help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Brien, M. L.
Right arrow Articles by Park-Sarge, O.-K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Brien, M. L.
Right arrow Articles by Park-Sarge, O.-K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
Endocrinology Vol. 140, No. 10 4530-4541
Copyright © 1999 by The Endocrine Society


ARTICLES

Characterization of Estrogen Receptor-ß (ERß) Messenger Ribonucleic Acid and Protein Expression in Rat Granulosa Cells1

Michelle L. O’Brien2, KyungSoo Park, YongHo In3 and Ok-Kyong Park-Sarge4

Graduate Center for Toxicology (M.L.O., O.-K.P.-S.) and Department of Physiology (K.P., Y.I., O.-K.P.-S.), University of Kentucky, Lexington, Kentucky 40536

Address all correspondence and requests for reprints to: Dr. Ok-Kyong Park-Sarge, Department of Physiology, University of Kentucky, Lexington, Kentucky 40536-0084. E-mail: OKPS{at}pop.uky.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have examined estrogen-responsiveness of ovarian granulosa cells by focusing on estrogen receptor (ER) expression. Estrogen responsiveness was determined by examining the effect of 17ß-estradiol (1–10 nM) on luciferase reporter activity in rat granulosa cells transfected with an ERE-luciferase construct. The results demonstrate an estrogen-induced (approximately 3-fold) increase in luciferase reporter activity, indicating that granulosa cells contain functional estrogen response element (ERE)-binding transcriptional activators. Gel mobility shift assays in combination with ER antibodies show that ERß is the predominant ERE-binding protein in granulosa cells. Western blotting results show that granulosa cells contain ERß-immunoreactive protein(s) migrating at a size substantially larger than the recombinant protein generated from the originally proposed 485 amino acid open-reading frame. This size discrepancy is not due to granulosa cell expression of ERß isoforms with insertions within the coding region because RT-PCR assays revealed products with sizes expected for ERß, ERßB, and {delta}3 isoforms. This size discrepancy appears to be due to usage of a well-conserved, upstream in-frame translation initiation codon (ATG436) leading to a 530 amino acid open reading frame. ERß messenger RNA (mRNA) characterization using 5'-rapid amplification of complementary DNA ends (5'-RACE) show the presence of two different (P1- and P2-) 5'-ends of rat ERß mRNA encoding the full-length ERß protein. The generation of the P2-specific exon is likely due to initiation of transcription from an alternative promoter. Both P1- and P2-specific exon-containing ERß mRNAs are expressed in granulosa cells, and they are rapidly down-regulated by the cAMP-mediated intracellular signaling pathway in cultured granulosa cells. Taken together, our results show that rat granulosa cells produce two different 3',5'-cAMP-regulated ERß mRNA species and that these mRNA species are capable of encoding the full-length ERß protein.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ESTROGEN IS A pleiotropic hormone that plays a pivotal role in many and diverse aspects of mammalian physiology. In particular, female reproduction is controlled by the ability of estrogen to regulate the synthesis of pituitary gonadotropins (1), to regulate proliferation of uterine cells and breast cancer cells (2), and to regulate various granulosa cell functions (3). In its target cells, this steroid binds to the intracellular receptor DNA-binding transcription factor that shares structural characteristics with other members of the steroid/thyroid hormone/retinoic acid receptor superfamily (4). Two types of estrogen receptors (ERs), ER{alpha} and ERß, are distinct gene products but are highly homologous to each other, in particular, in the ligand-binding and DNA-binding domains (5, 6, 7, 8, 9, 10, 11, 12, 13). Although ER{alpha} and ERß bind to endogenous ligands such as 17ß-estradiol with similar affinity (14, 15) and form homo- and hetero-dimers (16, 17, 18), they display differential transcriptional activities in a cell- and promoter context-dependent manner (19, 20, 21). Thus, differential production of ER{alpha} and/or ERß will likely provide a cellular microenvironment that regulates estrogen-responsiveness of target genes in a cell-dependent manner. Expression of several ER{alpha} (22, 23, 24, 25, 26, 27) and ERß (28, 29, 30, 31, 32) isoforms exhibiting potential differences in ligand/DNA binding and in transcriptional activities may also be an important factor in modulating cellular estrogen-responsiveness. In particular, at least three ERß isoforms have been identified which function as repressors of ER{alpha} and ERß. ERßcx is a human ERß isoform containing a different carboxy-most terminal exon and is a powerful repressor for both ER{alpha} and ERß (28). However, no homologs of this isoform have yet been identified in other species. ERßB, characterized by a 54-bp spliced-in exon within the hormone-binding domain, has been identified in the rat and mouse (29, 30, 31). Interestingly, ERßB has yet been identified in the human (32). This isoform has a much lower binding affinity for estrogen and has been shown to repress ER{alpha}- and ERß-induced transcription, when expressed at a molar ratio that exceeds ER{alpha} and/or ERß (28, 29, 33). In addition, {delta}3 isoforms (ERß{delta}3 and ERßB{delta}3) have a deletion in exon3 and are able to dimerize with ER{alpha}, ERß, and ERßB but are not able to interact with ERE and thus function as repressors (28). Several other ERß isoforms corresponding to ER{alpha} isoforms have been suggested to arise from alternative splicing within the hormone-binding in the rodent (28, 34) and human (34). Thus, understanding ERß protein expression is critical to understanding estrogen-responsiveness in target cells.

We (35) and others (8) have previously reported that ERß messenger RNA (mRNA) is highly expressed in small growing follicles but decreases in larger follicles due to the ability of gonadotropins to down regulate ERß gene expression. In contrast, expression of the ER{alpha} gene is low in the rat ovary (35). This mRNA data positively correlates to ERß protein expression as determined by immunocytochemistry (36, 37), suggesting that ERß dimers mediate estrogen actions on target genes in granulosa cells, which may be critical for the growth and development of ovarian follicles (38), ovarian steroidogenic capacity (39), and follicular viability (40). Indeed, ERß-null mutant mice demonstrate reduced ovarian efficacy (41). Interestingly, ER{alpha}-null mutant mice are infertile largely due to neuroendocrine dysfunction (42). Thus, we were interested in characterizing ERß mRNA and protein in rat granulosa cells. Our results suggest that granulosa cells produce approximately 62 kDa ERß protein(s) by using ERß transcripts with different 5'-ends, the level of which decreases in response to cAMP.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Unless specifically stated, all molecular biological enzymes were obtained from New England Biolabs, Inc. (Beverly, MA). Phenol red-free Hams-F12 and antibiotics for tissue culture were from Life Technologies, Inc. (Gaithersburg, MD) whereas 17ß-estradiol, phenol red-free DMEM, charcoal stripped-delipidated-calf serum, and all general reagents were from Sigma (St. Louis, MO). All radioisotopes were from NEN Life Science Products (Boston, MA). Oligonucleotides were synthesized by IDT (Coralville, IA).

Granulosa cell culture and treatments
All animal experiments were conducted with the approval from University of Kentucky Institutional Animal Care and Use Committee. Sprague Dawley immature rats at 21–23 days of age were purchased from Harlan Breeding Laboratories (Indianapolis, IN). Granulosa cells were prepared using follicular puncture essentially as described (35, 43, 44). For those cells that were used to examine the effect of 3', 5'-cAMP on ERß mRNA expression, rats were injected sc with PMSG (10 IU) and granulosa cells were isolated 24 h later and cultured overnight at a density of approximately 2–4 x 106 cells in 4F media [15 mM HEPES (pH 7.4), 50% DMEM, and 50% Ham’s F12 with bovine transferrin (5 µg/ml), human insulin (2 µg/ml), hydrocortisone (40 ng/ml) and antibiotics] with 5% FBS (Life Technologies, Inc.). Cells were treated with vehicle, forskolin at 10-4 M or 10-5 M, and hCG (1 IU/ml) for 3 h and lysed in guanidine isothiocynate for RNA purification by centrifugation through cesium chloride (45, 46). For those cells that were used for transfection, rats were used without hormone treatment. Granulosa cells were plated at a density of 2.5 x 105 (35-mm plate) in media containing Ham’s F-12:DMEM (1:1) without phenol red, 15 mM HEPES (pH 7.4), and antibiotics which were supplemented with 5% charcoal-stripped-delipidated FCS (tested negatively for estrogen content by RIA). Upon plating, cells were transfected with 5 µg of an ERE-tk-luciferase reporter construct that contains one copy of the vitellogenin A2 consensus sequence in front of a thymidine kinase promoter (a kind gift of Dr. Daniel Noonan, University of Kentucky) using a calcium phosphate method. One microgram of pCH110, a constitutively expressing ß-galactosidase plasmid, was used as an internal control for monitoring transfection efficiency. After 15 h at 37 C, 3% CO2, the medium was changed and cells were treated with vehicle or estrogen (1–100 nM) for 18 h at 37 C, 5% CO2. Protein extracts were prepared by lysing cells in a 200 µl volume of a buffer [0.1 M Tris-Cl, pH 7.8, 2 mM EDTA, 1% Triton X-100, 1 µM dithiothreitol (DTT)] for subsequent luciferase and ß-galactosidase assays. Luciferase activity was assayed in duplicates of samples (30 µl) in an assay solution (250 µl) that consists of 0.25 M Tris-Cl pH 7.8, 15 mM MgSO4, 1.7 mM ATP, 0.139 mM acetyl-CoA, 0.7 ng/ml BSA, and 1.38 mM DTT. A 10 sec integrated light emission upon addition of 100 µl 1 mM Na2+-luciferin (JBL, San Luis, CA) was measured in a Monolight 2010 (Analytical Luminescence Laboratory, Ann Arbor, MI). ß-galactosidase activity was assayed in duplicates of sample (15 µl) in Galacto Substrate and Enhancer (Tropix, Bedford, MA). Lysates were incubated at 48 C for 50 min to destroy endogenous ß-galactosidase activity, followed by the addition of 67 µl of substrate and room temperature incubation for 3.5 h. A 10-sec integrated light emission with a 2 sec delay upon addition of 100 µl enhancer was measured in a Monolight 2010 (Analytical Luminescence Laboratory, Ann Arbor, MI). Normalized results [relative light units (RLU) for luciferase/ß-galactosidase] were reported as mean ± SEM from four independent experiments (each experiment was performed using two to three replicate treatments).

5'-rapid amplification of cDNA ends (RACE) of ERß mRNA
The 5'-end sequences of rat and mouse ERß mRNA were determined using the 5'-RACE kit (BRL) and total ovarian RNA (1 µg). ERß-specific primers (for location, see Fig. 5Go) were designed based upon the previously published rat (8) and mouse (9) ERß mRNA sequences. After first-strand complementary DNA (cDNA) synthesis with the downstream primers and MMLV reverse transcriptase in 20 µl reaction, cDNA was purified using a silica-based membrane for tailing using terminal transferase. Tailed cDNA was used for subsequent PCR amplification using ERß-specific upstream primer and anchored primer at 60 C annealing temperature for 35–40 cycles. The PCR products were isolated on 1% agarose gel and subcloned into T/A cloning vector (Invitrogen) and subsequently sequenced using Amersham Pharmacia Biotech 33P-PCR sequencing kit and M13R/F primers.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 5. 5'-UTR sequences of the rat and mouse ERß mRNAs. The 5'-UTR sequences of the rat and mouse ERß mRNAs were determined using the 5'-RACE approach and aligned along with the human sequences (accession number AF060555). Panels A and B are the P1- and P2-specific 5'-ends of the ERß mRNAs, respectively. The nucleotide numbers shown matched with the rat ERß mRNA starting from the P1-specific 5'-most end. The numbers shown in parentheses are those from the previously published rat ERß mRNA (8 ). The shaded sequences are those common to both P1- and P2-ERß mRNA species. The boxed C is an additional nucleotide that was not reported in the original rat ERß mRNA. The exon/exon junctions as determined by alternatively spliced mRNA products are indicated by . Three in-frame ATGs are indicated in bold lettering and marked. Locations of primers are also indicated. The direction of primers indicate either sense () or antisense () sequences of the primers. A schematic illustration of P1- and P2-specific transcripts is shown in panel C. The shaded bar represents the sequences common to both kinds of transcripts, whereas the blank bar represents the sequences specific for P1- and P2-transcripts. Inserted triangles indicate locations of introns whose sizes are yet to be determined. The hatched bar represents a genomic sequences at the junction of P1- and P2-specific mRNA sequences. Primer locations are indicated by . Panel D shows the predicted molecular sizes of ERß proteins that are produced from the three different ATGs.

 
Genomic DNA Southern blotting
Rat testis genomic DNA was prepared as essentially described (45, 46) and digested with BamHI, EcoRI, or HindIII, separated on 0.8% agarose gel, transferred onto a nytron membrane (S & S), and baked at 80 C for 2 h. The blots were hybridized with 32P-{alpha}-dCTP-labeled probes specific for P1-specific exon, P2-specific exon, and common downstream exon at 42 C in a solution consisting of 50% fomamide, 5 x SSPE, 2 x Denhardt’s reagent, 10% dextran sulfate, 0.1% SDS, and 100 µg/ml salmon sperm DNA. After washing to the stringency of 0.1 x SSC plus 0.1% SDS at 68 C, blots were exposed to Kodak XAR-5 film for 3–5 days.

RT-PCR analysis
Oligonucleotide primer pairs of 20–22 nucleotides (40–60% GC content) were designed based on the sequences of the P1- or P2-specific exon of the rat ERß (for location, see Fig. 5Go), ERß, and rat ribosomal protein S16 (47, amplifying nucleotides from 59 to 159). The predicted sizes of the amplified products are 391 bp for P2 (pr3 and pr5) and 390 bp for P1 (pr4 and pr7), and 100 bp for S16. Locations of the primer pairs for ERß mRNA are listed as nucleotide numbers according to the originally published rat ERß mRNA (8): D1 (400–421), D2 (1350–1369), R1 (859–840), R2 (1092–1071), R3 (1305–1286), R4 (1909–1890), KAL (1018–1039), and KEL (1221–1200). For semiquantitative RT-PCR, we used conditions under which amplification of the product was linear with respect to the amount of input RNA. Total RNA (2.5 µg) was used for first-strand cDNA synthesis using random hexamer primers and MMLV reverse transcriptase in a 20-µl reaction. Five microliters of the cDNA samples was used for the subsequent PCR amplification of ERß and S16 cDNAs. A 20 µl mix including the oligonucleotide primers (50 ng each), {alpha}-32P-dCTP (2 µCi at 3000 Ci/mmol), and Taq DNA polymerase (2.5 U) in 1 x PCR buffer (10 mM Tris, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin) was added to each cDNA sample and overlaid with light mineral oil. Amplification was carried out for the indicated number of cycles using an annealing temperature of 65 C on a Perkin-Elmer thermal cycler (Perkin-Elmer Corp., Norwalk, CT). The samples were then electrophoresed on a 7.5% native polyacrylamide gel. For Southern blotting detection of P1- and P2-specific PCR products, cDNA samples were amplified for 35 cycles. PCR products were separated on 1.5% agarose gel, transferred onto nytron membrane, and probed using P1- or P2-specific probes.

Western blotting
Immunoblotting analyses for ER{alpha} and ERß were performed essentially as described (45, 46, 48) using tissue (ovary and uterus) extracts (200 µg) or granulosa cell extract (20 µg). Tissue extracts were prepared by powdering frozen tissues (100–200 g) and adding 200 µl of lysis buffer [0.5% SDS, 50 mM Tris (pH 8.0), 2% ß-mercaptoethanol]. Granulosa cell extracts were prepared by lysis in 5 vol of extract buffer [20 mM HEPES, pH 7.9, 0.42 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 25% glycerol] (49). Several recombinant ER proteins were also used. Baculovirus-expressed recombinant hER{alpha} protein (66 kDa) and recombinant rERß were gifts from Dr. Nicholas Koszweski, University of Kentucky, and Dr. George Kuiper, Karolinska Institute, Sweden, respectively. Baculovirus-expressed recombinant hERß protein (53 kDa) was purchased from Pan Vera Corp. We expressed, in yeast, rERß of 547 amino acids (ATG379-TGA) or 485 amino acids (ATG571-TGA) as a protein fused to ubiquitin that will be cleaved by endogenous ubiquitase. Cloning strategies resulted in addition of 8 amino acids to rERß. Thus, the predicted size of yeast-expressed rERß (YEPERß) is approximately 1 kDa larger than the rERß-open reading frame. Yeast extracts were prepared by lysing yeast cells, which express in a yeast lysis buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM ß-mercaptoethanol, 0.2% SDS, 2000 U/ml oxalyticase) (50). All protein samples were boiled to 100 C for 5 min before electrophoresis on a 10% or 7.5% SDS-polyacrylamide gel. Proteins were then transferred to a nitrocellulose membrane, rinsed in PBS (pH 7.4) containing 0.05–0.1% Tween 20. Blots were incubated with 1–5% nonfat dry milk in PBS (pH 7.4) at room temperature for 1 h and subsequently with antisera specific for ER{alpha} (ER715, 1:5000 dilution) or ERß (ABR, Inc., Golden, CO, PAI-310, 1:5000 dilution) at 4 C overnight. Antibody-antigen complexes were detected with the antirabbit goat antibody conjugated to HRP (1:2500 dilution) and subsequently visualized using chemiluminescence detection (Amersham Pharmacia Biotech or Pierce Chemical Co.). Specificity of ERß-immunoreactive bands was determined using preabsorbed antisera that had been incubated for 60 min in the presence of 1.25 µg/ml peptide specific for PAI-310 (ABR Inc.).

Gel mobility shift assay (GMSA)
The 32P-{alpha}-dCTP-labeled double stranded oligonucleotide containing a consensus ERE derived from vitellogenin A2 promoter sense strand (5'AGCTAGTCAGGTCAC-AGTGACCTGATC3') was incubated at room temperature (50,000 cpm/reaction) for 15 min with granulosa extracts (5 µg) that were prechilled on ice in a reaction buffer [10 mM Tris HCl pH7.5, 0.5 mM DTT, 5% glycerol, 0.5 mM PMSF, 1.25 mg/ml aprotinin, 1.25 mg/ml leupotinin, 80 mM KCl, 2 µg poly(dIdC), estrogen (10-7 M)]. Reactions were carried out in the presence and absence of competing nonlabeled oligonucleotides [an ERE (5'AGCTAGTCAGGTCACAGTGACCTGATC3'), a mutant ERE (5'AGCTAGTCAGAGCACAGTGCTCTGATC3'), or an AP-1 (5'TCGAGAGCTTAACCTCTGACACATGCAGCAC3')] at a 100-fold molar excess or of antisera specific for ERß (PAI-310, ABR Inc.) or ER{alpha} (MC-20, Santa Cruz Biotechnology, Inc., Santa Cruz, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To determine responsiveness of granulosa cells to estrogen, granulosa cells were isolated from immature rats, transfected with an ERE-tk-luciferase construct, and treated with 17ß-estradiol (1 and 10 nM). Luciferase activity was assayed as a measure of transcriptional activity and results (Fig. 1AGo, n = 4) show that estrogen treatment significantly (P < 0.05) increased transcriptional activity of this construct by approximately 3-fold in transfected granulosa cells. To examine expression of ERE-binding proteins in granulosa cells, we performed gel mobility shift assays. Whole cell extracts (~5 µg) were incubated with a 32P-{alpha}-dCTP-labeled double-stranded oligonucleotide containing an ERE sequence (5'AGCTAGTCAGGTCACAGTGACCTGATC3') in the presence or absence of cold oligonucleotide in excess and analyzed on a nondenaturing polyacrylamide gel. Results (Fig. 1BGo) show that indeed, granulosa cells contain a substantial amount of ERE-binding proteins. To test the sequence specificity of this interaction, we used oligonucleotides containing wild-type ERE (5'AGCTAGTCAGGTCACAGTGACCTGATC3'), a mutant ERE (5'AGCTAGTCAGAGCACAGTGCTCTGATC3'), or an AP-1 site (5'TCGAGAGCTTAACCTCTGACACATGCAGCAC3') in competition assays. The oligonucleotide containing a wild-type, but not mutant type ERE competed out ERE binding activities (Fig. 2Go). Interestingly, the oligonucleotide containing an AP-1 recognition sequence competed the fast migrating but weakly interacting protein without affecting the slow migrating but major interacting protein in these gel shift assays. Although rat granulosa cells express predominantly ERß mRNA (35) and protein (36, 37), it is unknown whether granulosa cell ERß interacts with DNA sufficiently. The consensus ERE sequence has been shown to be occupied by both ER{alpha} and ERß with similar affinity and transcriptional potency (8, 9, 10, 16, 17, 18, 19). Thus, we have used supershift quality antibodies specific for ERß (PAI-310, ABR) or for ER{alpha} (MC20, Santa Cruz Biotechnology, Inc. and ER715, NIDDK, shown is MC20) (Fig. 2BGo). The results show that the ERß-, but not ER{alpha}-specific polyclonal antibody caused retardation of a majority, if not all, of the slow migrating major ERE-binding protein, indicating that this binding activity is comprised mainly of ERß. The identity of the fast migrating but weaker protein in our gel shift assays is currently unknown but the oligonucleotide with an AP-1 site sufficiently compete out this interaction. Similar results were obtained using different batches of whole cell and nuclear extracts. These results showing that the majority of the ERE binding activity in granulosa cells is due to ERß protein(s).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. Responsiveness of rat granulosa cells to 17ß-estradiol. A, Estrogen-responsiveness of granulosa cells—granulosa cells were isolated from immature Sprague Dawley rats, transfected with an ERE-tk-luciferase along with an internal control PCH110, and treated with 17ß-estradiol (1 and 10 nM) or vehicle for 18 h. Luciferase activities were measured as an index of estrogen-induced transcription of the ERE-tk-luciferase gene, whereas ß-galactosidase activities were measured to monitor transfection efficiency. Luciferase activity/ß-galactosidase activity was used as a normalized transcription activity of the ERE-tk-luciferase gene. Data are presented as fold-induction ± SEM over control from four independent experiments, each of which was run in duplicates or triplicates. *, Statistical significance at P < 0.05 by Tox Stat Version 3.2 and ANOVA followed by Dunnetts test. B, Detection of ERE-binding proteins in granulosa cells—whole cell extracts (~5 µg) of granulosa cells of immature rats were incubated with a [{alpha}-32P]dCTP-labeled double-stranded oligonucleotide containing a consensus ERE. Upon completion of reactions (20 min), protein-bound (solid arrow) and free (dashed arrow) DNA probes were separated on a 5% native PAGE. To test the specificity of the DNA-protein interaction, a cold oligonucleotide at a 100-molar excess was used for competing the interaction between the radioactive probe and proteins.

 


View larger version (79K):
[in this window]
[in a new window]
 
Figure 2. ERß is the predominant ERE-binding protein produced by granulosa cells. Two sets of gel shift assays were conducted to examine the specificity of the interaction between ERE and granulosa cell ER. Whole cell extracts (~5 µg) of granulosa cells were incubated with a 32P-{alpha}-dCTP-labeled double-stranded consensus ERE oligonucleotide in the presence and absence of a competing cold-oligonucleotide at a 100-fold molar excess or ER antisera (1 µg). Competing oligonucleotides contain a consensus ERE (ERE), a mutant ERE, or an AP-1 site. Antibodies shown are PAI-310 (ERß) or MC-20 (ER{alpha}). DNA-protein complexes (solid arrows) and ternary complex (double arrows) were separated from free DNA (dashed arrows) on a 5% native polyacrylamide gel.

 
To further examine ERß protein expression in ovarian extracts, we performed a series of Western blots. We first compared ER expression in uterine and ovarian extracts of immature rats (200 µg each) using polyclonal antibodies specific for either ER{alpha} (MC20 or ER715, shown is MC20) or ERß (PAI-310, ABR Inc.). An ER{alpha}-immunoreactive protein (48) in uterus extract comigrated with a baculovirus-expressed human ER{alpha} protein (hER{alpha}) on a 10% SDS-PAGE gel (Fig. 3AGo). The lane with heavy dark bands at the left edge of the figure contains size markers (Sigma). An extract prepared from immature rat ovaries contained a barely detectable ER{alpha}-immunoreactive protein, indicating that immature rat ovaries express little ER{alpha} protein, extending our previous results demonstrating that ER{alpha} mRNA is expressed at low levels in immature rat ovaries (35). In contrast, we detected an ERß-immunoreactive band in an ovarian extract, which migrated much slower than baculovirus-expressed rat ERß (a kind gift from Dr. George Kuiper, 54 kDa) (Fig. 3AGo). This immunodetection is specific because the ERß-immunoreactive signals in a granulosa cell extract (20 µg) and a commercially available human ERß (PanVera, 53 kDa) were diminished when antigenic peptide-preabsorbed antibody was used (Fig. 3BGo). These results show that the granulosa cell ERß-immunoreactive protein migrates at a size larger than that expected from the previously reported open reading frame. To further examine the migration of the ERß-immunoreactive protein expressed in granulosa cells relative to ERß proteins, we compared ERß-immunoreactive proteins in extracts (20 µg) of granulosa cells and yeast expressing recombinant ERß (YEPERß) proteins of different sizes (Fig. 3CGo). YEPERß proteins are produced as a fusion protein linked to ubiquitin, which is cleaved by endogenously expressed ubiquitinase. Due to cloning strategies, recombinant YEPERß proteins (YEPERß-379 with 549 amino acid ERß sequences and YEPERß-571 with 485 amino acid ERß sequences) contain 8 extra amino acids at their N termini and thus are expected to migrate at approximately 63 kDa and 55 kDa, respectively. On a 7.5% SDS-PAGE, we detected two ERß-immunoreactive proteins in granulosa cell extracts. We do not know the exact reason why one or two immunoreactive bands are detected depending on % separation gels (10% vs. 7.5%). However, it is likely that these two bands are sandwiched together on a 10% gel due to the presence of a large amount of approximately 64 kDa protein in granulosa cell extracts. Curiously, these two granulosa cell ERß-immunoreactive proteins migrate at a size similar to the 62-kDa size marker. Both bands migrate clearly slower than YEPERß-571 (55 kDa) but at a reasonably similar rate as YEPERß-379 (63 kDa). These Western blotting results clearly indicate that the size of ERß proteins present in granulosa cells are significantly larger than that expected from the originally identified open-reading frame [485 amino acids (54 kDa) for ERß and 503 amino acids (57 kDa) for ERßB].



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Detection of ERß-immunoreactive proteins in rat granulosa cells. A, Western blotting for ER{alpha} and ERß in rat ovary. Extracts (200 µg) of immature rat ovaries (O) or uteri (U) along with extracts (2 µg) of sf9 cells carrying human ER{alpha} (hER{alpha}) or rat ERß (rERß) were fractionated on a 10% SDS-PAGE for immunodetection using ER{alpha} (MC20)- and ERß (PAI-310)-specific antisera. The expected sizes of recombinant proteins are listed. Molecular weights of standards (Sigma) are indicated in kDa. B, Comparison between ERß-antibody and antigen-preabsorbed ERß-antibody. The PAI-310 ERß-antibody was preincubated in the presence of antigenic peptide in excess at 4 C overnight before immuno-detection of granulosa cell (GC) extracts (20 µg) and hERß (PanVera) on a 10% SDS-PAGE (for details, see Materials and Methods). The expected size of the baculovirus-expressed hERß is listed. Molecular standards (Sigma) are indicated in kDa. C, Examination of granulosa cell ERß-immunoreactive proteins on a 7.5% SDS-PAGE. Migration of granulosa cell ERß-immunoreactive proteins was compared with recombinant rat ERß proteins expressed in yeast. The expected molecular sizes of recombinant proteins are listed. YEPERß proteins contain eight extra amino acids at their N termini in addition to rat ERß sequences of 549 or 485 amino acids. Molecular standards (Life Technologies, Inc.) are indicated in kDa.

 
To test whether this size discrepancy comes from any unknown ERß with spliced-in exons within the previously published coding region (8), we performed RT-PCR (20–25 cycles, linear range) of rat ERß mRNA using multiple combinations of primers based upon the previously published ERß coding sequences (8). The rat ERß cDNA was included as a control. All primer sets produced a band of the expected size from the cloned ERß cDNA (8) template (Fig. 4AGo). The ovarian RNA-derived cDNA template also produced bands of expected sizes based on available information on ERß and ERßB as well as their {delta}3 isoforms (Fig. 4BGo) (29). Several independent experiments were conducted using various ovarian RNAs and similar results were obtained. Transcripts with exon 3 (117 bp) deletion ({delta}3) are expected in RT-PCR of ovarian cDNA using D1/R2 (575 bp), D1/R3 (788 bp), and D1/R4 (1392 bp for ERß-{delta}3 and 1446 bp for ERßB-{delta}3) primer combinations. Interestingly, they are detected at a level less than 10% of the transcripts with exon 3 [D1/R2 (692 bp), D1/R3 (905 bp), D1/R4 (1509 bp for ERß-{delta}3 and 1563 bp for ERßB-{delta}3]. Transcripts containing the 54 bp exon are expected in RT-PCR of ovarian cDNA using D1/R4 (1563 bp) and D2/R4 (613 bp). The same sets of primers should amplify ERß cDNA fragments of 1509 bp (D1/R4) and 559 bp (D2/R2). On 4% native polyacrylamide gels, we are not able to resolve 1510 and 1564 bp as seen in the D1/R4 lane, but two bands with expected sizes (559 and 613 bp) are evident. Interestingly, the intensity of these two bands is similar, indicating that transcripts with the 54 bp exon are expressed at a similar level to those without this exon. Under the linear range of RT-PCR no other major transcripts were detected to have extra sequences within the coding region.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 4. RT-PCR analysis of ERß transcripts produced in granulosa cells. Total RNA from granulosa cells was used for generating first-strand cDNAs primed with random hexamers. These cDNA samples and the cloned ERß plasmid cDNA were used as a template for PCR in the presence of 32P-{alpha}-dCTP using ERß-specific primer sets (for locations of these primers, see Materials and Methods) for 20–25 cycles. PCR products were separated on a 4% polyacrylamide gel and exposed to Kodak XAR-5 film. A, Plasmid cDNA; B, ovarian cDNA; C, primer sets and expected sizes from known isoforms ERß, ERßB, and {delta}3 derivatives.

 
To further examine whether granulosa cell ERß isoforms are generated from an upstream in-frame initiation codon capable of encoding larger proteins, we characterized the 5'-UTR of ovarian ERß mRNA species. We chose the 5'-RACE approach to determine the 5'-end of the mRNA as it has successfully been used for other genes such as the human ER{alpha} and ERß (51, 52, 53, 54). A combination of ERß-specific primers (pr1, pr2, and pr3) which are located just downstream of the published translation initiation codon ATG for mouse (9) and rat (8) was used to produce cDNA and subsequent nested-PCR products. Sequence analyses of PCR products show various alternatively spliced transcripts depicting the exon/exon junctions (

) identified in the previously published ERß mRNA sequences (Fig. 5AGo). We have also confirmed that there is an additional nucleotide (boxed C) in the originally published 5'-UTR (8). The sequences shown in Fig. 5AGo are the most 5' end sequences of the ERß mRNA available to date. More importantly, we have also detected an additional ERß mRNA species with divergent 5'-end sequences from +319 (shown in Fig. 5BGo). The junction of divergence is at the left end of the shaded sequences common for both P1- and P2-ERß mRNA in Fig. 5Go, A and B, respectively. We designated these two divergent 5'-ends of the ERß mRNA as P1- and P2-specific sequences. Within the shaded, common sequences there are at least three in-frame translation initiation codons at nucleotides +379 (ATG379), +436 (ATG436), and +571 (ATG571) of the rat ERß mRNA. The ATG571 is the previously published translation initiation site leading to an open reading frame of 485 aa ERß (503 aa ERßB) (8). The ATG379 and ATG436, if they are functional, will encode proteins of 549 aa ERß (567 aa ERßB) and 530 aa ERß (548 aa ERßB), respectively. The corresponding {delta}3 isoforms should give rise to 5K-smaller mol wts. Alignment with the human ERß 5'-UTR, that is available in GenBank (accession number AF060555) (54) and confirmed using 5'-RACE on human granulosa cell RNA, demonstrates that ATG436 and ATG571 are conserved in human as well. However, the ATG379 will cause a frame-shift due to the absence of "C" corresponding to the rat +387 nucleotide (

), implicating the potential use of ATG436 and ATG571 in generating ERß (530 aa = 59 kDa and 485 aa = 54 kDa), ERßB (548 aa = 61 kDa and 503 aa = 56 kDa), and/or their {delta}3 isoforms (410 aa = 54 kDa and 365 aa = 49 kDa). The detection of approximately 62 kDa ERß-immunoreactive proteins on Western results shown in Fig. 3Go suggests that these proteins must come either from the use of the ATG436 and/or from significant posttranslational modifications of ERß proteins produced from the use of the ATG571.

To determine whether P2-specific sequences of the ERß mRNA (unshaded in Fig. 5BGo) are derived from an alternative exon or from intronic sequences, we used a Genewalk kit (CLONTECH Laboratories, Inc.) and cloned genomic DNA immediately upstream of the common sequences (shaded in Fig. 5Go, A and B) of P1- and P2-ERß mRNA. The primers pr4 and pr5 were used for nested PCR of genomic fragments. Sequence analyses of PCR fragments show that the genomic fragment does contain the P2-specific sequences of the ERß mRNA. To confirm the contiguity of the genomic and P2-specific ERß mRNA sequences, we performed genomic Southern blotting using probes corresponding to P1-specific (+1/+90 of the rat ERß, right panel), P2-specific (P2+1/P2+99 of the rat ERß, left panel), and common (+311/+594 of the rat ERß, middle panel) regions. Results (Fig. 6Go) show that P2-specific and common probes detected the same restriction patterns, whereas a P1-specific probe detected different restriction fragments of rat genomic DNA, again demonstrating the contiguity between the P2-specific ERß mRNA sequences and the downstream common exon. These results show that the P2-specific ERß mRNA sequences are derived from an otherwise intronic sequences, suggesting the potential usage of an alternative promoter within the intron.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 6. Genomic Southern blotting for P1- and P2-specific exons. Genomic DNA isolated from rat testis was digested with BamHI (lane 1), HindIII (lane 2), and EcoRI (lane 3), fractionated on an 0.8% agarose gel and transferred to a nylon membrane. The membrane was baked and hybridized at 42 C overnight with common exon- (left panel), P2-specific first exon (middle panel), and P1-specific first exon (right panel) DNAs that were labeled using 32P-{alpha}-dCTP and random hexamer. After stringent washing at 0.1 x SSC plus 0.1% SDS at 68C, the membranes were exposed to Kodak XAR-5 film for 3–5 days. Marker lane is a 1-kb ladder.

 
To examine the usage of both P1- and P2-specific exons in ERß mRNA production in granulosa cells, we performed RT-PCR Southern blotting. Primer sets used for specifically amplifying P1- and P2-transcripts were pr6/pr7 (P1, 235 bp) and pr3/pr5 (P2, 391 bp), and PCR products were detected by P1- and P2-specific probes as described for Fig. 6Go. The results (Fig. 7Go) show that P1-transcripts are generated equally well in epididymis (lane 1) and prostate (lane 2) as well as ovary (lane 3) and granulosa cells (lane 4), whereas P2-transcripts are equally generated by ovary and granulosa cells but to much less extent by prostate and epididymis. Negative controls for PCR amplification, RNA without RT (lane 5) and water (lane 6), demonstrated the purity of RNAs and lack of cross-contamination during assays. Similar results were obtained in three independent experiments. To extend our previous results demonstrating the cAMP-mediated down-regulation of ERß mRNA in granulosa cells (35), we further examined the effect of forskolin on the levels of P1- and/or P2-specific transcripts. Granulosa cells were isolated from PMSG (10 IU, 24 h)-treated immature rats, cultured in vitro, and treated with forskolin (10-5 M and 10-4 M) for 3 h. RT-PCR results of P1- and P2-specific ERß transcripts (Fig. 8Go, n = 4) showed that forskolin significantly decreased both P1- and P2-transcripts in granulosa cells, indicating that cAMP down regulates both P1- and P2-specific ERß mRNA expression.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 7. Detection of P1- and P2-specific ERß RT-PCR products by Southern blotting. RNA from indicated tissues was reverse-transcribed in the presence of random hexamer. PCR amplification was carried out for 30 cycles using an annealing temperature of 65 C. PCR products were fractionated on a 1% agarose gel, transferred to a nylon membrane, and hybridized at 42 C overnight with random-primed radioactive P1- and P2-specific first exon DNA probes. After stringent washing, membranes were exposed to Kodak XAR-5 film for 3 h. Lanes were epididymus (1 ), prostate (2 ), ovary (3 ), granulosa cells (4 ), RNA without RT (5 ), and water (6 ).

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 8. Effect of cAMP on P1- and P2-specific ERß transcripts in rat granulosa cells. Granulosa cells of immature rats treated with PMSG (10 IU, sc) for 24 h were cultured and treated with vehicle (lane 2), forskolin (10-4 M, lane 3), and forskolin (10-5 M, lane 4) for 3 h. RNA was isolated and subjected to RT-PCR for P1- (panel A, 25 cycles) and P2-specific (panel B, 30 cycles) ERß mRNA along with S16 as an internal control. RNA of immature rat ovaries was used as a positive control for ERß mRNA. Data are presented as fold-change ± SEM over control from four independent experiments. *, Statistical significance at P < 0.05 by Tox Stat Version 3.2 and ANOVA followed by Dunnett’s test.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have demonstrated that granulosa cells express ERß as the predominant functional ERE-binding protein. Thus, ERß must represent estrogen-binding activities repeatedly observed in granulosa cells (55, 56) and mediate estrogen-responsiveness of granulosa cells. Indeed, estrogen stimulates the transcription of an ERE-TATA-luciferase construct in transfected granulosa cells. Transcriptional stimulation from a consensus ERE element(s) is similar for ER{alpha} and ERß (8, 9, 10, 16, 17, 18, 19). However, these receptors differentially regulate the transcription from an AP-1 driven reporter gene (20) or the human retinoic acid receptor-{alpha}-1 promoter (57), presumably without directly binding to DNA but recruiting other proteins to DNA. In either case, differential expression of ER{alpha}/ERß may explain differential estrogen responsiveness at the level of transcription of this type of target genes. The progesterone receptor (PR) gene has long been identified as an estrogen target gene (2) and its estrogen-induced transcription requires a partial ERE element(s) that interacts with ER{alpha} (58). This functional PR-ERE does not appear to be recognized by ERß-predominant (34–36, this study) granulosa cell extracts in gel shift assays (59). Interestingly, the PR gene is not induced in granulosa cells in response to estrogen (59, 60). The question of whether the promoter context-dependency of estrogen-induced transcription is mainly due to differential affinity of ERs to DNA sequences remains to be determined.

Detection of approximately 62 kDa ERß-immunoreactive proteins in granulosa cells is in good agreement with previous reports showing 61–63 kDa ERß proteins in the human (54) and mouse (61) but raises an important question of whether these proteins are produced from transcripts with spliced-in exons or from alternative initiation codons. Several ERß isoforms have been reported previously: ERßcx, ERß, ERßB, and their {delta}3 derivatives. The PAI-310 ERß antibody recognizes the epitope in the carboxy-most terminal exon of the ERß and thus, should detect ERß, ERßB, and their {delta}3 derivatives. ERßcx (28) contains an alternative carboxy-most terminal exon and thus, will not be detected by this antibody. Nonetheless, rat granulosa cells appear not to express this isoform at a substantial level because ERßcx can bind the ERE (28) but the PAI-310 antibody supershifted granulosa cell ERE-binding activities nearly completely. Thus, if there exists the yet-to-be identified rat homolog of the human isoform ERßcx, our results suggest that its expression should be minimal in granulosa cells. RT-PCR results showing the expression of other ERß isoforms (ERß, ERßB, and their {delta}3 derivatives) in granulosa cells are in good agreement with previous studies (29, 30, 31). Unless there is differential translation or protein stability among these ERß isoforms, the ratio of mRNA species should relate directly to protein production in vivo. ERß mRNA with exon 3 deletion ({delta}3) is expressed at a level less than 10% of ERß mRNA with exon 3 (ERß and ERßB). The {delta}3 isoforms should migrate between 49–51 kDa depending on whether they contain the extra 54 bp exon according to the originally proposed open-reading frame (8). The fact that we did not detect these smaller ERß-immunoreactive proteins on Western blots may be accounted for by their low expression. Western blots often detected one larger but weak immunoreactive band (~63 kDa) and the other smaller but predominant band (~61 kDa). Based upon our RT-PCR results, we believe the larger immunoreactive band is likely ERßB with an extra 54-bp exon in the hormone binding domain (29, 30, 31), and the size difference (~2 kDa) is in good agreement with the predicted size difference between ERß and ERßB. Use of the ATG379, which is conserved between the rat and mouse, will produce a 61-kDa ERß and 63-kDa ERßB. However, use of the ATG379 in human will cause a frame-shift with a premature translation stop codon, indicating that the ATG379 may not be functional. The predicted sizes using the originally proposed conserved Kozak consensus (62) translation initiation codons ATG571 are 54 kDa for ERß and 56 kDa for ERßB. Thus, the migration of ERß-immunoreactive proteins on Western blotting is most consistent with the predicted sizes using the well-conserved Kozak consensus ATG436 (59 and 61 kDa), considering the presence of a significant amount of an approximately 64-kDa protein in our granulosa cell preparation. The corresponding ATG has also been designated as the translation initiation codon in the human (54). Alternatively, posttranslational modifications on ERß proteins may also account for this difference. Indeed, ERß contains several phosphorylation consensus sequences that can be targeted by protein kinases. The originally proposed ATG571 can be forced to be functional during in vitro transcription/translation (9) and thus, it remains to be determined whether the ATG571 is also functional in vivo and what posttranslational modifications occur on ERß proteins. The signal ratio of the two ERß-immunoreactive bands is not 1:1 as we might suspect from the ratio of ERß and ERßB mRNA, suggesting the possibility of differential translation efficacy in granulosa cells between these mRNA species. Thus, the potency of ERßB as a repressor of ER{alpha} and ERß in cells in vivo may not be physiologically important for estrogen-responsiveness of target cells such as granulosa cells.

The gene structure throughout the coding region of the human and mouse ERß (63) appears to be similar to that of the ER{alpha} gene (64). Using the 5'-RACE approach, a method to map the transcriptional start site, we identified the most 5'-end of the rat and mouse ERß mRNA. The presence of two (P1- and P2-) different 5'-ends of the ERß mRNA in rodent granulosa cells suggests the possibility that two alternative promoters direct ERß production. Similarly, the closely related ER{alpha} gene produces mRNA species encoding the full-length ER{alpha} (65, 66, 67, 68, 69) using three different promoters (ER{alpha}-P1, P2, and P3). The possibility of multiple ERß promoters has been suggested by previous reports showing multiple transcripts on Northern blotting (9, 10, 35, 63). Our results showing the presence of ERß transcripts with two different 5'-ends in both rat and mouse granulosa cells clearly support the synthesis of ERß from at least two alternative promoters. In addition, differential usage of multiple polyadenylation sites needs to be considered as demonstrated in the fish ER gene (70). Because regulatory sequences in the promoter as well as the UTR of the mRNA could respond to diverse stimuli, the presence of multiple promoters and polyadenylation sites will surely increase the complexity and flexibility of differential response of the ERß gene to diverse intracellular signals (65, 66, 67, 68, 69). We have examined one such intracellular signaling molecule cAMP because cAMP down-regulates ERß mRNA levels in granulosa cells (35). Forskolin, an adenylate cyclase activator, decreased the levels of both mRNA species containing P1- and P2-specific exons in cultured granulosa cells, suggesting that cAMP can regulate the suspected alternative promoters, or decrease ERß mRNA stability in granulosa cells. The cis-element (5'AUUUA3') that has been proposed to play a role critical in protecting mRNAs from degradation (71, 72) is present in the 3'-UTR of the rat ERß (8). The closely related ER{alpha} mRNA has also been suggested to be stabilized in breast cancer cells in response to TPA, which activates cascades of intracellular signaling pathways (73). Because the ability of hCG to decrease ERß mRNA levels in differentiated granulosa cells is independent of cycloheximide, a protein synthesis inhibitor (Park-Sarge, O.-K., unpublished data), the effect, if any, of cAMP on ERß mRNA stability must be mediated by posttranslational modifications of preexist proteins in granulosa cells.

Taken together, our results suggest the presence of alternative promoters directing the synthesis of ERß mRNA, their regulation by cAMP, and the potential usage of an up-stream translation initiation codon resulting in approximately 61 kDa ERß protein in granulosa cells. Because expression and regulation of the ERß gene is crucial for understanding differential estrogen action in various tissues, in particular ovarian granulosa cells which contain predominantly ERß, understanding the hormonal regulation of the alternative promoters will increase insight into both physiological and pathophysiological conditions.


    Acknowledgments
 
The authors wish to thank Drs. Daniel Noonan, Nicholas Koszweski, George Kuiper, and Kevin Sarge for rat genomic DNA, baculovirus human ER{alpha}, baculovirus rat ERß, and insightful discussions, respectively.


    Footnotes
 
1 This work was supported by NIH Grants HD-30719, ES08501, and HD-36879 (to O.-K.P.-S.). Back

2 Trainee supported by the NIH Training Grant in Reproductive Sciences and the NIH Grant in Toxicology. Back

3 Visiting graduate student scholar from the Department of Biochemistry and Molecular Biology, Hanyang University, South Korea. Back

4 Recipient of NIH Research Career Development Award HD-01135. Back

Received April 5, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Shupnik MA 1996 Gonadotropin gene modulation by steroids and gonadotropin-releasing hormone. Biol Reprod 54:279–286[Abstract]
  2. Katzenellenbogen BS, Nardulli AM, Read LD 1990 Estrogen regulation of proliferation and hormonal modulation of estrogen and progesterone receptor biosynthesis and degradation in target cells. Prog Clin Biol Res 322:201–211[Medline]
  3. Greenwald G, Roy S 1994 Follicular development and its control. Raven Press, New York, pp 629–724
  4. Shibata H, Spencer T, Onate S, Jenster G, Tsai S, Tsai M-J, O’Mally B 1997 Role of coactivators and corespressors in the mechanism of steroid/thyroid receptor action. Recent Prog Horm Res 52:141–164
  5. Koike S, Sakai M, Muramatsu M 1987 Molecular cloning and characterization of rat estrogen receptor cDNA. Nucleic Acids Res 15:2499–2513[Abstract/Free Full Text]
  6. Tora L, White J, Brou C, Tasset D, Webster N, Scheer E, Chambon P 1989 The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59:477–487[CrossRef][Medline]
  7. Lees JA, Fawell SE, Parker MG 1989 Identification of two transactivation domains in the mouse oestrogen receptor. Nucleic Acids Res 17:5477–5488[Abstract/Free Full Text]
  8. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  9. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, Giguere V 1997 Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor ß. Mol Endocrinol 11:353–365[Abstract/Free Full Text]
  10. Mosselman S, Polman J, Dijkema R 1996 ERß: identification and characterization of a novel human estrogen receptor. FEBS Lett 392:49–53[CrossRef][Medline]
  11. Rosenfeld CS, Yuan X, Manikkam M, Calder MD, Garverick HA, Lubahn DB 1999 Cloning, sequencing, and localization of bovine estrogen receptor-ß within the ovarian follicle. Biol Reprod 60:691–697[Abstract/Free Full Text]
  12. Tchoudakova A, Pathak S, Callard GV 1999 Molecular cloning of an estrogen receptor ß subtype from the goldfish, carassius auratus. Gen Comp Endocrinol 113:388–400[CrossRef][Medline]
  13. Lakaye B, Foidart A, Grisar T, Balthazart J 1998 Partial cloning and distribution of estrogen receptor ß in the avian brain. Neuroreport 9:2743–2748[Medline]
  14. Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson JA 1997 Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors {alpha} and ß. Endocrinology 138:863–870[Abstract/Free Full Text]
  15. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, van der Burg B, Gustafsson JA 1998 Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor ß. Endocrinology 1998 139:4252–4263
  16. Pettersson K, Grandien K, Kuiper GG, Gustafsson JA 1997 Mouse estrogen receptor ß forms estrogen response element-binding heterodimers with estrogen receptor {alpha}. Mol Endocrinol 11:1486–1496[Abstract/Free Full Text]
  17. Cowley SM, Hoare S, Mosselman S, Parker MG 1997 Estrogen receptors {alpha} and ß form heterodimers on DNA. J Biol Chem 272:19858–19862[Abstract/Free Full Text]
  18. Ogawa S, Inoue S, Watanabe T, Hiroi H, Orimo A, Hosoi T, Ouchi Y, Muramatsu M 1998 The complete primary structure of human estrogen re-ceptor ß (hER ß) and its heterodimerization with ER {alpha} in vivo and in vitro. Biochem Biophys Res Commun 243:122–126[CrossRef][Medline]
  19. Watanabe T, Inoue S, Ogawa S, Ishii Y, Hiroi H, Ikeda K, Orimo A, Muramatsu M 1997 Agonistic effect of tamoxifen is dependent on cell type, ERE-promoter context, and estrogen receptor subtype: functional difference between estrogen receptors {alpha} and ß. Biochem Biophys Res Commun 236:140–145[CrossRef][Medline]
  20. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  21. Montano MM, Jaiswal AK, Katzenellenbogen BS 1998 Transcriptional regulation of the human quinone reductase gene by antiestrogen-liganded estrogen receptor-{alpha} and estrogen receptor-ß. J Biol Chem 273:25443–9[Abstract/Free Full Text]
  22. Wang Y, Miksicek RJ 1991 Identification of a dominant negative form of the human estrogen receptor. Mol Endocrinol 5:1707–1715[Abstract/Free Full Text]
  23. Erenburg I, Schachter B, Mira y Lopez R, Ossowski L 1997 Loss of an estrogen receptor isoform (ER {alpha} delta 3) in breast cancer and the consequences of its reexpression: interference with estrogen-stimulated properties of malignant transformation. Mol Endocrinol 11:2004–2015[Abstract/Free Full Text]
  24. Inoue S, Hoshino S, Miyoshi H, Akishita M, Hosoi T, Orimo H, Ouchi Y 1996 Identification of a novel isoform of estrogen receptor, apotential inhibitor of estrogen action, in vascular smooth muscle cells. Biochem Biophys Res Commun 219:766–772[CrossRef][Medline]
  25. Marsigliante S, Muscella A, Ciardo V, Puddefoot JR, Leo G, Vinson GP, Storelli C 1995 Multiple isoforms of the oestrogen receptor in endometrial cancer. J Mol Endocrinol 14:365–374[Abstract/Free Full Text]
  26. Skipper JK, Young LJ, Bergeron JM, Tetzlaff MT, Osborn CT, Crews D 1993 Identification of an isoform of the estrogen receptor messenger RNA lacking exon four and present in the brain. Proc Natl Acad Sci USA 90:7172–7175[Abstract/Free Full Text]
  27. Puddefoot JR, Baker VA, Bakkers B, Marsigliante S, Barker S, Panahy C, Goode AW, Carpenter R, Vinson GP 1993 The nature and significance of multiple isoforms of the oestrogen receptor in breast tumours. J Mol Endocrinol 11:83–90[Abstract/Free Full Text]
  28. Ogawa S, Inoue S, Watanabe T, Orimo A, Hosoi T, Ouchi Y, Muramatsu M 1998 Molecular cloning and characterization of human estrogen receptor ßcx: a potential inhibitor of estrogen action in human. Nucleic Acids Res 26:3505–3512[Abstract/Free Full Text]
  29. Petersen DN, Tkalcevic GT, Koza-Taylor PH, Turi TG, Brown TA 1998 Identification of estrogen receptor ß2, a functional variant of estrogen receptor ß expressed in normal rat tissues. Endocrinology 139:1082–1092[Abstract/Free Full Text]
  30. Maruyama K, Endoh H, Sasaki-Iwaoka H, Kanou H, Shimaya E, Hashimoto S, Kato S, Kawashima H 1998 A novel isoform of rat estrogen receptor ß with 18 amino acid insertion in the ligand binding domain as a putative dominant negative regular of estrogen action. Biochem Biophys Res Commun 246:142–147[CrossRef][Medline]
  31. Chu S, Fuller PJ 1997 Identification of a splice variant of the rat estrogen receptor ß gene. Mol Cell Endocrinol 132:195–199[CrossRef][Medline]
  32. Lu B, Leygue E, Dotzlaw H, Murphy LJ, Murphy LC, Watson PH 1998 Estrogen receptor-ß mRNA variants in human and murine tissues. Mol Cell Endocrinol 138:199–203[CrossRef][Medline]
  33. Hanstein B, Liu H, Yancisin MC, Brown M 1999 Functional analysis of a novel estrogen receptor-ß isoform. Mol Endocrinol 13:129–137[Abstract/Free Full Text]
  34. Moore JT, McKee DD, Slentz-Kesler K, Moore LB, Jones SA, Horne EL, Su JL, Kliewer SA, Lehmann JM, Willson TM 1998 Cloning and characterization of human estrogen receptor ß isoforms. Biochem Biophys Res Commun 247:75–78[CrossRef][Medline]
  35. Byers M, Kuiper GG, Gustafsson JA, Park-Sarge OK 1997 Estrogen receptor-ß mRNA expression in rat ovary: down-regulation by gonadotropins. Mol Endocrinol 11:172–82[Abstract/Free Full Text]
  36. Saunders PT, Maguire SM, Gaughan J, Millar MR 1997 Expression of oestrogen receptor ß (ER ß) in multiple rat tissues visualised by immunohistochemistry. J Endocrinol 154:R13–R16
  37. Sar M, Welsch F 1999 Differential expression of estrogen receptor-ß and estrogen receptor-{alpha} in the rat ovary. Endocrinology 140:963–71[Abstract/Free Full Text]
  38. Goldenberg RL, Vaitukaitis JL, Ross GT 1972 Estrogen and follicle stimulation hormone interactions on follicle growth in rats. Endocrinology 90:1492–1498[Abstract/Free Full Text]
  39. Leung PC, Armstrong DT 1980 Further evidence in support of a short-loop feedback action of estrogen on ovarian androgen production. Life Sci 27:415–420[CrossRef][Medline]
  40. Dhanasekaran N, Moudgal NR 1989 Studies on follicular atresia: role of gonadotropins and gonadal steroids in regulating cathepsin-D activity of preovulatory follicles in the rat. Mol Cell Endocrinol 63:133–142[CrossRef][Medline]
  41. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, Korach KS, Gustafsson J, Smithies O 1998 Generation and reproductive phenotypes of mice lacking estrogen receptor ß. Proc Natl Acad Sci USA 95:15677–15682[Abstract/Free Full Text]
  42. Korach KS, Couse JF, Curtis SW, Washburn TF, Lindzey J, Kimbro KS, Eddy EM, Migliaccio S, Snedeker SM, Lubahn DB, Schomberg DW, Smith EP 1996 Estrogen receptor gene disruption: molecular characterization and experimental and clinical phenotypes. Recent Prog Horm Res 51:159–186; discussion 186–188
  43. Orly J, Sato G 1979 Fibronectin mediates cytokinesis and growth of rat follicular cells in serum-free medium. Cell 17:295–305[CrossRef][Medline]
  44. Park-Sarge OK, Sarge KD 1995 Cis-regulatory elements conferring cyclic 3',5'-adenosine monophosphate responsiveness of the progesterone receptor gene in transfected rat granulosa cells. Endocrinology 136:5430–5437[Abstract]
  45. Sambrook J, Fritsch E, Maniatis T 1989 Molecular cloning—A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Srping Harbor
  46. Ausbel F, Brent R, Kingston R, Moore D, Seidman J, Smith J, Struhl K 1989 Current protocols in molecular biology. John Wiley & Sons, New York
  47. Batra SK, Metzgar RS, Hollingsworth MA 1991 Molecular cloning and sequence analysis of the human ribosomal protein S16. J Biol Chem 266:6830–6833[Abstract/Free Full Text]
  48. Furlow JD, Ahrens H, Mueller GC, Gorski J 1990 Antisera to a synthetic peptide recognize native and denatured rat estrogen receptors. Endocrinology 127:1028–32[Abstract/Free Full Text]
  49. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2499[Free Full Text]
  50. McDonnell DP, Nawaz Z, Densmore C, Weigel NL, Pham TA, Clark JH, O’Malley BW 1991 High level expression of biologically active estrogen receptor in Saccharomyces cerevisiae. J Steroid Biochem Mol Biol 39:291–728[CrossRef][Medline]
  51. Bahring S, Sandig V, Lieber A, Strauss M 1994 Mapping of transcriptional start and capping points by a modified 5' RACE technique. Biotechniques 16:807–852[Medline]
  52. Grandien K 1996 Determination of transcription start sites in the human estrogen receptor gene and identification of a novel, tissue-specific, estrogen receptor-mRNA isoform. Mol Cell Endocrinol 116:207–212[CrossRef][Medline]
  53. Freyschuss B, Grandien K 1996 The 5' flank of the rat estrogen receptor gene: structural characterization and evidence for tissue- and species-specific promoter utilization. J Mol Endocrinol 17:197–206[Abstract/Free Full Text]
  54. Bhat RA, Harnish DC, Stevis PE, Lyttle CR, Komm BS 1998 A novel human estrogen receptor ß: identification and functional analysis of additional N-terminal amino acids. J Steroid Biochem Mol Biol 67:233–240[CrossRef][Medline]
  55. Richards JS, Ireland JJ, Rao MC, Bernath GA, Midgley Jr AR, Reichert Jr LE 1976 Ovarian follicular development in the rat: hormone receptor regulation by estradiol, follicle stimulating hormone, and luteinizing hormone. Endocrinology 99:1562–1570
  56. Kawashima M, Greenwald GS 1993 Comparison of follicular estrogen receptors in rat, hamster, and pig. Biol Reprod 48:172–179[Abstract]
  57. Zou A, Marschke KB, Arnold KE, Berger EM, Fitzgerald P, Mais DE, Allegretto EA 1999 Estrogen receptor ß activates the human retinoic acid receptor {alpha}-1 promoter in response to tamoxifen and other estrogen receptor antagonists, but not in response to estrogen. Mol Endocrinol 13:418–430[Abstract/Free Full Text]
  58. Kraus WL, Montano MM, Katzenellenbogen BS 1994 Identification of multiple, widely spaced estrogen-responsive regions in the rat progesterone receptor gene. Mol Endocrinol 8:952–969[Abstract/Free Full Text]
  59. Clemens JW, Robker RL, Kraus WL, Katzenellenbogen BS, Richards JS 1998 Hormone induction of progesterone receptor (PR) messenger ribonucleic acid and activation of PR promoter regions in ovarian granulosa cells: evidence for a role of cyclic adenosine 3',5'-monophosphate but not estradiol. Mol Endocrinol 12:1201–1214[Abstract/Free Full Text]
  60. Park-Sarge OK, Mayo KE 1994 Regulation of the progesterone receptor gene by gonadotropins and cyclic adenosine 3',5'-monophosphate in rat granulosa cells. Endocrinology 134:709–718[Abstract/Free Full Text]
  61. Dupont D, Kim P, Gamier J, Chambon P, Baron R 1997 Identification of a novel estrogen receptor ß and isoforms expressed in bone and ovary. ASBMR 19th Meeting (Abstract 34)
  62. Kozak M 1989 The scanning model for translation: an update. J Cell Biol 108:229–241[Abstract/Free Full Text]
  63. Enmark E, Pelto-Huikko M, Grandien K, Lagercrantz S, Lagercrantz J, Fried G, Nordenskjold M, Gustafsson JA 1997 Human estrogen receptor ß-gene structure, chromosomal localization, and expression pattern. J Clin Endocrinol Metab 82:4258–4265[Abstract/Free Full Text]
  64. Grandien K, Berkenstam A, Gustafsson JA 1997 The estrogen receptor gene: promoter organization and expression. Int J Biochem Cell Biol 29:1343–1369[CrossRef][Medline]
  65. deConinck EC, McPherson LA, Weigel RJ 1995 Transcriptional regulation of estrogen receptor in breast carcinomas. Mol Cell Biol 15:2191–2196[Abstract]
  66. Grandien KF, Berkenstam A, Nilsson S, Gustafsson JA 1993 Localization of DNase I hypersensitive sites in the human oestrogen receptor gene correlates with the transcriptional activity of two differentially used promoters. J Mol Endocrinol 10:269–277[Abstract/Free Full Text]
  67. Treilleux, Peloux N, Brown M, Sergeant A 1997 Human estrogen receptor (ER) gene promoter-P1:estradiol-independent activity and estradiol inducibility in ER+ and ER- cells. Mol Endocrinol 11:1319–1331[Abstract/Free Full Text]
  68. Hurd C, Dinda S, Khattree N, Moudgil VK 1999 Estrogen-dependent and independent activation of the P1 promoter of the p53 gene in transiently transfected breast cancer cells. Oncogene 18:1067–1072[CrossRef][Medline]
  69. Flouriot G, Griffin C, Kenealy M, Sonntag-Buck V, Gannon F 1998 Differentially expressed messenger RNA isoforms of the human estrogen receptor-{alpha} gene are generated by alternative splicing and promoter usage. Mol Endocrinol 12:1939–1954[Abstract/Free Full Text]
  70. Tan NS, Lam TJ, Ding JL 1996 The first contiguous estrogen receptor gene from a fish, Oreochromis aureus: evidence for multiple transcripts. Mol Cell Endocrinol 120:177–192[CrossRef][Medline]
  71. Sachs AB 1993 Messenger RNA degradation in eukaryotes. Cell 74:413–21[CrossRef][Medline]
  72. Klausner RD, Rouault TA, Harford JB 1993 Regulating the fate of mRNA: the control of cellular iron metabolism. Cell 72:19–28[CrossRef][Medline]
  73. Ree AH, Knutsen HK, Landmark BF, Eskild W, Hansson V 1992 Down-regulation of messenger ribonucleic acid (mRNA) for the estrogen receptor (ER) by phorbol ester requires ongoing RNA synthesis but not protein synthesis. Is hormonal control of ER mRNA degradation mediated by an RNA molecule? Endocrinology 131:1810–1814[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
U. Ohnemus, M. Uenalan, J. Inzunza, J.-A. Gustafsson, and R. Paus
The Hair Follicle as an Estrogen Target and Source
Endocr. Rev., October 1, 2006; 27(6): 677 - 706.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. J. Pepe, R. B. Billiar, M. G. Leavitt, N. C. Zachos, J. A. Gustafsson, and E. D. Albrecht
Expression of Estrogen Receptors {alpha} and {beta} in the Baboon Fetal Ovary
Biol Reprod, April 1, 2002; 66(4): 1054 - 1060.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. A. LaVoie, D. C. DeSimone, C. Gillio-Meina, and Y. Y. Hui
Cloning and Characterization of Porcine Ovarian Estrogen Receptor {beta} Isoforms
Biol Reprod, March 1, 2002; 66(3): 616 - 623.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Frasor, K. Park, M. Byers, C. Telleria, T. Kitamura, L.-y. Yu-Lee, J. Djiane, O.-K. Park-Sarge, and G. Gibori
Differential Roles for Signal Transducers and Activators of Transcription 5a and 5b in PRL Stimulation of ER{alpha} and ER{beta} Transcription
Mol. Endocrinol., December 1, 2001; 15(12): 2172 - 2181.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. Cardenas, K.A. Burke, R.M. Bigsby, W.F. Pope, and K.P. Nephew
Estrogen Receptor {beta} in the Sheep Ovary During the Estrous Cycle and Early Pregnancy
Biol Reprod, July 1, 2001; 65(1): 128 - 134.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. S. Richards
Perspective: The Ovarian Follicle--A Perspective in 2001
Endocrinology, June 1, 2001; 142(6): 2184 - 2193.
[Full Text] [PDF]


Home page
EndocrinologyHome page
C. Guo, L. Savage, K. D. Sarge, and O.-K. Park-Sarge
Gonadotropins Decrease Estrogen Receptor-{beta} Messenger Ribonucleic Acid Stability in Rat Granulosa Cells
Endocrinology, June 1, 2001; 142(6): 2230 - 2237.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. H. Price Jr., C. A. Butler, P. Webb, R. Uht, P. Kushner, and R. J. Handa
A Splice Variant of Estrogen Receptor {beta} Missing Exon 3 Displays Altered Subnuclear Localization and Capacity for Transcriptional Activation
Endocrinology, May 1, 2001; 142(5): 2039 - 2049.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Campbell-Thompson, I. J. Lynch, and B. Bhardwaj
Expression of Estrogen Receptor (ER) Subtypes and ER{beta} Isoforms in Colon Cancer
Cancer Res., January 1, 2001; 61(2): 632 - 640.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
C. S. Rosenfeld, A. A. Murray, G. Simmer, M. G. Hufford, M. F. Smith, N. Spears, and D. B. Lubahn
Gonadotropin Induction of Ovulation and Corpus Luteum Formation in Young Estrogen Receptor-{alpha} Knockout Mice
Biol Reprod, March 1, 2000; 62(3): 599 - 605.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Brien, M. L.
Right arrow Articles by Park-Sarge, O.-K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Brien, M. L.
Right arrow Articles by Park-Sarge, O.-K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals