| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Unit on Cell Biology, Laboratory of Genetics, National Institute of Mental Health, Bethesda, Maryland 20892-4094
Address all correspondence and requests for reprints to: Ted B. Usdin, Room 3D06, Building 36, 36 Convent Drive, MSC4094, NIH, Bethesda, Maryland 20892-4094. E-mail usdin{at}codon.nih.gov
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Northern blots of human messenger RNA (mRNA) showed that the PTH2 receptor was most highly expressed in the brain, pancreas, testis, placenta, and lung (1). It was not detected on Northern blots of human kidney mRNA or in bone-derived cell lines using RT-PCR. Detailed investigation of the PTH2 receptors cellular distribution in the rat revealed that it is expressed by an extremely small number of cells in the kidney, which are near the vascular pole of glomeruli. The major sites of PTH2 receptor expression in the rat are a number of discrete nuclei in the brain, the vasculature and heart, scattered endocrine cells, and pancreas (4).
Detailed anatomical investigation of the PTH2 receptor is being performed in the rat, and future physiological studies will be performed, at least initially, in rats or mice. Receptor activation by PTH but not PTHrP as observed in transfected tissue culture cells does not clearly correlate with effects of PTH, which have been observed in tissues where the PTH2 receptor is expressed. Where the data have been reported, most effects of PTH are reproduced by PTHrP, suggesting that PTH effects even in tissues that express the PTH2 receptor may be mediated by the PTH1 receptor (see Ref. 5 and references therein). An important consideration is that the pharmacological characterization of the PTH2 receptor has been performed using the cloned human receptor, but most studies of physiological responses are performed in rats. It is therefore important to determine the pharmacological profile of the rat PTH2 receptor.
A second reason for investigating the ligand activation specificity of the rat PTH2 receptor emerged during our characterization of the human receptor. [Nle8, 18, Tyr34]bPTH (334) caused significant activation of the human PTH2 receptor under conditions where no effect on the human PTH1 receptor was observed. This ligand was originally described as a PTH receptor antagonist based on its effects in vitro (6, 7). In vivo studies, however, suggested that it was a weak PTH receptor agonist (8). The relatively large effect on the human PTH2 receptor motivated the investigation of its effect on the rat PTH2 receptor to test the possibility that the previously observed effects of [Nle8, 18, Tyr34]bPTH (334) in vivo could reflect actions mediated by the PTH2 receptor.
The relatively abundant expression of the PTH2 receptor in the brain, in combination with our inability to detect PTH mRNA there, led us to look for another PTH2 receptor activating ligand (9). We have not completed the purification of this potential PTH2 receptor selective peptide, but we have compared the effects of the partially purified activity with the effects of PTH-derived peptides as part of our characterization of the rat PTH2 receptor. This comparison shows that PTH is a relatively poor ligand for the rat PTH2 receptor and suggests that a different peptide, such as the one found in hypothalamic extracts, is more likely to be its endogenous ligand.
| Materials and Methods |
|---|
|
|
|---|
-32P]dCTP was purchased
from ICN Biomedicals, Inc. (Costa Mesa, CA). Cell culture
supplies were obtained from Life Technologies, Inc.
(Frederick, MD) except for FBS which was from Sigma (St.
Louis, MO). Bovine hypothalamic extract was prepared by acid
extraction, gel-filtration and reverse-phase HPLC as previously
described (9).
Receptor cloning
A rat hypothalamus complementary DNA (cDNA) library was prepared
in the vector CDM7amp as previously described (10). Miniprep DNA from
47 pools of 20 000 clones was screened by PCR with rat PTH2
receptor-specific primers (amplifying bases 1069 to 1908, GenBank
accession no. U55836). Positive pools were rescreened with a sense
vector sequence primer (5'TTCCCATAGTAACGCCAATA) and an antisense primer
in the 5' end of the receptor sequence (bases 659 to 679) and then by
Southern blotting of an EcoRI-digest, using a
32P-labeled probe (bases 10691908). A clone was isolated
from a single positive pool by colony hybridization using the same
32P-labeled probe. Both strands were sequenced as
previously described (11) following subcloning of restriction fragments
into pUC18 vector.
Cell culture and transient expression in COS-7 cells
COS-7 cells were grown and transfected as previously described
(12) except that transfections were performed in 10 cm tissue culture
dishes using 10 µg of plasmid DNA. The cells were dislodged using
trypsin and transferred to 96-well plates at a density of 50 000
cells/well the following day. The plasmid constructs containing the
cDNA sequences of the human PTH2 receptor and ß-galactosidase have
been previously described (1, 13).
Measurement of cellular levels of cAMP
Following removal of medium, transfected COS-7 cells were
treated for 40 min at 37 C with 50 µl/well cAMP assay buffer (DMEM
containing 25 mM HEPES supplemented with 0.1% BSA, 30
µM Ro 201724 (RBI, Natick, MA), 100 µM
(4-(2-aminoethyl))-benzenesulfonylflouride and 1 µg/ml bacitracin).
This buffer was removed and replaced with 40 µl fresh buffer, test
agents were added in a volume of 10 µl and the cells incubated for an
additional 40 min at 37 C. The assay was then terminated by the
addition of 50 µl 0.1 N HCl, 0.1 mM
CaCl2. The assay volume was reduced to 25 µl for assays
of the effect of bovine hypothalamic extract and parallel assays of PTH
ligands. cAMP was quantified using a RIA as previously described (12).
Antagonist inhibitory potency was examined by measuring the
concentration dependence of rPTH (134)-stimulated cAMP accumulation
in the presence and absence of antagonist.
Data analysis
Concentration dependence data for ligand-stimulated cAMP
accumulation were analyzed with the following four parameter-logistic
equation using Prism 2.01 (GraphPad Software, Inc., San
Diego, CA):
![]() |
![]() |
| Results |
|---|
|
|
|---|
|
|
At the human PTH2 receptor, all PTH ligands containing the N-terminal
amino acid stimulated cAMP accumulation (Fig. 3A
). The highest potencies
(EC50 of 1 nM or less) were observed for rPTH
(134), rPTH (184), and hPTH (134) (Table 1
). For hPTH (134) a similar potency
was observed in previous studies (1, 2, 12)). [Nle8,18,
Tyr34]bPTH (134) was slightly less potent and activated
the receptor with lower intrinsic activity (maximal effect) (Fig. 3C
, Table 1
). Strikingly, at the rat PTH2 receptor all PTH ligands were
considerably less potent than at the human receptor (Fig. 3
, Tables 1
and 2
). The highest potency observed was
only 19 nM (for rPTH (184), Table 2
). For all other PTH
ligands the EC50 was approximately 100 nM
(Table 2
). Lower potency at the rat receptor was specific to PTH
ligands because PTHrP (134) displayed a 14-fold higher potency for
the rat receptor than the human receptor (Tables 1
and 2
). PTHrP
(134) acted with low intrinsic activity at both receptors (Tables 1
and 2
). A range of intrinsic activity was observed for PTH ligands at
the rat PTH2 receptor (Table 2
). For all PTH and PTHrP ligands the
maximal stimulation of cAMP production was less at the rat PTH2
receptor than at the human receptor (compare column 4 of Table 2
with
column 3 of Table 1
).
|
|
|
Stimulation of cAMP accumulation in response to bovine hypothalamic
extract at human and rat PTH2 receptors
Initial experiments demonstrated that bovine hypothalamic acid
extract activated the rat PTH2 receptor (Fig. 2A
). Full dose-response
curves for the extract (Fig. 4
) show that
neither the maximal response nor the potency are significantly
different at the human compared with the rat PTH2 receptor (maximal
responses = 4.6 ± 0.4 vs. 5.6 ± 1.2 pmol
cAMP·well-1, P = 0.44;
EC50 = 4.0 ± 0.6 vs. 5.0 ± 1.2
µg·ml-1, P = 0.44, for human and rat
receptors, respectively). At the human PTH2 receptor, the maximal
response to the extract was slightly less than the response to hPTH
(134) (Table 1
). However, at the rat PTH2 receptor the response to
the extract was more than double that of the most efficacious ligand
(rPTH (134), Table 2
). Therefore, all the PTH ligands tested are
partial agonists at the rat PTH2 receptor.
|
Measurement of antagonist inhibitory potency
The different rank order of intrinsic activity values for agonist
ligands suggests that the conformation of the receptors is different in
a manner that affects the ability of ligand to activate the receptor.
To investigate differences of activation-independent ligand binding
affinity at the two receptors, we compared the inhibitory potency of an
antagonist ligand ([Nle8,18,
D-Tryp12, Tyr34]bPTH (734)). In
these experiments, the concentration dependence of rPTH (134) for
stimulation of adenylyl cyclase was measured in the presence and
absence of 1 µM of the antagonist ligand. The rPTH
(134) EC50 value obtained in the presence and absence of
the antagonist was used to calculate the antagonist
pKB, a measure of the inhibitory potency of the
antagonist. pKB is defined as the concentration
of antagonist required to produce a 2-fold decrease of agonist potency
(i.e. a 2-fold increase of agonist EC50).
[Nle8,18, D-Tryp12,
Tyr34]bPTH (734) (1 µM) produced a
rightward shift of the rPTH (134) concentration-response curve for
both human and rat PTH2 receptors (Fig. 5
). The pKB value
for the antagonist was 6.5 ± 0.1 (320 nM) at the
human receptor and 6.5 ± 0.2 (310 nM) at the rat
receptor. These values are not significantly different
(P = 0.91). Activation-independent binding of this
antagonist ligand is therefore similar at both human and rat PTH2
receptors.
|
| Discussion |
|---|
|
|
|---|
When we first expressed the cloned rat PTH2 receptor, we observed much less accumulation of cAMP in response to PTH than was observed with the human receptor. One possible explanation is that PTH is not an effective ligand for the receptor. We previously demonstrated an activity in extracts prepared from bovine hypothalamus that preferentially activated the human PTH2 receptor over the PTH1 receptor (9). We are currently attempting to complete the purification of that activity. We examined the effect of partially purified material on the rat PTH2 receptor and observed that it caused more accumulation of cAMP than the maximum produced by PTH peptides. Because the maximal stimulation caused by treatment of the rat PTH2 receptor with the extract was almost the same as that caused by treatment of the human receptor it seems likely that their levels of expression are not greatly different. The in vitro potency of the currently available ligands is unlikely to be high enough to allow measurement of the level of expression using a radioligand binding assay.
The rank order of potency of a series of PTH analogs differs between the rat and human PTH2 receptors. This suggests an intrinsic functional difference between the receptors. The pharmacological data can be used to generate a hypothesis regarding the mechanism underlying the different properties of the human and rat PTH2 receptors. The PTH2 receptor belongs to the secretin family of G protein-coupled receptors (1). Agonist interaction with members of this family is believed to involve a two-site binding process (14). High affinity interaction of one region of the ligand with the large N-terminal domain of the receptor anchors the ligand to the receptor. Subsequent interaction of a second site of the ligand with an activation domain on the receptor leads to enhanced G protein activation and second-messenger production. In the simplest scenario one or both of these ligand-receptor interactions could underlie the different responses of the receptors to PTH ligands. Two observations are consistent with the hypothesis that binding to the activation domain rather than the N terminus is weaker for PTH ligands at the rat PTH2 receptor. 1) The lower intrinsic activities of ligands at the rat PTH2 receptor compared with the human receptor suggests that activating interactions of PTH ligands are weaker at the rat receptor. 2) The inhibitory potency of the antagonist [Nle8,18, D-Tryp12, Tyr34]bPTH (734) was similar for both human and rat receptors suggesting that activation-independent binding is similar at both receptors. This hypothesis could be tested by manipulation of receptor structure using, for example, site-directed in vitro mutagenesis. It is important to note that differences in ligand potency between the receptors provide little information that can be used to discriminate between the two steps in the mechanism described above because potency is defined by a function which includes the product of the affinities of the two postulated binding interactions (15).
We observed that N-terminal-truncated PTH analogs activated the human
PTH2 receptor with potencies of less than 10 nM (Table 1
).
We investigated the possibility that the PTH2 receptor may be involved
in mediating the weak PTH-like responses to these ligands observed
in vivo. Most of these functional experiments have been
performed using the rat (8), so we evaluated the effects of
[Nle8,18, Tyr34]bPTH (334) and bPTH (334)
on the cloned rat PTH2 receptor. No significant stimulation of cAMP
accumulation was observed with either compound, suggesting that the
PTH-like agonist properties of these ligands are not mediated by the
PTH2 receptor. It is more likely that the PTH-1 receptor mediates this
response; recently, the compounds have been demonstrated to elevate the
intracellular calcium level in proximal convoluted tubule cells of the
rat kidney (16), to stimulate phosphatidylcholine hydrolysis in rat
osteoblastic cells (17), and to stimulate protein kinase C
translocation to the plasma membrane in Chinese hamster ovary cells
transfected with rat PTH-1 receptor cDNA (18).
PTH has a low potency (near 20 nM) at the rat PTH2 receptor and is a partial agonist. Agonist potency at peptide receptors is generally subnanomolar for stimulation of adenylyl cyclase in transfected cells (19, 20, 21, 22, 23, 24), and we know of no cases where an endogenous ligand is thought to be a partial agonist. Therefore, we think it reasonable to conclude that PTH is unlikely to be a physiologically significant modulator of the rat PTH2 receptor. A rat homolog of the peptide present in bovine hypothalamus is a candidate for its endogenous ligand. The situation at the human PTH2 receptor is less clear because there is not a large difference between the intrinsic activities of the bovine extract and PTH peptides. There may be significant differences in the putative hypothalamic peptide between species. Sequence determination of the PTH2 receptor-stimulating activity in bovine hypothalamus and its homologs in other species, followed by investigation of the pharmacological and physiological effects of synthetic peptides will be an important step in understanding the biological role of the PTH2 receptor system, and may help define their endogenous ligands.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received March 1, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. M. Murray, L. G. Rao, P. Divieti, and F. R. Bringhurst Parathyroid Hormone Secretion and Action: Evidence for Discrete Receptors for the Carboxyl-Terminal Region and Related Biological Actions of Carboxyl- Terminal Ligands Endocr. Rev., February 1, 2005; 26(1): 78 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Papasani, R. C. Gensure, Y.-L. Yan, Y. Gunes, J. H. Postlethwait, B. Ponugoti, M. R. John, H. Juppner, and D. A. Rubin Identification and Characterization of the Zebrafish and Fugu Genes Encoding Tuberoinfundibular Peptide 39 Endocrinology, November 1, 2004; 145(11): 5294 - 5304. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Gensure, B. Ponugoti, Y. Gunes, M. R. Papasani, B. Lanske, M. Bastepe, D. A. Rubin, and H. Juppner Identification and Characterization of Two Parathyroid Hormone-Like Molecules in Zebrafish Endocrinology, April 1, 2004; 145(4): 1634 - 1639. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sugimura, T. Murase, S. Ishizaki, K. Tachikawa, H. Arima, Y. Miura, T. B. Usdin, and Y. Oiso Centrally Administered Tuberoinfundibular Peptide of 39 Residues Inhibits Arginine Vasopressin Release in Conscious Rats Endocrinology, July 1, 2003; 144(7): 2791 - 2796. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Goodman, I. B. Salusky, and H. Juppner New lessons from old assays: parathyroid hormone (PTH), its receptors, and the potential biological relevance of PTH fragments Nephrol. Dial. Transplant., October 1, 2002; 17(10): 1731 - 1736. [Full Text] [PDF] |
||||
![]() |
A. Eichinger, N. Fiaschi-Taesch, T. Massfelder, S. Fritsch, M. Barthelmebs, and J.-J. Helwig Transcript Expression of the Tuberoinfundibular Peptide (TIP)39/PTH2 Receptor System and Non-PTH1 Receptor-Mediated Tonic Effects of TIP39 and Other PTH2 Receptor Ligands in Renal Vessels Endocrinology, August 1, 2002; 143(8): 3036 - 3043. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. John, M. Arai, D. A. Rubin, K. B. Jonsson, and H. Juppner Identification and Characterization of the Murine and Human Gene Encoding the Tuberoinfundibular Peptide of 39 Residues Endocrinology, March 1, 2002; 143(3): 1047 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dobolyi, H. Ueda, H. Uchida, M. Palkovits, and T. B. Usdin Anatomical and physiological evidence for involvement of tuberoinfundibular peptide of 39 residues in nociception PNAS, January 24, 2002; (2002) 42416199. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Goold, T. B. Usdin, and S. R. J. Hoare Regions in Rat and Human Parathyroid Hormone (PTH) 2 Receptors Controlling Receptor Interaction with PTH and with Antagonist Ligands J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 678 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Ward, C. J. Small, K. G. Murphy, A. R. Kennedy, M. A. Ghatei, and S. R. Bloom The Actions of Tuberoinfundibular Peptide on the Hypothalamo-Pituitary Axes Endocrinology, August 1, 2001; 142(8): 3451 - 3456. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Jonsson, M. R. John, R. C. Gensure, T. J. Gardella, and H. Juppner Tuberoinfundibular Peptide 39 Binds to the Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor, but Functions as an Antagonist Endocrinology, February 1, 2001; 142(2): 704 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. J. Hoare and T. B. Usdin Tuberoinfundibular Peptide (7-39) [TIP(7-39)], a Novel, Selective, High-Affinity Antagonist for the Parathyroid Hormone-1 Receptor with No Detectable Agonist Activity J. Pharmacol. Exp. Ther., November 1, 2000; 295(2): 761 - 770. [Abstract] [Full Text] |
||||
![]() |
S. R. J. Hoare, D. A. Rubin, H. Juppner, and T. B. Usdin Evaluating the Ligand Specificity of Zebrafish Parathyroid Hormone (PTH) Receptors: Comparison of PTH, PTH-Related Protein, and Tuberoinfundibular Peptide of 39 Residues Endocrinology, September 1, 2000; 141(9): 3080 - 3086. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Piserchio, T. Usdin, and D. F. Mierke Structure of Tuberoinfundibular Peptide of 39 Residues J. Biol. Chem., August 25, 2000; 275(35): 27284 - 27290. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. J. Hoare, J. A. Clark, and T. B. Usdin Molecular Determinants of Tuberoinfundibular Peptide of 39 Residues (TIP39) Selectivity for the Parathyroid Hormone-2 (PTH2) Receptor. N-TERMINAL TRUNCATION OF TIP39 REVERSES PTH2 RECEPTOR/PTH1 RECEPTOR BINDING SELECTIVITY J. Biol. Chem., August 25, 2000; 275(35): 27274 - 27283. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dobolyi, H. Ueda, H. Uchida, M. Palkovits, and T. B. Usdin Anatomical and physiological evidence for involvement of tuberoinfundibular peptide of 39 residues in nociception PNAS, February 5, 2002; 99(3): 1651 - 1656. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |