| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Developmental Neuroendocrinology Unit (M.C.L., E.V., A.G., G.P., J.P.B.), Division of Ambulatory Pediatrics and Adolescent Medicine, Department of Pediatrics, University of Liège, C.H.U. Sart Tilman, B-4000 Liège, Belgium; Eurogentec (M.L.), B-4000 Liège, Belgium; and Department of Pharmacology (S.W.), The Mount Sinai Medical Center, New York, New York 10029-6574
Address all correspondence and requests for reprints to: Jean-Pierre Bourguignon, M.D., Ph.D., Division of Pediatric and Adolescent Medicine, C.H.U. Sart Tilman, B-4000 Liège, Belgium. E-mail: Jean-Pierre.Bourguignon{at}chu.ulg.ac.be
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The physiological role of pituitary endopeptidases in limiting GnRH stimulation of the pituitary gonadotropes was supported by the increase in gonadotropin secretion seen after systemic administration of EP24.15 inhibitors in the rat (3, 4). A possible role for brain endopeptidases in the regulation of GnRH effects was suggested by the effect of intracerebroventricular (ICV) administration of EP24.15 inhibitors, which resulted in increased gonadotropin secretion (3) as well as increased recovery of ICV-administered GnRH (5). In ovariectomized estrogen-primed rats, progesterone administration caused a reduction in GnRH degrading activity in the median eminence, which was associated with an increase of the GnRH content (6). In the female monkey, pulsatile GnRH secretion in the stalk-median eminence area was increased by local immunoneutralization of EP24.15, whereas it was suppressed by recombinant EP24.15 (7). In the ovariectomized ewe, however, pulsatile LH secretion was not affected by ICV administration of PEP or EP24.15 inhibitors (8).
While the primary aim of endopeptidase degradation was thought to be the limitation of GnRH interaction at pituitary and hypothalamic GnRH receptors, we proposed an additional inhibitory autofeedback role. This was based on the possible inhibition by the GnRH[1–5] subproduct of the secretion of GnRH evoked through stimulation of the N-methyl-D-aspartate (NMDA) receptors (9). Because this autofeedback control could affect the frequency of GnRH pulsatility, it appeared relevant to study the role of hypothalamic PEP and EP24.15 in the early ontogeny of pulsatile GnRH secretion. We aimed at elucidation of the endopeptidase contribution in the developmental changes in the hypothalamic GnRH pulse generator leading to the onset of puberty.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Measurement of endopeptidase activity
Retrochiasmatic hypothalamic explants were dissected and
immediately homogenized in 10 times as much buffer (20 mM
TES, N-Tris(hydroxymethyl)methyl-2-aminoethanosulfonic
acid), pH 7.4), at 4 C, with a Politron homogenizer. After low speed
centrifugation to remove cellular debris, the supernatant was
centrifuged at 10,000 x g, 4 C for 20 min. The
supernatant was kept as a soluble fraction, and the pellet was washed
twice by resuspension in the homogenization buffer followed by
recentrifugation. The final pellet was resuspended in the
homogenization buffer and kept as a membrane fraction. Both fractions
were stored at -70 C. Aliquots of the fractions were assayed for
protein determination by a dye-binding method using a commercial kit
(Bio-Rad Laboratories, Inc., Hercules, CA). Synthetic
GnRH[1–10] or GnRH[1–9] (UCB, Brussels,
Belgium) was incubated with hypothalamic soluble or membrane fraction
(20 to 40 µg of protein) at 37 C in 250 µl of 200 mM
TES, pH 7.4. Twenty micrograms of peptide were incubated with the
soluble fraction for 30 min and 10 µg with the membrane fraction for
60 min. The reactions were terminated by heating, 100 C for 7 min.
After brief centrifugation, 200 µl were injected onto a microBondapak
C18 column (3.9 x 300 mm, Waters Corp., Milford,
MA). The peptides were eluted from the column by a linear gradient from
10–30% of solvent (0.08% TFA/CH3CN) at a flow rate of 1 ml/min.
Chromatography was performed with a Waters HPLC system and
monitored by UV detection at 214 nm. The elution peaks of GnRH and
degradation fragments were identified by comigration of synthetic
GnRH[1–10] and the GnRH[1–9] and
GnRH[1–5] subproducts and peak areas were calculated.
The GnRH[1–10] or GnRH[1–9] degrading
activity was estimated by disappearance of the peptides after
incubation. The presence of GnRH[1–5] after incubation
was regarded as generation of GnRH[1–5] because this
subproduct was relatively stable (16). In the used conditions, the
relationship between protein concentration and incubation time was
linear.
The specificity of the assays for PEP and EP24.15 activity was assessed using the soluble fraction of hypothalamic extracts prepared from 15-day-old rats. Incubation with 200 µM of bacitracin (Sigma, St. Louis, MO) a competitive PEP inhibitor (17) or 100 nM of Fmoc-Prolyl-Pyrrolidine-2-nitrile (Fmoc-Pro-PyrrCN), a recently proposed noncompetitive PEP inhibitor that is more specific and potent than bacitracin (18), resulted in a profound inhibition of GnRH[1–10] degradation (2–3% of controls), a complete suppression of GnRH[1–9] generation and a reduction of GnRH[1–5] generation (13–14% of controls). This indicated PEP inhibition and residual GnRH[1–5] generation presumably through direct EP24.15 degradation of GnRH[1–10]. Incubation with 10 µM of N-[1(R,S)carboxy-3-phenylpropyl]Ala-Ala-Tyr-p-aminobenzoate (CFP-A-A-Y-pAB), a competitive EP24.15 inhibitor (1) resulted in a slight reduction of GnRH[1–10] degradation (77% of controls), an increase of GnRH[1–9] generation (445% of controls), and a profound inhibition of GnRH[1–5] (6% of controls).
Quantitation of PEP mRNAs
Total RNAs were extracted from retrochiasmatic explants
according to the RNAzol method (19). The extracted RNAs were reverse
transcribed with Moloney Murine leukaemia virus reverse transcriptase
(Expand, Roche Molecular Biochemicals, Mannheim,
Germany) using oligo (dT) 12–18 (Eurogentec, Liège,
Belgium). The cDNAs obtained were then amplified by PCR (32 cycles at
94 C for 90 sec, 55 C for 90 sec, 72 C for 90 sec) using the
5'-oligonucleotide CATTCTGCAGCTTCACGACC (7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26) and the
3'-oligonucleotide GCGCAAGAAGGACT-CTAAGA (91–112) from rat prolyl
endopeptidase (accession number H34452) (20). The predicted size of
this PCR product was 106 bp. As positive and semiquantitative controls,
the 5'-oligonucleotide GTGACTTCACACGCCATAATG (236–256) and the
3'-oligonucleotide CCTTCAAGTCTAGCAGGATTG (677–697) from rat
cyclophilin were used (accession number M19533). The predicted size of
this PCR product was 453 bp. The PCR products were studied through
electrophoresis on 1.5% agarose gel in TAE buffer, stained with
ethidium bromide, and photographed under UV illumination. An electronic
densitometric scanning of PCR product signals was directly processed
from agarose gel under a UV transilluminator with a black and white
highly sensitive camera.
Study protocols
Using hypothalamic explants obtained at 1-day intervals between
fetal day 20–21 and postnatal day 25 and at 5-day intervals between
days 25 and 50, the frequency and the amplitude of pulsatile GnRH
secretion was studied. For consistency with our previous studies
(9, 10, 11, 12), the present one was performed using 20 µM of
bacitracin.
Using the soluble and membrane fractions of hypothalamic explants prepared at 5-day intervals between fetal days 20–21 and postnatal day 50, the activity of PEP and EP24.15 was measured using reversed phase HPLC through the degradation of synthetic GnRH[1–10] and GnRH[1–9] and the generation of GnRH[1–5]. Using the total RNAs extracted from the retrochiasmatic hypothalamus on fetal days 20–21 and postnatal days 5, 10, 15, 25, and 50, the PEP and cyclophilin gene expression was studied through RT-PCR.
Using explants obtained on fetal days 20–21 and on postnatal day 5, 7.5-min stimulation using 50 mM of NMDA (Sigma, St. Louis, MO) was performed repeatedly at regular intervals of 37.5 min (five fractions) to mimic the frequency of GnRH pulsatility observed from 25 days of age onwards. These experiments were performed in the absence of bacitracin or using different concentrations of the inhibitor (20 µM, 2 mM and 20 mM). The NMDA-evoked release of GnRH was calculated as the difference between GnRH secretion in the fractions collected immediately before and during NMDA stimulation. When no bacitracin was used in the incubation medium, 10 µl of 1 mM bacitracin were added to the collected medium to prevent further degradation of GnRH during the RIA procedure.
Using explants obtained on fetal days 20–21 and postnatal day 5, 15, 25, and 50, pulsatile GnRH secretion in vitro was studied in the absence of bacitracin and using 20 µM or 2 mM of the inhibitor. On fetal days 20–21 and postnatal days 5 and 15, similar experiments were performed using Fmoc-Pro-PyrrCN (18).
Statistical analysis
The occurrence of significant pulses of GnRH secretion was
determined using the Pulsar program (21, 22) as described previously
(23). The individual interpulse interval and pulse amplitude as well as
the mean ± SD were calculated. The significance of
differences in GnRH pulse amplitude and frequency and NMDA-evoked GnRH
release was calculated by ANOVA with correction for repeated
measurement and Scheffé’s F test. The significance of
age-differences in GnRH degrading activity and PEP mRNAs was analyzed
using one-way ANOVA. The level of significance was P <
0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
180 min, which was the minimal
study period (Fig. 1
). From the day of
birth onwards, pulsatility was observed with a mean interpulse interval
of 86 ± 8 min. A progressive reduction in interpulse interval was
seen between birth and 10 days of age (72 ± 4 min). A 2-fold
greater reduction occurred between 10 and 20 days (47 ± 3 min).
An adult pattern of frequency was attained by 25 days of age (interval:
39 ± 4 min) when the first evidence of spermatogenetic maturation
could be obtained (23). The mean GnRH pulse amplitude was around 6
pg/7.5-min fraction in the early neonatal period and increased
progressively but not significantly with age to reach an average of 8
pg/7.5 min after 25 days.
|
). The GnRH[1–10]
degrading activity (PEP and EP24.15) was present in the fetal
hypothalamus, increased to maximal levels at postnatal days 5–10, and
decreased subsequently during prepubertal and pubertal periods. In
contrast, degradation of GnRH[1–9] and generation of
GnRH[1–5] from GnRH[1–9] did not show any
significant change between day 10 and day 50 (Fig. 2), indicating that
EP24.15 activity did not change throughout development. Using the
membrane fraction of retrochiasmatic hypothalamic extracts (Table 1), the endopeptidase activity was lower
than in soluble fraction and showed similar developmental variations.
GnRH[1–10] degradation and GnRH[1–5]
generation were low in the fetal hypothalamus, reached maximal levels
at days 5–10, and decreased subsequently during postnatal life. Taken
together, these data suggested that the developmental changes in
GnRH[1–10] degradation involved changes in PEP
activity.
|
|
). Significantly lower levels
(P < 0.05) were observed using hypothalamic extracts
from 25- and 50-day-old rats.
|
). Bacitracin 20 µM and 2
mM caused a dose-related increase in the initial secretory
response of GnRH and prevented partially (20 µM) or
totally (2 mM) the inhibition of the NMDA-evoked release of
GnRH that occurred during repeated stimulation (Fig. 4). Using explants
of 5-day-old rats, the GnRH secretory response to repeated NMDA
stimulation was reduced only at the fifth and sixth stimulatory episode
when 20 µM or 2 mM of bacitracin was used. A
20 mM concentration of bacitracin was necessary to prevent
the inhibition of the NMDA-evoked release of GnRH at 5 days.
|
). Similar observations were made using
bacitracin, a competitive antagonist of PEP. At 5 and 15 days, 2
mM of bacitracin were required to obtain a significant
reduction of the interpulse interval, whereas a 20 µM
concentration was already effective in causing a reduction at 25 and 50
days.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this paper, we show that, in the explanted male rat hypothalamus, the GnRH pulse generator is silent before birth though GnRH is already releasable by episodic stimulation using NMDA. These findings suggest that GnRH synthesis and storage as well as NMDA receptor synthesis are not the ultimate factors that control the expression of the GnRH pulse generator. We showed previously that the GnRH[1–5] subproduct of GnRH degradation was involved in an inhibitory autofeedback effect on pulsatility (9), and here we have obtained evidence that GnRH degrading activity is present in the fetal hypothalamus. PEP inhibition results in facilitation of GnRH secretion in response to exogenous NMDA challenges that can mimic an adult pattern of GnRH secretion from fetal explants. The inhibitors, however, do not cause pulsatility to occur. Thus, endopeptidase degradation of GnRH is effective in the fetal hypothalamus but does not represent the key factor that restrains the pulse generator. Increased activity of other inhibitory mechanisms such as GABAergic inputs or insufficient activity of stimulatory mechanisms such as glutamatergic inputs deserve further studies to elucidate why the GnRH pulse generator is silent in the fetal explant. Quite remarkably, pulsatile GnRH secretion in vitro can be observed from the first postnatal day onwards. This may suggest that some inhibitory factors are related to the intrauterine conditions. Recent studies have shown that GnRH existed in the hypothalamus in a particular [Hyp9] GnRH form with hydroxyproline instead of proline as the ninth residue (28). This form accounts for the majority of hypothalamic GnRH immunoreactivity in the fetus and decreases progressively throughout postnatal life. Because [Hyp9] GnRH is less sensitive than GnRH[1–10] to PEP activity, this peptide could account for less inhibitory autofeedback, thus adding to our conclusion that such a mechanism does not explain absent pulsatility in the fetus. An alternative hypothesis was that [Hyp9] GnRH was secreted but less detected than GnRH[1–10] in the GnRH RIA. It is, however, unlikely that the secretion of [Hyp9] GnRH, which is almost not detected in our RIA, could account for undetected pulsatility because GnRH secretion would then be undetectable in response to secretagogues such as NMDA. This is in contrast to our observation that GnRH pulsatility evoked by NMDA is well observable. Also, the sudden occurrence of pulsatility after birth is not consistent with the progressive postnatal changes in proportion of [Hyp9] GnRH (30–40%) found in the immunoreactive material released by hypothalamic explants between birth and 6 weeks of age (29).
The detailed study of the ontogeny of pulsatile GnRH secretion from the explanted male rat hypothalamus shows a remarkably progressive increase in pulse frequency during the 2 weeks preceding the onset of puberty. If relevant to in vivo physiology, this finding emphasizes that the neuroendocrine changes leading to onset of puberty take place relatively early in life before the age of 3 weeks, whereas no subsequent changes are seen throughout puberty. Unfortunately, due to the size of the rat and the limited sensitivity of LH assay, pulsatile LH could not be studied in vivo so far, and no correlation between in vitro and in vivo data were possible. Our data indicate that the reduction in potency of GnRH inhibitory autofeedback, possibly resulting from a reduced PEP activity with age, can contribute to the acceleration of the GnRH pulse generator that occurs before the onset of puberty, in agreement with our earlier findings (30). In the presence of PEP inhibitors, a developmental reduction of the GnRH interpulse interval is still observed, indicating that other factors such as the GABA-receptor mediated inhibition play an important role as well (31). It is unclear whether the inhibitory autofeedback effects of GnRH are mediated only through the interaction of GnRH[1–5] at NMDA receptors, as we suggested, or whether GnRH receptors are involved as well. Reduced degradation of GnRH could account for increased activity of the GnRH pulse generator through a stimulatory effect of GnRH at its own receptors as long as these receptors mediate a positive autofeedback. Indeed, central microinjection of GnRH in the arcuate nucleus-median eminence area of the female rat causes premature electrophysiological manifestation of the pulse generator (32) and the preovulatory LH surge is delayed by central microinjection of a GnRH antagonist that does not generate any GnRH[1–5] (33). Using hypothalamic explants from male rats incubated with GnRH antagonists or GnRH receptor antisense oligodeoxynucleotides, we also obtained evidence of a positive autofeedback of GnRH (34). Importantly, such observations may not apply to other species. In the ram or the ewe, GnRH antagonists cause an acceleration of LH or GnRH pulsatility, thus pointing to an inhibition mediated via the GnRH receptors (35, 36, 37). GnRH antagonists do not appear to affect the electrophysiological correlates of the pulse generator in the monkey (38) nor the frequency of pulsatile LH secretion in man (39). Based on these studies, the mechanism of GnRH positive autofeedback warrants further delineation and integration with the inhibitory autofeedback mediated through GnRH[1–5].
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Post-doctoral fellow supported by a grant from the
Bristol-Myers Squibb MeadJohnson Foundation. Present
address: Department of Pediatrics, Tenri Hospital, 200 Mishima-cho,
Tenri, Nara 632, Japan.
Received January 27, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-subunit pulses after
LH-releasing hormone antagonist administration in normal men. J
Clin Endocrinol Metab 70:1472–1478[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  A.-S. Parent, G. Rasier, V. Matagne, A. Lomniczi, M.-C. Lebrethon, A. Gerard, S. R. Ojeda, and J.-P. Bourguignon Oxytocin Facilitates Female Sexual Maturation through a Glia-to-Neuron Signaling Pathway Endocrinology, March 1, 2008; 149(3): 1358 - 1365. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Rasier, A.-S. Parent, A. Gerard, M.-C. Lebrethon, and J.-P. Bourguignon Early Maturation of Gonadotropin-Releasing Hormone Secretion and Sexual Precocity after Exposure of Infant Female Rats to Estradiol or Dichlorodiphenyltrichloroethane Biol Reprod, October 1, 2007; 77(4): 734 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Zemkova, A. Balik, Y. Jiang, K. Kretschmannova, and S. S. Stojilkovic Roles of Purinergic P2X Receptors as Pacemaking Channels and Modulators of Calcium-Mobilizing Pathway in Pituitary Gonadotrophs Mol. Endocrinol., June 1, 2006; 20(6): 1423 - 1436. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. Wu, M. J. Glucksman, J. L. Roberts, and S. K. Mani Facilitation of Lordosis in Rats by a Metabolite of Luteinizing Hormone Releasing Hormone Endocrinology, May 1, 2006; 147(5): 2544 - 2549. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Matagne, M.-C. Lebrethon, A. Gerard, and J.-P. Bourguignon Kainate/Estrogen Receptor Involvement in Rapid Estradiol Effects in Vitro and Intracellular Signaling Pathways Endocrinology, May 1, 2005; 146(5): 2313 - 2323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. Heimann, M. H. Favarato, F. C. Gozzo, V. Rioli, F. R. Carreno, M. N. Eberlin, E. S. Ferro, J. H. Krege, and J. E. Krieger ACE gene titration in mice uncovers a new mechanism for ACE on the control of body weight Physiol Genomics, January 20, 2005; 20(2): 173 - 182. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-S. Parent, M.-C. Lebrethon, A. Gerard, and J.-P. Bourguignon Factors Accounting for Perinatal Occurrence of Pulsatile Gonadotropin-Releasing Hormone Secretion In Vitro in Rats Biol Reprod, January 1, 2005; 72(1): 143 - 149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Matagne, G. Rasier, M.-C. Lebrethon, A. Gerard, and J.-P. Bourguignon Estradiol Stimulation of Pulsatile Gonadotropin-Releasing Hormone Secretion in Vitro: Correlation with Perinatal Exposure to Sex Steroids and Induction of Sexual Precocity in Vivo Endocrinology, June 1, 2004; 145(6): 2775 - 2783. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. MATAGNE, M.-C. LEBRETHON, A. GERARD, and J.-P. BOURGUIGNON In Vitro Paradigms for the Study of GnRH Neuron Function and Estrogen Effects Ann. N.Y. Acad. Sci., December 1, 2003; 1007(1): 129 - 142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. C. Harris and J. E. Levine Pubertal Acceleration of Pulsatile Gonadotropin-Releasing Hormone Release in Male Rats as Revealed by Microdialysis Endocrinology, January 1, 2003; 144(1): 163 - 171. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. N. Shrimpton, A. I. Smith, and R. A. Lew Soluble Metalloendopeptidases and Neuroendocrine Signaling Endocr. Rev., October 1, 2002; 23(5): 647 - 664. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. H. Jiang, J. Z. Tsien, P. G. Schultz, and Y. Hu The effects of aging on gene expression in the hypothalamus and cortex of mice PNAS, February 13, 2001; 98(4): 1930 - 1934. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Rampon, C. H. Jiang, H. Dong, Y.-P. Tang, D. J. Lockhart, P. G. Schultz, J. Z. Tsien, and Y. Hu Effects of environmental enrichment on gene expression in the brain PNAS, November 7, 2000; 97(23): 12880 - 12884. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
