help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, X.
Right arrow Articles by Peter, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, X.
Right arrow Articles by Peter, R. E.
Endocrinology Vol. 140, No. 11 5211-5219
Copyright © 1999 by The Endocrine Society


ARTICLES

Molecular Cloning and Expression of Two Type One Somatostatin Receptors in Goldfish Brain1

Xinwei Lin, Jo Ann Janovick, Shaun Brothers, P. Michael Conn and Richard E. Peter

Department of Biological Sciences (X.L., R.E.P.), University of Alberta, Edmonton, Alberta T6G 2E9, Canada; Oregon Regional Primate Research Center (J.A.J., S.B., P.M.C.), Beaverton, Oregon 97006; and Department of Physiology and Pharmacology (P.M.C.), Oregon Health Sciences University, Portland, Oregon 97201

Address all correspondence and requests for reprints to: Dr. R. E. Peter, Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9 Canada. E-mail: dick.peter{at}ualberta.ca


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Somatostatin (SRIF or SS) exerts diverse inhibitory actions through binding to specific receptors. In this study, two SRIF receptor complementary DNAs (cDNAs) were cloned and sequenced from goldfish brain using PCR and cDNA library screening. The two cDNAs share 92% similarity in nucleotide sequence and 98% similarity in the deduced amino acid sequences and are presumably derived from duplicate genes, as goldfish are tetraploid. Two cDNAs encode two 367-amino acid goldfish type one SRIF receptors (designated as sst1A and sst1B, respectively), with seven putative transmembrane domains (TMD) and YANSCANP motif in the 7th TMD, a signature sequence for mammalian SRIF receptor (sst) family. In addition, the amino acid sequences of two receptors have 76% and 75% similarity to human or rat sst1, respectively, and 39–55% similarities to other mammalian sst subtypes (sst2–5), suggesting that the two receptors could be the goldfish homologs of mammalian sst1. The difference between goldfish and mammalian sst1 is mainly reflected by the extreme divergence in their extracellular N termini. Both SRIF-14 and [Pro2]SRIF-14, two of the native goldfish SRIF forms, significantly inhibited forskolin-stimulated cAMP release in COS-7 cells transiently expressing goldfish sst1A or sst1B, suggesting functional coupling of the two receptors to adenylate cyclase. Northern blot and RT-PCR showed that messenger RNAs (mRNAs) for both receptors are widely distributed throughout goldfish brain, whereas only one receptor mRNA is expressed in the pituitary. RT-PCR analysis also detected sst1 receptor mRNAs in several peripheral tissues. These findings provide fundamental information for studying the mechanism of SRIF actions in vertebrates and structural analysis of mammalian sst receptors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SOMATOSTATIN (SRIF OR SS) is a polypeptide that was originally isolated from mammalian hypothalamus and characterized as a physiological inhibitor of GH secretion (1). SRIF is now known to be a multifunctional peptide widely distributed throughout the central nervous system and peripheral tissues (2, 3). Mammalian SRIF exists as two predominant biologically active forms, SRIF-14 and its NH2-terminal extension of 14 amino acids, SRIF-28. Both SRIF-14 and SRIF-28 are encoded by a common gene (2, 3). SRIF-14 has been identified, with the same amino acid sequence, in representative species of all classes of vertebrate (4, 5). In addition, four molecular variants of SRIF-14, [Ser12]SRIF-14, [Ser5]SRIF-14, [Pro2, Met13]SRIF-14 and [Pro2]SRIF-14, have been isolated in nonmammalian vertebrates (4, 5). In teleosts, the presence of a multigene family for SRIF has been demonstrated by molecular cloning of complementary DNAs (cDNAs) encoding for SRIF-14 and a large form of SRIF (SRIF-25 or SRIF-28), respectively (6, 7, 8). Recently, two SRIF messenger RNAs (mRNAs) encoding for SRIF-14 and a SRIF-14 variant, [Pro2, Met13]SRIF-14, were identified in frog brain (9). Furthermore, an SRIF-related gene termed as cortistatin (CST) has been described in mammals (10, 11, 12). The CST precursor contains a tetradecapeptide at its C-terminus with an 11 amino acid homology with SRIF-14 (10, 11, 12). In our recent studies, three SRIF cDNAs were cloned from goldfish brain, which encode three preprosomatostatins (PSS) designated as PSS-I, PSS-II and PSS-III, potentially processing into SRIF-14 with sequence identical to mammalian SRIF-14, SRIF-28 with [Glu1, Tyr7, Gly10]SRIF-14 at its C-terminus, and [Pro2]SRIF-14, respectively (6). The goldfish PSS-III shows homology to frog [Pro2, Met13]SRIF-14 and mammalian CST precursors (6).

SRIF exerts diverse inhibitory actions through binding to specific plasma membrane receptors. Since 1991, five subtypes of SRIF receptor (sst1–5) have been identified by molecular cloning of their cDNAs or genes in several mammalian species (2, 3, 13, 14). All of five subtypes of mammalian sst are members of the guanine nucleotide binding (G) protein-coupled receptor (GPCR) family and are negatively coupled to adenylate cyclase. All five subtypes of sst bind SRIF-14 and mammalian SRIF-28 with high affinity, whereas sst5 exhibits weak selectivity for SRIF-28 (2, 3, 13, 14). In addition, all five subtypes of sst receptors or their mRNAs are expressed throughout brain (2, 3, 14). In nonmammalian vertebrates, the brain distribution of the SRIF binding sites has been studied only in frog (15) and the African lungfish (16), whereas the characteristics of the SRIF binding sites has been reported only in the brain slices of frog (9) and the liver membrane preparations and hepatocytes of rainbow trout (17, 18). There have been no reports on the identification of sst in nonmammalian vertebrates, which could contribute to the understanding of structure/function evolution of mammalian sst. In the present study, two SRIF receptor cDNAs were cloned and sequenced from goldfish brain, and their mRNA expression and functional characteristics investigated.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Goldfish (Carassius auratus) of the common or comet variety with body weight ranging from 25–40 g were purchased from Mt. Parnell Fisheries (Mercersburg, PA) and maintained in 300-liter flow-through aquaria at 17 C under a simulated natural photoperiod of Edmonton, Alberta, Canada. The fish were fed with commercially prepared Unifeed Nu-Way trout ration (United Feeds, Calgary, Canada). Sexually regressed fish (June–July) were used for extraction of RNA for molecular cloning, and sexually recrudescent fish (January–March) were used for tissue distribution studies. Goldfish were anesthetized with 0.05% tricaine methanesulfonate (Syndel, Vancouver, British Columbia, Canada) before tissue collection.

Reagents and test substances
SRIF-14 (Ala-Gly-Cys-Lys-Asn-Phe-Phe-Trp-Lys-Thr-Phe-Thr-Ser-Cys) was obtained from Sigma (St. Louis, MO). [Pro2]SRIF-14 was a gift from Dr. J. Rivier (The Salk Institute, La Jolla, CA). The expression vector pcDNA3.1 was purchased from Invitrogen (San Diego, CA). Trizol Reagent, DMEM, OPTI-MEM, lipofectamine, Taq DNA polymerase and SuperScript Preamplification System were purchased from Life Technologies, Inc. (Grand Island, NY). JM109 competent cells, pGEM-T vector system, restriction enzymes and modified enzymes were purchased from Promega Corp. (Madison, WI). T7QuickPrime Kit was obtained from Pharmacia Biotech (Baie d’Urfe, Québec, Canada). Nybond nylon membranes and discs and [{alpha}-32P]deoxy-CTP (dCTP) were obtained from Amersham Pharmacia Biotech (Buckinghamshire, UK). Other reagents were of the highest degree of purity available from commercial sources.

Cloning of goldfish SRIF receptor cDNAs
Total RNA was extracted from goldfish forebrain (telencephalon, including optic nerve and preoptic region, and hypothalamus) using Trizol Reagent, based on the acid guanidinium thiocyanate-phenol-chloroform extraction method (19). For cloning of goldfish SRIF receptor cDNA, RT-PCR was used to prepare a DNA probe for screening the goldfish brain cDNA library. cDNA was synthesized from 4 µg of total RNA from goldfish forebrain using the SuperScript Preamplification System. For PCR, two degenerate primers, forward primer SST-S [5'GTCATGAGCATCGA(CT)CG(CG)TA3'] and reverse primer SST-A [5'GGGTTGGCGCA(GC)(GC)TGTT(AG)GC(AG)TA3'], were designed on the basis of the coding sequences for DRY motif region and for consensus YANSCANP motif of the mammalian SRIF receptor cDNAs (2, 3). Thirty cycles of PCR amplification were performed with denaturation for 1 min at 95 C, annealing for 1 min at 50 C, extension for 1.5 min at 73 C, and final extension for 10 min at 73 C after the last cycle. Amplification products were separated by agarose gel, and the band of desired size was excised and purified. The purified DNA fragment (about 500 bp) was subcloned into pGEM-T vector. The nucleotide sequence analysis of the cloned PCR product showed high similarity in nucleotide sequence and deduced amino acid sequence with mammalian SRIF receptor cDNAs and amino acid sequence. This DNA fragment was then used as a probe to screen the cDNA library.

A goldfish brain cDNA library (kindly provided by Dr. H. R. Habibi, University of Calgary, Calgary, Alberta, Canada) was constructed using the ZAP-cDNA synthesis kit, including Gigapack II Gold packaging extract (Stratagene, La Jolla, CA). The library was amplified once to a titer of 6 x 109 pfu/ml before being transferred to Nybond-N+ discs at a density of 2 x 104 plaques/filter according to the manufacturer’s protocol. The filters were probed with the 500 bp DNA probe prepared by PCR as described above. The probe was labeled with [{alpha}-32P]dCTP using T7QuickPrime Kit based on the random priming technique (20). Hybridization was performed using methods described by Church and Gilbert (21). In brief, the membranes were prehybridized in hybridization solution (0.5 M NaHPO4, 7% SDS, 1 mM EDTA, and 1% BSA) for at least 1 h. The hybridization solution was then changed and the labeled probe was added. After hybridization overnight at 65 C, the membranes were washed three times with washing solution (0.04 M NaHPO4, 1 mM EDTA, and 1% SDS) and exposed to x-ray film for 24 h at -80 C. A total of 5 x 105 clones were screened, out of which seven positives were picked and subjected to secondary screening. Five positive clones were obtained from the secondary screening and subjected to in vivo excision according to the instruction of the ZAP-cDNA synthesis kit. Four clones with cDNA inserts of desired size were sequenced on an PE Applied Biosystems automated sequencer (373A) according to the manufacturer’s protocol. Sequencing was carried out on both strands using T7 and T3 sequencing primers and gene-specific primers.

Transient transfection of COS-7 cells
To examine the pharmacological characteristics, two type one goldfish SRIF receptor cDNAs were subcloned into pcDNA3.1 (Invitrogen), a mammalian expression vector, and transiently expressed in COS-7 cells. An expression vector (pCIS-LacZ) expressing ß-galactosidase driven by CMV promoter was used as a control plasmid (22). For transfection, a large-scale of plasmid DNA was prepared by double-banded CsCl gradient centrifugation. COS-7 cells were maintained in growth medium (DMEM) containing 10% FCS (HyClone Laboratories, Inc. Logan, UT) and 20 µg/ml gentamicin (Gemini Bioproducts, Calabasas, CA)] in a humidified atmosphere (37 C) containing 5% CO2. The cells (105 cells/well) were seeded in 24-well plates (Costar, Cambridge, MA). Twenty-four hours after plating, the cells were transfected with 0.8 µg plasmid DNA/well using 2 µl lipofectamine in 0.25 ml OPTI-MEM. Five hours later, 0.25 ml of DMEM containing 20% FCS was added to each well. Twenty-four hours after the start of transfection, the medium was replaced with fresh growth medium, and the cells were allowed to grow for 48 h before functional assay (cAMP assay) was done.

Quantitation of cAMP
Forty-eight hours after the start of transfection, the cells transfected with SRIF receptor DNA or LacZ control plasmid were washed with DMEM containing 0.1% BSA (Irvine Scientific, Santa Ana, CA) and 20 µg/ml gentamicin. The cells were then stimulated for 3 h with 1 µM forskolin in absence or presence of different concentrations of SRIF peptide in DMEM-0.1% BSA-20 µg/ml gentamicin containing 0.2 mM methylisobutylxanthine (MIX) to prevent degradation of cAMP. After stimulation, the medium from each well was collected in tubes containing sufficient theophylline for a final concentration of 1 mM. The samples were heated (95 C) for 5 min to destroy phosphodiesterases. RIA of cAMP was performed by a modification of the method of Steiner et al. (23), with the addition of the acetylation step described by Harper and Brooker (24). cAMP antiserum C-1B (prepared in our laboratory, 25) was used at a titer of 1:5100. This antiserum showed less than 0.1% cross-reaction with cGMP, 2',3'-cAMP, 5'-cAMP, 3'-cAMP, ADP, GDP, ATP, CTP, MIX, or theophylline.

Northern blot analysis
Northern blot analyses was carried out to detect brain and pituitary distribution of mRNAs for two type one SRIF receptors. Tissues of five discrete goldfish brain areas, olfactory bulbs and tracts, telencephalon (including optic nerve and preoptic region), hypothalamus, optic tectum-thalamus, and posterior brain (including cerebellum, medulla and spinal cord), and pituitary were freshly excised and homogenized for extraction of total RNA using Trizol Reagent as described above. Twenty-two micrograms of total RNA from individual tissues was fractionated by electrophoresis in a denaturing agarose gel (1.5%) with formaldehyde and blotted onto Nybond nylon membrane by capillary transfer. A 942-bp DNA probe that covers most of the coding region for goldfish sst1A or sst1B was prepared by PCR with primer set, sst1-F (5'TTAAACTTGGCGATCGCG3') and sst1-R (5'CACATACTGCAGTGACAACAG3') concensus for both cloned sst1A and sst1B cDNA sequences with the sst1A or sst1B plasmid DNA as template. The probe was labeled with [{alpha}-32P]dCTP using T7QuickPrime Kit based on the random priming technique (20). Hybridization was performed using methods described in the previous section. After hybridization, membranes were exposed to a PhosphorImager screen (Molecular Dynamics, Inc., Sunnyvale, CA) for 72 h, and the hybridization signals were scanned using a PhosphorImager 445 SI (Molecular Dynamics, Inc.) and analyzed by ImageQuant software (Molecular Dynamics, Inc.). To serve as an internal control, the membrane was stripped and reprobed with an [{alpha}-32P]dCTP labeled parital cDNA for goldfish ß-actin (unpublished results, GenBank accession number AF079831).

RT-PCR and restriction enzyme analysis
The brain distribution of the two goldfish SRIF receptor mRNAs was further confirmed by RT-PCR followed by restriction enzyme digestion. The peripheral tissue distributions of the two goldfish SRIF receptor mRNAs were also examined by this approach. First-strand cDNA was prepared from total RNA using the SuperScript Preamplification System and used as templates for PCR using specific primers for the two goldfish SRIF receptor mRNAs. The primer sets are sst1A-F (5'GTGCGCGCATTTTCTAAT3') and sst1-R for sst1A mRNA, and sst1B-F (5'GCGCATTTCCTGAGCGCGTA3') and sst1-R for sst1B. PCR condition was denaturation 1 min at 95 C, annealing 1 min at 51-53 C and extension 1 min at 73 C for a total of 30 cycles, and a final extension of 10 min at 73 C. To verify the identities of the RT-PCR products for each receptor mRNA, restriction enzyme analysis was carried out. RT-PCR reactions were chloroform extracted and ethanol precipitated. The DNA pellets were then suspended in buffer solution for NdeI restriction enzyme (Promega Corp.) and digested with NdeI at 37 C overnight. The restriction enzyme reaction was fractionated on 1.5% agarose gel and stained by ethidium bromide. The gel image was taken using the Imager Documentation System (Appligene, Oncor, Gaithersburg, MD). For internal control, RT-PCR was performed at the same time using a primer set (Actin-F: CTACTGGTATTGTGATGGACTCCG; Actin-R: TCCAGACAGAGTATTTGCGCTCAG) for goldfish ß-actin. cDNA samples prepared from total RNA without addition of reverse-transcriptase were used as negative control.

Data analysis
The goldfish sst1 mRNA levels in brain regions and pituitary were expressed as a ratio between sst1 mRNA and ß-actin mRNA (internal control) and then normalized as a percentage of sst1B (2.3 kb) mRNA levels in the telencephalon. The data for cAMP levels, quantitated by RIA, and SRIF receptor mRNA levels, quantitated by Northern blot analysis, were subjected to statistical analysis using ANOVA followed by Student-Newman-Keuls Multiple Comparisons Test. Differences are considered significant at P < 0.05. The transfection experiment was repeated at least three times with similar results.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Two type one goldfish SRIF receptor cDNAs
A partial cDNA clone with nucleotide sequence similar to the coding region from transmembrane domain (TMD) 3 to TMD7 of mammalian SRIF receptors was obtained using RT-PCR. This partial cDNA clone was used as a probe to screen a goldfish brain cDNA library, and two full-length cDNA clones were isolated and sequenced (GenBank accession numbers AF097726 and AF097727, Fig. 1Go). Both cDNAs contain a single open reading frame of 1104 bp encoding a 367-amino acid receptor protein, with seven hydrophobic TMDs, a feature characteristic of the GPCR family, and a YANSCANP motif in the putative 7th TMD, a signature sequence for the mammalian sst family (Fig. 1Go). The two cDNAs share 92% similarity in nucleotide sequence and 98% similarity in the deduced amino acid sequences (5 out of 367 amino acids). The amino acid sequences of the two receptors have 76% and 75% similarity to human or rat sst1 receptor, respectively (Fig. 2Go), and 39–55% similarities to other mammalian sst subtypes (sst2–5), indicating that the two receptors could be the goldfish homologs of mammalian sst1 receptor, and thus designated as gsst1A and gsst1B (Fig. 1Go). The intracellular loops and extracellular loops (ECL), TMDs, and the intracellular C-terminal domain were largely conserved between goldfish and mammalian sst1 receptors, whereas the NH2-terminal extracellular domain were extremely divergent between goldfish and mammalian sst1 receptors (Fig. 2Go). There are three consensus sequences (Asn-X-Ser/Thr) for Asn (N)-linked glycosylation (Asn4, Asn18, Asn22) in the putative extracellular NH2-terminal domain. There are two putative phosphorylation sites (Thr148 and Ser241) for cAMP-dependent protein kinase and protein kinase C (26), respectively, in regions that are predicted to be the second and third intracellular loops, which are also conserved in mammalian sst1 receptors. The intracellular C-terminal domain is also Ser- and Thr-rich and could serve as a substrate for Ser/Thr protein kinases (27). Several amino acids that are conserved within the DRY-containing (rhodopsin) family of GPCRs (28, 29) are also conserved in the two goldfish SRIF receptors, similar to their mammalian counterparts. These motifs include GNX2V (1st TMD), NLAXAD (2nd TMD), SX3LX3SXDRY (3rd TMD-2nd intracellular loop), WX2SX5P (4th TMD), FX2P (5th TMD), FX2CWXP (6th TMD) and NSX2NPX2Y (7th TMD), which may serve to define the conformation required for receptor function. In addition, two conserved Cys residues appear in the first and second putative ECLs (Cys106 and Cys184), which are shown to form a disulfide bond to stabilize tertiary structure in other GPCRs (29). An additional highly conserved Cys residue is found within the intracellular C-terminal domain (Cys315) (Fig. 1Go and 2Go). This residue has been shown to be palmitoylated in the ß2- and {alpha}2-adrenergic receptors and rhodopsin and could anchor a part of the intracellular C-terminal domain of the receptor to the plasma membrane (30, 31, 32).



View larger version (75K):
[in this window]
[in a new window]
 
Figure 1. Comparison of the cDNA and deduced amino acid sequences of the two goldfish type one SRIF receptors (sst1A and sst1B). The cDNA sequences are shown as lower case letters, whereas deduced amino acid sequences are shown as single letter abbreviations in upper case. Nucleotides are numbered from 5' to 3' and the amino acid residues are numbered starting with the start codon in the open reading frame. The nucleotide sequence regions in sst1B cDNA that is identical to the corresponding regions of sst1A are indicated by dashes. The complete amino acid sequence for sst1A is shown. Amino acid residues of the corresponding sst1B that differ from those of sst1A are shown in boldface type following sst1A residues with a slash. Three concensus sites (Asn-X-Ser/Thr) for N-linked glycosylation in the extracellular N-terminal domain are indicated by ellipsis. The potential phosphorylation sites for cAMP-dependent protein kinase and protein kinase C are boxed.

 


View larger version (81K):
[in this window]
[in a new window]
 
Figure 2. Sequence alignment of the two goldfish type one SRIF receptors (gsst1A and gsst1B) to the rat (rsst1), human (hsst1) and mouse (msst1) type one SRIF receptors. The putative transmembrane domains (TMD) are indicated as predicted by HMMTOP method (49 ). Consensus amino acid residues are indicated by asterisks. Dashed lines represent spaces introduced to optimize alignment. The amino acid positions are given at the right. The three consensus sites for N-linked glycosylation in the extracellular NH2-terminal domain are indicated by black background. The sequences for mammalian sst1 receptors (35 36 37 ) are from GenBank database (accession numbers M97656, M81831, M81829).

 
Pharmacological characterization of goldfish type one SRIF receptors
For functional characterization, the cloned goldfish sst1 receptor cDNAs were transiently transfected in COS-7 cells. The transfected cells were treated with forskolin (1 µM) to elevate cAMP levels in the absence or presence of SRIF peptides. Both native goldfish SRIF peptides, SRIF-14 and [Pro2]SRIF-14, displayed a significant and dose-dependent inhibition of forskolin-stimulated cAMP production, with comparable potency, in COS-7 cells transiently expressing gsst1A or gsst1B, indicating that both receptors are negatively coupled to adenylate cyclase (Fig. 3Go). Activation of gsst1A and gsst1B receptors by either peptide resulted in an approximately 36–40% and 30–32% decrease of cAMP release, respectively (Fig. 3Go). There was no effect on basal cAMP release by either peptide in COS-7 cells transiently expressing gsst1A or gsst1B receptors (data not shown). There was no effect on cAMP release by either peptide in untransfected COS-7 cells or COS-7 cells transiently transfected with control plasmid DNA (data not shown).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 3. Inhibition of forskolin-stimulated cAMP release by SRIF peptides in COS-7 cells transiently transfected with the goldfish type one SRIF receptor sst1A (A) and sst1B (B). Forty-eight hours after transfection, COS-7 cells were stimulated with 1 µM forskolin for 3 h in the presence or absence of different concentrations of SRIF-14 or [Pro2]SRIF-14. Data shown are the means of triplicate determinations ± SEM. Treatments giving similar cAMP responses were grouped within same underscore (P < 0.05, ANOVA followed by Student-Newman-Keuls Multiple Comparisons Test).

 
Differential tissue distribution of two goldfish SRIF receptor mRNAs
To examine the brain and pituitary distributions of the two goldfish sst1 mRNAs, total RNA prepared from pituitary and five different brain areas, including olfactory bulbs and tracts, telencephalon-preoptic region, hypothalamus, optic tectum-thalamus, and posterior brain region, was subjected to Northern blot analysis (Fig. 4Go). The same results were obtained using [{alpha}-32P]-labeled sst1A probe or sst1B probe, as both probes share 95% nucleotide sequence similarity. Two mRNA transcripts for goldfish sst1 receptors of 2.3 kb and 3.8 kb were consistently identified in all five brain areas, with different expression levels between the brain regions and between the two gene transcripts within a brain region (Fig. 4BGo). However, only one mRNA transcript (2.3 kb) was detected in pituitary (Fig. 4BGo). The mRNA levels for both gene transcripts were significantly higher in telencephalon-preoptic region and hypothalamus than in other brain regions and pituitary (Fig. 4DGo). The mRNA levels for the two transcripts are similar within a brain region, except olfactory bulbs, where mRNA levels for 2.3 kb transcript were significantly higher than the 3.8 kb transcript (Fig. 4DGo).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4. Distribution of the two type one goldfish SRIF receptor (sst1) mRNAs in brain and pituitary as revealed by Northern blot analysis. Total RNA was prepared from five brain regions, specifically olfactory bulb and tract (OB), telencephalon-preoptic region (TEL), hypothalamus (HYP), optic tectum-thalamus (OT-THAL), posterior brain region (POST), and pituitary (PIT). The RNA (22 µg) was fractionated on denaturing agarose gel and transblotted onto Nybond nylon membranes. The membrane was hybridized with one of the goldfish sst1 receptor cDNA probes labeled with [{alpha}-32P]dCTP and exposed to a PhosphorImager screen. A, Dissection of the goldfish brain regions and pituitary used for RNA extraction. ON, Optic nerve. B, Representative image showing hybridization signals of two sst1 receptor mRNAs in brain regions and pituitary. C, Representative image showing hybridization signals of goldfish ß-actin mRNA performed as an internal control. D, mRNA levels for two sst1 in different brain regions and pituitary. Hybridization signals were detected using PhosphorImager and quantitated using ImageQuant program. The sst1 mRNA levels were expressed as a ratio between sst1 mRNA and ß-actin mRNA (internal control) and then normalized as a percentage of sst1B (2.3 kb) mRNA levels in the telencephalon. Data are mean ± SEM (n = 4). Similar mRNA levels are grouped within same underscore (P < 0.05, ANOVA followed by Student-Newman-Keuls Multiple Comparisons Test).

 
The peripheral tissue distribution of the two goldfish sst1 mRNAs was examined using RT-PCR followed by restriction enzyme digestion (Fig. 5AGo). The primer set specific for goldfish sst1A mRNA amplified an expected size of 1225 bp PCR product; the primer set specific for goldfish sst1B mRNA amplified an expected size of 1220 bp PCR product. The predicted sequences of the RT-PCR product generated by the primer set for sst1A mRNA contained a unique NdeI restriction endonuclease site at position 706 (position +642 relative to the start codon) and the predicted sequence of the RT-PCR product generated by the primer set for sst1B mRNA did not. Thus, the 1225 bp PCR product for sst1A was digested by NdeI into two fragments of 706 bp and 519 bp. The 1220 bp PCR product for sst1B was not digested by NdeI. The two DNA fragments derived from sst1A mRNA were detected in brain, kidney, and testis. In other tissues, including intestine, liver, muscle, pituitary, and ovary, no PCR product for sst1A mRNA was detected. The single DNA fragment from sst1B mRNA was detected in brain, kidney, and testis, as well as intestine and pituitary, where sst1A product was not detected. No PCR product for sst1B was detected in other tissues examined. The RT-PCR product for sst1B, but not for sst1A, was detected in the pituitary, indicating that the 2.3 kb gene transcript in the pituitary as revealed by Northern blot represents sst1B mRNA, whereas 3.8 kb gene transcript is sst1A mRNA.



View larger version (91K):
[in this window]
[in a new window]
 
Figure 5. Peripheral (A) and brain (B) distribution of the two type one goldfish SRIF receptor (sst1) mRNAs as revealed by RT-PCR followed by restriction enzyme analysis. cDNA was prepared from the total RNA samples from different tissues, brain (1 ), heart (2 ), intestine (3 ), kidney (4 ), liver (5 ), muscle (6 ), pituitary (7 ), ovary (8 ), and testis (9 ), and five brain regions, including olfactory bulb and tract (10 ), telencephalon-preoptic region (11 ), hypothalamus (12 ), optic tectum-thalamus (13 ), and posterior brain region (14 ). PCR was performed using the specific primer set for each goldfish SRIF receptor mRNA. RT-PCR reactions were chloroform extracted and ethanol precipitated. The DNA products were then digested with NdeI and fractionated on 1.5% agarose gel. In (A) and (B), arrows indicate the expected size of RT-PCR products for sst1A (706 bp and 519 bp) and for sst1B (1220 bp) after digestion with NdeI. RT-PCR products (580 bp) for goldfish ß-actin (internal control) is shown in (C). The negative images of ethidium bromide-staining of the agarose gels are shown.

 
The differential brain distribution of the two goldfish sst1 mRNAs was confirmed using RT-PCR followed by restriction enzyme digestion (Fig. 5BGo). The two fragments (706 bp and 519 bp) from sst1A mRNA were detected in all five brain regions. The single 1220 bp DNA fragment for sst1B mRNA was also detected in all five brain regions.

The primer set specific for goldfish ß-actin mRNA amplified a PCR product of 580 bp in all of the tissues and brain regions examined, verifying the quality and integrity of the cDNA samples (Fig. 5CGo). There was no PCR product detected in the negative controls (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, two type one SRIF receptor cDNAs were cloned and sequenced from goldfish brain. To our knowledge, this is the first such report in nonmammalian vertebrates. The deduced 367-amino acid goldfish type one SRIF receptors (sst1A and sst1B) have 75–76% similarity to mammalian sst1 receptor, and only 39–55% similarities to other mammalian sst subtypes. The two receptors expressed in COS-7 cells showed ability to mediate the action of native goldfish SRIF peptides. In addition, two receptor mRNA are widely expressed throughout the brain and only one receptor mRNA is expressed in the pituitary.

The two goldfish type one SRIF receptor cDNAs share 92% similarity in nucleotide sequences and 98% similarity in the deduced amino acid sequences, and are presumably derived from duplicate genes. Genome duplication (or tetraploidization) is thought to be one genetic basis for the origin of a multigene family (33). Duplicate loci and sequence diversity in goldfish was first demonstrated for the synapse protein SNAP-25, consistent with a more recent tetraploidization event in the present-day goldfish (34). Although many duplicate genes for neuropeptides, hormones, or isozymes in goldfish have been elucidated using molecular cloning approaches, whether these duplicate genes are derived from the gene duplication during early vertebrate evolution or from a more recent tetraploidization event is not always clear. The present finding of duplicate genes for goldfish type one sst receptors, with high amino acid homology and similar receptor pharmacology (discussed below), suggest that the two receptors derived from a recent tetraploidization event.

Five subtypes of SRIF receptor (sst) have been identified by molecular cloning of their cDNAs or genes in several mammalian species (2, 3, 13, 14). Among them, sst1 has been identified in human (35, 36), rat, and mouse (37). However, there have been no reports on the molecular cloning of SRIF receptors in nonmammalian vertebrates, which could contribute to the understanding of structure/function evolution of the mammalian sst family. The two cloned goldfish SRIF receptors showed only 24–25% sequence divergence compared with their mammalian counterparts. The difference between goldfish and mammalian sst1 is mainly reflected by the extreme divergence in their extracellular N termini, whereas TMDs and extracellular and intracellular domains are highly conserved. Similar to mammalian ssts, both goldfish sst1 receptors display most of the conserved sequence motifs in TMD1–7, common to the rhodopsin family of the GPCRs. In addition, the YANSCANP motif within the TMD7 was found in both goldfish sst1s, which is thought to be a signature motif for identification of mammalian ssts (2, 3, 14). Three consensus Asn-linked glycosylation sites were identified in the cloned goldfish sst1 receptors. Surprisingly, localization of the three Asn-linked glycosylation sites is identical or similar to the corresponding glycosylation sites in human, rat and mouse sst1 receptors (35, 36, 37).

The ligand binding site of GPCRs for short peptides typically involves residues in the ECLs and TMDs (38). Studies with chimeras of mouse sst1 and sst2 indicated that the structural determinants in the third ECL and its surrounding TMD regions are responsible for selective binding of octapeptide analogs (39, 40). In contrast, the structural determinants in the second ECL are responsible for binding of the sst1 selective peptide des-AA1,2,5-[D-Trp8,IAMP9]SST-14 (40). Mutational analysis of human sst5 receptor suggest an overall binding domain for SRIF ligand made up of residues within TMDs3–7, with a potential contribution by the second ECL (41). Comparison of goldfish sst1 with mammalian sst1 reveals that the sequences of ECL2 and ECL3 are quite different from each other. These sequence differences in ECL2 and ECL3 could result in differences in agonist selectivity between goldfish and mammalian sst1.

All five subtypes of sst in mammals bind SRIF-14 and mammalian SRIF-28 with high affinity, whereas sst5 exhibits weak selectivity for SRIF-28 (2, 3, 13, 14). Mutational analysis with sst5 receptor revealed that the region encompassing TMD6 through the C-terminus in sst5 may be critical for the lower binding affinity of SRIF-14 in comparison with SRIF-28 (42). Substitution of Phe265 of TMD6 in sst5 with a Tyr, the corresponding residue of the other ssts (sst1–4), improved the binding of SRIF-14 to an affinity comparable to that observed for sst2, suggesting that Tyr in TMD6 of sst1–4 may be an important contact point between SRIF-14 and sst subtypes. Interestingly, a His residue in goldfish sst1 receptors (His264) is found in the corresponding position of the conserved Tyr residue in mammalian sst1–4. Recent cloning of three PSSs encoding cDNAs from goldfish brain indicated that the three PSSs may be potentially processed into SRIF-14, goldfish SRIF-28, and [Pro2]SRIF-14, respectively (6). There are 11 amino acids different between mammalian SRIF-28 and goldfish brain SRIF-28. Whether the substitution of Tyr with His in goldfish sst1 receptors is important for binding of a SRIF-14 variant or goldfish SRIF-28 in goldfish remains to be investigated.

All mammalian ssts, except for sst5, display a Glu in TMD2 adjacent to the conserved Asp in LAXAD motif. Substitution of the Glu in sst3 with Gln, Val, or Leu, increased Na+ sensitivity of agonist binding (43). This Glu residue is also conserved (Glu81) in goldfish sst1A, whereas a Asp81 is found in the corresponding position in goldfish sst1B, suggesting that two goldfish sst1 receptors may have different Na+ sensitivity of ligand binding.

All five subtypes of mammalian sst are coupled to multiple cellular effectors including adenylate cyclase (3, 14). In goldfish, it has been shown that SRIF-14 interferes with cAMP-dependent mechanisms to inhibit basal and stimulated GH release from pituitary cells (44). In the present study, two native goldfish SRIF peptides, SRIF-14 and [Pro2]SRIF-14, inhibited forskolin-stimulated cAMP production, at comparable potencies, in COS-7 cells expressing goldfish sst1A or sst1B receptors. These results indicated that both cloned receptors are able to bind SRIF peptides, mediate activation by SRIF peptides, and couple to inhibition of adenylate cyclase, consistent with the observation for mammalian sst receptors. In addition, there were no apparent differences between two goldfish sst1 receptors in their potencies for mediating action of SRIF-14 and [Pro2]SRIF-14, suggesting that two receptors display similar affinity for both peptides. Comparison of two goldfish sst1 receptors shows only five amino acids difference. Among them, two distinct residues are localized in extracellular N-terminal domain and intracellular C-terminal domain, respectively; these residues may not contribute to the domain for ligand binding. The other three residues include Glu81 and Asp81 in TMD2, Met266 and Val266 in TMD6, and Ala278 and Ser278 in ECL3 of sst1A and sst1B, respectively. Interestingly, Glu81, Val266, and Ala278 are conserved residues in mammalian sst1, but variable among five subtypes of sst. These comparisons suggest that these variable residues may not be responsible for the binding domain for SRIF-14. [Pro2]SRIF-14 is a SRIF-14 variant, identified from goldfish brain by molecular cloning (6). The present results showed that [Pro2]SRIF-14 displayed a similar potency to SRIF-14 in inhibition of forskolin-stimulated cAMP production through sst1 receptors. Our previous studies showed that [Pro2]SRIF-14 inhibited basal or stimulated GH release from goldfish pituitary, with similar potency to that observed for SRIF-14 (6). Taken together, these results suggest that sst1, in at least goldfish, is not able to distinguish SRIF-14 from a variant with substitution of Gly2 with Pro2.

The mRNAs for sst receptors are widely expressed at varying levels in human and rodent tissues and have distinct but overlapping patterns of expression (3, 14). All five subtypes of ssts are expressed in the central nervous system and pituitary (3, 14). In rat brain, sst1 mRNA is present throughout the brain and heavily expressed in hypothalamic neurons containing somatostatin and/or GH-releasing hormone (GHRH) (45, 46, 47). In the present study, mRNAs for both sst1 receptors are expressed throughout goldfish brain. High levels of both mRNAs were found in telencephalon and hypothalamus. In peripheral tissues, only sst1B mRNA was found in pituitary and intestine, whereas both mRNAs were found in kidney and testis. The higher expression of both sst1 mRNAs in the telencephalon-preoptic region and hypothalamus suggests that both sst1 receptors may participate in the central regulation of brain neuropeptides, such as GHRH, GnRH, and neuropeptide Y. These neuropeptide neurons are mainly localized in the telencephalon-preoptic region and hypothalamus, and are likely also involved in controlling pituitary GH secretion in goldfish (48). However, the expression of only sst1B mRNA in pituitary suggests that only one form of sst1 may be involved in regulation of pituitary hormone secretion. It is unknown why only sst1B mRNA is expressed in pituitary and intestine. The differential expression pattern of the two receptor mRNAs could result from the usage of distinct promoters and regulatory mechanisms for gene transcription of the two receptors.

In summary, two type one SRIF receptor cDNAs were identified from goldfish brain, with 8% sequence divergence. The two goldfish sst1 receptors share high similarity to mammalian sst1 receptors. Both receptors showed ability to mediate inhibition of forskolin-stimulated cAMP production by two native goldfish SRIF peptides. In addition, both receptors are differentially expressed throughout brain and some peripheral tissues; however, only one receptor is expressed in the pituitary, indicating that only one of the receptors is involved in the regulation of pituitary hormone secretion.


    Acknowledgments
 
We thank Drs. J. Rivier and H. R. Habibi for providing [Pro2]SRIF-14 and goldfish brain cDNA library, respectively, and Pierre Peyon and Helene Volkoff for their assistance.


    Footnotes
 
1 This research was supported by grant A6371 from NSERC to REP. Back

Received April 15, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Brazeau P, Vale WW, Burgus R, Ling N, Butcher M, Rivier J, Guillemin R 1973 Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone. Science 179:77–79[Abstract/Free Full Text]
  2. Reisine T, Bell GI 1995 Molecular biology of somatostatin receptors. Endocr Rev 16:427–442[CrossRef][Medline]
  3. Patel YC, Srikant CB 1997 Somatostatin receptors. Trends Endocrinol Metab 8:398–405[Medline]
  4. Conlon JM, Tostivint H, Vaudry H 1997 Somatostatin- and urotensin II-related peptides: molecular diversity and evolutionary perspectives. Regul Pept 69:95–103[CrossRef][Medline]
  5. Lin XW, Otto CJ, Peter RE 1998 Evolution of neuroendocrine peptide systems: gonadotropin-releasing hormone and somatostatin. Comp Biochem Physiol 119C:375–388
  6. Lin X, Otto CJ, Peter RE 1999 Expression of three distinct somatostatin messenger ribonucleic acids (mRNAs) in goldfish brain: characterization of the complementary deoxyribonucleic acids, distribution and seasonal variation of the mRNAs, and action of a somatostatin-14 variant. Endocrinology 140:2089–2099[Abstract/Free Full Text]
  7. Moore CA, Kittilson JD, Dahl SK, Sheridan MA 1995 Isolation and characterization of a cDNA encoding for preprosomatostatin containing [Tyr7 Gly10]-somatostatin-14 from the endocrine pancreas of rainbow trout, Oncorhynchus mykiss. Gen Comp Endocrinol 98: 253–261
  8. Hobart P, Crawford R, Shen LP, Pictet R, Rutte WJ 1980 Cloning and sequence analysis of cDNAs encoding two distinct somatostatin precursors found in the endocrine pancreas of anglerfish. Nature 288:137–141[CrossRef][Medline]
  9. Tostivint H, Lihrmann I, Bucharles C, Vieau D, Coulouarn Y, Fournier A, Conlon JM, Vaudry H 1996 Occurrence of two somatostatin variants in the frog brain: characterization of the cDNAs, distribution of the mRNAs, and receptor-binding affinities of the peptides. Proc Natl Acad Sci USA 93:12605–12610[Abstract/Free Full Text]
  10. de Lecea L, Criado JR, Prospero O, Gautvik KM, Schweitzer P, Danielson PE, Dunlop CM, Siggins GR, Henriksen SJ, Sutcliffe JG 1996 A cortical neuropeptide with neuronal depressant and sleep-modulating properties. Nature 381:242–245[CrossRef][Medline]
  11. de Lecea L, Ruiz-Lozano P, Danielson PE, Peelle-Kirley J, Foye PE, Frankel WN, Sutcliffe JG 1997 Cloning, mRNA expression, and chromosomal mapping of mouse and human preprocortistatin. Genomics 42:499–506[CrossRef][Medline]
  12. Fukusumi S, Kitada C, Takekawa S, Kizawa H, Sakamoto J, Miyamoto M, Hinuma S, Kitano K, Fujino M 1997 Identification and characterization of a novel human cortistatin-like peptide. Biochem Biophys Res Commun 232:157–163[CrossRef][Medline]
  13. Hoyer D, Bell GI, Berelowitz M, Epelbaum J, Feniuk W, Humphrey PPA, O’Carroll A-M, Patel YC, Schonbrumm A, Taylor JE, Reisine T 1995 Classification and nomenclature of somatostatin receptors. Trends Pharmacol Sci 16:86–88[CrossRef][Medline]
  14. Meyerhof W 1998 The elucidation of somatostatin receptor functions: a current view. Rev Physiol Biochem Pharmacol 133:55–108[Medline]
  15. Laquerrière, A, Leroux P, Gonzalez BJ, Bodenant C, Benoit R, Vaudry H 1989 Distribution of somatostatin receptors in the brain of the frog Rana ridibunda: correlation with the localization of somatostatin-containing neurons. J Comp Neurol 280:451–467[CrossRef][Medline]
  16. Vallarino M, Trabucchi M, Masini MA, Chartrel N, Vaudry H 1997 Immunocytochemical localization of somatostatin and autoradiographic distribution of somatostatin binding sites in the brain of the African lungfish, Protopterus annectens. J Comp Neurol 388:337–353[CrossRef][Medline]
  17. Pesek MJ, Sheridan MA 1996 Fasting alters somatostatin binding to liver membranes of rainbow trout (Oncorhynchus mykiss). J Endocrinol 150:179–186[Abstract]
  18. Pesek MJ, Howe N, Sheridan MA 1998 Somatostatin binding to hepatocytes isolated from rainbow trout, Oncorhynchus mykiss, is modulated by insulin and glucagon. Gen Comp Endocrinol 112:183–190[CrossRef][Medline]
  19. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidunium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:1556–1559
  20. Feinberg AP, Vogelstein B 1983 A technique for radiolabeling DNA restriction endonuclease fragments to high specificity activity. Anal Biochem 1983:132:6–13
  21. Church GM, Gilbert W 1984 Genomic sequencing. Proc Natl Acad Sci USA 81:1991–1995[Abstract/Free Full Text]
  22. Steiner AL, Parker CW, Kipnis DM 1972 Radioimmunoassay for cyclic nucleotides. J Biol Chem 247:1106–1113[Abstract/Free Full Text]
  23. Lin X, Conn PM 1998 Transcriptional activation of gonadotropin-releasing hormone (GnRH) receptor gene by GnRH and cyclic adenosine monophosphate. Endocrinology 139:3896–3902[Abstract/Free Full Text]
  24. Harper JF, Brooker G 1975 Femtomole sensitive radioimmunoassay of cyclic AMP and cyclic GMP after 2'0 acetylation by acetic anhydride in aqueous solution. J Cyclic Nucleotide Res 1:207–218[Medline]
  25. Andrews WV, Conn PM 1986 Gonadotropin-releasing hormone stimulates mass changes in phosphoinositides and diacylglycerol accumulation in purified gonadotrope cell cultures. Endocrinology 118:1148–1158[Abstract]
  26. Kemp BE, Pearson RB 1990 Protein kinase recognition sequence motifs. Trends Biochem Sci 15:342–346[Medline]
  27. Sibley DR, Benovic JL, Caron MG, Lefkowitz RJ 1988 Phosphorylation of cell surface receptors: a mechanism for regulating signal transduction pathways. Endocr Rev 9:38–56[Medline]
  28. Sealfon SC 1998 Synthesis, internalization, recycling and regulation of peptide hormone receptors. In: Conn PM (ed) The Handbook of Physiology: The Endocrine System Vol I, Cellular Endocrinology. Oxford University Press, New York, pp 23–38
  29. Strader CD, Fong TM, Tota MR, Underwood D 1994 Structure and function of G protein-coupled receptors. Annu Rev Biochem 63:101–132[CrossRef][Medline]
  30. O’Dowd BF, Hnatowich M, Caron MG, Lefkowitz RJ, Bouvier M 1989 Palmitoylation of the human ß2-adrenergic receptor. Mutation of Cys341 in the carboxyl tail leads to an uncoupled nonpalmitoylated form of the receptor. J Biol Chem 264:7564–7569[Abstract/Free Full Text]
  31. Kennedy M, Limbird LE 1993 Mutations of the {alpha}2A-adrenergic receptor that eliminate detectable palmitoylation do not perturb receptor-G-protein coupling. J Biol Chem 268:8003–8011[Abstract/Free Full Text]
  32. Papac DI, Thornburg KR, Bullesbach EE, Crouch RK, Knapp DR 1992 palmitoylation of a G-protein coupled receptor. Direct analysis by tandem mass spectrometry. J Biol Chem 267:16889–16894[Abstract/Free Full Text]
  33. Ohno S 1970 Evolution by Gene Duplication. Springer-Verlag, Berlin/New York, pp 59–88
  34. Risinger C, Larhammar D 1993 Multiple loci for synapse protein SNAP-25 in the tetraploid goldfish. Proc Natl Acad Sci USA 90:10598–10602[Abstract/Free Full Text]
  35. Li X-J, Forte M, North RA, Ross CA, Snyder SH 1992 Cloning and expression of a rat somatostatin receptor enriched in brain. J Biol Chem 267:21307–21312[Abstract/Free Full Text]
  36. Meyerhof W, Paust H-J, Schönrock C, Richter D 1991 Cloning of a cDNA encoding a novel putative G-protein-coupled receptor expressed in specific rat brain regions. DNA Cell Biol 10:689–694[Medline]
  37. Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino S 1992 Cloning and functional characterization of a family of human and mouse somatostatin receptors expressed in brain, gastrointestinal tract, and kidney. Proc Natl Acad Sci USA 89:251–255[Abstract/Free Full Text]
  38. Ji TH, Grossmann M, Ji I 1998 G Protein-coupled receptors. I. Diversity of receptor-ligand interactions. J Biol Chem 273:17299–17302[Free Full Text]
  39. Kaupmann K, Bruns C, Raulf F, Weber HP, Mattes H, Lübbert H 1995 Two amino acids, located in transmembrane domains VI and VII, determine the selectivity of the peptide agonist SMS 201–995 for the SSTR2 somatostatin receptor. EMBO J 14:727–735[Medline]
  40. Liapakis G, Fitzpatrick D, Hoeger C, Rivier J, Vandlen R, Reisine T 1996 Identification of ligand binding determinants in the somatostatin receptor subtypes 1 and 2. J Biol Chem 271:20331–20339[Abstract/Free Full Text]
  41. Greenwood MT, Hukovic N, Kumar U, Panetta R, Hjorth SA, Srikant CB, Patel YC 1997 Ligand binding pocket of the human somatostatin receptor 5:mutational analysis of the extracellular domains. Mol Pharmacol 52:807–814[Abstract/Free Full Text]
  42. Ozenberger BA, Hadcock JR 1995 A single amino acid substitution in somatostatin receptor subtype 5 increases affinity for somatostatin-14. Mol Pharmacol 47:82–87[Abstract]
  43. Nehring R, Meyerhof W, Richter D 1996 Mutation of glutamate residue 92 of the rat somatostatin receptor subtype 3 enhances sodium regulation of sst-14 binding. In: Krish B, Mentlein R (eds) The Peptidergic Neuron. Birkhäuser, Basel, pp 135–140
  44. Peter RE, Chang JP 1997 Growth hormone secretion in fish. In: Kawashima S, Kikuyama S (eds) Advances in Comparative Endocrinology. Proceedings of the XIIIth International Congress of Comparative Endocrinology (Japan), November 17–21:1997. Monduzzi Editore, Bologna, Italy, pp 915–919
  45. Kong H, DePaoli AM, Breder CD, Yasuda K, Bell GI, Reisine T 1994 Differential expression of messenger RNAs for somatostatin receptor subtypes SSTR1, SSTR2 and SSTR3 in adult rat brain: analysis by RNA blotting and in situ hybridization histochemistry. Neuroscience 59:175–184[CrossRef][Medline]
  46. Beaudet A, Greenspun D, Raelson J, Tannenbaum GS 1995 Patterns of expression of SSTR1 and SSTR2 somatostatin receptor subtypes in the hypothalamus of the adult rat: relationship to neuroendocrine function. Neuroscience 65:551–561[CrossRef][Medline]
  47. Senaris RM, Humphrey PP, Emson PC 1994 Distribution of somatostatin receptors 1, 2 and 3 mRNA in rat brain and pituitary. Eur J Neurosci 6:1883–1896[CrossRef][Medline]
  48. Peng C, Peter RE 1997 Neuroendocrine regulation of growth hormone secretion and growth in fish. Zool Stud 36:79–89
  49. Tusnády GE, Simon I 1998 Principles governing amino acid composition of integral membrane proteins: application to topology prediction. J Mol Biol 283:489–506[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. F. Canosa, S. Unniappan, and R. E. Peter
Periprandial changes in growth hormone release in goldfish: role of somatostatin, ghrelin, and gastrin-releasing peptide
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2005; 289(1): R125 - R133.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. K. Yunker, S. Smith, C. Graves, P. J. Davis, S. Unniappan, J. E. Rivier, R. E. Peter, and J. P. Chang
Endogenous Hypothalamic Somatostatins Differentially Regulate Growth Hormone Secretion from Goldfish Pituitary Somatotropes in Vitro
Endocrinology, September 1, 2003; 144(9): 4031 - 4041.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, X.
Right arrow Articles by Peter, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, X.
Right arrow Articles by Peter, R. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals