Endocrinology Vol. 140, No. 11 5211-5219
Copyright © 1999 by The Endocrine Society
Molecular Cloning and Expression of Two Type One Somatostatin Receptors in Goldfish Brain1
Xinwei Lin,
Jo Ann Janovick,
Shaun Brothers,
P. Michael Conn and
Richard E. Peter
Department of Biological Sciences (X.L., R.E.P.), University of
Alberta, Edmonton, Alberta T6G 2E9, Canada; Oregon Regional Primate
Research Center (J.A.J., S.B., P.M.C.), Beaverton, Oregon 97006; and
Department of Physiology and Pharmacology (P.M.C.), Oregon Health
Sciences University, Portland, Oregon 97201
Address all correspondence and requests for reprints to: Dr. R. E. Peter, Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9 Canada. E-mail:
dick.peter{at}ualberta.ca
 |
Abstract
|
|---|
Somatostatin (SRIF or SS) exerts diverse inhibitory actions through
binding to specific receptors. In this study, two SRIF receptor
complementary DNAs (cDNAs) were cloned and sequenced from goldfish
brain using PCR and cDNA library screening. The two cDNAs share 92%
similarity in nucleotide sequence and 98% similarity in the deduced
amino acid sequences and are presumably derived from duplicate genes,
as goldfish are tetraploid. Two cDNAs encode two 367-amino acid
goldfish type one SRIF receptors (designated as sst1A and
sst1B, respectively), with seven putative transmembrane
domains (TMD) and YANSCANP motif in the 7th TMD, a signature sequence
for mammalian SRIF receptor (sst) family. In addition, the amino acid
sequences of two receptors have 76% and 75% similarity to human or
rat sst1, respectively, and 3955% similarities to other
mammalian sst subtypes (sst25), suggesting that the two
receptors could be the goldfish homologs of mammalian sst1.
The difference between goldfish and mammalian sst1 is
mainly reflected by the extreme divergence in their extracellular N
termini. Both SRIF-14 and [Pro2]SRIF-14, two of the
native goldfish SRIF forms, significantly inhibited
forskolin-stimulated cAMP release in COS-7 cells transiently expressing
goldfish sst1A or sst1B, suggesting functional
coupling of the two receptors to adenylate cyclase. Northern blot and
RT-PCR showed that messenger RNAs (mRNAs) for both receptors are widely
distributed throughout goldfish brain, whereas only one receptor mRNA
is expressed in the pituitary. RT-PCR analysis also detected
sst1 receptor mRNAs in several peripheral tissues. These
findings provide fundamental information for studying the mechanism of
SRIF actions in vertebrates and structural analysis of mammalian sst
receptors.
 |
Introduction
|
|---|
SOMATOSTATIN (SRIF OR SS) is a polypeptide
that was originally isolated from mammalian hypothalamus and
characterized as a physiological inhibitor of GH secretion (1). SRIF is
now known to be a multifunctional peptide widely distributed throughout
the central nervous system and peripheral tissues (2, 3). Mammalian
SRIF exists as two predominant biologically active forms, SRIF-14 and
its NH2-terminal extension of 14 amino acids, SRIF-28. Both
SRIF-14 and SRIF-28 are encoded by a common gene (2, 3). SRIF-14 has
been identified, with the same amino acid sequence, in representative
species of all classes of vertebrate (4, 5). In addition, four
molecular variants of SRIF-14, [Ser12]SRIF-14,
[Ser5]SRIF-14, [Pro2,
Met13]SRIF-14 and [Pro2]SRIF-14, have been
isolated in nonmammalian vertebrates (4, 5). In teleosts, the presence
of a multigene family for SRIF has been demonstrated by molecular
cloning of complementary DNAs (cDNAs) encoding for SRIF-14 and a large
form of SRIF (SRIF-25 or SRIF-28), respectively (6, 7, 8). Recently, two
SRIF messenger RNAs (mRNAs) encoding for SRIF-14 and a SRIF-14 variant,
[Pro2, Met13]SRIF-14, were identified in frog
brain (9). Furthermore, an SRIF-related gene termed as cortistatin
(CST) has been described in mammals (10, 11, 12). The CST precursor
contains a tetradecapeptide at its C-terminus with an 11 amino acid
homology with SRIF-14 (10, 11, 12). In our recent studies, three SRIF cDNAs
were cloned from goldfish brain, which encode three preprosomatostatins
(PSS) designated as PSS-I, PSS-II and PSS-III, potentially processing
into SRIF-14 with sequence identical to mammalian SRIF-14, SRIF-28 with
[Glu1, Tyr7, Gly10]SRIF-14 at its
C-terminus, and [Pro2]SRIF-14, respectively (6). The
goldfish PSS-III shows homology to frog [Pro2,
Met13]SRIF-14 and mammalian CST precursors (6).
SRIF exerts diverse inhibitory actions through binding to specific
plasma membrane receptors. Since 1991, five subtypes of SRIF receptor
(sst15) have been identified by molecular cloning of
their cDNAs or genes in several mammalian species (2, 3, 13, 14). All
of five subtypes of mammalian sst are members of the guanine nucleotide
binding (G) protein-coupled receptor (GPCR) family and are negatively
coupled to adenylate cyclase. All five subtypes of sst bind SRIF-14 and
mammalian SRIF-28 with high affinity, whereas sst5 exhibits
weak selectivity for SRIF-28 (2, 3, 13, 14). In addition, all five
subtypes of sst receptors or their mRNAs are expressed throughout brain
(2, 3, 14). In nonmammalian vertebrates, the brain distribution of the
SRIF binding sites has been studied only in frog (15) and the African
lungfish (16), whereas the characteristics of the SRIF binding sites
has been reported only in the brain slices of frog (9) and the liver
membrane preparations and hepatocytes of rainbow trout (17, 18). There
have been no reports on the identification of sst in nonmammalian
vertebrates, which could contribute to the understanding of
structure/function evolution of mammalian sst. In the present study,
two SRIF receptor cDNAs were cloned and sequenced from goldfish brain,
and their mRNA expression and functional characteristics investigated.
 |
Materials and Methods
|
|---|
Animals
Goldfish (Carassius auratus) of the common or comet
variety with body weight ranging from 2540 g were purchased from Mt.
Parnell Fisheries (Mercersburg, PA) and maintained in 300-liter
flow-through aquaria at 17 C under a simulated natural photoperiod of
Edmonton, Alberta, Canada. The fish were fed with commercially prepared
Unifeed Nu-Way trout ration (United Feeds, Calgary, Canada). Sexually
regressed fish (JuneJuly) were used for extraction of RNA for
molecular cloning, and sexually recrudescent fish (JanuaryMarch) were
used for tissue distribution studies. Goldfish were anesthetized with
0.05% tricaine methanesulfonate (Syndel, Vancouver, British Columbia,
Canada) before tissue collection.
Reagents and test substances
SRIF-14
(Ala-Gly-Cys-Lys-Asn-Phe-Phe-Trp-Lys-Thr-Phe-Thr-Ser-Cys) was obtained
from Sigma (St. Louis, MO). [Pro2]SRIF-14
was a gift from Dr. J. Rivier (The Salk Institute, La
Jolla, CA). The expression vector pcDNA3.1 was purchased from
Invitrogen (San Diego, CA). Trizol Reagent, DMEM,
OPTI-MEM, lipofectamine, Taq DNA polymerase and SuperScript
Preamplification System were purchased from Life Technologies, Inc. (Grand Island, NY). JM109 competent cells, pGEM-T vector
system, restriction enzymes and modified enzymes were purchased from
Promega Corp. (Madison, WI). T7QuickPrime Kit was obtained
from Pharmacia Biotech (Baie dUrfe, Québec,
Canada). Nybond nylon membranes and discs and
[
-32P]deoxy-CTP (dCTP) were obtained from
Amersham Pharmacia Biotech (Buckinghamshire, UK). Other
reagents were of the highest degree of purity available from commercial
sources.
Cloning of goldfish SRIF receptor cDNAs
Total RNA was extracted from goldfish forebrain (telencephalon,
including optic nerve and preoptic region, and hypothalamus) using
Trizol Reagent, based on the acid guanidinium
thiocyanate-phenol-chloroform extraction method (19). For cloning of
goldfish SRIF receptor cDNA, RT-PCR was used to prepare a DNA probe for
screening the goldfish brain cDNA library. cDNA was synthesized from 4
µg of total RNA from goldfish forebrain using the SuperScript
Preamplification System. For PCR, two degenerate primers, forward
primer SST-S [5'GTCATGAGCATCGA(CT)CG(CG)TA3'] and reverse primer
SST-A [5'GGGTTGGCGCA(GC)(GC)TGTT(AG)GC(AG)TA3'], were designed on the
basis of the coding sequences for DRY motif region and for consensus
YANSCANP motif of the mammalian SRIF receptor cDNAs (2, 3). Thirty
cycles of PCR amplification were performed with denaturation for 1 min
at 95 C, annealing for 1 min at 50 C, extension for 1.5 min at 73 C,
and final extension for 10 min at 73 C after the last cycle.
Amplification products were separated by agarose gel, and the band of
desired size was excised and purified. The purified DNA fragment (about
500 bp) was subcloned into pGEM-T vector. The nucleotide sequence
analysis of the cloned PCR product showed high similarity in nucleotide
sequence and deduced amino acid sequence with mammalian SRIF receptor
cDNAs and amino acid sequence. This DNA fragment was then used as a
probe to screen the cDNA library.
A goldfish brain cDNA library (kindly provided by Dr. H. R.
Habibi, University of Calgary, Calgary, Alberta, Canada) was
constructed using the ZAP-cDNA synthesis kit, including Gigapack II
Gold packaging extract (Stratagene, La Jolla, CA). The
library was amplified once to a titer of 6 x 109
pfu/ml before being transferred to Nybond-N+ discs at a
density of 2 x 104 plaques/filter according to the
manufacturers protocol. The filters were probed with the 500 bp DNA
probe prepared by PCR as described above. The probe was labeled with
[
-32P]dCTP using T7QuickPrime Kit based on the random
priming technique (20). Hybridization was performed using methods
described by Church and Gilbert (21). In brief, the membranes were
prehybridized in hybridization solution (0.5 M
NaHPO4, 7% SDS, 1 mM EDTA, and 1% BSA) for at
least 1 h. The hybridization solution was then changed and the
labeled probe was added. After hybridization overnight at 65 C, the
membranes were washed three times with washing solution (0.04
M NaHPO4, 1 mM EDTA, and 1% SDS)
and exposed to x-ray film for 24 h at -80 C. A total of 5 x
105 clones were screened, out of which seven positives were
picked and subjected to secondary screening. Five positive clones were
obtained from the secondary screening and subjected to in
vivo excision according to the instruction of the ZAP-cDNA
synthesis kit. Four clones with cDNA inserts of desired size were
sequenced on an PE Applied Biosystems automated sequencer
(373A) according to the manufacturers protocol. Sequencing was
carried out on both strands using T7 and T3 sequencing primers and
gene-specific primers.
Transient transfection of COS-7 cells
To examine the pharmacological characteristics, two type one
goldfish SRIF receptor cDNAs were subcloned into pcDNA3.1
(Invitrogen), a mammalian expression vector, and
transiently expressed in COS-7 cells. An expression vector (pCIS-LacZ)
expressing ß-galactosidase driven by CMV promoter was used as a
control plasmid (22). For transfection, a large-scale of plasmid DNA
was prepared by double-banded CsCl gradient centrifugation. COS-7 cells
were maintained in growth medium (DMEM) containing 10% FCS
(HyClone Laboratories, Inc. Logan, UT) and 20 µg/ml
gentamicin (Gemini Bioproducts, Calabasas, CA)] in a humidified
atmosphere (37 C) containing 5% CO2. The cells
(105 cells/well) were seeded in 24-well plates
(Costar, Cambridge, MA). Twenty-four hours after plating,
the cells were transfected with 0.8 µg plasmid DNA/well using 2 µl
lipofectamine in 0.25 ml OPTI-MEM. Five hours later, 0.25 ml of DMEM
containing 20% FCS was added to each well. Twenty-four hours after the
start of transfection, the medium was replaced with fresh growth
medium, and the cells were allowed to grow for 48 h before
functional assay (cAMP assay) was done.
Quantitation of cAMP
Forty-eight hours after the start of transfection, the cells
transfected with SRIF receptor DNA or LacZ control plasmid were washed
with DMEM containing 0.1% BSA (Irvine Scientific, Santa
Ana, CA) and 20 µg/ml gentamicin. The cells were then stimulated for
3 h with 1 µM forskolin in absence or presence of
different concentrations of SRIF peptide in DMEM-0.1% BSA-20 µg/ml
gentamicin containing 0.2 mM methylisobutylxanthine (MIX)
to prevent degradation of cAMP. After stimulation, the medium from each
well was collected in tubes containing sufficient theophylline for a
final concentration of 1 mM. The samples were heated (95 C)
for 5 min to destroy phosphodiesterases. RIA of cAMP was performed by a
modification of the method of Steiner et al. (23), with the
addition of the acetylation step described by Harper and Brooker (24).
cAMP antiserum C-1B (prepared in our laboratory, 25) was used at a
titer of 1:5100. This antiserum showed less than 0.1% cross-reaction
with cGMP, 2',3'-cAMP, 5'-cAMP, 3'-cAMP, ADP, GDP, ATP, CTP, MIX, or
theophylline.
Northern blot analysis
Northern blot analyses was carried out to detect brain and
pituitary distribution of mRNAs for two type one SRIF receptors.
Tissues of five discrete goldfish brain areas, olfactory bulbs and
tracts, telencephalon (including optic nerve and preoptic region),
hypothalamus, optic tectum-thalamus, and posterior brain (including
cerebellum, medulla and spinal cord), and pituitary were freshly
excised and homogenized for extraction of total RNA using Trizol
Reagent as described above. Twenty-two micrograms of total RNA from
individual tissues was fractionated by electrophoresis in a denaturing
agarose gel (1.5%) with formaldehyde and blotted onto Nybond nylon
membrane by capillary transfer. A 942-bp DNA probe that covers most of
the coding region for goldfish sst1A or sst1B
was prepared by PCR with primer set, sst1-F (5'TTAAACTTGGCGATCGCG3')
and sst1-R (5'CACATACTGCAGTGACAACAG3') concensus for both cloned
sst1A and sst1B cDNA sequences with the
sst1A or sst1B plasmid DNA as template. The
probe was labeled with [
-32P]dCTP using T7QuickPrime
Kit based on the random priming technique (20). Hybridization was
performed using methods described in the previous section. After
hybridization, membranes were exposed to a PhosphorImager screen
(Molecular Dynamics, Inc., Sunnyvale, CA) for 72 h,
and the hybridization signals were scanned using a PhosphorImager 445
SI (Molecular Dynamics, Inc.) and analyzed by ImageQuant
software (Molecular Dynamics, Inc.). To serve as an
internal control, the membrane was stripped and reprobed with an
[
-32P]dCTP labeled parital cDNA for goldfish ß-actin
(unpublished results, GenBank accession number AF079831).
RT-PCR and restriction enzyme analysis
The brain distribution of the two goldfish SRIF receptor mRNAs
was further confirmed by RT-PCR followed by restriction enzyme
digestion. The peripheral tissue distributions of the two goldfish SRIF
receptor mRNAs were also examined by this approach. First-strand cDNA
was prepared from total RNA using the SuperScript Preamplification
System and used as templates for PCR using specific primers for the two
goldfish SRIF receptor mRNAs. The primer sets are sst1A-F
(5'GTGCGCGCATTTTCTAAT3') and sst1-R for sst1A mRNA, and
sst1B-F (5'GCGCATTTCCTGAGCGCGTA3') and sst1-R for sst1B.
PCR condition was denaturation 1 min at 95 C, annealing 1 min at 51-53
C and extension 1 min at 73 C for a total of 30 cycles, and a final
extension of 10 min at 73 C. To verify the identities of the RT-PCR
products for each receptor mRNA, restriction enzyme analysis was
carried out. RT-PCR reactions were chloroform extracted and ethanol
precipitated. The DNA pellets were then suspended in buffer solution
for NdeI restriction enzyme (Promega Corp.) and
digested with NdeI at 37 C overnight. The restriction enzyme
reaction was fractionated on 1.5% agarose gel and stained by ethidium
bromide. The gel image was taken using the Imager Documentation System
(Appligene, Oncor, Gaithersburg, MD). For internal control, RT-PCR was
performed at the same time using a primer set (Actin-F:
CTACTGGTATTGTGATGGACTCCG; Actin-R: TCCAGACAGAGTATTTGCGCTCAG) for
goldfish ß-actin. cDNA samples prepared from total RNA without
addition of reverse-transcriptase were used as negative control.
Data analysis
The goldfish sst1 mRNA levels in brain regions and
pituitary were expressed as a ratio between sst1 mRNA and
ß-actin mRNA (internal control) and then normalized as a percentage
of sst1B (2.3 kb) mRNA levels in the telencephalon. The
data for cAMP levels, quantitated by RIA, and SRIF receptor mRNA
levels, quantitated by Northern blot analysis, were subjected to
statistical analysis using ANOVA followed by Student-Newman-Keuls
Multiple Comparisons Test. Differences are considered significant at
P < 0.05. The transfection experiment was repeated at
least three times with similar results.
 |
Results
|
|---|
Two type one goldfish SRIF receptor cDNAs
A partial cDNA clone with nucleotide sequence similar to the
coding region from transmembrane domain (TMD) 3 to TMD7 of mammalian
SRIF receptors was obtained using RT-PCR. This partial cDNA clone was
used as a probe to screen a goldfish brain cDNA library, and two
full-length cDNA clones were isolated and sequenced (GenBank accession
numbers AF097726 and AF097727, Fig. 1
).
Both cDNAs contain a single open reading frame of 1104 bp encoding a
367-amino acid receptor protein, with seven hydrophobic TMDs, a feature
characteristic of the GPCR family, and a YANSCANP motif in the putative
7th TMD, a signature sequence for the mammalian sst family (Fig. 1
).
The two cDNAs share 92% similarity in nucleotide sequence and 98%
similarity in the deduced amino acid sequences (5 out of 367 amino
acids). The amino acid sequences of the two receptors have 76% and
75% similarity to human or rat sst1 receptor, respectively
(Fig. 2
), and 3955% similarities to
other mammalian sst subtypes (sst25), indicating that the
two receptors could be the goldfish homologs of mammalian
sst1 receptor, and thus designated as gsst1A
and gsst1B (Fig. 1
). The intracellular loops and
extracellular loops (ECL), TMDs, and the intracellular C-terminal
domain were largely conserved between goldfish and mammalian
sst1 receptors, whereas the NH2-terminal
extracellular domain were extremely divergent between goldfish and
mammalian sst1 receptors (Fig. 2
). There are three
consensus sequences (Asn-X-Ser/Thr) for Asn (N)-linked glycosylation
(Asn4, Asn18, Asn22) in the
putative extracellular NH2-terminal domain. There are two
putative phosphorylation sites (Thr148 and
Ser241) for cAMP-dependent protein kinase and protein
kinase C (26), respectively, in regions that are predicted to be the
second and third intracellular loops, which are also conserved in
mammalian sst1 receptors. The intracellular C-terminal
domain is also Ser- and Thr-rich and could serve as a substrate for
Ser/Thr protein kinases (27). Several amino acids that are conserved
within the DRY-containing (rhodopsin) family of GPCRs (28, 29) are also
conserved in the two goldfish SRIF receptors, similar to their
mammalian counterparts. These motifs include GNX2V (1st
TMD), NLAXAD (2nd TMD), SX3LX3SXDRY (3rd
TMD-2nd intracellular loop), WX2SX5P (4th TMD),
FX2P (5th TMD), FX2CWXP (6th TMD) and
NSX2NPX2Y (7th TMD), which may serve to define
the conformation required for receptor function. In addition, two
conserved Cys residues appear in the first and second putative ECLs
(Cys106 and Cys184), which are shown to form a
disulfide bond to stabilize tertiary structure in other GPCRs (29). An
additional highly conserved Cys residue is found within the
intracellular C-terminal domain (Cys315) (Fig. 1
and 2
).
This residue has been shown to be palmitoylated in the
ß2- and
2-adrenergic receptors and
rhodopsin and could anchor a part of the intracellular C-terminal
domain of the receptor to the plasma membrane (30, 31, 32).

View larger version (75K):
[in this window]
[in a new window]
|
Figure 1. Comparison of the cDNA and deduced amino acid
sequences of the two goldfish type one SRIF receptors
(sst1A and sst1B). The cDNA sequences are shown
as lower case letters, whereas deduced amino acid
sequences are shown as single letter abbreviations in upper
case. Nucleotides are numbered from 5' to 3' and the amino acid
residues are numbered starting with the start codon in the open reading
frame. The nucleotide sequence regions in sst1B cDNA that
is identical to the corresponding regions of sst1A are
indicated by dashes. The complete amino acid sequence
for sst1A is shown. Amino acid residues of the
corresponding sst1B that differ from those of
sst1A are shown in boldface type following
sst1A residues with a slash. Three concensus sites
(Asn-X-Ser/Thr) for N-linked glycosylation in the extracellular
N-terminal domain are indicated by ellipsis. The
potential phosphorylation sites for cAMP-dependent protein kinase and
protein kinase C are boxed.
|
|

View larger version (81K):
[in this window]
[in a new window]
|
Figure 2. Sequence alignment of the two goldfish type one
SRIF receptors (gsst1A and gsst1B) to the rat
(rsst1), human (hsst1) and mouse
(msst1) type one SRIF receptors. The putative transmembrane
domains (TMD) are indicated as predicted by HMMTOP method (49 ).
Consensus amino acid residues are indicated by
asterisks. Dashed lines represent spaces
introduced to optimize alignment. The amino acid positions are given at
the right. The three consensus sites for N-linked glycosylation in the
extracellular NH2-terminal domain are indicated by
black background. The sequences for mammalian
sst1 receptors (35 36 37 ) are from GenBank database
(accession numbers M97656, M81831, M81829).
|
|
Pharmacological characterization of goldfish type one SRIF
receptors
For functional characterization, the cloned goldfish
sst1 receptor cDNAs were transiently transfected in COS-7
cells. The transfected cells were treated with forskolin (1
µM) to elevate cAMP levels in the absence or presence of
SRIF peptides. Both native goldfish SRIF peptides, SRIF-14 and
[Pro2]SRIF-14, displayed a significant and dose-dependent
inhibition of forskolin-stimulated cAMP production, with comparable
potency, in COS-7 cells transiently expressing gsst1A or
gsst1B, indicating that both receptors are negatively
coupled to adenylate cyclase (Fig. 3
).
Activation of gsst1A and gsst1B receptors by
either peptide resulted in an approximately 3640% and 3032%
decrease of cAMP release, respectively (Fig. 3
). There was no effect on
basal cAMP release by either peptide in COS-7 cells transiently
expressing gsst1A or gsst1B receptors (data not
shown). There was no effect on cAMP release by either peptide in
untransfected COS-7 cells or COS-7 cells transiently transfected with
control plasmid DNA (data not shown).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 3. Inhibition of forskolin-stimulated cAMP release by
SRIF peptides in COS-7 cells transiently transfected with the goldfish
type one SRIF receptor sst1A (A) and sst1B (B).
Forty-eight hours after transfection, COS-7 cells were stimulated with
1 µM forskolin for 3 h in the presence or absence of
different concentrations of SRIF-14 or [Pro2]SRIF-14.
Data shown are the means of triplicate determinations ±
SEM. Treatments giving similar cAMP responses were grouped
within same underscore (P < 0.05, ANOVA followed
by Student-Newman-Keuls Multiple Comparisons Test).
|
|
Differential tissue distribution of two goldfish SRIF receptor
mRNAs
To examine the brain and pituitary distributions of the two
goldfish sst1 mRNAs, total RNA prepared from pituitary and
five different brain areas, including olfactory bulbs and tracts,
telencephalon-preoptic region, hypothalamus, optic tectum-thalamus, and
posterior brain region, was subjected to Northern blot analysis (Fig. 4
). The same results were obtained using
[
-32P]-labeled sst1A probe or
sst1B probe, as both probes share 95% nucleotide sequence
similarity. Two mRNA transcripts for goldfish sst1
receptors of 2.3 kb and 3.8 kb were consistently identified in all five
brain areas, with different expression levels between the brain regions
and between the two gene transcripts within a brain region (Fig. 4B
).
However, only one mRNA transcript (2.3 kb) was detected in pituitary
(Fig. 4B
). The mRNA levels for both gene transcripts were significantly
higher in telencephalon-preoptic region and hypothalamus than in other
brain regions and pituitary (Fig. 4D
). The mRNA levels for the two
transcripts are similar within a brain region, except olfactory bulbs,
where mRNA levels for 2.3 kb transcript were significantly higher than
the 3.8 kb transcript (Fig. 4D
).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 4. Distribution of the two type one goldfish SRIF
receptor (sst1) mRNAs in brain and pituitary as revealed by
Northern blot analysis. Total RNA was prepared from five brain regions,
specifically olfactory bulb and tract (OB), telencephalon-preoptic
region (TEL), hypothalamus (HYP), optic tectum-thalamus (OT-THAL),
posterior brain region (POST), and pituitary (PIT). The RNA (22 µg)
was fractionated on denaturing agarose gel and transblotted onto Nybond
nylon membranes. The membrane was hybridized with one of the goldfish
sst1 receptor cDNA probes labeled with [ -32P]dCTP and
exposed to a PhosphorImager screen. A, Dissection of the goldfish brain
regions and pituitary used for RNA extraction. ON, Optic nerve. B,
Representative image showing hybridization signals of two
sst1 receptor mRNAs in brain regions and pituitary. C,
Representative image showing hybridization signals of goldfish
ß-actin mRNA performed as an internal control. D, mRNA levels for two
sst1 in different brain regions and pituitary.
Hybridization signals were detected using PhosphorImager and
quantitated using ImageQuant program. The sst1 mRNA levels
were expressed as a ratio between sst1 mRNA and ß-actin mRNA (internal control) and then normalized
as a percentage of sst1B (2.3 kb) mRNA levels in the
telencephalon. Data are mean ± SEM (n = 4).
Similar mRNA levels are grouped within same underscore
(P < 0.05, ANOVA followed by Student-Newman-Keuls
Multiple Comparisons Test).
|
|
The peripheral tissue distribution of the two goldfish sst1
mRNAs was examined using RT-PCR followed by restriction enzyme
digestion (Fig. 5A
).
The primer set specific for goldfish sst1A mRNA amplified
an expected size of 1225 bp PCR product; the primer set specific for
goldfish sst1B mRNA amplified an expected size of 1220 bp
PCR product. The predicted sequences of the RT-PCR product generated by
the primer set for sst1A mRNA contained a unique
NdeI restriction endonuclease site at position 706 (position
+642 relative to the start codon) and the predicted sequence of the
RT-PCR product generated by the primer set for sst1B mRNA
did not. Thus, the 1225 bp PCR product for sst1A was
digested by NdeI into two fragments of 706 bp and 519 bp.
The 1220 bp PCR product for sst1B was not digested by
NdeI. The two DNA fragments derived from sst1A
mRNA were detected in brain, kidney, and testis. In other tissues,
including intestine, liver, muscle, pituitary, and ovary, no PCR
product for sst1A mRNA was detected. The single DNA
fragment from sst1B mRNA was detected in brain, kidney, and
testis, as well as intestine and pituitary, where sst1A
product was not detected. No PCR product for sst1B was
detected in other tissues examined. The RT-PCR product for
sst1B, but not for sst1A, was detected in the
pituitary, indicating that the 2.3 kb gene transcript in the pituitary
as revealed by Northern blot represents sst1B mRNA, whereas
3.8 kb gene transcript is sst1A mRNA.

View larger version (91K):
[in this window]
[in a new window]
|
Figure 5. Peripheral (A) and brain (B) distribution of the
two type one goldfish SRIF receptor (sst1) mRNAs as
revealed by RT-PCR followed by restriction enzyme analysis. cDNA was
prepared from the total RNA samples from different tissues, brain (1 ),
heart (2 ), intestine (3 ), kidney (4 ), liver (5 ), muscle (6 ), pituitary
(7 ), ovary (8 ), and testis (9 ), and five brain regions, including
olfactory bulb and tract (10 ), telencephalon-preoptic region (11 ),
hypothalamus (12 ), optic tectum-thalamus (13 ), and posterior brain
region (14 ). PCR was performed using the specific primer set for each
goldfish SRIF receptor mRNA. RT-PCR reactions were chloroform extracted
and ethanol precipitated. The DNA products were then digested with
NdeI and fractionated on 1.5% agarose gel. In (A) and
(B), arrows indicate the expected size of RT-PCR
products for sst1A (706 bp and 519 bp) and for
sst1B (1220 bp) after digestion with NdeI.
RT-PCR products (580 bp) for goldfish ß-actin (internal control) is
shown in (C). The negative images of ethidium bromide-staining of the
agarose gels are shown.
|
|
The differential brain distribution of the two goldfish
sst1 mRNAs was confirmed using RT-PCR followed by
restriction enzyme digestion (Fig. 5B
). The two fragments (706 bp and
519 bp) from sst1A mRNA were detected in all five brain
regions. The single 1220 bp DNA fragment for sst1B mRNA was
also detected in all five brain regions.
The primer set specific for goldfish ß-actin mRNA amplified a PCR
product of 580 bp in all of the tissues and brain regions examined,
verifying the quality and integrity of the cDNA samples (Fig. 5C
).
There was no PCR product detected in the negative controls (data not
shown).
 |
Discussion
|
|---|
In this study, two type one SRIF receptor cDNAs were cloned and
sequenced from goldfish brain. To our knowledge, this is the first such
report in nonmammalian vertebrates. The deduced 367-amino acid goldfish
type one SRIF receptors (sst1A and sst1B) have
7576% similarity to mammalian sst1 receptor, and only 3955%
similarities to other mammalian sst subtypes. The two receptors
expressed in COS-7 cells showed ability to mediate the action of native
goldfish SRIF peptides. In addition, two receptor mRNA are widely
expressed throughout the brain and only one receptor mRNA is expressed
in the pituitary.
The two goldfish type one SRIF receptor cDNAs share 92% similarity in
nucleotide sequences and 98% similarity in the deduced amino acid
sequences, and are presumably derived from duplicate genes. Genome
duplication (or tetraploidization) is thought to be one genetic basis
for the origin of a multigene family (33). Duplicate loci and sequence
diversity in goldfish was first demonstrated for the synapse protein
SNAP-25, consistent with a more recent tetraploidization event in the
present-day goldfish (34). Although many duplicate genes for
neuropeptides, hormones, or isozymes in goldfish have been elucidated
using molecular cloning approaches, whether these duplicate genes are
derived from the gene duplication during early vertebrate evolution or
from a more recent tetraploidization event is not always clear. The
present finding of duplicate genes for goldfish type one sst receptors,
with high amino acid homology and similar receptor pharmacology
(discussed below), suggest that the two receptors derived from a recent
tetraploidization event.
Five subtypes of SRIF receptor (sst) have been identified by molecular
cloning of their cDNAs or genes in several mammalian species (2, 3, 13, 14). Among them, sst1 has been identified in human (35, 36), rat, and mouse (37). However, there have been no reports on the
molecular cloning of SRIF receptors in nonmammalian vertebrates, which
could contribute to the understanding of structure/function evolution
of the mammalian sst family. The two cloned goldfish SRIF receptors
showed only 2425% sequence divergence compared with their mammalian
counterparts. The difference between goldfish and mammalian
sst1 is mainly reflected by the extreme divergence in their
extracellular N termini, whereas TMDs and extracellular and
intracellular domains are highly conserved. Similar to mammalian ssts,
both goldfish sst1 receptors display most of the conserved
sequence motifs in TMD17, common to the rhodopsin family of the
GPCRs. In addition, the YANSCANP motif within the TMD7 was found in
both goldfish sst1s, which is thought to be a signature
motif for identification of mammalian ssts (2, 3, 14). Three consensus
Asn-linked glycosylation sites were identified in the cloned goldfish
sst1 receptors. Surprisingly, localization of the three
Asn-linked glycosylation sites is identical or similar to the
corresponding glycosylation sites in human, rat and mouse
sst1 receptors (35, 36, 37).
The ligand binding site of GPCRs for short peptides typically involves
residues in the ECLs and TMDs (38). Studies with chimeras of mouse
sst1 and sst2 indicated that the structural
determinants in the third ECL and its surrounding TMD regions are
responsible for selective binding of octapeptide analogs (39, 40). In
contrast, the structural determinants in the second ECL are responsible
for binding of the sst1 selective peptide
des-AA1,2,5-[D-Trp8,IAMP9]SST-14
(40). Mutational analysis of human sst5 receptor suggest an
overall binding domain for SRIF ligand made up of residues within
TMDs37, with a potential contribution by the second ECL (41).
Comparison of goldfish sst1 with mammalian sst1
reveals that the sequences of ECL2 and ECL3 are quite different from
each other. These sequence differences in ECL2 and ECL3 could result in
differences in agonist selectivity between goldfish and mammalian
sst1.
All five subtypes of sst in mammals bind SRIF-14 and mammalian SRIF-28
with high affinity, whereas sst5 exhibits weak selectivity
for SRIF-28 (2, 3, 13, 14). Mutational analysis with sst5
receptor revealed that the region encompassing TMD6 through the
C-terminus in sst5 may be critical for the lower binding
affinity of SRIF-14 in comparison with SRIF-28 (42). Substitution of
Phe265 of TMD6 in sst5 with a Tyr, the
corresponding residue of the other ssts (sst14), improved
the binding of SRIF-14 to an affinity comparable to that observed for
sst2, suggesting that Tyr in TMD6 of sst14
may be an important contact point between SRIF-14 and sst subtypes.
Interestingly, a His residue in goldfish sst1 receptors
(His264) is found in the corresponding position of the
conserved Tyr residue in mammalian sst14. Recent cloning
of three PSSs encoding cDNAs from goldfish brain indicated that the
three PSSs may be potentially processed into SRIF-14, goldfish SRIF-28,
and [Pro2]SRIF-14, respectively (6). There are 11 amino
acids different between mammalian SRIF-28 and goldfish brain SRIF-28.
Whether the substitution of Tyr with His in goldfish sst1
receptors is important for binding of a SRIF-14 variant or goldfish
SRIF-28 in goldfish remains to be investigated.
All mammalian ssts, except for sst5, display a Glu in TMD2
adjacent to the conserved Asp in LAXAD motif. Substitution of the Glu
in sst3 with Gln, Val, or Leu, increased Na+
sensitivity of agonist binding (43). This Glu residue is also conserved
(Glu81) in goldfish sst1A, whereas a
Asp81 is found in the corresponding position in goldfish
sst1B, suggesting that two goldfish sst1
receptors may have different Na+ sensitivity of ligand
binding.
All five subtypes of mammalian sst are coupled to multiple cellular
effectors including adenylate cyclase (3, 14). In goldfish, it has been
shown that SRIF-14 interferes with cAMP-dependent mechanisms to inhibit
basal and stimulated GH release from pituitary cells (44). In the
present study, two native goldfish SRIF peptides, SRIF-14 and
[Pro2]SRIF-14, inhibited forskolin-stimulated cAMP
production, at comparable potencies, in COS-7 cells expressing goldfish
sst1A or sst1B receptors. These results
indicated that both cloned receptors are able to bind SRIF peptides,
mediate activation by SRIF peptides, and couple to inhibition of
adenylate cyclase, consistent with the observation for mammalian sst
receptors. In addition, there were no apparent differences between two
goldfish sst1 receptors in their potencies for mediating
action of SRIF-14 and [Pro2]SRIF-14, suggesting that two
receptors display similar affinity for both peptides. Comparison of two
goldfish sst1 receptors shows only five amino acids
difference. Among them, two distinct residues are localized in
extracellular N-terminal domain and intracellular C-terminal domain,
respectively; these residues may not contribute to the domain for
ligand binding. The other three residues include Glu81 and
Asp81 in TMD2, Met266 and Val266 in
TMD6, and Ala278 and Ser278 in ECL3 of
sst1A and sst1B, respectively. Interestingly,
Glu81, Val266, and Ala278 are
conserved residues in mammalian sst1, but variable among
five subtypes of sst. These comparisons suggest that these variable
residues may not be responsible for the binding domain for SRIF-14.
[Pro2]SRIF-14 is a SRIF-14 variant, identified from
goldfish brain by molecular cloning (6). The present results showed
that [Pro2]SRIF-14 displayed a similar potency to SRIF-14
in inhibition of forskolin-stimulated cAMP production through
sst1 receptors. Our previous studies showed that
[Pro2]SRIF-14 inhibited basal or stimulated GH release
from goldfish pituitary, with similar potency to that observed for
SRIF-14 (6). Taken together, these results suggest that
sst1, in at least goldfish, is not able to distinguish
SRIF-14 from a variant with substitution of Gly2 with
Pro2.
The mRNAs for sst receptors are widely expressed at varying levels in
human and rodent tissues and have distinct but overlapping patterns of
expression (3, 14). All five subtypes of ssts are expressed in the
central nervous system and pituitary (3, 14). In rat brain,
sst1 mRNA is present throughout the brain and heavily
expressed in hypothalamic neurons containing somatostatin and/or
GH-releasing hormone (GHRH) (45, 46, 47). In the present study, mRNAs for
both sst1 receptors are expressed throughout goldfish
brain. High levels of both mRNAs were found in telencephalon and
hypothalamus. In peripheral tissues, only sst1B mRNA was
found in pituitary and intestine, whereas both mRNAs were found in
kidney and testis. The higher expression of both sst1
mRNAs in the telencephalon-preoptic region and hypothalamus
suggests that both sst1 receptors may participate in the
central regulation of brain neuropeptides, such as GHRH, GnRH, and
neuropeptide Y. These neuropeptide neurons are mainly localized in the
telencephalon-preoptic region and hypothalamus, and are likely also
involved in controlling pituitary GH secretion in goldfish (48).
However, the expression of only sst1B mRNA in pituitary
suggests that only one form of sst1 may be involved in
regulation of pituitary hormone secretion. It is unknown why only
sst1B mRNA is expressed in pituitary and intestine. The
differential expression pattern of the two receptor mRNAs could result
from the usage of distinct promoters and regulatory mechanisms for gene
transcription of the two receptors.
In summary, two type one SRIF receptor cDNAs were identified from
goldfish brain, with 8% sequence divergence. The two goldfish
sst1 receptors share high similarity to mammalian
sst1 receptors. Both receptors showed ability to mediate
inhibition of forskolin-stimulated cAMP production by two native
goldfish SRIF peptides. In addition, both receptors are differentially
expressed throughout brain and some peripheral tissues; however, only
one receptor is expressed in the pituitary, indicating that only one of
the receptors is involved in the regulation of pituitary hormone
secretion.
 |
Acknowledgments
|
|---|
We thank Drs. J. Rivier and H. R. Habibi for providing
[Pro2]SRIF-14 and goldfish brain cDNA library,
respectively, and Pierre Peyon and Helene Volkoff for their
assistance.
 |
Footnotes
|
|---|
1 This research was supported by grant A6371 from NSERC to REP. 
Received April 15, 1999.
 |
References
|
|---|
-
Brazeau P, Vale WW, Burgus R, Ling N, Butcher M,
Rivier J, Guillemin R 1973 Hypothalamic polypeptide that inhibits
the secretion of immunoreactive pituitary growth hormone. Science 179:7779[Abstract/Free Full Text]
-
Reisine T, Bell GI 1995 Molecular biology of
somatostatin receptors. Endocr Rev 16:427442[CrossRef][Medline]
-
Patel YC, Srikant CB 1997 Somatostatin receptors.
Trends Endocrinol Metab 8:398405[Medline]
-
Conlon JM, Tostivint H, Vaudry H 1997 Somatostatin- and urotensin II-related peptides: molecular diversity
and evolutionary perspectives. Regul Pept 69:95103[CrossRef][Medline]
-
Lin XW, Otto CJ, Peter RE 1998 Evolution of
neuroendocrine peptide systems: gonadotropin-releasing hormone and
somatostatin. Comp Biochem Physiol 119C:375388
-
Lin X, Otto CJ, Peter RE 1999 Expression of three
distinct somatostatin messenger ribonucleic acids (mRNAs) in goldfish
brain: characterization of the complementary deoxyribonucleic acids,
distribution and seasonal variation of the mRNAs, and action of a
somatostatin-14 variant. Endocrinology 140:20892099[Abstract/Free Full Text]
-
Moore CA, Kittilson JD, Dahl SK, Sheridan MA 1995 Isolation and characterization of a cDNA encoding for
preprosomatostatin containing [Tyr7
Gly10]-somatostatin-14 from the endocrine pancreas of
rainbow trout, Oncorhynchus mykiss. Gen Comp Endocrinol 98:
253261
-
Hobart P, Crawford R, Shen LP, Pictet R, Rutte WJ 1980 Cloning and sequence analysis of cDNAs encoding two distinct
somatostatin precursors found in the endocrine pancreas of anglerfish.
Nature 288:137141[CrossRef][Medline]
-
Tostivint H, Lihrmann I, Bucharles C, Vieau D,
Coulouarn Y, Fournier A, Conlon JM, Vaudry H 1996 Occurrence of
two somatostatin variants in the frog brain: characterization of the
cDNAs, distribution of the mRNAs, and receptor-binding affinities of
the peptides. Proc Natl Acad Sci USA 93:1260512610[Abstract/Free Full Text]
-
de Lecea L, Criado JR, Prospero O, Gautvik KM,
Schweitzer P, Danielson PE, Dunlop CM, Siggins GR, Henriksen SJ,
Sutcliffe JG 1996 A cortical neuropeptide with neuronal depressant
and sleep-modulating properties. Nature 381:242245[CrossRef][Medline]
-
de Lecea L, Ruiz-Lozano P, Danielson PE, Peelle-Kirley
J, Foye PE, Frankel WN, Sutcliffe JG 1997 Cloning, mRNA
expression, and chromosomal mapping of mouse and human
preprocortistatin. Genomics 42:499506[CrossRef][Medline]
-
Fukusumi S, Kitada C, Takekawa S, Kizawa H, Sakamoto J,
Miyamoto M, Hinuma S, Kitano K, Fujino M 1997 Identification and
characterization of a novel human cortistatin-like peptide. Biochem
Biophys Res Commun 232:157163[CrossRef][Medline]
-
Hoyer D, Bell GI, Berelowitz M, Epelbaum J, Feniuk W,
Humphrey PPA, OCarroll A-M, Patel YC, Schonbrumm A, Taylor JE,
Reisine T 1995 Classification and nomenclature of somatostatin
receptors. Trends Pharmacol Sci 16:8688[CrossRef][Medline]
-
Meyerhof W 1998 The elucidation of somatostatin
receptor functions: a current view. Rev Physiol Biochem Pharmacol 133:55108[Medline]
-
Laquerrière, A, Leroux P, Gonzalez BJ, Bodenant C,
Benoit R, Vaudry H 1989 Distribution of somatostatin receptors in
the brain of the frog Rana ridibunda: correlation with the
localization of somatostatin-containing neurons. J Comp Neurol 280:451467[CrossRef][Medline]
-
Vallarino M, Trabucchi M, Masini MA, Chartrel N, Vaudry
H 1997 Immunocytochemical localization of somatostatin and
autoradiographic distribution of somatostatin binding sites in the
brain of the African lungfish, Protopterus annectens. J
Comp Neurol 388:337353[CrossRef][Medline]
-
Pesek MJ, Sheridan MA 1996 Fasting alters
somatostatin binding to liver membranes of rainbow trout
(Oncorhynchus mykiss). J Endocrinol 150:179186[Abstract]
-
Pesek MJ, Howe N, Sheridan MA 1998 Somatostatin
binding to hepatocytes isolated from rainbow trout, Oncorhynchus
mykiss, is modulated by insulin and glucagon. Gen Comp Endocrinol 112:183190[CrossRef][Medline]
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acid guanidunium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162:15561559
-
Feinberg AP, Vogelstein B 1983 A technique for
radiolabeling DNA restriction endonuclease fragments to high
specificity activity. Anal Biochem 1983:132:613
-
Church GM, Gilbert W 1984 Genomic sequencing. Proc
Natl Acad Sci USA 81:19911995[Abstract/Free Full Text]
-
Steiner AL, Parker CW, Kipnis DM 1972 Radioimmunoassay for cyclic nucleotides. J Biol Chem 247:11061113[Abstract/Free Full Text]
-
Lin X, Conn PM 1998 Transcriptional activation of
gonadotropin-releasing hormone (GnRH) receptor gene by GnRH and cyclic
adenosine monophosphate. Endocrinology 139:38963902[Abstract/Free Full Text]
-
Harper JF, Brooker G 1975 Femtomole sensitive
radioimmunoassay of cyclic AMP and cyclic GMP after 2'0 acetylation by
acetic anhydride in aqueous solution. J Cyclic Nucleotide Res 1:207218[Medline]
-
Andrews WV, Conn PM 1986 Gonadotropin-releasing
hormone stimulates mass changes in phosphoinositides and diacylglycerol
accumulation in purified gonadotrope cell cultures. Endocrinology 118:11481158[Abstract]
-
Kemp BE, Pearson RB 1990 Protein kinase recognition
sequence motifs. Trends Biochem Sci 15:342346[Medline]
-
Sibley DR, Benovic JL, Caron MG, Lefkowitz RJ 1988 Phosphorylation of cell surface receptors: a mechanism for regulating
signal transduction pathways. Endocr Rev 9:3856[Medline]
-
Sealfon SC 1998 Synthesis, internalization,
recycling and regulation of peptide hormone receptors. In: Conn PM (ed)
The Handbook of Physiology: The Endocrine System Vol I, Cellular
Endocrinology. Oxford University Press, New York, pp 2338
-
Strader CD, Fong TM, Tota MR, Underwood D 1994 Structure and function of G protein-coupled receptors. Annu Rev Biochem 63:101132[CrossRef][Medline]
-
ODowd BF, Hnatowich M, Caron MG, Lefkowitz RJ, Bouvier
M 1989 Palmitoylation of the human ß2-adrenergic
receptor. Mutation of Cys341 in the carboxyl tail leads to an uncoupled
nonpalmitoylated form of the receptor. J Biol Chem 264:75647569[Abstract/Free Full Text]
-
Kennedy M, Limbird LE 1993 Mutations of the
2A-adrenergic receptor that eliminate detectable
palmitoylation do not perturb receptor-G-protein coupling. J Biol
Chem 268:80038011[Abstract/Free Full Text]
-
Papac DI, Thornburg KR, Bullesbach EE, Crouch RK, Knapp
DR 1992 palmitoylation of a G-protein coupled receptor. Direct
analysis by tandem mass spectrometry. J Biol Chem 267:1688916894[Abstract/Free Full Text]
-
Ohno S 1970 Evolution by Gene Duplication.
Springer-Verlag, Berlin/New York, pp 5988
-
Risinger C, Larhammar D 1993 Multiple loci for
synapse protein SNAP-25 in the tetraploid goldfish. Proc Natl Acad Sci
USA 90:1059810602[Abstract/Free Full Text]
-
Li X-J, Forte M, North RA, Ross CA, Snyder SH 1992 Cloning and expression of a rat somatostatin receptor enriched in
brain. J Biol Chem 267:2130721312[Abstract/Free Full Text]
-
Meyerhof W, Paust H-J, Schönrock C, Richter D 1991 Cloning of a cDNA encoding a novel putative G-protein-coupled
receptor expressed in specific rat brain regions. DNA Cell Biol 10:689694[Medline]
-
Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino
S 1992 Cloning and functional characterization of a family of
human and mouse somatostatin receptors expressed in brain,
gastrointestinal tract, and kidney. Proc Natl Acad Sci USA 89:251255[Abstract/Free Full Text]
-
Ji TH, Grossmann M, Ji I 1998 G Protein-coupled
receptors. I. Diversity of receptor-ligand interactions. J Biol
Chem 273:1729917302[Free Full Text]
-
Kaupmann K, Bruns C, Raulf F, Weber HP, Mattes H,
Lübbert H 1995 Two amino acids, located in transmembrane
domains VI and VII, determine the selectivity of the peptide agonist
SMS 201995 for the SSTR2 somatostatin receptor. EMBO J 14:727735[Medline]
-
Liapakis G, Fitzpatrick D, Hoeger C, Rivier J, Vandlen
R, Reisine T 1996 Identification of ligand binding determinants in
the somatostatin receptor subtypes 1 and 2. J Biol Chem 271:2033120339[Abstract/Free Full Text]
-
Greenwood MT, Hukovic N, Kumar U, Panetta R, Hjorth SA,
Srikant CB, Patel YC 1997 Ligand binding pocket of the human
somatostatin receptor 5:mutational analysis of the extracellular
domains. Mol Pharmacol 52:807814[Abstract/Free Full Text]
-
Ozenberger BA, Hadcock JR 1995 A single amino acid
substitution in somatostatin receptor subtype 5 increases affinity for
somatostatin-14. Mol Pharmacol 47:8287[Abstract]
-
Nehring R, Meyerhof W, Richter D 1996 Mutation of
glutamate residue 92 of the rat somatostatin receptor subtype 3
enhances sodium regulation of sst-14 binding. In: Krish B, Mentlein R
(eds) The Peptidergic Neuron. Birkhäuser, Basel, pp 135140
-
Peter RE, Chang JP 1997 Growth hormone secretion in
fish. In: Kawashima S, Kikuyama S (eds) Advances in Comparative
Endocrinology. Proceedings of the XIIIth International Congress of
Comparative Endocrinology (Japan), November 1721:1997. Monduzzi
Editore, Bologna, Italy, pp 915919
-
Kong H, DePaoli AM, Breder CD, Yasuda K, Bell GI,
Reisine T 1994 Differential expression of messenger RNAs for
somatostatin receptor subtypes SSTR1, SSTR2 and SSTR3 in adult rat
brain: analysis by RNA blotting and in situ hybridization
histochemistry. Neuroscience 59:175184[CrossRef][Medline]
-
Beaudet A, Greenspun D, Raelson J, Tannenbaum GS 1995 Patterns of expression of SSTR1 and SSTR2 somatostatin receptor
subtypes in the hypothalamus of the adult rat: relationship to
neuroendocrine function. Neuroscience 65:551561[CrossRef][Medline]
-
Senaris RM, Humphrey PP, Emson PC 1994 Distribution
of somatostatin receptors 1, 2 and 3 mRNA in rat brain and pituitary.
Eur J Neurosci 6:18831896[CrossRef][Medline]
-
Peng C, Peter RE 1997 Neuroendocrine regulation of
growth hormone secretion and growth in fish. Zool Stud 36:7989
-
Tusnády GE, Simon I 1998 Principles governing
amino acid composition of integral membrane proteins: application to
topology prediction. J Mol Biol 283:489506[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
L. F. Canosa, S. Unniappan, and R. E. Peter
Periprandial changes in growth hormone release in goldfish: role of somatostatin, ghrelin, and gastrin-releasing peptide
Am J Physiol Regulatory Integrative Comp Physiol,
July 1, 2005;
289(1):
R125 - R133.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. K. Yunker, S. Smith, C. Graves, P. J. Davis, S. Unniappan, J. E. Rivier, R. E. Peter, and J. P. Chang
Endogenous Hypothalamic Somatostatins Differentially Regulate Growth Hormone Secretion from Goldfish Pituitary Somatotropes in Vitro
Endocrinology,
September 1, 2003;
144(9):
4031 - 4041.
[Abstract]
[Full Text]
[PDF]
|
 |
|