in primary breast cancers. Int J Cancer 73:812–815[CrossRef][Medline]
  22. Juppner H, Abou-Samra AB, Freeman M, Kong XF, Schipani E, Richards J, Kolakowski Jr LF, Gock J, Pots JT, Kronenberg HM, Segre GV 1991 A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 254:1024–1026[Abstract/Free Full Text]
  23. Ishihara T, Nakamura S, Kaziro Y, Takahashi T, Takahashi K, Nagata S 1991 Molecular cloning and expression of a cDNA encoding the secretin receptor. EMBO J 10:1635–1641[Medline]
  24. Ishihara T, Shigemoto R, Mori K, Takahashi K, Nagata S 1992 Functional expression and tissue distribution of a novel receptor for vasoactive intestinal polypeptide. Neuron 8:811–819[CrossRef][Medline]
  25. Thorens B 1992 Expression cloning of the pancreatic ß cell receptor for the gluco-incretin hormone glucagon-like peptide 1. Proc Natl Acad Sci USA 89:8641–8645[Abstract/Free Full Text]
  26. Mayo KE 1992 Molecular cloning and expression of a pituitary-specific receptor for growth hormone-releasing hormone. Mol Endocrinol 6:1734–1744[Abstract/Free Full Text]
  27. Jelinek LJ, Lok S, Rosenberg GB, Smith RA, Grant FJ, Biggs S, Bensch PA, Kuijper JL, Sheppard PO, Sprecher CA, O’Hara PJ, Foster D, Walker KM, Chen LHJ, McKernan PA, Kindsvogel W 1993 Expression cloning and signalling properties of the rat glucagon receptor. Science 259:1614–1616[Abstract/Free Full Text]
  28. Pisegna JR, Wank SA 1993 Molecular cloning and functional expression of the pituitary adenylate cyclase-activating polypeptide type 1 receptor. Proc Natl Acad Sci USA 90:6345–6349[Abstract/Free Full Text]
  29. Chen R, Lewis KA, Perrin MH, Vale WW 1993 Expression cloning of a human corticotropin-releasing-factor receptor. Proc Natl Acad Sci USA 90:8967–8971[Abstract/Free Full Text]
  30. Usdin TB, Mezey E, Button DC, Brownstein MJ, Bonner TI 1993 Gastric inhibitory polypeptide receptor, a member of the secretin-vasoactive intestinal peptide receptor family, is widely distributed in peripheral organs and the brain. Endocrinology 133:2861–2870[Abstract/Free Full Text]
  31. Zolnierowicz S, Cron P, Solinas-Toldo S, Fries R, Lin HY, Hemmings BA 1994 Isolation, characterization and chromosomal localization of the porcine calcitonin receptor gene. J Biol Chem 30:19530–19538
  32. Wight DC, Wagner TE 1994 Transgenic mice: a decade of progress in technology and research. Mutat Res 307:429–444[Medline]
  33. Pondel MD, Proudfoot NJ, Whitelaw C, Whitelaw E 1992 The developmental regulation of the human {zeta}-globin gene in transgenic mice employing ß-galactosidase as a reporter gene. Nucleic Acids Res 20:5655–5660[Abstract/Free Full Text]
  34. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 161:156–159[CrossRef]
  35. Anderson RR 1978 Embryonic and fetal development of the mammary apparatus. In: Carson M (ed) Lactation. Academic Press, New York, vol 4, pp 3–39
  36. Heuberger B, Fitzka I, Wasner G, Kratochwil K 1982 Induction of androgen receptor formation by epithelium mesenchyme interaction in embryonic mouse mammary gland. Proc Natl Acad Sci USA 79:2957–2961[Abstract/Free Full Text]
  37. Henke H, Tobler PH, Fischer JA 1983 Localization of salmon calcitonin binding sites in rat brain by autoradiography. Brain Res 272:373–377[CrossRef][Medline]
  38. Hilton JM, Chai SY, Sexton PM 1995 In vitro autoradiographic localization of the calcitonin receptor isoforms, C1a and C1b in rat brain. Neuroscience 69:1223–1237[CrossRef][Medline]
  39. Sheward WJ, Lutz EM, Harmar AJ 1994 The expression of the calcitonin receptor gene in brain and pituitary gland of the rat. Neurosci Lett 181:31–34[CrossRef][Medline]
  40. Jemtland R, Lee K, Segre GV 1998 Heterogeneity among cells that express osteoclast associated genes in developing bone. Endocrinology 139:340–349[Abstract/Free Full Text]
  41. Nicholson CG, Moseley JM, Sexton PM, Mendelsohn FAO, Martin TJ 1986 Abundant calcitonin receptors in isolated rat osteoclasts. J Clin Invest 78:355–360
  42. Goldring SR, Roelke MS, Petrison K, Bhan AK 1987 Human giant cell tumors of bone. Identification and characterization of cell types. J Clin Invest 79:483–491
  43. Nicholson GC, Horton MA, Sexton PM, D’Santos CS, Moseley JM, Kemp BE, Pringle JAS, Martin TJ 1987 Calcitonin receptors of human osteoclastoma. Horm Metab Res 19:585–589
  44. McCuaig KA, Lee HG, Clarke JC, Assar H, Horsford J, White JH 1995 PTH/PTHrP receptor gene transcripts are expressed from tissue specific and ubiquitous promoters. Nucleic Acids Res 23:1948–1955[Abstract/Free Full Text]
  45. Amizuka N, Lee HH, Kwan MY, Arzani A, Warshawsky H, Gendy GN, Ozawa H, White JH, Goltzman D 1997 Cell specific expression of the PTH/PTHrP receptor gene in kidney from kidney-specific and ubiquitous promoters. Endocrinology 138:469–481[Abstract/Free Full Text]
  46. Curtis ASG 1957 The role of calcium in cell aggregation of Xenopus embryos. Proc Roy Phys Soc of Edinburgh 26:25–32
  47. Steinberg MA 1962 On the chemical bonds between animal cells. A mechanism for type specific association. Am Nat 92:68–81
  48. Jones KW, Elsdale TR 1963 The culture of small aggregates of amphibian embryonic cels in vitro. J Embryol Exp Morphol 11:135–154



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
M. Nakamura, B. Han, T. Nishishita, Y. Bai, and K. Kakudo
Calcitonin targets extracellular signal-regulated kinase signaling pathway in human cancers
J. Mol. Endocrinol., December 1, 2007; 39(6): 375 - 384.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. A. Tverberg, M. F. Gustafson, T. L. Scott, I. V. Arzumanova, E. R. Provost, A. W. Yan, and S. A. Rawie
Induction of Calcitonin and Calcitonin Receptor Expression in Rat Mammary Tissue during Pregnancy
Endocrinology, October 1, 2000; 141(10): 3696 - 3702.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Anusaksathien, C. Laplace, X. Li, Y. Ren, L. Peng, S. R. Goldring, and D. L. Galson
Tissue-specific and Ubiquitous Promoters Direct the Expression of Alternatively Spliced Transcripts from the Calcitonin Receptor Gene
J. Biol. Chem., June 15, 2001; 276(25): 22663 - 22674.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jagger, C.
Right arrow Articles by Pondel, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jagger, C.
Right arrow Articles by Pondel, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals