Endocrinology Vol. 140, No. 10 4609-4615
Copyright © 1999 by The Endocrine Society
Early Prepubertal Ontogeny of Pulsatile Gonadotropin-Releasing Hormone (GnRH) Secretion: I. Inhibitory Autofeedback Control through Prolyl Endopeptidase Degradation of GnRH1
C. Yamanaka2,
M. C. Lebrethon,
E. Vandersmissen,
A. Gerard,
G. Purnelle,
M. LeMaitre,
S. Wilk and
J. P. Bourguignon
Developmental Neuroendocrinology Unit (M.C.L., E.V., A.G., G.P.,
J.P.B.), Division of Ambulatory Pediatrics and Adolescent Medicine,
Department of Pediatrics, University of Liège, C.H.U. Sart
Tilman, B-4000 Liège, Belgium; Eurogentec (M.L.), B-4000
Liège, Belgium; and Department of Pharmacology (S.W.), The Mount
Sinai Medical Center, New York, New York 10029-6574
Address all correspondence and requests for reprints to: Jean-Pierre Bourguignon, M.D., Ph.D., Division of Pediatric and Adolescent Medicine, C.H.U. Sart Tilman, B-4000 Liège, Belgium. E-mail:
Jean-Pierre.Bourguignon{at}chu.ulg.ac.be
 |
Abstract
|
|---|
GnRH[15], a subproduct resulting from degradation of
GnRH by prolyl endopeptidase (PEP) and endopeptidase 24.15 (EP24.15)
was known to account for an inhibitory autofeedback of GnRH secretion
through an effect at the
N-methyl-D-aspartate (NMDA) receptors. This
study aimed at determining the possible role of such a mechanism in the
early developmental changes in frequency of pulsatile GnRH secretion.
Using retrochiasmatic explants from fetal male rats (day 2021 of
gestation), no GnRH pulses could be observed in vitro,
whereas pulses occurred at a mean interval of 86 min from the day of
birth onwards. This interval decreased steadily until day 25 (39 min),
during the period preceding the onset of puberty. Based on
GnRH[110] or GnRH[19] degradation and
GnRH[15] generation after incubation with hypothalamic
extracts, EP24.15 activity did not change with age, whereas PEP
activity was maximal at days 510 and decreased subsequently until day
50. These changes were consistent with the ontogenetic variations in
PEP messenger RNAs (mRNAs) quantitated using RT-PCR. Using fetal
explants, the NMDA-evoked release of GnRH was potentiated in a
dose-dependent manner by bacitracin, a competitive PEP inhibitor and
the desensitization to the NMDA effect was prevented using 2
mM of bacitracin. At day 5, a higher bacitracin
concentration of 20 mM was required for a similar effect.
Pulsatile GnRH secretion from fetal explants was not caused to occur
using bacitracin or Fmoc-Prolyl-Pyrrolidine-2-nitrile
(Fmoc-Pro-PyrrCN), a noncompetitive PEP inhibitor. At postnatal days 5
and 15, a significant acceleration of pulsatility was obtained using 1
µM of Fmoc-Pro-PyrrCN or 2 mM of bacitracin.
At 25 and 50 days, a lower bacitracin concentration of 20
µM was effective as well in increasing the frequency of
GnRH pulsatility. We conclude that the GnRH inhibitory autofeedback
resulting from degradation of the peptide is operational in the fetal
hypothalamus but does not explain the absence of pulsatile GnRH
secretion at that early age. After birth, PEP activity is high and may
account for the low frequency of pulsatility. The potency of that
effect decreases before the onset of puberty and may contribute to the
acceleration of GnRH pulsatility.
 |
Introduction
|
|---|
AFTER BEING SECRETED, GnRH was shown to be
degraded in the hypothalamus and the anterior pituitary gland by two
endopeptidases acting in a stepwise manner (1). Prolyl endopeptidase
(PEP) resulted in cleavage of the C-terminal glycinamide
residue and generated GnRH[19], which was in turn
cleaved at the tyr5-gly6 bond by the
metalloendopeptidase EC 3.4.24.15 (EP24.15), thus generating GnRH[15] (1). GnRH[19] was the preferred
substrate of EP24.15 because it was 11 times more potent than
GnRH[110] in generating GnRH[15]
(2).
The physiological role of pituitary endopeptidases in limiting GnRH
stimulation of the pituitary gonadotropes was supported by the increase
in gonadotropin secretion seen after systemic administration of EP24.15
inhibitors in the rat (3, 4). A possible role for brain endopeptidases
in the regulation of GnRH effects was suggested by the effect of
intracerebroventricular (ICV) administration of EP24.15 inhibitors,
which resulted in increased gonadotropin secretion (3) as well as
increased recovery of ICV-administered GnRH (5). In ovariectomized
estrogen-primed rats, progesterone administration caused a reduction in
GnRH degrading activity in the median eminence, which was associated
with an increase of the GnRH content (6). In the female monkey,
pulsatile GnRH secretion in the stalk-median eminence area was
increased by local immunoneutralization of EP24.15, whereas it was
suppressed by recombinant EP24.15 (7). In the ovariectomized ewe,
however, pulsatile LH secretion was not affected by ICV administration
of PEP or EP24.15 inhibitors (8).
While the primary aim of endopeptidase degradation was thought to be
the limitation of GnRH interaction at pituitary and hypothalamic GnRH
receptors, we proposed an additional inhibitory autofeedback role. This
was based on the possible inhibition by the GnRH[15]
subproduct of the secretion of GnRH evoked through stimulation of the
N-methyl-D-aspartate (NMDA) receptors (9).
Because this autofeedback control could affect the frequency of GnRH
pulsatility, it appeared relevant to study the role of hypothalamic PEP
and EP24.15 in the early ontogeny of pulsatile GnRH secretion. We aimed
at elucidation of the endopeptidase contribution in the developmental
changes in the hypothalamic GnRH pulse generator leading to the onset
of puberty.
 |
Materials and Methods
|
|---|
Hypothalamic explant incubation and RIA of GnRH
In male Wistar rats of different ages between late gestation
(fetal day 2021) and postnatal day 50, the retrochiasmatic
hypothalamus was rapidly dissected after decapitation and transferred
into a static incubator as described in detail previously (10, 11, 12).
Noteworthy, the studied retrochiasmatic explants did contain GnRH axons
and terminals but virtually no GnRH cell bodies (13). In each
experiment, 12 to 15 explants were studied individually for 4 to 6
h through collection and renewal of the incubation medium (0.5 ml)
every 7.5 min. GnRH was measured in the collected fractions using a
highly sensitive RIA (10, 11). The values below the limit of detection
(5 pg/7.5 min) were assigned that value. Two different GnRH antisera
were used, generously gifted by Dr. A. W. Root (St. Petersburgh,
FL) (14) and by Dr. Y. F. Chen and V. D. Ramirez (Urbana, IL)
(15). Both antisera were highly specific of GnRH[110]
without significant cross-reactivity of neither
GnRH[19] and GnRH[15], nor any of the
reagents used in the experiments. [Hyp9]GnRH resulted in
only 5% cross-reactivity in the assay.
Measurement of endopeptidase activity
Retrochiasmatic hypothalamic explants were dissected and
immediately homogenized in 10 times as much buffer (20 mM
TES, N-Tris(hydroxymethyl)methyl-2-aminoethanosulfonic
acid), pH 7.4), at 4 C, with a Politron homogenizer. After low speed
centrifugation to remove cellular debris, the supernatant was
centrifuged at 10,000 x g, 4 C for 20 min. The
supernatant was kept as a soluble fraction, and the pellet was washed
twice by resuspension in the homogenization buffer followed by
recentrifugation. The final pellet was resuspended in the
homogenization buffer and kept as a membrane fraction. Both fractions
were stored at -70 C. Aliquots of the fractions were assayed for
protein determination by a dye-binding method using a commercial kit
(Bio-Rad Laboratories, Inc., Hercules, CA). Synthetic
GnRH[110] or GnRH[19] (UCB, Brussels,
Belgium) was incubated with hypothalamic soluble or membrane fraction
(20 to 40 µg of protein) at 37 C in 250 µl of 200 mM
TES, pH 7.4. Twenty micrograms of peptide were incubated with the
soluble fraction for 30 min and 10 µg with the membrane fraction for
60 min. The reactions were terminated by heating, 100 C for 7 min.
After brief centrifugation, 200 µl were injected onto a microBondapak
C18 column (3.9 x 300 mm, Waters Corp., Milford,
MA). The peptides were eluted from the column by a linear gradient from
1030% of solvent (0.08% TFA/CH3CN) at a flow rate of 1 ml/min.
Chromatography was performed with a Waters HPLC system and
monitored by UV detection at 214 nm. The elution peaks of GnRH and
degradation fragments were identified by comigration of synthetic
GnRH[110] and the GnRH[19] and
GnRH[15] subproducts and peak areas were calculated.
The GnRH[110] or GnRH[19] degrading
activity was estimated by disappearance of the peptides after
incubation. The presence of GnRH[15] after incubation
was regarded as generation of GnRH[15] because this
subproduct was relatively stable (16). In the used conditions, the
relationship between protein concentration and incubation time was
linear.
The specificity of the assays for PEP and EP24.15 activity was assessed
using the soluble fraction of hypothalamic extracts prepared from
15-day-old rats. Incubation with 200 µM of bacitracin
(Sigma, St. Louis, MO) a competitive PEP inhibitor (17) or
100 nM of Fmoc-Prolyl-Pyrrolidine-2-nitrile
(Fmoc-Pro-PyrrCN), a recently proposed noncompetitive PEP inhibitor
that is more specific and potent than bacitracin (18), resulted in a
profound inhibition of GnRH[110] degradation (23% of
controls), a complete suppression of GnRH[19]
generation and a reduction of GnRH[15] generation
(1314% of controls). This indicated PEP inhibition and residual
GnRH[15] generation presumably through direct EP24.15
degradation of GnRH[110]. Incubation with 10
µM of
N-[1(R,S)carboxy-3-phenylpropyl]Ala-Ala-Tyr-p-aminobenzoate
(CFP-A-A-Y-pAB), a competitive EP24.15 inhibitor (1)
resulted in a slight reduction of GnRH[110] degradation
(77% of controls), an increase of GnRH[19] generation
(445% of controls), and a profound inhibition of
GnRH[15] (6% of controls).
Quantitation of PEP mRNAs
Total RNAs were extracted from retrochiasmatic explants
according to the RNAzol method (19). The extracted RNAs were reverse
transcribed with Moloney Murine leukaemia virus reverse transcriptase
(Expand, Roche Molecular Biochemicals, Mannheim,
Germany) using oligo (dT) 1218 (Eurogentec, Liège,
Belgium). The cDNAs obtained were then amplified by PCR (32 cycles at
94 C for 90 sec, 55 C for 90 sec, 72 C for 90 sec) using the
5'-oligonucleotide CATTCTGCAGCTTCACGACC (7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26) and the
3'-oligonucleotide GCGCAAGAAGGACT-CTAAGA (91112) from rat prolyl
endopeptidase (accession number H34452) (20). The predicted size of
this PCR product was 106 bp. As positive and semiquantitative controls,
the 5'-oligonucleotide GTGACTTCACACGCCATAATG (236256) and the
3'-oligonucleotide CCTTCAAGTCTAGCAGGATTG (677697) from rat
cyclophilin were used (accession number M19533). The predicted size of
this PCR product was 453 bp. The PCR products were studied through
electrophoresis on 1.5% agarose gel in TAE buffer, stained with
ethidium bromide, and photographed under UV illumination. An electronic
densitometric scanning of PCR product signals was directly processed
from agarose gel under a UV transilluminator with a black and white
highly sensitive camera.
Study protocols
Using hypothalamic explants obtained at 1-day intervals between
fetal day 2021 and postnatal day 25 and at 5-day intervals between
days 25 and 50, the frequency and the amplitude of pulsatile GnRH
secretion was studied. For consistency with our previous studies
(9, 10, 11, 12), the present one was performed using 20 µM of
bacitracin.
Using the soluble and membrane fractions of hypothalamic explants
prepared at 5-day intervals between fetal days 2021 and postnatal day
50, the activity of PEP and EP24.15 was measured using reversed phase
HPLC through the degradation of synthetic GnRH[110] and
GnRH[19] and the generation of
GnRH[15]. Using the total RNAs extracted from the
retrochiasmatic hypothalamus on fetal days 2021 and postnatal days 5,
10, 15, 25, and 50, the PEP and cyclophilin gene expression was studied
through RT-PCR.
Using explants obtained on fetal days 2021 and on postnatal day
5, 7.5-min stimulation using 50 mM of NMDA
(Sigma, St. Louis, MO) was performed repeatedly at regular
intervals of 37.5 min (five fractions) to mimic the frequency of GnRH
pulsatility observed from 25 days of age onwards. These experiments
were performed in the absence of bacitracin or using different
concentrations of the inhibitor (20 µM, 2 mM
and 20 mM). The NMDA-evoked release of GnRH was calculated
as the difference between GnRH secretion in the fractions collected
immediately before and during NMDA stimulation. When no bacitracin was
used in the incubation medium, 10 µl of 1 mM bacitracin
were added to the collected medium to prevent further degradation of
GnRH during the RIA procedure.
Using explants obtained on fetal days 2021 and postnatal day 5, 15,
25, and 50, pulsatile GnRH secretion in vitro was studied in
the absence of bacitracin and using 20 µM or 2
mM of the inhibitor. On fetal days 2021 and postnatal
days 5 and 15, similar experiments were performed using Fmoc-Pro-PyrrCN
(18).
Statistical analysis
The occurrence of significant pulses of GnRH secretion was
determined using the Pulsar program (21, 22) as described previously
(23). The individual interpulse interval and pulse amplitude as well as
the mean ± SD were calculated. The significance of
differences in GnRH pulse amplitude and frequency and NMDA-evoked GnRH
release was calculated by ANOVA with correction for repeated
measurement and Scheffés F test. The significance of
age-differences in GnRH degrading activity and PEP mRNAs was analyzed
using one-way ANOVA. The level of significance was P <
0.05.
 |
Results
|
|---|
Ontogeny of pulsatile GnRH secretion
The amplitude and the frequency of pulsatile GnRH secretion
in vitro were studied at different ages between late fetal
life and adulthood using 20 µM of bacitracin, which is in
conditions similar to our previous studies (9, 10, 11, 12). No pulses could be
observed using the fetal explants, thus accounting for absence of
pulsatility or interpulse interval
180 min, which was the minimal
study period (Fig. 1
). From the day of
birth onwards, pulsatility was observed with a mean interpulse interval
of 86 ± 8 min. A progressive reduction in interpulse interval was
seen between birth and 10 days of age (72 ± 4 min). A 2-fold
greater reduction occurred between 10 and 20 days (47 ± 3 min).
An adult pattern of frequency was attained by 25 days of age (interval:
39 ± 4 min) when the first evidence of spermatogenetic maturation
could be obtained (23). The mean GnRH pulse amplitude was around 6
pg/7.5-min fraction in the early neonatal period and increased
progressively but not significantly with age to reach an average of 8
pg/7.5 min after 25 days.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1. Developmental changes in frequency and amplitude
of GnRH secretion in vitro from retrochiasmatic explants
(n = 636) of the male rat hypothalamus. F, Fetal, days 2021 of
gestation. B, Day of birth. The data are mean ± SD.
ANOVA shows a significant reduction in GnRH interpulse interval before
onset of puberty and no significant changes in amplitude.
|
|
Ontogeny of hypothalamic GnRH endopeptidase activity
Using the soluble fraction of retrochiasmatic hypothalamic
extracts prepared at different ages, the degradation of
GnRH[110] and the generation of
GnRH[15] assessed through reversed-phase HPLC showed
significant and parallel changes during development (Fig. 2
). The GnRH[110]
degrading activity (PEP and EP24.15) was present in the fetal
hypothalamus, increased to maximal levels at postnatal days 510, and
decreased subsequently during prepubertal and pubertal periods. In
contrast, degradation of GnRH[19] and generation of
GnRH[15] from GnRH[19] did not show any
significant change between day 10 and day 50 (Fig. 2
), indicating that
EP24.15 activity did not change throughout development. Using the
membrane fraction of retrochiasmatic hypothalamic extracts (Table 1
), the endopeptidase activity was lower
than in soluble fraction and showed similar developmental variations.
GnRH[110] degradation and GnRH[15]
generation were low in the fetal hypothalamus, reached maximal levels
at days 510, and decreased subsequently during postnatal life. Taken
together, these data suggested that the developmental changes in
GnRH[110] degradation involved changes in PEP
activity.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2. Developmental changes in endopeptidase degradation
of GnRH estimated through HPLC assessment of degradation of
GnRH[110] or GnRH[19] and generation of
GnRH[15] from those two peptides using soluble fraction
extracts of the retrochiasmatic hypothalamus (n = 4). F =
Fetal, days 2021 of gestation. *, P < 0.05
vs. 5 days.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1. Developmental changes in endopeptidase degradation
of GnRH estimated through HPLC assessment of GnRH[110]
degradation and GnRH[15] generation using membrane
fraction extracts of the retrochiasmatic hypothalamus in male rats
|
|
Ontogeny of hypothalamic PEP mRNAs
Based on the ratio between PEP and cyclophilin mRNAs in the
retrochiasmatic hypothalamus, the highest PEP mRNA level was found at
fetal days 2021 as well as on postnatal day 5 and 10 (Fig. 3
). Significantly lower levels
(P < 0.05) were observed using hypothalamic extracts
from 25- and 50-day-old rats.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 3. Developmental changes in PEP mRNAs estimated
through RT-PCR of extracts from the retrochiasmatic hypothalamus of
male rats (A) and densitometric analysis of the ratio between PEP and
cyclophilin mRNAs (B). The data are mean ±SD of six
estimates. *, P < 0.05 vs. data
obtained at 5 days. The upper photograph shows the
electrophoretic pattern of cyclophilin (cyclo) and PEP mRNAs at the
different ages of study. F, Fetal; d, days, postnatal age; c, control;
MM, molecular markers.
|
|
Effects of PEP inhibition on the NMDA-evoked release of GnRH
Using fetal hypothalamic explants incubated without bacitracin,
NMDA stimulation repeated every 37.5 min resulted in a progressive
extinction of the initial response (Fig. 4
). Bacitracin 20 µM and 2
mM caused a dose-related increase in the initial secretory
response of GnRH and prevented partially (20 µM) or
totally (2 mM) the inhibition of the NMDA-evoked release of
GnRH that occurred during repeated stimulation (Fig. 4
). Using explants
of 5-day-old rats, the GnRH secretory response to repeated NMDA
stimulation was reduced only at the fifth and sixth stimulatory episode
when 20 µM or 2 mM of bacitracin was used. A
20 mM concentration of bacitracin was necessary to prevent
the inhibition of the NMDA-evoked release of GnRH at 5 days.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4. Mean (± SD) secretory response of
GnRH to repeated (every 37.5 min) NMDA stimulation of retrochiasmatic
hypothalamic explants from fetal or 5-day-old male rats. Six explants
were studied in each age group. The release obtained using medium
without bacitracin was compared with that seen using three different
bacitracin concentrations. The asterisks denote
significant differences vs. the initial secretory
response (fraction 5).
|
|
Effects of PEP inhibition on the frequency of GnRH
pulsatility
Using Fmoc-Pro-PyrrCN, a noncompetitive inhibitor of PEP,
pulsatile GnRH secretion was not caused to occur from fetal explants.
At 5 and 15 days postnatally, the GnRH interpulse interval was
significantly reduced by the inhibitor (Fig. 5
). Similar observations were made using
bacitracin, a competitive antagonist of PEP. At 5 and 15 days, 2
mM of bacitracin were required to obtain a significant
reduction of the interpulse interval, whereas a 20 µM
concentration was already effective in causing a reduction at 25 and 50
days.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 5. Developmental changes in the effects of
noncompetitive PEP inhibition using Fmoc-Pro-PyrrCN (upper
panel) or competitive PEP inhibition using bacitracin
(lower panel) on the frequency of pulsatile GnRH
secretion from retrochiasmatic hypothalamic explants of male rats. Five
to 10 explants were studied in each age group. The
asterisks denote significant differences
vs. the data obtained without inhibitor.
|
|
 |
Discussion
|
|---|
To assess the activity of the hypothalamic endopeptidases involved
in GnRH degradation, we have combined a bioassay using synthetic
GnRH[110] and [19], an assessment of
the PEP transcripts and a study of the effects of bacitracin, a
competitive PEP inhibitor, on GnRH secretion. It was crucial to study
directly the GnRH degrading activity because the information provided
indirectly by bacitracin effects on the NMDA-evoked secretion of GnRH
involved not only the inhibitory interaction of
GnRH[15] but also possible developmental changes in
activity of glutamatergic neurons and expression of NMDA receptors.
Such developmental changes were suggested by our previous studies
showing age-related changes in sensitivity of GnRH secretion to NMDA as
well as to MK-801, a NMDA-receptor antagonist (12, 23). Because
bacitracin was not a highly specific PEP inhibitor, we also studied the
effects of Fmoc-Pro-PyrrCN, a highly specific inhibitor recently made
available (18). All together, the HPLC estimation of
GnRH[15] generation, the RT-PCR estimation of PEP
transcripts and the concentrations of bacitracin required to prevent
GnRH inhibitory autofeedback concur to demonstrate developmental
changes in hypothalamic PEP activity, which is maximal by 510 days of
age postnatally. Very few data were available on the early ontogeny of
PEP and EP24.15 in the brain. Whole brain PEP was found to increase
between days 4 and 15 when maximal levels were reached in the rat (24).
In a study starting at 15 days of age, EP24.15 activity in the arcuate
nucleus-median eminence area did not change throughout development
(25). These data are consistent with the absence of developmental
changes in EP24.15 activity, as found in the present study. The data
reported using whole brain extracts (24) are of little significance
because regional differences may be seen such as between preoptic area
and mediobasal hypothalamus (25). We elected to study the
retrochiasmatic hypothalamus because the inhibitory autofeedback of
GnRH was shown to occur in this explant (9). The occurrence of GnRH
degradation in the vicinity of GnRH terminals in the median eminence
area is supported by the presence of EP24.15 in the perivascular spaces
of the median eminence (4). GnRH degrading activity in the median
eminence was also found to increase during anestrus and proestrus in
the female rat (26). We studied both the soluble and
membrane-associated forms because it is unclear which fraction was
physiologically relevant. If the membrane-associated form truly
reflects the extracellular endopeptidase activity, it is of note that
the two-step degradation of GnRH was found to occur in the
extracellular milieu of median eminence endothelial cells (27). While
the observed changes in PEP activity are thought to influence the GnRH
pulse generator through GnRH[15] inhibitory effects, we
cannot exclude an interaction of other peptides such as TRH or
substance P, which involve PEP in their metabolism as well and could
thus be affected by the PEP inhibitors.
In this paper, we show that, in the explanted male rat hypothalamus,
the GnRH pulse generator is silent before birth though GnRH is already
releasable by episodic stimulation using NMDA. These findings suggest
that GnRH synthesis and storage as well as NMDA receptor synthesis are
not the ultimate factors that control the expression of the GnRH pulse
generator. We showed previously that the GnRH[15]
subproduct of GnRH degradation was involved in an inhibitory
autofeedback effect on pulsatility (9), and here we have obtained
evidence that GnRH degrading activity is present in the fetal
hypothalamus. PEP inhibition results in facilitation of GnRH secretion
in response to exogenous NMDA challenges that can mimic an adult
pattern of GnRH secretion from fetal explants. The inhibitors, however,
do not cause pulsatility to occur. Thus, endopeptidase degradation of
GnRH is effective in the fetal hypothalamus but does not represent the
key factor that restrains the pulse generator. Increased activity of
other inhibitory mechanisms such as GABAergic inputs or insufficient
activity of stimulatory mechanisms such as glutamatergic inputs deserve
further studies to elucidate why the GnRH pulse generator is silent in
the fetal explant. Quite remarkably, pulsatile GnRH secretion in
vitro can be observed from the first postnatal day onwards. This
may suggest that some inhibitory factors are related to the
intrauterine conditions. Recent studies have shown that GnRH existed in
the hypothalamus in a particular [Hyp9] GnRH form with
hydroxyproline instead of proline as the ninth residue (28). This form
accounts for the majority of hypothalamic GnRH immunoreactivity in the
fetus and decreases progressively throughout postnatal life. Because
[Hyp9] GnRH is less sensitive than
GnRH[110] to PEP activity, this peptide could account
for less inhibitory autofeedback, thus adding to our conclusion that
such a mechanism does not explain absent pulsatility in the fetus. An
alternative hypothesis was that [Hyp9] GnRH was secreted
but less detected than GnRH[110] in the GnRH RIA. It
is, however, unlikely that the secretion of [Hyp9] GnRH,
which is almost not detected in our RIA, could account for undetected
pulsatility because GnRH secretion would then be undetectable in
response to secretagogues such as NMDA. This is in contrast to our
observation that GnRH pulsatility evoked by NMDA is well observable.
Also, the sudden occurrence of pulsatility after birth is not
consistent with the progressive postnatal changes in proportion of
[Hyp9] GnRH (3040%) found in the immunoreactive
material released by hypothalamic explants between birth and 6 weeks of
age (29).
The detailed study of the ontogeny of pulsatile GnRH secretion from the
explanted male rat hypothalamus shows a remarkably progressive increase
in pulse frequency during the 2 weeks preceding the onset of puberty.
If relevant to in vivo physiology, this finding emphasizes
that the neuroendocrine changes leading to onset of puberty take place
relatively early in life before the age of 3 weeks, whereas no
subsequent changes are seen throughout puberty. Unfortunately, due to
the size of the rat and the limited sensitivity of LH assay, pulsatile
LH could not be studied in vivo so far, and no correlation
between in vitro and in vivo data were possible.
Our data indicate that the reduction in potency of GnRH inhibitory
autofeedback, possibly resulting from a reduced PEP activity with age,
can contribute to the acceleration of the GnRH pulse generator that
occurs before the onset of puberty, in agreement with our earlier
findings (30). In the presence of PEP inhibitors, a developmental
reduction of the GnRH interpulse interval is still observed, indicating
that other factors such as the GABA-receptor mediated inhibition play
an important role as well (31). It is unclear whether the inhibitory
autofeedback effects of GnRH are mediated only through the interaction
of GnRH[15] at NMDA receptors, as we suggested, or
whether GnRH receptors are involved as well. Reduced degradation of
GnRH could account for increased activity of the GnRH pulse generator
through a stimulatory effect of GnRH at its own receptors as long as
these receptors mediate a positive autofeedback. Indeed, central
microinjection of GnRH in the arcuate nucleus-median eminence area of
the female rat causes premature electrophysiological manifestation of
the pulse generator (32) and the preovulatory LH surge is delayed by
central microinjection of a GnRH antagonist that does not generate any
GnRH[15] (33). Using hypothalamic explants from male
rats incubated with GnRH antagonists or GnRH receptor antisense
oligodeoxynucleotides, we also obtained evidence of a positive
autofeedback of GnRH (34). Importantly, such observations may not apply
to other species. In the ram or the ewe, GnRH antagonists cause an
acceleration of LH or GnRH pulsatility, thus pointing to an inhibition
mediated via the GnRH receptors (35, 36, 37). GnRH antagonists do not
appear to affect the electrophysiological correlates of the pulse
generator in the monkey (38) nor the frequency of pulsatile LH
secretion in man (39). Based on these studies, the mechanism of GnRH
positive autofeedback warrants further delineation and integration with
the inhibitory autofeedback mediated through
GnRH[15].
 |
Acknowledgments
|
|---|
We are grateful to Dr. I. A. Smith for kindly providing us
with the EP24.15 inhibitor (CFP-A-A-Y-pAB) and Dr. V. D. Ramirez
for generous supply of the anti-GnRH antiserum. We thank Mrs. J.
Laurent for excellent secretarial assistance.
 |
Footnotes
|
|---|
1 Supported by the Belgian "Fonds de la Recherche Scientifique
Médicale" (Grant 3.4529.97), the Faculty of Medicine at the
University of Liège, and the Belgian Study Group for Pediatric
Endocrinology. 
2 Post-doctoral fellow supported by a grant from the
Bristol-Myers Squibb MeadJohnson Foundation. Present
address: Department of Pediatrics, Tenri Hospital, 200 Mishima-cho,
Tenri, Nara 632, Japan. 
Received January 27, 1999.
 |
References
|
|---|
-
Lew RA, Tetaz TJ, Glucksman MJ, Roberts JL, Smith
AI 1994 Evidence for a two-step mechanism of
Gonadotropin-releasing hormone metabolism by prolyl endopeptidase and
metalloendopeptidase EC 3.4.24.15 in ovine hypothalamic extracts.
J Biol Chem 269:1262612632[Abstract/Free Full Text]
-
Smith AI, Tetaz T, Roberts JL, Glucksman MJ, Clarke IJ,
Lew RA 1994 The role of EC 3.4.24.15 in the post-secretory
regulation of peptide signals. Biochimie (Paris). 76:288294
-
Lasdun A, Orlowski M 1990 Inhibition of
endopeptidase 24.15 greatly increases the release of luteinizing
hormone and follicle stimulating hormone in response to luteinizing
hormone/releasing hormone. J Pharmacol Exp Ther 253:12651271[Abstract/Free Full Text]
-
Wu TJ, Pierotti AR, Jakubowski M, Sheward WJ, Glucksman
MJ, Smith AI, King JC, Fink G, Roberts JL 1997 Endopeptidase EC
3.4.24.15 presence in the rat median eminence and hypophysial portal
blood and its modulation of the luteinizing hormone surge. J
Neuroendocrinol 9:813822[CrossRef][Medline]
-
Lasdun A, Reznik S, Molineaux CJ, Orlowski M 1989 Inhibition of endopeptidase 24.15 slows the in vivo degradation of
luteinizing hormone-releasing hormone. J Pharmacol Exp Ther 251:439447[Abstract/Free Full Text]
-
Advis JP, Krause JE, McKelvy JF 1983 Evidence that
endopeptidase-catalyzed luteinizing hormone Releasing Hormone cleavage
contributes to the regulation of median eminence LHRH levels during
positive steroid feedback. Endocrinology 112:11471149[Abstract/Free Full Text]
-
Nyberg CL, Yu GZ, Glucksman MJ, Roberts JL, Terasawa
E The role of the metalloendopeptidase E.C. 3.4.24.15 (EP24.15)
in the pulsatility of LHRH release in rhesus monkeys. 10th
International Congress of Endocrinology, San Francisco, 1996, p 744
(abstract)
-
Lew RA, Cowley M, Clarke IJ, Smith AI 1997 Peptidases that degrade gonadotropin-releasing hormone: influence on LH
secretion in the ewe. J Neuroendocrinol 9:707712[CrossRef][Medline]
-
Bourguignon JP, Alvarez Gonzalez ML, Gérard A,
Franchimont P 1994 Gonadotropin releasing hormone inhibitory
autofeedback by subproduct antagonist at
N-methyl-D-aspartate receptors: a model of
autocrine regulation of peptide secretion. Endocrinology 134:15891592[Abstract/Free Full Text]
-
Bourguignon JP, Gérard A, Franchimont P 1989 Direct activation of GnRH secretion through different receptors to
neuroexcitatory amino acids. Neuroendocrinology 49:402408[Medline]
-
Bourguignon JP, Gérard A, Mathieu J, Simons J,
Franchimont P 1989 Pulsatile release of gonadotropin-releasing
hormone from hypothalamic explants is restrained by blockade of
N-methyl-D,L-aspartate receptors. Endocrinology 125:10901096[Abstract/Free Full Text]
-
Bourguignon JP, Gérard A, Alvarez Gonzalez ML,
Franchimont P 1992 The neuroendocrine mechanism of onset of
puberty: sequential reduction in activity of inhibitory and
facilitatory N-methyl-D-aspartate receptors.
J Clin Invest 90:17361744
-
Purnelle G, Gérard A, Czajkowski V, Bourguignon
JP 1997 Pulsatile secretion of gonadotropin-releasing hormone by
rat hypothalamic explants without cell bodies of GnRH neurons.
Neuroendocrinology 66:305312[Medline]
-
Root AW, Reiter EO, Duckett GE, Sweetland ML 1975 Effect of short-term castration and starvation upon hypothalamic
content of luteinizing hormone-releasing hormone in adult male rats.
Proc Soc Exp Biol Med 150:602607[CrossRef][Medline]
-
Hartter DE, Ramirez VD 1985 Responsiveness of
immature versus adult male rat hypothalami to dibutyryl cyclic AMP- and
forskolin-induced LHRH release in vitro. Neuroendocrinology 40:476482[Medline]
-
Carone FA, Stetler-Stevenson MA, May V, LaBarbera A,
Flouret G 1987 Differences between in vitro and
in vivo degradation of LHRH by rat brain and other organs.
Am J Physiol 253:E317E321
-
McKelvy JF, LeBlanc P, Laudes C, Perrie S,
Grimm-Jorgensen Y, Kordon C 1976 The use of bacitracin as an
inhibitor of the degradation of thyrotropin releasing factor and
luteinizing hormone releasing factor. Biochem Biophys Res Commun 73:507515[CrossRef][Medline]
-
Li J, Wilk E, Wilk S 1996 Inhibition of prolyl
oligopeptidase by Fmoc-aminoacylpyrrolidine-2-nitriles. J
Neurochem 66:21052112[Medline]
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162:156159[Medline]
-
Gocayne JD, Adams MA, Kerlavage AR, Fraser CM, Venter
JC 1995 Comparative expresses-sequence-tag analysis of
differential gene expression profiles in PC-12 cells before and after
nerve growth factor treatment. Proc Natl Acad Sci USA 92:83038307[Abstract/Free Full Text]
-
Merriam GR, Wachter KW 1982 Algorithms for the
study of episodic hormone secretion. Am J Physiol
243:E310E318
-
Gitzen JF, Ramirez VD 1987 PC Pulsar-pulsar pulse
analysis for the IBM-PC. Psychoneuroendocrinology 12:36[CrossRef][Medline]
-
Bourguignon JP, Gérard A, Mathieu J, Mathieu A,
Franchimont P 1990 Maturation of the hypothalamic control of
pulsatile gonadotropin-releasing hormone secretion at onset of puberty:
I. Increased activation of N-methyl-D-aspartate
receptors. Endocrinology 127:873881[Abstract/Free Full Text]
-
Kato T, Nakano T, Kojima K, Nagatsu T, Sakakibara S 1980 Changes in prolyl endopeptidase during maturation of rat brain and
hydrolysis of substance P by the purified enzyme. J Neurochem 35:527535[CrossRef][Medline]
-
Pierotti AR, Lasdun A, Ayala JM, Roberts JL, Molineaux
CJ 1991 Endopeptidase 24.15 in rat hypothalamic/pituitary/gonadal
axis. Mol Cell Endocrinol 76:95103[CrossRef][Medline]
-
Advis JP, Krause JE, McKelvy JF 1982 Luteinizing
hormone-releasing hormone peptidase activities in discrete hypothalamic
regions and anterior pituitary of the rat: apparent regulation during
the prepubertal period and first estrous cycle at puberty.
Endocrinology 110:12381245[Abstract/Free Full Text]
-
Lew RA, TetazT, Smith AI 1994 Characterization of
membrane-associated peptidase activities expressed by endothelial cells
of the ovine median eminence. J Neuroendocrinol 6:225232[CrossRef][Medline]
-
Gautron JP, Leblanc P, Bluet-Pajot MT, Pattou E,
LHeritier A, Mounier F, Ponce G, Audinot V, Rasolonjanahary R, Kordon
C 1992 A second endogenous molecular form of mammalian
hypothalamic luteinizing hormone-releasing hormone, (hydroxyproline9)
LHRH, releases luteinizing hormone and follicle-stimulating hormone
in vitro and in vivo. Mol Cell Endocrinol 85:99107[CrossRef][Medline]
-
Rochdi L, Theraulaz L, Enjalbert A, Gautron JP 1998 Catabolisme différentiel de la HypLHRH et de la LHRH dans
lhypothalamus et lhypophyse au cours de lontogenèse chez le
rat. 27ème Colloque de la Société de
Neuroendocrinologie Expérimentale, en association avec le British
Neuroendocrine Group, Lille, p 21 (Abstract)
-
Bourguignon JP, Gérard A, Franchimont P 1990 Maturation of the hypothalamic control of pulsatile
gonadotropin-releasing hormone secretion at onset of puberty. II.
Reduced potency of an inhibitory autofeedback. Endocrinology 127:28842890[Abstract/Free Full Text]
-
Bourguignon JP, Gérard A, Purnelle G, Czakjowski
V, Yamanaka C, Lemaître M, Rigo JM, Moonen G, Franchimont
P 1997 Duality of glutamatergic and gabaergic control of pulsatile
GnRH secretion by rat hypothalamic explants: II. Reduced NR2C- and
GABAA-receptor-mediated inhibition at initiation of sexual
maturation. J Neuroendocrinol 9:193199[CrossRef][Medline]
-
Hiruma H, Kimura F 1995 Luteinizing
hormone-releasing hormone is a putative factor that causes LHRH neurons
to fire synchronously in ovariectomized rats. Neuroendocrinology 61:509516[Medline]
-
Funabashi T, Hashimoto R, Jinnai K, Kimura F 1994 Microinjection of LHRH and its antagonistic analog into the medical
preoptic area does not affect pulsatile secretion of LH in
ovariectomized rats. Endocr J 41:559563[Medline]
-
Yamanaka C, Gérard A, Lemaître M,
Bourguignon JP 1997 Positive autofeed-back in pulsatile
Gonadotrophin-releasing hormone secretion during development. 5th Joint
Meeting European Society for Pediatric/Lawson Wilkins Pediatric
Endocrine Society, Stockholm. Horm Res [S2] 48:14
-
Lincoln GA, Fraser HM 1987 Compensatory response of
luteinizing-hormone(LH)-releasing hormone (LHRH)/LH pulse generator
after administration of a potent LHRH antagonist in the ram.
Endocrinology 120:22452250[Abstract/Free Full Text]
-
Padmanabhan V, Evans NP, Dahl GE, McFadden KL, Mauger
DT, Karsch FJ 1995 Evidence for short or ultrashort loop negative
feedback of gonadotropin-releasing hormone secretion.
Neuroendocrinology 62:248258[Medline]
-
Blache D, Chagas LM, Caraty A, Deghenghi R, Delaleu B,
Blackberry MA, Martin GB 1997 GnRH secretion into CSF in rams
treated with a GnRH antagonist. J Neuroendocrinol 9:887892[CrossRef][Medline]
-
Ördög T, Chen MD, Nishihara M, Connaughton
MA, Goldsmith JR, Knobil E 1997 On the role of
gonadotropin-releasing hormone (GnRH) in the operation of the GnRH
pulse generator in the rhesus monkey. Neuroendocrinology 65:307313[Medline]
-
Pavlou SN, Veldhuis JD, Lindner J, Souza KH, Urban RJ,
Rivier JE, Vale WW, Stallard DJ 1990 Persistence of concordant
luteinizing hormone (LH), testosterone, and
-subunit pulses after
LH-releasing hormone antagonist administration in normal men. J
Clin Endocrinol Metab 70:14721478[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
A.-S. Parent, G. Rasier, V. Matagne, A. Lomniczi, M.-C. Lebrethon, A. Gerard, S. R. Ojeda, and J.-P. Bourguignon
Oxytocin Facilitates Female Sexual Maturation through a Glia-to-Neuron Signaling Pathway
Endocrinology,
March 1, 2008;
149(3):
1358 - 1365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Rasier, A.-S. Parent, A. Gerard, M.-C. Lebrethon, and J.-P. Bourguignon
Early Maturation of Gonadotropin-Releasing Hormone Secretion and Sexual Precocity after Exposure of Infant Female Rats to Estradiol or Dichlorodiphenyltrichloroethane
Biol Reprod,
October 1, 2007;
77(4):
734 - 742.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zemkova, A. Balik, Y. Jiang, K. Kretschmannova, and S. S. Stojilkovic
Roles of Purinergic P2X Receptors as Pacemaking Channels and Modulators of Calcium-Mobilizing Pathway in Pituitary Gonadotrophs
Mol. Endocrinol.,
June 1, 2006;
20(6):
1423 - 1436.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Wu, M. J. Glucksman, J. L. Roberts, and S. K. Mani
Facilitation of Lordosis in Rats by a Metabolite of Luteinizing Hormone Releasing Hormone
Endocrinology,
May 1, 2006;
147(5):
2544 - 2549.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Matagne, M.-C. Lebrethon, A. Gerard, and J.-P. Bourguignon
Kainate/Estrogen Receptor Involvement in Rapid Estradiol Effects in Vitro and Intracellular Signaling Pathways
Endocrinology,
May 1, 2005;
146(5):
2313 - 2323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. S. Heimann, M. H. Favarato, F. C. Gozzo, V. Rioli, F. R. Carreno, M. N. Eberlin, E. S. Ferro, J. H. Krege, and J. E. Krieger
ACE gene titration in mice uncovers a new mechanism for ACE on the control of body weight
Physiol Genomics,
January 20, 2005;
20(2):
173 - 182.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-S. Parent, M.-C. Lebrethon, A. Gerard, and J.-P. Bourguignon
Factors Accounting for Perinatal Occurrence of Pulsatile Gonadotropin-Releasing Hormone Secretion In Vitro in Rats
Biol Reprod,
January 1, 2005;
72(1):
143 - 149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Matagne, G. Rasier, M.-C. Lebrethon, A. Gerard, and J.-P. Bourguignon
Estradiol Stimulation of Pulsatile Gonadotropin-Releasing Hormone Secretion in Vitro: Correlation with Perinatal Exposure to Sex Steroids and Induction of Sexual Precocity in Vivo
Endocrinology,
June 1, 2004;
145(6):
2775 - 2783.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. C. Harris and J. E. Levine
Pubertal Acceleration of Pulsatile Gonadotropin-Releasing Hormone Release in Male Rats as Revealed by Microdialysis
Endocrinology,
January 1, 2003;
144(1):
163 - 171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. N. Shrimpton, A. I. Smith, and R. A. Lew
Soluble Metalloendopeptidases and Neuroendocrine Signaling
Endocr. Rev.,
October 1, 2002;
23(5):
647 - 664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. Jiang, J. Z. Tsien, P. G. Schultz, and Y. Hu
The effects of aging on gene expression in the hypothalamus and cortex of mice
PNAS,
February 13, 2001;
98(4):
1930 - 1934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Rampon, C. H. Jiang, H. Dong, Y.-P. Tang, D. J. Lockhart, P. G. Schultz, J. Z. Tsien, and Y. Hu
Effects of environmental enrichment on gene expression in the brain
PNAS,
November 7, 2000;
97(23):
12880 - 12884.
[Abstract]
[Full Text]
[PDF]
|
 |
|