| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Graduate Center for Toxicology (M.L.O., O.-K.P.-S.) and Department of Physiology (K.P., Y.I., O.-K.P.-S.), University of Kentucky, Lexington, Kentucky 40536
Address all correspondence and requests for reprints to: Dr. Ok-Kyong Park-Sarge, Department of Physiology, University of Kentucky, Lexington, Kentucky 40536-0084. E-mail: OKPS{at}pop.uky.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3 isoforms. This size discrepancy appears to be
due to usage of a well-conserved, upstream in-frame translation
initiation codon (ATG436) leading to a 530 amino acid open reading
frame. ERß messenger RNA (mRNA) characterization using 5'-rapid
amplification of complementary DNA ends (5'-RACE) show the presence of
two different (P1- and P2-) 5'-ends of rat ERß mRNA encoding the
full-length ERß protein. The generation of the P2-specific exon is
likely due to initiation of transcription from an alternative promoter.
Both P1- and P2-specific exon-containing ERß mRNAs are expressed in
granulosa cells, and they are rapidly down-regulated by the
cAMP-mediated intracellular signaling pathway in cultured granulosa
cells. Taken together, our results show that rat granulosa cells
produce two different 3',5'-cAMP-regulated ERß mRNA species and that
these mRNA species are capable of encoding the full-length ERß
protein. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß, are distinct gene products but are
highly homologous to each other, in particular, in the ligand-binding
and DNA-binding domains (5, 6, 7, 8, 9, 10, 11, 12, 13). Although ER and ERß bind to
endogenous ligands such as 17ß-estradiol with similar affinity
(14, 15) and form homo- and hetero-dimers (16, 17, 18), they display
differential transcriptional activities in a cell- and promoter
context-dependent manner (19, 20, 21). Thus, differential production of
ER and/or ERß will likely provide a cellular microenvironment that
regulates estrogen-responsiveness of target genes in a cell-dependent
manner. Expression of several ER (22, 23, 24, 25, 26, 27) and ERß (28, 29, 30, 31, 32)
isoforms exhibiting potential differences in ligand/DNA binding and in
transcriptional activities may also be an important factor in
modulating cellular estrogen-responsiveness. In particular, at least
three ERß isoforms have been identified which function as repressors
of ER and ERß. ERßcx is a human ERß isoform containing a
different carboxy-most terminal exon and is a powerful repressor for
both ER and ERß (28). However, no homologs of this isoform have
yet been identified in other species. ERßB, characterized by a 54-bp
spliced-in exon within the hormone-binding domain, has been identified
in the rat and mouse (29, 30, 31). Interestingly, ERßB has yet been
identified in the human (32). This isoform has a much lower binding
affinity for estrogen and has been shown to repress ER- and
ERß-induced transcription, when expressed at a molar ratio that
exceeds ER and/or ERß (28, 29, 33). In addition, 3 isoforms
(ERß3 and ERßB3) have a deletion in exon3 and are able to
dimerize with ER, ERß, and ERßB but are not able to interact
with ERE and thus function as repressors (28). Several other ERß
isoforms corresponding to ER isoforms have been suggested to arise
from alternative splicing within the hormone-binding in the rodent (28, 34) and human (34). Thus, understanding ERß protein expression is
critical to understanding estrogen-responsiveness in target
cells.
We (35) and others (8) have previously reported that ERß messenger
RNA (mRNA) is highly expressed in small growing follicles but decreases
in larger follicles due to the ability of gonadotropins to down
regulate ERß gene expression. In contrast, expression of the ER
gene is low in the rat ovary (35). This mRNA data positively correlates
to ERß protein expression as determined by immunocytochemistry (36, 37), suggesting that ERß dimers mediate estrogen actions on target
genes in granulosa cells, which may be critical for the growth and
development of ovarian follicles (38), ovarian steroidogenic capacity
(39), and follicular viability (40). Indeed, ERß-null mutant mice
demonstrate reduced ovarian efficacy (41). Interestingly, ER-null
mutant mice are infertile largely due to neuroendocrine dysfunction
(42). Thus, we were interested in characterizing ERß mRNA and protein
in rat granulosa cells. Our results suggest that granulosa cells
produce approximately 62 kDa ERß protein(s) by using ERß
transcripts with different 5'-ends, the level of which decreases in
response to cAMP.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Granulosa cell culture and treatments
All animal experiments were conducted with the approval from
University of Kentucky Institutional Animal Care and Use Committee.
Sprague Dawley immature rats at 21–23 days of age were purchased from
Harlan Breeding Laboratories (Indianapolis, IN). Granulosa
cells were prepared using follicular puncture essentially as described
(35, 43, 44). For those cells that were used to examine the effect of
3', 5'-cAMP on ERß mRNA expression, rats were injected sc with PMSG
(10 IU) and granulosa cells were isolated 24 h later and cultured
overnight at a density of approximately 2–4 x 106
cells in 4F media [15 mM HEPES (pH 7.4), 50% DMEM, and
50% Ham’s F12 with bovine transferrin (5 µg/ml), human insulin (2
µg/ml), hydrocortisone (40 ng/ml) and antibiotics] with 5% FBS
(Life Technologies, Inc.). Cells were treated with
vehicle, forskolin at 10-4 M or
10-5 M, and hCG (1 IU/ml) for 3 h and
lysed in guanidine isothiocynate for RNA purification by centrifugation
through cesium chloride (45, 46). For those cells that were used for
transfection, rats were used without hormone treatment. Granulosa cells
were plated at a density of 2.5 x 105 (35-mm plate)
in media containing Ham’s F-12:DMEM (1:1) without phenol red, 15
mM HEPES (pH 7.4), and antibiotics which were supplemented
with 5% charcoal-stripped-delipidated FCS (tested negatively for
estrogen content by RIA). Upon plating, cells were transfected with 5
µg of an ERE-tk-luciferase reporter construct that contains one copy
of the vitellogenin A2 consensus sequence in front of a thymidine
kinase promoter (a kind gift of Dr. Daniel Noonan, University of
Kentucky) using a calcium phosphate method. One microgram of pCH110, a
constitutively expressing ß-galactosidase plasmid, was used as an
internal control for monitoring transfection efficiency. After 15
h at 37 C, 3% CO2, the medium was changed and cells were
treated with vehicle or estrogen (1–100 nM) for 18 h
at 37 C, 5% CO2. Protein extracts were prepared by lysing
cells in a 200 µl volume of a buffer [0.1 M Tris-Cl, pH
7.8, 2 mM EDTA, 1% Triton X-100, 1 µM
dithiothreitol (DTT)] for subsequent luciferase and ß-galactosidase
assays. Luciferase activity was assayed in duplicates of samples (30
µl) in an assay solution (250 µl) that consists of 0.25
M Tris-Cl pH 7.8, 15 mM MgSO4, 1.7
mM ATP, 0.139 mM acetyl-CoA, 0.7 ng/ml BSA, and
1.38 mM DTT. A 10 sec integrated light emission upon
addition of 100 µl 1 mM Na2+-luciferin (JBL,
San Luis, CA) was measured in a Monolight 2010 (Analytical Luminescence Laboratory, Ann Arbor, MI). ß-galactosidase
activity was assayed in duplicates of sample (15 µl) in Galacto
Substrate and Enhancer (Tropix, Bedford, MA). Lysates were
incubated at 48 C for 50 min to destroy endogenous ß-galactosidase
activity, followed by the addition of 67 µl of substrate and room
temperature incubation for 3.5 h. A 10-sec integrated light
emission with a 2 sec delay upon addition of 100 µl enhancer was
measured in a Monolight 2010 (Analytical Luminescence Laboratory, Ann Arbor, MI). Normalized results [relative light
units (RLU) for luciferase/ß-galactosidase] were reported as
mean ± SEM from four independent experiments (each
experiment was performed using two to three replicate treatments).
5'-rapid amplification of cDNA ends (RACE) of ERß mRNA
The 5'-end sequences of rat and mouse ERß mRNA were determined
using the 5'-RACE kit (BRL) and total ovarian RNA (1 µg).
ERß-specific primers (for location, see Fig. 5
) were designed based
upon the previously published rat (8) and mouse (9) ERß mRNA
sequences. After first-strand complementary DNA (cDNA) synthesis with
the downstream primers and MMLV reverse transcriptase in 20 µl
reaction, cDNA was purified using a silica-based membrane for tailing
using terminal transferase. Tailed cDNA was used for subsequent PCR
amplification using ERß-specific upstream primer and anchored primer
at 60 C annealing temperature for 35–40 cycles. The PCR products were
isolated on 1% agarose gel and subcloned into T/A cloning vector
(Invitrogen) and subsequently sequenced using
Amersham Pharmacia Biotech 33P-PCR sequencing
kit and M13R/F primers.
|
-dCTP-labeled probes specific for
P1-specific exon, P2-specific exon, and common downstream exon at 42 C
in a solution consisting of 50% fomamide, 5 x SSPE, 2 x
Denhardt’s reagent, 10% dextran sulfate, 0.1% SDS, and 100 µg/ml
salmon sperm DNA. After washing to the stringency of 0.1 x SSC
plus 0.1% SDS at 68 C, blots were exposed to Kodak XAR-5
film for 3–5 days.
RT-PCR analysis
Oligonucleotide primer pairs of 20–22 nucleotides (40–60% GC
content) were designed based on the sequences of the P1- or P2-specific
exon of the rat ERß (for location, see Fig. 5
), ERß, and rat
ribosomal protein S16 (47, amplifying nucleotides from 59 to 159). The
predicted sizes of the amplified products are 391 bp for P2 (pr3 and
pr5) and 390 bp for P1 (pr4 and pr7), and 100 bp for S16. Locations of
the primer pairs for ERß mRNA are listed as nucleotide numbers
according to the originally published rat ERß mRNA (8): D1
(400–421), D2 (1350–1369), R1 (859–840), R2 (1092–1071), R3
(1305–1286), R4 (1909–1890), KAL (1018–1039), and KEL (1221–1200).
For semiquantitative RT-PCR, we used conditions under which
amplification of the product was linear with respect to the amount of
input RNA. Total RNA (2.5 µg) was used for first-strand cDNA
synthesis using random hexamer primers and MMLV reverse transcriptase
in a 20-µl reaction. Five microliters of the cDNA samples was used
for the subsequent PCR amplification of ERß and S16 cDNAs. A 20 µl
mix including the oligonucleotide primers (50 ng each),
-32P-dCTP (2 µCi at 3000 Ci/mmol), and Taq
DNA polymerase (2.5 U) in 1 x PCR buffer (10 mM Tris,
pH 8.3, 50 mM KCl, 1.5 mM MgCl2,
0.01% gelatin) was added to each cDNA sample and overlaid with light
mineral oil. Amplification was carried out for the indicated number of
cycles using an annealing temperature of 65 C on a
Perkin-Elmer thermal cycler (Perkin-Elmer Corp., Norwalk, CT). The samples were then electrophoresed on a
7.5% native polyacrylamide gel. For Southern blotting detection of P1-
and P2-specific PCR products, cDNA samples were amplified for 35
cycles. PCR products were separated on 1.5% agarose gel, transferred
onto nytron membrane, and probed using P1- or P2-specific probes.
Western blotting
Immunoblotting analyses for ER and ERß were performed
essentially as described (45, 46, 48) using tissue (ovary and uterus)
extracts (200 µg) or granulosa cell extract (20 µg). Tissue
extracts were prepared by powdering frozen tissues (100–200 g) and
adding 200 µl of lysis buffer [0.5% SDS, 50 mM Tris (pH
8.0), 2% ß-mercaptoethanol]. Granulosa cell extracts were prepared
by lysis in 5 vol of extract buffer [20 mM HEPES, pH 7.9,
0.42 mM NaCl, 1.5 mM MgCl2, 0.2
mM EDTA, 0.5 mM DTT, 0.5 mM PMSF,
25% glycerol] (49). Several recombinant ER proteins were also used.
Baculovirus-expressed recombinant hER protein (66 kDa) and
recombinant rERß were gifts from Dr. Nicholas Koszweski, University
of Kentucky, and Dr. George Kuiper, Karolinska Institute, Sweden,
respectively. Baculovirus-expressed recombinant hERß protein (53 kDa)
was purchased from Pan Vera Corp. We expressed, in yeast, rERß of 547
amino acids (ATG379-TGA) or 485 amino acids (ATG571-TGA) as a protein
fused to ubiquitin that will be cleaved by endogenous ubiquitase.
Cloning strategies resulted in addition of 8 amino acids to rERß.
Thus, the predicted size of yeast-expressed rERß (YEPERß) is
approximately 1 kDa larger than the rERß-open reading frame. Yeast
extracts were prepared by lysing yeast cells, which express in a yeast
lysis buffer (60 mM Na2HPO4, 40
mM NaH2PO4, 10 mM KCl,
1 mM MgSO4, 50 mM
ß-mercaptoethanol, 0.2% SDS, 2000 U/ml oxalyticase) (50). All
protein samples were boiled to 100 C for 5 min before electrophoresis
on a 10% or 7.5% SDS-polyacrylamide gel. Proteins were then
transferred to a nitrocellulose membrane, rinsed in PBS (pH 7.4)
containing 0.05–0.1% Tween 20. Blots were incubated with 1–5%
nonfat dry milk in PBS (pH 7.4) at room temperature for 1 h and
subsequently with antisera specific for ER (ER715, 1:5000 dilution)
or ERß (ABR, Inc., Golden, CO, PAI-310, 1:5000 dilution) at 4 C
overnight. Antibody-antigen complexes were detected with the
antirabbit goat antibody conjugated to HRP (1:2500 dilution) and
subsequently visualized using chemiluminescence detection
(Amersham Pharmacia Biotech or Pierce Chemical Co.). Specificity of ERß-immunoreactive bands was determined
using preabsorbed antisera that had been incubated for 60 min in the
presence of 1.25 µg/ml peptide specific for PAI-310 (ABR Inc.).
Gel mobility shift assay (GMSA)
The 32P--dCTP-labeled double stranded
oligonucleotide containing a consensus ERE derived from vitellogenin A2
promoter sense strand
(5'AGCTAGTCAGGTCAC-AGTGACCTGATC3') was incubated
at room temperature (50,000 cpm/reaction) for 15 min with granulosa
extracts (5 µg) that were prechilled on ice in a reaction buffer [10
mM Tris HCl pH7.5, 0.5 mM DTT, 5% glycerol,
0.5 mM PMSF, 1.25 mg/ml aprotinin, 1.25 mg/ml leupotinin,
80 mM KCl, 2 µg poly(dIdC), estrogen (10-7
M)]. Reactions were carried out in the presence and
absence of competing nonlabeled oligonucleotides [an ERE
(5'AGCTAGTCAGGTCACAGTGACCTGATC3'), a mutant ERE
(5'AGCTAGTCAGAGCACAGTGCTCTGATC3'),
or an AP-1 (5'TCGAGAGCTTAACCTCTGACACATGCAGCAC3')] at a 100-fold molar
excess or of antisera specific for ERß (PAI-310, ABR Inc.) or ER
(MC-20, Santa Cruz Biotechnology, Inc., Santa Cruz,
CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, n = 4) show that estrogen
treatment significantly (P < 0.05) increased
transcriptional activity of this construct by approximately 3-fold in
transfected granulosa cells. To examine expression of ERE-binding
proteins in granulosa cells, we performed gel mobility shift assays.
Whole cell extracts (
5 µg) were incubated with a
32P--dCTP-labeled double-stranded oligonucleotide
containing an ERE sequence
(5'AGCTAGTCAGGTCACAGTGACCTGATC3') in the presence
or absence of cold oligonucleotide in excess and analyzed on a
nondenaturing polyacrylamide gel. Results (Fig. 1B) show that indeed,
granulosa cells contain a substantial amount of ERE-binding proteins.
To test the sequence specificity of this interaction, we used
oligonucleotides containing wild-type ERE
(5'AGCTAGTCAGGTCACAGTGACCTGATC3'), a mutant
ERE
(5'AGCTAGTCAGAGCACAGTGCTCTGATC3'),
or an AP-1 site (5'TCGAGAGCTTAACCTCTGACACATGCAGCAC3') in competition
assays. The oligonucleotide containing a wild-type, but not mutant type
ERE competed out ERE binding activities (Fig. 2). Interestingly, the oligonucleotide
containing an AP-1 recognition sequence competed the fast migrating but
weakly interacting protein without affecting the slow migrating but
major interacting protein in these gel shift assays. Although rat
granulosa cells express predominantly ERß mRNA (35) and protein
(36, 37), it is unknown whether granulosa cell ERß interacts with DNA
sufficiently. The consensus ERE sequence has been shown to be occupied
by both ER and ERß with similar affinity and transcriptional
potency (8, 9, 10, 16, 17, 18, 19). Thus, we have used supershift quality
antibodies specific for ERß (PAI-310, ABR) or for ER (MC20,
Santa Cruz Biotechnology, Inc. and ER715, NIDDK, shown is
MC20) (Fig. 2B). The results show that the ERß-, but not
ER-specific polyclonal antibody caused retardation of a majority, if
not all, of the slow migrating major ERE-binding protein, indicating
that this binding activity is comprised mainly of ERß. The identity
of the fast migrating but weaker protein in our gel shift assays is
currently unknown but the oligonucleotide with an AP-1 site
sufficiently compete out this interaction. Similar results were
obtained using different batches of whole cell and nuclear extracts.
These results showing that the majority of the ERE binding activity in
granulosa cells is due to ERß protein(s).
|
|
(MC20 or ER715, shown
is MC20) or ERß (PAI-310, ABR Inc.). An ER-immunoreactive protein
(48) in uterus extract comigrated with a baculovirus-expressed
human ER protein (hER) on a 10% SDS-PAGE gel (Fig. 3A). The lane with heavy dark bands at
the left edge of the figure contains size markers (Sigma).
An extract prepared from immature rat ovaries contained a barely
detectable ER-immunoreactive protein, indicating that immature rat
ovaries express little ER protein, extending our previous results
demonstrating that ER mRNA is expressed at low levels in immature
rat ovaries (35). In contrast, we detected an ERß-immunoreactive band
in an ovarian extract, which migrated much slower than
baculovirus-expressed rat ERß (a kind gift from Dr. George Kuiper, 54
kDa) (Fig. 3A). This immunodetection is specific because the
ERß-immunoreactive signals in a granulosa cell extract (20 µg) and
a commercially available human ERß (PanVera, 53 kDa) were diminished
when antigenic peptide-preabsorbed antibody was used (Fig. 3B). These
results show that the granulosa cell ERß-immunoreactive protein
migrates at a size larger than that expected from the previously
reported open reading frame. To further examine the migration of the
ERß-immunoreactive protein expressed in granulosa cells relative to
ERß proteins, we compared ERß-immunoreactive proteins in extracts
(20 µg) of granulosa cells and yeast expressing recombinant ERß
(YEPERß) proteins of different sizes (Fig. 3C). YEPERß proteins are
produced as a fusion protein linked to ubiquitin, which is cleaved by
endogenously expressed ubiquitinase. Due to cloning strategies,
recombinant YEPERß proteins (YEPERß-379 with 549 amino acid ERß
sequences and YEPERß-571 with 485 amino acid ERß sequences) contain
8 extra amino acids at their N termini and thus are expected to migrate
at approximately 63 kDa and 55 kDa, respectively. On a 7.5% SDS-PAGE,
we detected two ERß-immunoreactive proteins in granulosa cell
extracts. We do not know the exact reason why one or two immunoreactive
bands are detected depending on % separation gels (10% vs.
7.5%). However, it is likely that these two bands are sandwiched
together on a 10% gel due to the presence of a large amount of
approximately 64 kDa protein in granulosa cell extracts. Curiously,
these two granulosa cell ERß-immunoreactive proteins migrate at a
size similar to the 62-kDa size marker. Both bands migrate clearly
slower than YEPERß-571 (55 kDa) but at a reasonably similar rate as
YEPERß-379 (63 kDa). These Western blotting results clearly indicate
that the size of ERß proteins present in granulosa cells are
significantly larger than that expected from the originally identified
open-reading frame [485 amino acids (54 kDa) for ERß and 503 amino
acids (57 kDa) for ERßB].
|
).
The ovarian RNA-derived cDNA template also produced bands of expected
sizes based on available information on ERß and ERßB as well as
their 3 isoforms (Fig. 4B) (29). Several independent experiments
were conducted using various ovarian RNAs and similar results were
obtained. Transcripts with exon 3 (117 bp) deletion (3) are expected
in RT-PCR of ovarian cDNA using D1/R2 (575 bp), D1/R3 (788 bp), and
D1/R4 (1392 bp for ERß-3 and 1446 bp for ERßB-3) primer
combinations. Interestingly, they are detected at a level less than
10% of the transcripts with exon 3 [D1/R2 (692 bp), D1/R3 (905 bp),
D1/R4 (1509 bp for ERß-3 and 1563 bp for ERßB-3].
Transcripts containing the 54 bp exon are expected in RT-PCR of ovarian
cDNA using D1/R4 (1563 bp) and D2/R4 (613 bp). The same sets of primers
should amplify ERß cDNA fragments of 1509 bp (D1/R4) and 559 bp
(D2/R2). On 4% native polyacrylamide gels, we are not able to resolve
1510 and 1564 bp as seen in the D1/R4 lane, but two bands with expected
sizes (559 and 613 bp) are evident. Interestingly, the intensity of
these two bands is similar, indicating that transcripts with the 54 bp
exon are expressed at a similar level to those without this exon. Under
the linear range of RT-PCR no other major transcripts were detected to
have extra sequences within the coding region.
|
and
ERß (51, 52, 53, 54). A combination of ERß-specific primers (pr1, pr2, and
pr3) which are located just downstream of the published translation
initiation codon ATG for mouse (9) and rat (8) was used to produce cDNA
and subsequent nested-PCR products. Sequence analyses of PCR
products show various alternatively spliced transcripts depicting
the exon/exon junctions
( 
). We have also
confirmed that there is an additional nucleotide (boxed
C) in the originally published 5'-UTR (8). The
sequences shown in Fig. 5A are the most 5' end sequences of the ERß
mRNA available to date. More importantly, we have also detected an
additional ERß mRNA species with divergent 5'-end sequences from +319
(shown in Fig. 5B). The junction of divergence is at the left end of
the shaded sequences common for both P1- and P2-ERß mRNA in Fig. 5, A
and B, respectively. We designated these two divergent 5'-ends of the
ERß mRNA as P1- and P2-specific sequences. Within the shaded, common
sequences there are at least three in-frame translation initiation
codons at nucleotides +379 (ATG379), +436 (ATG436), and +571 (ATG571)
of the rat ERß mRNA. The ATG571 is the previously published
translation initiation site leading to an open reading frame of 485 aa
ERß (503 aa ERßB) (8). The ATG379 and ATG436, if they are
functional, will encode proteins of 549 aa ERß (567 aa ERßB) and
530 aa ERß (548 aa ERßB), respectively. The corresponding 3
isoforms should give rise to 5K-smaller mol wts. Alignment with the
human ERß 5'-UTR, that is available in GenBank (accession number
AF060555) (54) and confirmed using 5'-RACE on human granulosa cell RNA,
demonstrates that ATG436 and ATG571 are conserved in human as well.
However, the ATG379 will cause a frame-shift due to the absence of
"C" corresponding to the rat +387 nucleotide
( 
3 isoforms (410 aa = 54 kDa and
365 aa = 49 kDa). The detection of approximately 62 kDa
ERß-immunoreactive proteins on Western results shown in Fig. 3
suggests that these proteins must come either from the use of the
ATG436 and/or from significant posttranslational modifications of ERß
proteins produced from the use of the ATG571.
To determine whether P2-specific sequences of the ERß mRNA
(unshaded in Fig. 5B) are derived from an alternative exon
or from intronic sequences, we used a Genewalk kit (CLONTECH Laboratories, Inc.) and cloned genomic DNA immediately upstream
of the common sequences (shaded in Fig. 5, A and B) of P1-
and P2-ERß mRNA. The primers pr4 and pr5 were used for nested PCR of
genomic fragments. Sequence analyses of PCR fragments show that the
genomic fragment does contain the P2-specific sequences of the ERß
mRNA. To confirm the contiguity of the genomic and P2-specific ERß
mRNA sequences, we performed genomic Southern blotting using probes
corresponding to P1-specific (+1/+90 of the rat ERß, right
panel), P2-specific (P2+1/P2+99 of the rat ERß, left
panel), and common (+311/+594 of the rat ERß, middle
panel) regions. Results (Fig. 6)
show that P2-specific and common probes detected the same restriction
patterns, whereas a P1-specific probe detected different restriction
fragments of rat genomic DNA, again demonstrating the contiguity
between the P2-specific ERß mRNA sequences and the downstream common
exon. These results show that the P2-specific ERß mRNA sequences are
derived from an otherwise intronic sequences, suggesting the potential
usage of an alternative promoter within the intron.
|
.
The results (Fig. 7) show that
P1-transcripts are generated equally well in epididymis (lane 1) and
prostate (lane 2) as well as ovary (lane 3) and granulosa cells (lane
4), whereas P2-transcripts are equally generated by ovary and granulosa
cells but to much less extent by prostate and epididymis. Negative
controls for PCR amplification, RNA without RT (lane 5) and water (lane
6), demonstrated the purity of RNAs and lack of cross-contamination
during assays. Similar results were obtained in three independent
experiments. To extend our previous results demonstrating the
cAMP-mediated down-regulation of ERß mRNA in granulosa cells (35), we
further examined the effect of forskolin on the levels of P1- and/or
P2-specific transcripts. Granulosa cells were isolated from
PMSG (10 IU, 24 h)-treated immature rats, cultured in
vitro, and treated with forskolin (10-5 M
and 10-4 M) for 3 h. RT-PCR results
of P1- and P2-specific ERß transcripts (Fig. 8, n = 4) showed that forskolin
significantly decreased both P1- and P2-transcripts in granulosa cells,
indicating that cAMP down regulates both P1- and P2-specific ERß mRNA
expression.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß (8, 9, 10, 16, 17, 18, 19). However, these receptors differentially regulate the
transcription from an AP-1 driven reporter gene (20) or the human
retinoic acid receptor--1 promoter (57), presumably without directly
binding to DNA but recruiting other proteins to DNA. In either case,
differential expression of ER/ERß may explain differential
estrogen responsiveness at the level of transcription of this type of
target genes. The progesterone receptor (PR) gene has long been
identified as an estrogen target gene (2) and its estrogen-induced
transcription requires a partial ERE element(s) that interacts with
ER (58). This functional PR-ERE does not appear to be recognized by
ERß-predominant (34–36, this study) granulosa cell extracts in gel
shift assays (59). Interestingly, the PR gene is not induced in
granulosa cells in response to estrogen (59, 60). The question of
whether the promoter context-dependency of estrogen-induced
transcription is mainly due to differential affinity of ERs to DNA
sequences remains to be determined.
Detection of approximately 62 kDa ERß-immunoreactive proteins in
granulosa cells is in good agreement with previous reports showing
61–63 kDa ERß proteins in the human (54) and mouse (61) but raises
an important question of whether these proteins are produced from
transcripts with spliced-in exons or from alternative initiation
codons. Several ERß isoforms have been reported previously: ERßcx,
ERß, ERßB, and their 3 derivatives. The PAI-310 ERß antibody
recognizes the epitope in the carboxy-most terminal exon of the ERß
and thus, should detect ERß, ERßB, and their 3 derivatives.
ERßcx (28) contains an alternative carboxy-most terminal exon and
thus, will not be detected by this antibody. Nonetheless, rat granulosa
cells appear not to express this isoform at a substantial level because
ERßcx can bind the ERE (28) but the PAI-310 antibody supershifted
granulosa cell ERE-binding activities nearly completely. Thus, if there
exists the yet-to-be identified rat homolog of the human isoform
ERßcx, our results suggest that its expression should be minimal in
granulosa cells. RT-PCR results showing the expression of other ERß
isoforms (ERß, ERßB, and their 3 derivatives) in granulosa cells
are in good agreement with previous studies (29, 30, 31). Unless there is
differential translation or protein stability among these ERß
isoforms, the ratio of mRNA species should relate directly to protein
production in vivo. ERß mRNA with exon 3 deletion (3)
is expressed at a level less than 10% of ERß mRNA with exon 3 (ERß
and ERßB). The 3 isoforms should migrate between 49–51 kDa
depending on whether they contain the extra 54 bp exon according to the
originally proposed open-reading frame (8). The fact that we did not
detect these smaller ERß-immunoreactive proteins on Western blots may
be accounted for by their low expression. Western blots often detected
one larger but weak immunoreactive band (63 kDa) and the other
smaller but predominant band (61 kDa). Based upon our RT-PCR
results, we believe the larger immunoreactive band is likely ERßB
with an extra 54-bp exon in the hormone binding domain (29, 30, 31), and
the size difference (2 kDa) is in good agreement with the predicted
size difference between ERß and ERßB. Use of the ATG379, which is
conserved between the rat and mouse, will produce a 61-kDa ERß and
63-kDa ERßB. However, use of the ATG379 in human will cause a
frame-shift with a premature translation stop codon, indicating that
the ATG379 may not be functional. The predicted sizes using the
originally proposed conserved Kozak consensus (62) translation
initiation codons ATG571 are 54 kDa for ERß and 56 kDa for ERßB.
Thus, the migration of ERß-immunoreactive proteins on Western
blotting is most consistent with the predicted sizes using the
well-conserved Kozak consensus ATG436 (59 and 61 kDa), considering the
presence of a significant amount of an approximately 64-kDa protein in
our granulosa cell preparation. The corresponding ATG has also been
designated as the translation initiation codon in the human (54).
Alternatively, posttranslational modifications on ERß proteins may
also account for this difference. Indeed, ERß contains several
phosphorylation consensus sequences that can be targeted by protein
kinases. The originally proposed ATG571 can be forced to be functional
during in vitro transcription/translation (9) and thus, it
remains to be determined whether the ATG571 is also functional in
vivo and what posttranslational modifications occur on ERß
proteins. The signal ratio of the two ERß-immunoreactive bands is not
1:1 as we might suspect from the ratio of ERß and ERßB mRNA,
suggesting the possibility of differential translation efficacy in
granulosa cells between these mRNA species. Thus, the potency of ERßB
as a repressor of ER and ERß in cells in vivo may not
be physiologically important for estrogen-responsiveness of target
cells such as granulosa cells.
The gene structure throughout the coding region of the human and mouse
ERß (63) appears to be similar to that of the ER gene (64). Using
the 5'-RACE approach, a method to map the transcriptional start site,
we identified the most 5'-end of the rat and mouse ERß mRNA. The
presence of two (P1- and P2-) different 5'-ends of the ERß mRNA in
rodent granulosa cells suggests the possibility that two alternative
promoters direct ERß production. Similarly, the closely related ER
gene produces mRNA species encoding the full-length ER (65, 66, 67, 68, 69)
using three different promoters (ER-P1, P2, and P3). The possibility
of multiple ERß promoters has been suggested by previous reports
showing multiple transcripts on Northern blotting (9, 10, 35, 63). Our
results showing the presence of ERß transcripts with two different
5'-ends in both rat and mouse granulosa cells clearly support the
synthesis of ERß from at least two alternative promoters. In
addition, differential usage of multiple polyadenylation sites needs to
be considered as demonstrated in the fish ER gene (70). Because
regulatory sequences in the promoter as well as the UTR of the mRNA
could respond to diverse stimuli, the presence of multiple promoters
and polyadenylation sites will surely increase the complexity and
flexibility of differential response of the ERß gene to diverse
intracellular signals (65, 66, 67, 68, 69). We have examined one such intracellular
signaling molecule cAMP because cAMP down-regulates ERß mRNA levels
in granulosa cells (35). Forskolin, an adenylate cyclase activator,
decreased the levels of both mRNA species containing P1- and
P2-specific exons in cultured granulosa cells, suggesting that cAMP can
regulate the suspected alternative promoters, or decrease ERß mRNA
stability in granulosa cells. The cis-element (5'AUUUA3') that has been
proposed to play a role critical in protecting mRNAs from degradation
(71, 72) is present in the 3'-UTR of the rat ERß (8). The closely
related ER mRNA has also been suggested to be stabilized in breast
cancer cells in response to TPA, which activates cascades of
intracellular signaling pathways (73). Because the ability of hCG to
decrease ERß mRNA levels in differentiated granulosa cells is
independent of cycloheximide, a protein synthesis inhibitor
(Park-Sarge, O.-K., unpublished data), the effect, if any, of cAMP on
ERß mRNA stability must be mediated by posttranslational
modifications of preexist proteins in granulosa cells.
Taken together, our results suggest the presence of alternative promoters directing the synthesis of ERß mRNA, their regulation by cAMP, and the potential usage of an up-stream translation initiation codon resulting in approximately 61 kDa ERß protein in granulosa cells. Because expression and regulation of the ERß gene is crucial for understanding differential estrogen action in various tissues, in particular ovarian granulosa cells which contain predominantly ERß, understanding the hormonal regulation of the alternative promoters will increase insight into both physiological and pathophysiological conditions.
|
Acknowledgments |
|---|
, baculovirus rat ERß, and insightful
discussions, respectively. |
Footnotes |
|---|
2 Trainee supported by the NIH Training Grant in Reproductive Sciences
and the NIH Grant in Toxicology.
3 Visiting graduate student scholar from the Department of
Biochemistry and Molecular Biology, Hanyang University, South
Korea.
4 Recipient of NIH Research Career Development Award HD-01135.
Received April 5, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ß. Endocrinology 138:863–870. Mol Endocrinol 11:1486–1496 and ß form heterodimers on DNA. J Biol
Chem 272:19858–19862
in vivo and in vitro. Biochem Biophys Res Commun 243:122–126[CrossRef][Medline]
and ß.
Biochem Biophys Res Commun 236:140–145[CrossRef][Medline]
and ERß at AP1 sites. Science 277:1508–1510 and estrogen receptor-ß.
J Biol Chem 273:25443–9 delta 3) in breast
cancer and the consequences of its reexpression: interference with
estrogen-stimulated properties of malignant transformation. Mol
Endocrinol 11:2004–2015 in the rat ovary.
Endocrinology 140:963–71-1 promoter in response to tamoxifen
and other estrogen receptor antagonists, but not in response to
estrogen. Mol Endocrinol 13:418–430 gene are generated by
alternative splicing and promoter usage. Mol Endocrinol 12:1939–1954This article has been cited by other articles:
 |
|
 |
|
  U. Ohnemus, M. Uenalan, J. Inzunza, J.-A. Gustafsson, and R. Paus The Hair Follicle as an Estrogen Target and Source Endocr. Rev., October 1, 2006; 27(6): 677 - 706. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. J. Pepe, R. B. Billiar, M. G. Leavitt, N. C. Zachos, J. A. Gustafsson, and E. D. Albrecht Expression of Estrogen Receptors {alpha} and {beta} in the Baboon Fetal Ovary Biol Reprod, April 1, 2002; 66(4): 1054 - 1060. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. A. LaVoie, D. C. DeSimone, C. Gillio-Meina, and Y. Y. Hui Cloning and Characterization of Porcine Ovarian Estrogen Receptor {beta} Isoforms Biol Reprod, March 1, 2002; 66(3): 616 - 623. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Frasor, K. Park, M. Byers, C. Telleria, T. Kitamura, L.-y. Yu-Lee, J. Djiane, O.-K. Park-Sarge, and G. Gibori Differential Roles for Signal Transducers and Activators of Transcription 5a and 5b in PRL Stimulation of ER{alpha} and ER{beta} Transcription Mol. Endocrinol., December 1, 2001; 15(12): 2172 - 2181. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Cardenas, K.A. Burke, R.M. Bigsby, W.F. Pope, and K.P. Nephew Estrogen Receptor {beta} in the Sheep Ovary During the Estrous Cycle and Early Pregnancy Biol Reprod, July 1, 2001; 65(1): 128 - 134. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Richards Perspective: The Ovarian Follicle--A Perspective in 2001 Endocrinology, June 1, 2001; 142(6): 2184 - 2193. [Full Text] [PDF]
|
|
|
|
|
|
C. Guo, L. Savage, K. D. Sarge, and O.-K. Park-Sarge Gonadotropins Decrease Estrogen Receptor-{beta} Messenger Ribonucleic Acid Stability in Rat Granulosa Cells Endocrinology, June 1, 2001; 142(6): 2230 - 2237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. H. Price Jr., C. A. Butler, P. Webb, R. Uht, P. Kushner, and R. J. Handa A Splice Variant of Estrogen Receptor {beta} Missing Exon 3 Displays Altered Subnuclear Localization and Capacity for Transcriptional Activation Endocrinology, May 1, 2001; 142(5): 2039 - 2049. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. Campbell-Thompson, I. J. Lynch, and B. Bhardwaj Expression of Estrogen Receptor (ER) Subtypes and ER{beta} Isoforms in Colon Cancer Cancer Res., January 1, 2001; 61(2): 632 - 640. [Abstract] [Full Text]
|
|
|
|
|
|
C. S. Rosenfeld, A. A. Murray, G. Simmer, M. G. Hufford, M. F. Smith, N. Spears, and D. B. Lubahn Gonadotropin Induction of Ovulation and Corpus Luteum Formation in Young Estrogen Receptor-{alpha} Knockout Mice Biol Reprod, March 1, 2000; 62(3): 599 - 605. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) or antisense
(
) sequences
of the primers. A schematic illustration of P1- and P2-specific
transcripts is shown in panel C. The shaded bar represents
the sequences common to both kinds of transcripts, whereas the
blank bar represents the sequences specific for P1- and
P2-transcripts. Inserted triangles indicate locations of
introns whose sizes are yet to be determined. The hatched
bar represents a genomic sequences at the junction of P1- and
P2-specific mRNA sequences. Primer locations are indicated by
. Panel D shows the
predicted molecular sizes of ERß proteins that are produced from the
three different ATGs.
