| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Endocrine Research Unit (L.C.H., F.G., B.L.R., S.K.) and Department of Biochemistry and Molecular Biology (T.C.S.), Mayo Clinic and Mayo Foundation, Rochester, Minnesota 55905; Amgen, Inc. (D.L.L., C.R.D.), Thousand Oaks, California 91320
Address all correspondence and requests for reprints to: Sundeep Khosla, M.D., Mayo Clinic and Mayo Foundation, Joseph 5–194, 200 First Street, S.W., Rochester, Minnesota 55905. E-mail: khosla{at}mayo.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Osteoprotegerin (OPG) has recently been identified by several groups
(12, 13, 14, 15, 16) as a novel, secreted cytokine receptor that is a member of the
tumor necrosis factor (TNF) receptor (TNF-R) superfamily.
Overexpression of OPG in transgenic mice results in
osteopetrosis (generalized increased bone mass) and the administration
of OPG to normal animals prevents ovariectomy-induced bone loss (12).
By contrast, targeted ablation of the OPG gene in knock-out
mice leads to early-onset, severe osteoporosis (17, 18). More recently,
two groups have independently identified the cognate ligand for OPG
(OPG-L; osteoclast differentiation factor, ODF) (19, 20). OPG-L
is identical to a previously described novel member of the TNF ligand
superfamily named TRANCE [TNF-related activation-induced cytokine
(21)] and RANKL [receptor activator of NF-
B ligand (22)], and has
been implicated in T cell and dendritic cell maturation and activation
(21, 22, 23).
OPG-L exists in a cell membrane-associated and a soluble form, both of which stimulate osteoclastogenesis and osteoclast action after binding to and activating a high-affinity receptor located on osteoclast precursors (19, 20). Recent studies have shown that OPG-L, in the presence of macrophage colony-stimulating factor (M-CSF) is both sufficient and necessary for osteoclast development in vitro (19, 20, 24), and when administered to normal mice results in enhanced osteoclastogenesis, severe osteoporosis, and malignant hypercalcemia (19). The soluble cytokine receptor OPG counteracts the biological effects of OPG-L by competing for both forms of OPG-L and preventing them from binding to the OPG-L receptor on osteoclast precursors (19). Of note, OPG-L knock-out mice have recently been shown to develop severe osteopetrosis and completely lack mature osteoclasts (23).
We and others have previously demonstrated that OPG gene expression and
protein production in osteoblastic cells is regulated by various
calcitropic hormones and cytokines (25, 26, 27, 28, 29). OPG production is
stimulated by 1,25-dihydroxyvitamin D3 (25), bone
morphogenetic protein-2 (25), TNF-
and -ß (25, 27), interleukin
(IL)-1 and -ß (25, 28) as well as by estrogen (26) and decreased
by prostaglandin E2 (29). Here we report that
glucocorticoids concurrently decrease OPG and increase OPG-L production
by human osteoblastic lineage cells, and increase osteoclastogenesis
in vitro. These findings thus provide a potential paracrine
mechanism for glucocorticoid effects on bone resorption.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-32P]-dCTP was from NEN Life Science Products (Boston, MA). The human ß-actin
complementary DNA (cDNA) insert and ExpressHyb solution were obtained
from CLONTECH Laboratories, Inc. (Palo Alto, CA).
Recombinant human TNF- was from R & D Systems
(Minneapolis, MN). All other reagents were purchased from
Sigma (St. Louis, MO).
Cell cultures
The following human osteoblastic cells were used: 1) a
conditionally immortalized bipotential marrow stromal cell line (hMS)
(30); 2) a conditionally immortalized fetal osteoblastic cell line
(hFOB) that displays the complete characteristics of the mature
osteoblastic phenotype (31); 3) primary osteoblasts (hOB) obtained from
cultures of trabecular bone explants from corrective orthopedic
procedures (32); 4) primary marrow stromal cells (MS) from healthy
subjects (33); and 5) the human osteosarcoma cell line, MG-63, obtained
from American Tissue Culture Collection. The hOB and MS cells were
obtained following approval by the Institutional Review Board. Both
conditionally immortalized cell lines, hMS and hFOB, proliferate at
33.5 C (the permissive temperature, when the temperature-sensitive
mutant SV 40 large T antigen is active) and differentiate at 39.5 C
(the restrictive temperature, when the SV 40 large T antigen is
inactive) (30, 31). At the restrictive temperature, these cells are
essentially a clonal population of normal preosteoblastic (hMS) and
osteoblastic (hFOB) cells. All other cells were grown at 37 C. All
cells were maintained in phenol-free medium supplemented with 10%
double charcoal-stripped FCS and were grown in serum-free medium
supplemented with 0.125% (wt/vol) BSA for 4 days before RNA
isolation.
Northern blot analysis
Total RNA was isolated from cell cultures using the
QIAGEN RNeasy kit in combination with the QiaShredder from
QIAGEN (Hilden, Germany). Poly-A RNA was isolated using
the PolyATract messenger RNA (mRNA) kit from Promega Corp.
(Madison, WI). Ten micrograms of total RNA or 1 µg of poly-A+ RNA
were separated on a 1.5% (wt/vol) agarose/formaldehyde gel using
continous buffer circulation (34) and then transferred to a nylon
membrane (Hybond N+, Amersham Pharmacia Biotech, Arlington
Heights, IL) by capillary blotting (35). The human cDNA inserts, a
ß-actin cDNA that hybridized to a 2.0 kb mRNA, a
full-length OPG cDNA that hybridized to three mRNA species
of 2.9 kb, 4.4 kb, and 6.6 kb (25), and an OPG-L cDNA that
hybridized to a mRNA species of 2.4 kb (19) were radiolabeled by random
primer labeling (36). Hybridization and stringent washing were carried
out as reported elsewhere (25). Band intensity was quantified by
densitometry. Control hybridization with human ß-actin
cDNA verified that equal amounts of RNA were loaded. All experiments
were carried out at least three times, and representative blots are
shown.
Semiquantitative RT-PCR
RT was performed with 2 µg of total RNA as previously
described (36). PCR reactions were carried out in 25 µl reactions at
a cycle number ensuring a linear amplification profile (OPG-L, 2 min at
94 C, 35 cyles [of 30 sec at 94 C, 30 sec at 58 C, 1 min at 72 C], 7
min at 72 C; GAPDH, 2 min at 94 C, 24 cyles [of 30 sec at 94 C, 30 sec
at 55 C, 30 min at 72 C], 7 min at 72 C). The oligonucleotides for
OPG-L (sense: 5' TCAGAAGATGGCACTCACTG 3'; antisense: 5'
AACATCTCCCACTGGCTGTA 3') were synthesized at the Mayo Oligonucleotide
Core Facility. For radiolabeled PCR reactions, [32P]-dCTP
(0.5 µl/reaction) was used. PCR products were analyzed by
electrophoresis on a 1.5 (wt/vol)% agarose gel and visualized under UV
light. For quantitative analysis of radiolabeled PCR products gel
slices were prepared from the gel and the radioactivity was determined
by a liquid scintillation counter (37).
Nuclear run-on assay
Two micrograms of full-length OPG cDNA were denatured and
fractionated in an agarose/formaldehyde gel under denaturing conditions
and transferred to a nylon membrane analogous to the Northern blot
procedure. MG-63 osteosarcoma cells (2 x 108 cells)
were treated either with vehicle or dexamethasone (10-8
M) for 24 h. Then cellular nuclei were prepared
according the method of Dignam et al. (38). Nuclear RNA was
radiolabeled using [32P]-dCTP (15 µl/reaction), and
extracted using the QIAGEN RNeasy kit from
QIAGEN (Hilden, Germany). The two lanes on the nylon
membrane were then cut and separately hybridized each with radiolabeled
RNA (107 cpm/µg) as described in (25). The membrane
strips were then exposed to an autoradiography film.
OPG protein measurement
Conditioned media from cultured cells was centrifuged to remove
cell debris. OPG protein concentration was determined in triplicate
measurements with a sandwich ELISA (CV: < 3%; lower limit of
detection: 0.1 ng/ml) as described previously (12, 25).
In vitro osteoclastogenesis assay
Bone marrow cells from 4- to- 6-week-old male CSH/HeN mice
(Charles River Laboratories, Inc. Wilmington, MA) were
prepared as previously described (19) and cultured for 7 days in
-MEM containing 10% of FCS. To assess the activity of conditioned
medium on osteoclastogenesis, the murine marrow cells (2 x
105 per well in 96-well-plates) were cultured for 7 days in
an 1:1 mixture of fresh -MEM/sterile-filtered conditioned medium
(harvested from MG-63 cells treated for 48 h either with vehicle
or dexamethasone at a concentration of 10-8 M)
supplemented with FCS (10%), recombinant human OPG-L (20 ng/ml), and
recombinant human M-CSF (60 ng/ml). To assess the direct effects of
dexamethasone, the cells were treated with either recombinant human
OPG-L (10 ng/ml), recombinant human M-CSF (30 ng/ml, R & D Systems, Minneapolis, MN), recombinant human OPG (10 ng/ml), or
dexamethasone (10-8 M). Tartrate-resistant
acid phosphatase (TRAP) activity of cell lysates (n = 4) was
assessed by a solution assay using the Acid Phosphatase Activity Assay
from Sigma. TRAP cytochemistry (n = 3) was performed
in the plates following formaldehyde fixation by using a leukocyte acid
phosphatase assay from Sigma.
Statistical analysis
Unless otherwise stated, all values are expressed as mean
± SEM. Student’s paired t test was used to
evaluate differences between the sample of interest and its respective
control. For analysis of time course and dose response, multiple
measurement ANOVA was used. A P value of < 0.05 was
considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Of note, constitutive OPG mRNA
steady-state levels were low in the bipotential, uncommitted marrow
stromal cell line (hMS) and high in differentiated osteoblastic cell
systems that have a mature osteoblastic phenotype (hFOB, hOB) as well
as in the osteosarcoma cell line, MG-63 (Fig. 1). Regardless of the
baseline OPG mRNA levels, treatment with dexamethasone at a
concentration of 10-8 M for 24 h
inhibited constitutive OPG mRNA levels by 70–90% (Fig. 1).
|
). The chronological pattern indicated
that dexamethasone (10-8 M) inhibited
constitutive OPG mRNA levels after 6 h (by 70%) with a maximum
effect of 90% after 12 to 24 h of treatment (Fig. 2B). A similar
dexamethasone-induced dose-dependent and chronological reduction of
constitutive OPG mRNA steady-state levels was also detected in primary
marrow stromal cells (by 60% and 90%, respectively) and MG-63 cells
(by 90% and 70%, respectively) (data not shown). As shown in Fig. 3, constitutive OPG mRNA levels in hFOB
cells were 10-fold higher at 39.5 C (when proliferation ceases, and the
cells differentiate and display a mature osteoblast phenotype) compared
with 33.5 C (when the cells proliferate, but do not differentiate).
However, dexamethasone dose dependently inhibited constitutive OPG mRNA
levels of hFOB cells by 90% at both temperatures (Fig. 3). Thus, the
action of dexamethasone was independent of the activity of the SV40
large T antigen, which is active at 33.5 C but inactive at 39.5 C.
|
|
(9 nM). The latter has recently been demonstrated
to stimulate OPG mRNA and protein levels (25, 27). TNF- stimulated
OPG mRNA levels by 3-fold, whereas cotreatment with dexamethasone (at
10-7 M) completely abrogated the stimulatory
effects of TNF- on OPG mRNA levels (Fig. 4).
|
Nuclear run-on studies and effects of protein synthesis inhibition
on OPG mRNA regulation by dexamethasone
To assess whether dexamethasone-induced inhibition of OPG mRNA
required de novo protein synthesis, we treated MG-63
osteosarcoma cells either with vehicle, dexamethasone
(10-8 M), the protein synthesis inhibitor,
cycloheximide (10 µg/ml), or dexamethasone (10-8
M) and cycloheximide (10 µg/ml). As shown in Fig. 6A, cycloheximide failed to abrogate the
inhibitory effect of dexamethasone on OPG mRNA levels. This suggests
that no newly synthesized protein is required for or involved in the
inhibition of OPG mRNA expression by dexamethasone. Next, we assessed
the effects of dexamethasone treatment on OPG gene transcription by
MG-63 cells directly by using a nuclear run-on assay. Compared with
vehicle treatment, dexamethasone markedly decreased OPG mRNA expression
(Fig. 6B). Collectively, these results indicate that the inhibition of
osteoblastic OPG production occurs mainly at the transcriptional
level.
|
). Quantitative analysis using
liquid scintillation counting of gel slices from radioactive PCR
reactions demonstrated a 2-fold increase of OPG-L mRNA steady-state
levels following treatment with dexamethasone (for 24 h) in a
glucocorticoid dose-dependent fashion (P < 0.001 by
ANOVA). Similarly, a 4-fold increase was observed after treatment with
dexamethasone (10-8 M) for 6 h
(P < 0.001 by ANOVA) (Fig. 7B).
|
, while
OPG-L mRNA levels in hFOB cells were barely detectable, marrow stromal
cells expressed high constitutive OPG-L mRNA levels that increased by
2-fold following treatment with dexamethasone.
|
, conditioned medium harvested from
MG-63 cells following treatment with dexamethasone (10-8
M) increased TRAP activity by 54% compared with
conditioned medium from control-treated cells (n = 4,
P < 0.005). Of note, the finding that TRAP activity in
cell lysates treated with vehicle-treated conditioned medium was
inhibited by 77% compared with TRAP activity in cell lysates cultured
in fresh medium may be due to the inhibitory effect of OPG, which is
abundantly expressed by MG-63 cells under basal conditions (see Fig. 1
). In addition, cotreatment of cells treated with OPG-L and M-CSF at
concentrations of 10 ng/ml and 30 ng/ml, respectively, with
dexamethasone (10-8 M) increased TRAP activity
of cell lysates by 2.5-fold (n = 4, P < 0.001),
compared with cells in the absence of dexamethasone (Fig. 9B). By
contrast, TRAP activity of OPG-L- and M-CSF-treated cells was inhibited
by cotreatment with OPG (10 ng/ml), and was not detected in the absence
of either M-CSF or OPG-L (Fig. 9B). Consistent with the data in Fig. 9B, TRAP cytochemistry demonstrated the presence of numerous, large,
multinucleated TRAP-positive osteoclasts following treatment with
dexamethasone compared with treatment with vehicle (data not
shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
OPG and OPG-L are potent regulators of bone homeostasis because they are expressed by cells of the osteoblastic lineage (12, 13, 15, 16, 25) and act in opposite directions on the differentiation and activity of osteoclasts (12, 13, 14, 16, 19, 20, 24). OPG-L has been shown to be a prerequiste for osteoclastogenesis in vitro (19, 20, 24). Furthermore, OPG and OPG-L production is regulated by major calcitropic hormones and cytokines known to regulate bone resorption (20, 25, 26, 27, 28, 29). The importance of the OPG-L/OPG system for bone metabolism is further supported by the phenotypic extremes of osteopetrosis (when the OPG gene is overexpressed in transgenic mice, and thus the effects of OPG-L are completely blocked) (12) and severe osteoporosis (when the OPG gene is deleted in knock-out mice and the effects of OPG-L are unopposed) (17, 18). The latter phenotype can also be generated by exogenous administration of recombinant OPG-L to normal mice (19). These data thus suggest that the OPG-L/OPG system may be the final and common pathway for mediating the effects of other candidate cytokines on osteoclastogenesis and bone resorption.
The inhibition of OPG mRNA levels by glucocorticoids was detected in
all human osteoblastic cell systems, including the immortalized fetal
osteoblastic cell line (hFOB), the immortalized adult marrow stromal
cell line (hMS), primary trabecular osteoblasts (hOB), primary marrow
stromal cells (MS), and the osteosarcoma cells line, MG-63. Thus,
glucocorticoids inhibit OPG mRNA levels in osteoblastic lineage cells
regardless of their stage of differentiation, phenotype, or absolute
constitutive OPG mRNA levels. The inhibition by glucocorticoids was
demonstrated in hFOB cells for both constitutive and TNF--stimulated
OPG expression and was present both at the mRNA and the protein levels.
The inhibition was substantial in magnitude (
90%) and was
glucocorticoid dose and time dependent. Moreover, the inhibition of OPG
in hFOB cells by glucocorticoids was detected at both the restrictive
temperature and the permissive temperature, indicating that the
inhibition of OPG by glucocorticoids was independent of the activity of
the SV 40 large T antigen. Thus, the inhibition of OPG production
following glucocorticoid treatment meets the criteria for a physiologic
response. During the review process of this manuscript, the inhibitory
effects of glucocorticoids on OPG mRNA levels were also reported by
Vidal et al. (40), although this study did not assess
glucocorticoid effects on OPG-L mRNA expression or the biologic
consequences of these changes. In the present studies, we also
demonstrate direct inhibition of OPG gene transcription by
dexamethasone (by a nuclear run-on assay) and failure of the protein
synthesis inhibitor, cycloheximide, to prevent dexamethasone-induced
suppression of OPG mRNA steady-state levels, indicating that
glucocorticoids inhibit OPG production mainly at the transcriptional
level and that this does not require de novo protein
synthesis.
In addition to effects on OPG production, glucocorticoids concurrently
increased OPG-L mRNA levels in hFOB and MS cells, as assessed by RT-PCR
and Northern analysis, by up to 2- to 4-fold in a time- and
dose-dependent fashion. In this study, we did not assess OPG-L
regulation at the protein level because no antibodies are as yet
available for an ELISA or Western analysis. Thus, glucocorticoids
increased the OPG-L/OPG ratio in these osteoblastic cells by 20- to
40-fold. Obviously, OPG-L/OPG mediation of the stimulatory effects of
glucocorticoids on bone resorption does not exclude the contribution of
other proinflammatory and bone-resorbing cytokines and cytokine
receptors such as TNF-, IL-1, and IL-6 (41, 42, 43). However, while
OPG-L is induced by glucocorticoids, the synthesis of TNF-, IL-1,
and IL-6 is suppressed by glucocorticoids (44, 45). In contrast to the
marked and consistent inhibition of OPG by glucocorticoids, soluble or
cell-associated cytokine receptors and endogenous antagonists for other
bone-resorbing cytokines (IL-1 receptors, IL-1 receptors, and TNF-R-1
and -2) appear not to be significantly regulated by glucocorticoids
(44, 46). Moreover, glucocorticoids did not affect the production of
M-CSF by various osteoblastic cell systems studied (Hofbauer, L.
C., and S. Khosla, unpublished data).
In conclusion, we find that glucocorticoids concurrently inhibit production of the antiresorptive cytokine receptor, OPG, while stimulating the mRNA levels of the bone-resorbing cytokine, OPG-L in various human osteoblastic lineage cells. We also demonstrate stimulatory effects of conditioned medium from osteoblastic cells treated with glucocorticoids and of glucocorticoids on osteoclastogenesis in vitro. These findings thus provide a potential paracrine mechanism for glucocorticoid effects on bone resorption. Strategies aimed at reducing the OPG-L/OPG ratio during the systemic use of glucocorticoids may therefore be useful in preventing glucocorticoid-induced osteoporosis.
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Recipient of a postdoctoral fellowship from the Deutsche
Forschungsgemeinschaft (Ho 1875/1–1).
Received October 28, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and
-ß upregulate the levels of osteoprotegerin mRNA in human
osteosarcoma MG-63 cells. Biochem Biophys Res Commun 248:454–457[CrossRef][Medline]
in the human osteosarcoma cell line MG-63 and in human
osteoblast-like cells. Biochem Biophys Res Commun 248:696–700[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  L. C. Hofbauer and M. Rauner Minireview: Live and Let Die: Molecular Effects of Glucocorticoids on Bone Cells Mol. Endocrinol., October 1, 2009; 23(10): 1525 - 1531. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. F. Faienza, G. Brunetti, S. Colucci, L. Piacente, M. Ciccarelli, L. Giordani, G. C. Del Vecchio, M. D'Amore, L. Albanese, L. Cavallo, et al. Osteoclastogenesis in Children with 21-Hydroxylase Deficiency on Long-Term Glucocorticoid Therapy: The Role of Receptor Activator of Nuclear Factor-{kappa}B Ligand/Osteoprotegerin Imbalance J. Clin. Endocrinol. Metab., July 1, 2009; 94(7): 2269 - 2276. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Hardy and M S Cooper Bone loss in inflammatory disorders J. Endocrinol., June 1, 2009; 201(3): 309 - 320. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. H. Kalajian, P. S. Malhotra, J. P. Callen, and L. P. Parker Calciphylaxis With Normal Renal and Parathyroid Function: Not as Rare as Previously Believed Arch Dermatol, April 1, 2009; 145(4): 451 - 458. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Nerenz, M. L. Martowicz, and J. W. Pike An Enhancer 20 Kilobases Upstream of the Human Receptor Activator of Nuclear Factor-{kappa}B Ligand Gene Mediates Dominant Activation by 1,25-Dihydroxyvitamin D3 Mol. Endocrinol., May 1, 2008; 22(5): 1044 - 1056. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Kearns, S. Khosla, and P. J. Kostenuik Receptor Activator of Nuclear Factor {kappa}B Ligand and Osteoprotegerin Regulation of Bone Remodeling in Health and Disease Endocr. Rev., April 1, 2008; 29(2): 155 - 192. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Horsch, H. de Wet, M. M. Schuurmans, F. Allie-Reid, A. C. B. Cato, J. Cunningham, J. M. Burrin, F. S. Hough, and P. A. Hulley Mitogen-Activated Protein Kinase Phosphatase 1/Dual Specificity Phosphatase 1 Mediates Glucocorticoid Inhibition of Osteoblast Proliferation Mol. Endocrinol., December 1, 2007; 21(12): 2929 - 2940. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Vega, N. M. Maalouf, and K. Sakhaee The Role of Receptor Activator of Nuclear Factor-{kappa}B (RANK)/RANK Ligand/Osteoprotegerin: Clinical Implications J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4514 - 4521. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. B. Goodman, W. Jiranek, E. Petrow, and A. W. Yasko The Effects of Medications on Bone J. Am. Acad. Ortho. Surg., August 1, 2007; 15(8): 450 - 460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Chavassieux, E. Seeman, and P. D. Delmas Insights into Material and Structural Basis of Bone Fragility from Diseases Associated with Fractures: How Determinants of the Biomechanical Properties of Bone Are Compromised by Disease Endocr. Rev., April 1, 2007; 28(2): 151 - 164. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Mancini, M. J. Paul-Clark, G. Rosignoli, R. Hannon, J. E. Martin, I. Macintyre, and M. Perretti Calcitonin and Prednisolone Display Antagonistic Actions on Bone and Have Synergistic Effects in Experimental Arthritis Am. J. Pathol., March 1, 2007; 170(3): 1018 - 1027. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Leonard Glucocorticoid-Induced Osteoporosis in Children: Impact of the Underlying Disease Pediatrics, March 1, 2007; 119(Supplement_2): S166 - S174. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Cunningham Pathogenesis and Prevention of Bone Loss in Patients Who Have Kidney Disease and Receive Long-Term Immunosuppression J. Am. Soc. Nephrol., January 1, 2007; 18(1): 223 - 234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Jia, C. A. O'Brien, S. A. Stewart, S. C. Manolagas, and R. S. Weinstein Glucocorticoids Act Directly on Osteoclasts to Increase Their Life Span and Reduce Bone Density Endocrinology, December 1, 2006; 147(12): 5592 - 5599. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kim, M. Yamazaki, L. A. Zella, N. K. Shevde, and J. W. Pike Activation of Receptor Activator of NF-{kappa}B Ligand Gene Expression by 1,25-Dihydroxyvitamin D3 Is Mediated through Multiple Long-Range Enhancers. Mol. Cell. Biol., September 1, 2006; 26(17): 6469 - 6486. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kawai, T. Matsuyama, Y. Hosokawa, S. Makihira, M. Seki, N. Y. Karimbux, R. B. Goncalves, P. Valverde, S. Dibart, Y.-P. Li, et al. B and T Lymphocytes Are the Primary Sources of RANKL in the Bone Resorptive Lesion of Periodontal Disease Am. J. Pathol., September 1, 2006; 169(3): 987 - 998. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Swanson, M. Lorentzon, H. H. Conaway, and U. H. Lerner Glucocorticoid Regulation of Osteoclast Differentiation and Expression of Receptor Activator of Nuclear Factor-{kappa}B (NF-{kappa}B) Ligand, Osteoprotegerin, and Receptor Activator of NF-{kappa}B in Mouse Calvarial Bones Endocrinology, July 1, 2006; 147(7): 3613 - 3622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Hjelmesaeth, T. Ueland, A. Flyvbjerg, J. Bollerslev, T. Leivestad, T. Jenssen, T. K. Hansen, S. Thiel, S. Sagedal, J. Roislien, et al. Early Posttransplant Serum Osteoprotegerin Levels Predict Long-Term (8-Year) Patient Survival and Cardiovascular Death in Renal Transplant Patients J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1746 - 1754. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. P. Lukert Glucocorticoid replacement--how much is enough? J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 793 - 794. [Full Text] [PDF]
|
|
|
|
|
|
A. Rogers and R. Eastell Circulating Osteoprotegerin and Receptor Activator for Nuclear Factor {kappa}B Ligand: Clinical Utility in Metabolic Bone Disease Assessment J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6323 - 6331. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Oka, Y. Kubota, T. Yamashiro, S. Ogata, T. Ninomiya, S. Ito, and K. Shirasuna Effects of Positive Pressure in Odontogenic Keratocysts Journal of Dental Research, October 1, 2005; 84(10): 913 - 918. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Freundlich, E. Alonzo, E. Bellorin-Font, and J. R. Weisinger Increased Osteoblastic Activity and Expression of Receptor Activator of NF-{kappa}B Ligand in Nonuremic Nephrotic Syndrome J. Am. Soc. Nephrol., July 1, 2005; 16(7): 2198 - 2204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Bonadonna, A. Burattin, M. Nuzzo, G. Bugari, E. A. Rosei, D. Valle, N. Iori, J. P Bilezikian, J. D Veldhuis, and A. Giustina Chronic glucocorticoid treatment alters spontaneous pulsatile parathyroid hormone secretory dynamics in human subjects Eur. J. Endocrinol., February 1, 2005; 152(2): 199 - 205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O Di Munno, M Mazzantini, A D. Sedie, M Mosca, and S Bombardieri Risk factors for osteoporosis in female patients with systemic lupus erythematosus Lupus, September 1, 2004; 13(9): 724 - 730. [Abstract] [PDF]
|
|
|
|
|
|
M. Schoppet, N. Al-Fakhri, F. E. Franke, N. Katz, P. J. Barth, B. Maisch, K. T. Preissner, and L. C. Hofbauer Localization of Osteoprotegerin, Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand, and Receptor Activator of Nuclear Factor-{kappa}B Ligand in Monckeberg's Sclerosis and Atherosclerosis J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 4104 - 4112. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. C. Hofbauer and M. Schoppet Clinical Implications of the Osteoprotegerin/RANKL/RANK System for Bone and Vascular Diseases JAMA, July 28, 2004; 292(4): 490 - 495. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Gluck and G. Colice Recognizing and Treating Glucocorticoid-Induced Osteoporosis in Patients With Pulmonary Diseases Chest, May 1, 2004; 125(5): 1859 - 1876. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hirotani, N. A. Tuohy, J.-T. Woo, P. H. Stern, and N. A. Clipstone The Calcineurin/Nuclear Factor of Activated T Cells Signaling Pathway Regulates Osteoclastogenesis in RAW264.7 Cells J. Biol. Chem., April 2, 2004; 279(14): 13984 - 13992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.Y.Y. Tay, B.H. Bay, J.F Yeo, M. Harris, S. Meghji, and S.T. Dheen Identification of RANKL in Osteolytic Lesions of the Facial Skeleton Journal of Dental Research, April 1, 2004; 83(4): 349 - 353. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. O'Brien, D. Jia, L. I. Plotkin, T. Bellido, C. C. Powers, S. A. Stewart, S. C. Manolagas, and R. S. Weinstein Glucocorticoids Act Directly on Osteoblasts and Osteocytes to Induce Their Apoptosis and Reduce Bone Formation and Strength Endocrinology, April 1, 2004; 145(4): 1835 - 1841. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Justesen, L. Mosekilde, M. Holmes, K. Stenderup, J. Gasser, J. J. Mullins, J. R. Seckl, and M. Kassem Mice Deficient in 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Lack Bone Marrow Adipocytes, but Maintain Normal Bone Formation Endocrinology, April 1, 2004; 145(4): 1916 - 1925. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. H. Lerner NEW MOLECULES IN THE TUMOR NECROSIS FACTOR LIGAND AND RECEPTOR SUPERFAMILIES WITH IMPORTANCE FOR PHYSIOLOGICAL AND PATHOLOGICAL BONE RESORPTION Critical Reviews in Oral Biology & Medicine, March 1, 2004; 15(2): 64 - 81. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Rydziel, A. M. Delany, and E. Canalis AU-Rich Elements in the Collagenase 3 mRNA Mediate Stabilization of the Transcript by Cortisol in Osteoblasts J. Biol. Chem., February 13, 2004; 279(7): 5397 - 5404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. B. Sher, H. W. Woitge, D. J. Adams, G. A. Gronowicz, Z. Krozowski, J. R. Harrison, and B. E. Kream Transgenic Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 2 in Osteoblasts Reveals an Anabolic Role for Endogenous Glucocorticoids in Bone Endocrinology, February 1, 2004; 145(2): 922 - 929. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Takuma, T. Kaneda, T. Sato, S. Ninomiya, M. Kumegawa, and Y. Hakeda Dexamethasone Enhances Osteoclast Formation Synergistically with Transforming Growth Factor-{beta} by Stimulating the Priming of Osteoclast Progenitors for Differentiation into Osteoclasts J. Biol. Chem., November 7, 2003; 278(45): 44667 - 44674. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Viereck, C. Grundker, S. Blaschke, B. Niederkleine, H. Siggelkow, K.-H. Frosch, D. Raddatz, G. Emons, and L. C. Hofbauer Raloxifene Concurrently Stimulates Osteoprotegerin and Inhibits Interleukin-6 Production by Human Trabecular Osteoblasts J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4206 - 4213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Cooper, A. Blumsohn, P. E. Goddard, W. A. Bartlett, C. H. Shackleton, R. Eastell, M. Hewison, and P. M. Stewart 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Activity Predicts the Effects of Glucocorticoids on Bone J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3874 - 3877. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-i. Hirose, H. Tomiyama, R. Okazaki, T. Arai, Y. Koji, G. Zaydun, S. Hori, and A. Yamashina Increased Pulse Wave Velocity Associated with Reduced Calcaneal Quantitative Osteo-sono Index: Possible Relationship Between Atherosclerosis and Osteopenia J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2573 - 2578. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Coghlan, P. B. Jacobson, B. Lane, M. Nakane, C. W. Lin, S. W. Elmore, P. R. Kym, J. R. Luly, G. W. Carter, R. Turner, et al. A Novel Antiinflammatory Maintains Glucocorticoid Efficacy with Reduced Side Effects Mol. Endocrinol., May 1, 2003; 17(5): 860 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Sezer, U. Heider, I. Zavrski, C. A. Kuhne, and L. C. Hofbauer RANK ligand and osteoprotegerin in myeloma bone disease Blood, March 15, 2003; 101(6): 2094 - 2098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B.-K. Choi, H. J. Lee, J. H. Kang, G. J. Jeong, C. K. Min, and Y.-J. Yoo Induction of Osteoclastogenesis and Matrix Metalloproteinase Expression by the Lipooligosaccharide of Treponema denticola Infect. Immun., January 1, 2003; 71(1): 226 - 233. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Krieger, K. K. Frick, and D. A. Bushinsky Cortisol Inhibits Acid-Induced Bone Resorption In Vitro J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2534 - 2539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Rubin and J. P. Bilezikian The Role of Parathyroid Hormone in the Pathogenesis of Glucocorticoid-Induced Osteoporosis: A Re-Examination of the Evidence J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4033 - 4041. [Full Text] [PDF]
|
|
|
|
|
|
J. Rubin, C. L. Ackert-Bicknell, L. Zhu, X. Fan, T. C. Murphy, M. S. Nanes, R. Marcus, L. Holloway, W. G. Beamer, and C. J. Rosen IGF-I Regulates Osteoprotegerin (OPG) and Receptor Activator of Nuclear Factor-{kappa}B Ligand in Vitro and OPG in Vivo J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4273 - 4279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T Mushtaq and S F Ahmed The impact of corticosteroids on growth and bone health Arch. Dis. Child., August 1, 2002; 87(2): 93 - 96. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Schoppet, K. T. Preissner, and L. C. Hofbauer RANK Ligand and Osteoprotegerin: Paracrine Regulators of Bone Metabolism and Vascular Function Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 549 - 553. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Biskobing COPD and Osteoporosis Chest, February 1, 2002; 121(2): 609 - 620. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Canalis and A. Giustina Glucocorticoid-Induced Osteoporosis: Summary of a Workshop J. Clin. Endocrinol. Metab., December 1, 2001; 86(12): 5681 - 5685. [Full Text] [PDF]
|
|
|
|
|
|
S. Khosla Minireview: The OPG/RANKL/RANK System Endocrinology, December 1, 2001; 142(12): 5050 - 5055. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Watkins, Y. Li, and M. F. Seifert Nutraceutical Fatty Acids as Biochemical and Molecular Modulators of Skeletal Biology J. Am. Coll. Nutr., October 1, 2001; 20(90005): 410S - 416. [Abstract] [Full Text]
|
|
|
|
|
|
T. Yamagishi, E. Otsuka, and H. Hagiwara Reciprocal Control of Expression of mRNAs for Osteoclast Differentiation Factor and OPG in Osteogenic Stromal Cells by Genistein: Evidence for the Involvement of Topoisomerase II in Osteoclastogenesis Endocrinology, August 1, 2001; 142(8): 3632 - 3637. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Watkins, Y. Li, H. E. Lippman, and M. F. Seifert Omega-3 Polyunsaturated Fatty Acids and Skeletal Health Experimental Biology and Medicine, June 1, 2001; 226(6): 485 - 497. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Sasaki, E. Kusano, Y. Ando, K. Yano, E. Tsuda, and Y. Asano Glucocorticoid decreases circulating osteoprotegerin (OPG): possible mechanism for glucocorticoid induced osteoporosis Nephrol. Dial. Transplant., March 1, 2001; 16(3): 479 - 482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. W. Eberhardt, A. Yeager-Jones, and H. C. Blair Regional Trabecular Bone Matrix Degeneration and Osteocyte Death in Femora of Glucocorticoid- Treated Rabbits Endocrinology, March 1, 2001; 142(3): 1333 - 1340. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Fan, D. Fan, H. Gewant, C. L. Royce, M. S. Nanes, and J. Rubin Increasing membrane-bound MCSF does not enhance OPGL-driven osteoclastogenesis from marrow cells Am J Physiol Endocrinol Metab, January 1, 2001; 280(1): E103 - E111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Gori, L. C. Hofbauer, C. R. Dunstan, T. C. Spelsberg, S. Khosla, and B. L. Riggs The Expression of Osteoprotegerin and RANK Ligand and the Support of Osteoclast Formation by Stromal-Osteoblast Lineage Cells Is Developmentally Regulated Endocrinology, December 1, 2000; 141(12): 4768 - 4776. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Teitelbaum Bone Resorption by Osteoclasts Science, September 1, 2000; 289(5484): 1504 - 1508. [Abstract] [Full Text]
|
|
|
|
|
|
E. A. Gonzalez The role of cytokines in skeletal remodelling: possible consequences for renal osteodystrophy Nephrol. Dial. Transplant., July 1, 2000; 15(7): 945 - 950. [Full Text] [PDF]
|
|
|
|
|
|
S. C. Manolagas Birth and Death of Bone Cells: Basic Regulatory Mechanisms and Implications for the Pathogenesis and Treatment of Osteoporosis Endocr. Rev., April 1, 2000; 21(2): 115 - 137. [Abstract] [Full Text]
|
|
|
|
|
|
S. C. Manolagas Editorial: Cell Number Versus Cell Vigor--What Really Matters to a Regenerating Skeleton? Endocrinology, October 1, 1999; 140(10): 4377 - 4381. [Full Text]
|
|
|
|
|
|
H. Zhou, V. Kartsogiannis, Y. S. Hu, J. Elliott, J. M. W. Quinn, W. J. McKinstry, M. T. Gillespie, and K. W. Ng A Novel Osteoblast-derived C-type Lectin That Inhibits Osteoclast Formation J. Biol. Chem., April 27, 2001; 276(18): 14916 - 14923. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Schoppet, K. T. Preissner, and L. C. Hofbauer RANK Ligand and Osteoprotegerin: Paracrine Regulators of Bone Metabolism and Vascular Function Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 549 - 553. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
