| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Section on Neuroendocrinology, Laboratory of Developmental Neurobiology (Y.G., S.L.C., M.A.A.N, D.C.K), and Laboratory of Molecular Genetics (R.T., A.C.), National Institute of Child Health and Human Development, National Institutes of Health, Department of Physiology, Uniform Services University of Health Sciences (M.A.A.N.), Bethesda, Maryland 20892
Address all correspondence and requests for reprints to: Dr. David C. Klein, Section on Neuroendocrinology, Laboratory of Developmental Neurobiology, National Institute of Child Health and Human Development, National Institutes of Health 49/5A38, 49 Convent Drive, Bethesda, Maryland 20892-4480. E-mail: klein{at}helix.nih.gov
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
Melatonin is produced during the night at two major sites. One is the pineal gland, the source of circulating melatonin (1, 3). Circulating melatonin plays an endocrine role in seasonal and circadian physiology. The second site of melatonin synthesis is retinal photoreceptor cells, where melatonin is thought to play a paracrine role in adaptation to light and darkness.
Melatonin is derived from tryptophan by the action of four enzymes: tryptophan hydroxylase, aromatic amino acid decarboxylase, serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase, AANAT), and hydroxyindole-O-methyltransferase. AANAT is of special interest because large daily changes in the activity of this enzyme control the rhythm in circulating levels of melatonin (4). Recent studies have indicated that two AANAT genes exist in pike and trout, described as AANAT-1 and AANAT-2 (5); AANAT-1 has been previously described in other classes of vertebrates (4).
The daily rhythm in AANAT activity is controlled by external light signals and in most cases by an internal circadian clock. The organization of melatonin rhythm generating systems varies among vertebrates (4, 6). In mammals, the endogenous clock is located in the suprachiasmatic nucleus (SCN). SCN neurons exhibit circadian rhythms in function (4); signals from the SCN course to the pineal gland via a multisynaptic pathway that passes through central and peripheral structures. SCN stimulation of the pineal gland increases AANAT activity and melatonin production (4). Light acts via retinal photoreceptors and a retinal hypothalamic projection to entrain the clock and to control stimulation of the pineal gland.
A somewhat different system functions in lower vertebrates, in which the pineal gland contains all elements required for photic entrainment and circadian rhythm generation: it is photoreceptive and, in most cases, contains an endogenous circadian clock (2). For example, in pike and zebrafish, melatonin production in the adult pineal gland is controlled by a pineal circadian clock and influenced by light acting on pineal photoreceptors (5, 6, 7, 8, 9). As a consequence, photic entrainment and circadian rhythmicity can be observed when the tissue is placed in culture. Similarly, night time AANAT messenger RNA (mRNA) levels are higher than day time levels in cultured adult zebrafish pineal glands, and these differences persist in constant light conditions, indicating that AANAT mRNA levels are controlled by a pineal circadian clock (9).
It has become clear that the zebrafish is emerging as an excellent experimental model for the genetic analysis of development. In the study presented here, we determined whether zebrafish AANAT (zfAANAT) mRNA might be used as a marker to monitor early development of pineal cells and circadian mechanisms and to identify mutations in which these are altered.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
FIX-II (Stratagene, La Jolla, CA) was
screened at moderate stringency with [32P]-labeled
(Megaprime labeling kit, Amersham Pharmacia Biotech,
Arlington Heights, IL) open reading frames (ORF) of pike AANAT-2 cDNAs
as a probe (5). Hybridizations were performed at 60 C in QuickHyb
(Stratagene) and final washes in 0.2 x SSC, 0.1%
SDS at 60 C for 30 min. Three independent clones (6, 7B, and 13) were
identified using the pike AANAT-2 ORF probe and purified. They appeared
to be similar based on restriction enzyme mapping. A 5-kb
NotI/EcoRI fragment and a 4-kb
EcoRI/HindIII fragment were subcloned from clone
6 into pBluescript II (Stratagene) and partially sequenced
using an ABI automated sequencer. These two fragments cover the ORF of
a putative zfAANAT gene. Independent attempts to isolate additional genomic AANAT clones using the pike AANAT-1 ORF (5) as a probe resulted in identifying the same three clones (6, 7B, and 13) described above; additional clones were not detected.
PCR amplification of AANAT cDNA. mRNA was isolated from adult retina and pineal glands (kindly provided by Dr. Gregory M. Cahill, University of Houston, Houston, TX) using magnetic beads (Dynal, Oslo, Norway) and was used as a template to synthesize first strand cDNA on the beads as previously described (10), except that Tth DNA polymerase (Epicentre, Madison, WI) was used instead of Retrotherm reverse transcriptase. 3' RACE was performed on first strand cDNA using oligo (dT) and nested primers zf6f4 (aacacatcacaccactgagacg) and zf6f5 (tccaccaacagacagactgttg), which correspond to genomic sequences upstream of the putative ATG translation start site. Amplification reactions were performed in 50 µl containing 500 nM primers, 200 µM dNTPs and 1 U Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN). Reaction conditions were 95 C for 2 min followed by 30 cycles of denaturation at 94 C for 30 sec, annealing at 55 C for 1 min, and extension at 72 C for 1 min (PTC-100, MJ Research, Inc., Watertown, MA). The 3'RACE product was cloned into pGEM-T Easy (Promega Corp., Madison, WI) and sequenced using an ABI automated sequencer. This clone, contains 90 bp of 5' UTR, the entire coding region and 3' UTR of zfAANAT cDNA.
The cloned 3'RACE product (zfNATc) was cut with NsiI, religated, and transformed. The resulting clone (zfNATc-Nsi) lacks the polyA region and 60 bp of the 3' UTR and has the SP6 RNA polymerase promoter flanking the zfAANAT cDNA sequence without any intervening plasmid sequences. zfNATc-Nsi was used to generate probes for in situ hybridization (ISH) analysis.
Preparation and analysis of recombinant AANAT
Preparation of GST-zfAANAT. The full ORF of zfAANAT
cDNA was subcloned into pGEX-4T-3, a prokaryotic expression vector
(Pharmacia & Upjohn, Piscataway, NJ) that generates
glutathione S-transferase (GST) fusion proteins. The
resulting GST-zfAANAT construct ZF5X was used to transform
BL21(DE3)pLysS cells, which were induced to express protein by
treatment with 0.2 mM IPTG for 14 h at 22 C. The cell
pellet was collected by centrifugation and sonicated in 2 x PBS
(6.7 mM) containing 10 mM dithiothreitol (DTT)
and a protease inhibitor cocktail (Complete, Roche Molecular Biochemicals). The sonicate was centrifuged (14,000 x
g, 10 min, 4 C) and the clear supernatant was mixed with
glutathione Sepharose beads (Pharmacia & Upjohn). The
beads were washed with 2 x PBS containing 10 mM DTT,
and Buffer A (100 mM sodium citrate in 50 mM
Tris pH 8.0 containing 10 mM DTT and 10% vol/vol
glycerol). The GST-zfAANAT fusion protein was eluted with Buffer A
containing 10 mM glutathione and concentrated (Centriprep
30, Amicon, Beverly, MA) to 30 µg/ml. Aliquots were diluted in assay
buffer (0.1 M phosphate buffer, pH 6.8, 2 mM
EDTA) containing 2 mg/ml BSA and assayed.
Analysis of zfAANAT activity. The assays used for substrate specificity and temperature/activity relationships studies of recombinant GST-zfAANAT protein are described below.
Substrate specificity.
Substrate specificity was studied
using an automated adaptation of a published colorimetric assay (11)
(and Verghese, G., D. C. Klein, and M. A. A. Namboodiri,
unpublished results). Reactions were performed in 100 µl by combining
25 µl of diluted enzyme (1/200) with 75 µl assay buffer containing
BSA (1 mg/ml), acetyl-CoA (final concentration 1 mM) and
varying concentrations of arylalkylamine substrates and incubating at
30 C for 15 min. The reaction was stopped by the addition of 150 µl
of sodium phosphate (0.1 M, pH 7.5) containing 1
mM 5,5'-dithiobis (2-nitrobenzoic acid) (DTNB), 10
mM EDTA and 3 M guanidine hydrochloride.
Colored product formed by the reaction of the -SH group of CoA with the
thiol reagent DTNB was measured after 5 min of incubation at room
temperature by measuring absorbency at 405 nm. The assay was automated
using a Dynex Multiple Reagent Dispenser (MRD)/incubator/plate reader
system in which 500 samples could be analyzed in 1 h. Assays were
done in duplicate and each analysis was repeated. The Km
and Vmax values were calculated using a nonlinear curve fit
program.
Temperature/activity relationships.
Temperature/activity
relationship were determined using a radiochemical assay (5). Diluted
recombinant enzyme (1/4,000) was incubated with 10 mM
tryptamine and 0.5 mM [3H]-acetyl-CoA [4
Ci/mol] in 40 µl assay buffer for 15 min at various temperatures. To
measure the formation of [3H]-acetylated product,
N-[3H]-acetyltryptamine was extracted into
chloroform; the chloroform was evaporated under vacuum and the residue
was redissolved in scintillation fluid for counting. Assays were done
in triplicate. The entire experiment was repeated and similar results
were obtained.
|
Embryo and larval culture |
|---|
|
TopAbstractIntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
In the studies designed to determine whether AANAT mRNA levels cycle in larvae and whether these cycles are driven by a circadian clock, 2- to 5-day-old embryos/larvae were kept under LD cycles or transferred, during the dark phase, to constant darkness (DD). Samples (n > 10) were collected throughout the 24 h cycle [Zeitgeber time (ZT) 3.5, 7, 10.5, 16.5, 19, and 21.5 and again at ZT 3.5 and 7] and zfAANAT mRNA was detected by whole mount ISH as described below.
|
In situ hybridization |
|---|
|
TopAbstractIntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
Tissue sections. Adult zebrafish were fixed in 4% paraformaldehyde, embedded in paraffin, and transverse sections (10 µm) were taken from the head at the level of the brain, including the pineal gland, and eyes and from the body at the level of the gonads and kidney. In situ hybridization was performed using established methods (Molecular Histology, Inc., Gaithersburg, MD)
Whole mount embryos/larvae. Zebrafish embryos and larvae were fixed in 4% paraformaldehyde for 12 h at room temperature and stored in 100% methanol at -20 C until used for whole mount ISH. Whole mount ISH was performed with DIG-labeled probe at a concentration of 1 ng/µl using a published procedure (17). Highest sensitivity was obtained using a 24-h color development reaction. Maximal day/night differences were detected with an 8-h color development reaction.
Image analysis. Embryos/larvae were first observed using an MZ6 dissecting stereoscope (Leica Corp., Heerburgg, Switzerland). Samples were then placed in 80% glycerol and the pineal glands were photographed from a dorsal view under Nomarski optics at x400 magnification using a compound stereoscope (Axiophot, Carl Zeiss, Jena, Germany). Photographic images were digitized and the area of the signal and the mean optical density (OD) were measured using NIHimage software. Total OD was calculated by multiplying the area of the signal by the mean OD.
Statistics. Differences in signal intensities, between time points throughout the 24-h cycle and between wild-type (wt) and mib-/- were evaluated using ANOVA. Results are expressed as mean total optical density ± SE.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
)
that is 81 and 83% identical to pike and trout AANAT-2s, respectively;
it is less similar (57–66%) to AANAT-1s of fish and other
vertebrates. Phylogenetic analysis based on distances and parsimony
places the cloned zfAANAT with pike and trout AANAT-2 as a separate
group (Fig. 1B). The highest degree of conservation among all AANATs is
found in domains C/c-1, D/c-1, and D/c-2 (Fig. 1A) in the
arylalkylamine binding domain (18). These regions are highly conserved
among all AANATs and minor differences within these regions appear to
differentiate the AANAT-1 and AANAT-2 subfamilies. Other conserved
regions among AANATs include the putative acetyl coenzyme A binding
site within motifs A and B (Fig. 1A), a histidine rich (H114,122,124,
129 and 131) putative catalytic domain, two protein kinase A
phosphorylation sites (R30-T34, R204-S207) and an N terminus lysine
residue (K13) thought to be involved in regulation (4, 6).
|
0.03 nmol/h/ng
enzyme; Km 0.2 mM) and
ß-phenylethylamine (Vmax 0.01 nmol/h/ng enzyme;
Km 0.38 mM) (Fig. 1C
). Acetylation of
the arylamines p-aminobenzoic acid (PABA) and phenetidine was not
detectable (data not shown). This pattern of strong preference for
indoleethylamines over phenylethylamines is exhibited by pike
AANAT-2 but not by AANAT-1s from pike or sheep (5, 19).
Temperature/activity analysis indicated that GST-zfAANAT was active
over a broad range of temperatures from 0 C to 42 C with a peak at
30 C; 25% of maximal activity was detected at 0 C (Fig. 1D). This
broad temperature-activity relationship is similar to that of pike
AANAT-2. Based on the above observations, it appears that clone zfNATc represents the zebrafish AANAT-2 cDNA (zfAANAT-2). Accordingly, mRNA detected with the zfNATc probe will be referred to as zfAANAT-2 mRNA.
zfAANAT-2 mRNA expression in pineal and retina of adult
zebrafish
Analysis of adult zebrafish tissue sections using the
riboprobe antisense zfAANAT-2 probe indicated that zfAANAT-2 mRNA is
expressed in the pineal gland at both the end vesicle (Fig. 2A) and the stalk (Fig. 2B); it is also
expressed in the retina, in the outer nuclear layer (Fig. 2, C and D).
Sense probes did not generate signals (Fig. 2D; data not shown),
indicating that the signal generated by the antisense probe was
specific. zfAANAT-2 mRNA was not detected in other parts of the brain
or viscera. This pattern of expression is generally consistent with
previous observations made with zebrafish (9) and other vertebrates
(4), indicating AANAT genes are expressed strongly in either the pineal
gland, retina or both, but very weakly or not at all in other
tissues.
|
, A and B). From 24 to 45 h
post fertilization (hpf), the level of expression increases and remains
restricted to the pineal complex (Fig. 3C). During the third day of
development the area expressing zfAANAT-2 mRNA can be divided into an
anterior domain and a posterior domain. The initiation of this process
and formation of two domains in roof of the diencephalon can be
visualized from a lateral view (Fig. 3D). During the fourth day of
development, two adjoining, but distinct, zfAANAT-2 mRNA-positive cell
clusters are observed (Fig. 3E). As discussed in greater detail in
the Discussion, these appear to represent the primordia of
the pineal and parapineal organs (20, 21, 22, 23).
|
), which contains the first photoreceptors (24, 25, 26). At 5 day
pf (dpf), the signal is present throughout the retina (data not shown),
as are morphologically distinct photoreceptors (24, 25, 26).
Alteration of pineal zfAANAT-2 mRNA expression in developmental
mutants mib and flh
We explored the utility of whole mount ISH method as a screening
procedure to detect genetically determined differences in expression of
the zfAANAT-2 gene. Two well-studied lethal developmental mutants,
mib and flh, which display pineal defects among
other abnormalities, were examined to determine if these defects were
associated with alterations in expression of zfAANAT-2. The zfAANAT-2
mRNA signal, as judged by measuring the area and mean optical density,
is 2.5-fold higher in mib-/- (n = 5) than
in their sibling wild-type (wt) embryos (n = 5) at 24 hpf,
indicating that the number of zfAANAT-2 mRNA-expressing cells is
increased in mib-/- (Fig. 4, A and B). An increased AANAT-2 mRNA
signal in mib-/- embryos was visually verified
in a subsequent experiment.
|
, C and D),
consistent with the observation that pineal photoreceptors and
projecting neurons are dramatically reduced in
flh-/- embryos (16).
Circadian rhythms in zfAANAT-2 mRNA levels
zfAANAT-2 mRNA levels in 2- to 5-day-old zebrafish larvae were
measured throughout the day to determine whether a 24-h rhythm was
present. To do this, a semiquantitative screening assay was developed
which maximizes day/night differences in mRNA levels. This was done by
altering one step in the color development method: the alkaline
phosphatase reaction was shortened to 8 h. With this screening
assay, a zfAANAT-2 mRNA signal was consistently detected in the pineal
gland of all larvae collected at night but not those collected
during the day (Figs. 5, A–C, and
6, A and B); batch-to-batch variation in
night-time levels is apparent, but a dramatic night/day difference is
consistently observed. The finding of this difference indicates that
the rhythm in zfAANAT-2 mRNA levels is already established in 2-day-old
zebrafish.
|
, A–C, and 6, C and D); it should be noted that
the increase in zfAANAT-2 mRNA appeared to be delayed in DD, suggesting
that darkness during the day altered clock function. The existence of a
rhythm in DD indicates that a circadian clock controls expression of
pineal zfAANAT-2 mRNA at the larval stage, as is known to be the case
in the adult (9). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
Characterization of zfAANAT-2
The zebrafish AANAT cDNA that was cloned is a representative of
the AANAT-2 gene subfamily, as indicated by phylogenetic analysis,
substrate preference and temperature kinetics. In pike and trout, which
have two AANAT genes, the AANAT-2 gene is expressed only in the pineal
gland and is nearly undetectable in the retina, whereas the AANAT-1
gene is expressed only in the retina but not in the pineal gland (5, 9). Our finding that zfAANAT-2 mRNA is expressed in both the retina and
pineal gland and our inability to date to obtain evidence that a
zfAANAT-1 gene exists in zebrafish suggests that the AANAT-1 gene may
have been lost in this species. The selective pressures determining
such differences among teleosts may include environmental factors, such
as lighting or water temperature. It should be emphasized, however,
that we recognize the possibility that AANAT-1 or another AANAT gene
exists in zebrafish (27, 28), but that to date it has not been detected
(see Note Added in Proof).
zfAANAT-2 mRNA is useful marker of pineal and retinal photoreceptor
development
The only vertebrate tissues known to synthesize significant
quantities of melatonin and have high levels of AANAT mRNA are the
pineal gland and retina. Accordingly, the expression of zfAANAT-2 mRNA
at high levels only in these tissues is consistent with this, making it
an excellent marker for development of photoreceptor cells in both
tissues.
The expression pattern of zfAANAT-2 mRNA in the developing retina is essentially identical to that described for the differentiation of photoreceptors, with the initial expression limited to a patch in a ventral region, followed by expression gradually spreading throughout the retina (24, 25, 26). This spatial-temporal difference in development within the retina provides a potentially useful experimental system to visualize cells at successive stages of development along a gradient that starts at the ventral patch and to determine the schedule of expression of molecules which control zfAANAT-2 gene expression.
Expression of zfAANAT-2 mRNA in the embryonic pineal is restricted to the midline where photoreceptors are located (16). The appearance of AANAT-2 mRNA in the pineal gland before that in the retina is consistent with the observation that pineal photoreceptors develop earlier than retinal photoreceptors in zebrafish (16, 24, 25, 26) and other teleosts (29, 30). The very early pineal expression of zfAANAT-2 mRNA at 22 hpf raises the possibility that AANAT-2 has a role during embryogenesis, perhaps through production of melatonin (31, 32).
zfAANAT-2 mRNA expression in the developing pineal complex appears to occur in two sites corresponding to the primordia of the pineal and parapineal organs. The pineal complex develops as two outgrowths from the diencephalic roof (20, 21, 22, 23). In teleosts, the anterior outgrowth forms the parapineal organ, which later regresses and is considered rudimentary (in amphibians and reptiles it continues to develop and grows out through the skull to form the parietal eye). The posterior evagination continues to develop into the pineal gland. This study is the first to demonstrate AANAT gene expression in teleost parapineal and provides an additional tool to investigate the fate of the parapineal organ during development.
Our studies have indicated that monitoring zfAANAT-2 mRNA expression will be useful in identifying mutations, because it was possible to detect differences in zfAANAT-2 mRNA expression in mib-/- and flh-/-. mib is a gene that is involved in early neurogenesis and is thought to be a component of the Notch-Delta lateral specification system (13). In mib-/- there is an increased number of early differentiating neurons including Islet-1 (a marker for primary neurons) immunoreactive cells in the developing pineal gland (13). Because pineal photoreceptor cells are derived from Islet-1-positive cells (16), our observation of increased numbers of zfAANAT-2 mRNA-positive cells in mib-/- embryos is consistent with the mib-/- phenotype and indicates that mib is involved in pineal development.
The homeobox gene flh was originally described as an essential gene for notochord development (14, 15). Massai and co-workers have shown that flh is expressed in pineal precursor cells and that the formation and differentiation of pineal neurons is severely disrupted in flh mutants (16). Our finding that zfAANAT-2 mRNA is undetectable in flh-/- embryos corroborates the conclusion that flh is required for pineal neuron formation and differentiation (16).
In summary, these studies indicate that zfAANAT-2 mRNA is an early and a very specific developmental marker for pineal photoreceptor neurons and could be used to screen for mutations that affect pineal development.
zfAANAT-2 mRNA as a marker for circadian clock regulation
The appearance of a rhythm in pineal zfAANAT-2 mRNA levels at day
2 is of special note because it is the earliest indication of a
functional circadian clock in this species and provides clear evidence
that circadian function does not require later developmental events.
This is of value in the analysis of the molecular basis of clock
development.
Rhythms in AANAT activity have been shown to be regulated at both transcriptional and posttranslational levels. However, the amplitude of AANAT mRNA rhythm is different from one species to another, reflecting differences in the mechanism of AANAT regulation. In the rat, AANAT mRNA levels exhibit a 150-fold rhythm (33), whereas in sheep and monkey AANAT mRNA levels increase only 1.5- and 3-fold and AANAT activity increases 7- and 30-fold, respectively (4, 15). In the chicken, a circadian clock located in the pineal gland drives a 10-fold increase in both AANAT mRNA and activity (34, 35).
Remarkable differences in AANAT regulation exist also among teleosts. A clock-controlled rhythm in AANAT-2 mRNA levels was demonstrated in the adult pike and zebrafish (5, 9). In contrast, melatonin production in the trout pineal is not regulated by a circadian clock and AANAT-2 mRNA levels are constant throughout the 24 h cycle (9). In the present study, we have demonstrated a circadian rhythm in pineal zfAANAT-2 mRNA levels starting 2 days after fertilization. This rhythm persists in constant darkness, indicating that a functional circadian clock operates and has a function at this stage of development. The development of a functional pineal clock before the development of functional retina is in contrast with higher vertebrates (36, 37) and reflects the autonomous nature of the teleost pineal gland.
The circadian rhythm in AANAT mRNA is the earliest known example of clock-controlled gene expression in the developing zebrafish. Thus, monitoring AANAT-2 mRNA expression provides an alternative to current approaches (38, 39) to screening for novel circadian clock mutants in zebrafish. The use of this technique along with the growing knowledge of the molecular basis of circadian clock function (40) and AANAT gene expression may provide new insight into the molecular basis of clock and clock-output mechanisms.
|
Note Added in Proof |
|---|
|
TopAbstractIntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received February 18, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsEmbryo and larval cultureIn situ hybridizationResultsDiscussionNote Added in ProofReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  B. N. Kennedy, Y. Alvarez, S. E. Brockerhoff, G. W. Stearns, B. Sapetto-Rebow, M. R. Taylor, and J. B. Hurley Identification of a Zebrafish Cone Photoreceptor-Specific Promoter and Genetic Rescue of Achromatopsia in the nof Mutant Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 522 - 529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Vuilleumier, L. Besseau, G. Boeuf, A. Piparelli, Y. Gothilf, W. G. Gehring, D. C. Klein, and J. Falcon Starting the Zebrafish Pineal Circadian Clock with a Single Photic Transition Endocrinology, May 1, 2006; 147(5): 2273 - 2279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L Appelbaum, D Vallone, A Anzulovich, L Ziv, M Tom, N S Foulkes, and Y Gothilf Zebrafish arylalkylamine-N-acetyltransferase genes - targets for regulation of the circadian clock. J. Mol. Endocrinol., April 1, 2006; 36(2): 337 - 347. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Ziv and Y. Gothilf Circadian time-keeping during early stages of development. PNAS, March 14, 2006; 103(11): 4146 - 4151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. T. Gamse, Y.-S. Kuan, M. Macurak, C. Brosamle, B. Thisse, C. Thisse, and M. E. Halpern Directional asymmetry of the zebrafish epithalamus guides dorsoventral innervation of the midbrain target Development, November 1, 2005; 132(21): 4869 - 4881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Appelbaum, A. Anzulovich, R. Baler, and Y. Gothilf Homeobox-Clock Protein Interaction in Zebrafish: A SHARED MECHANISM FOR PINEAL-SPECIFIC AND CIRCADIAN GENE EXPRESSION J. Biol. Chem., March 25, 2005; 280(12): 11544 - 11551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Li, S. Temple, Y. Gao, T. J. Haimberger, C. W. Hawryshyn, and L. Li Circadian rhythms of behavioral cone sensitivity and long wavelength opsin mRNA expression: a correlation study in zebrafish J. Exp. Biol., February 1, 2005; 208(3): 497 - 504. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Appelbaum, R. Toyama, I. B. Dawid, D. C. Klein, R. Baler, and Y. Gothilf Zebrafish Serotonin-N-Acetyltransferase-2 Gene Regulation: Pineal-Restrictive Downstream Module Contains a Functional E-Box and Three Photoreceptor Conserved Elements Mol. Endocrinol., May 1, 2004; 18(5): 1210 - 1221. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. T. Gamse, C. Thisse, B. Thisse, and M. E. Halpern The parapineal mediates left-right asymmetry in the zebrafish diencephalon Development, March 15, 2003; 130(6): 1059 - 1068. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Spitsbergen and M. L. Kent The State of the Art of the Zebrafish Model for Toxicology and Toxicologic Pathology Research--Advantages and Current Limitations Toxicol Pathol, January 1, 2003; 31(1_suppl): 62 - 87. [Abstract] [PDF]
|
|
|
|
|
|
G. Ferry, A. Loynel, N. Kucharczyk, S. Bertin, M. Rodriguez, P. Delagrange, J.-P. Galizzi, E. Jacoby, J.-P. Volland, D. Lesieur, et al. Substrate Specificity and Inhibition Studies of Human Serotonin N-Acetyltransferase J. Biol. Chem., March 17, 2000; 275(12): 8794 - 8805. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Liang, A Etheridge, L Hantsoo, A. Rubinstein, S. Nowak, J. Izpisua Belmonte, and M. Halpern Asymmetric nodal signaling in the zebrafish diencephalon positions the pineal organ Development, January 12, 2000; 127(23): 5101 - 5112. [Abstract] [PDF]
|
|
| |||||||||||||||||||||||||||||
