help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fang, Y.
Right arrow Articles by Nilsen-Hamilton, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fang, Y.
Right arrow Articles by Nilsen-Hamilton, M.
Endocrinology Vol. 140, No. 11 5239-5249
Copyright © 1999 by The Endocrine Society


ARTICLES

Signaling between the Placenta and the Uterus Involving the Mitogen-Regulated Protein/Proliferins1

Yu Fang2, Pierig Lepont, John T. Fassett, Stephen P. Ford, Adnan Mubaidin3, Richard T. Hamilton and Marit Nilsen-Hamilton

Department of Biochemistry (Y.F., P.L., M.N.-H.), Biophysics and Molecular Biology, Department of Zoology and Genetics (J.T.F., R.T.H.), and Department of Animal Sciences (S.P.F.), Iowa State University, Ames, Iowa 50011

Address all correspondence and requests for reprints to: Marit Nilsen-Hamilton, Department of Biochemistry, Biophysics and Molecular Biology, Iowa State University, 3206 Molecular Biology Building, Ames, Iowa 50011. E-mail: marit{at}iastate.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The aim of this investigation was to examine signaling between the placenta and uterus during pregnancy. To do this, we determined the tissue messenger RNA and protein levels of members of a glycopeptide hormone family known to stimulate the proliferation of uterine cells and related these levels to the growth of the uterus during pregnancy in the mouse. This hormone family is known as mitogen-regulated protein (MRP); alternatively proliferin (PLF). Three mrp/plf genes, plf1, mrp3 and mrp4, are expressed by the placenta with different developmental profiles. The major increase of about 4-fold in DNA content of the uterus occurs between days 9 and 14 when MRP/PLFs are present in the placenta. By contrast, the gestational changes in estradiol-17ß levels in placental and uterine tissues and in circulation do not correlate with the period of uterine growth. The previously reported mitogenic activity of the MRP/PLFs and their gestational profiles suggest that one or more of these proteins stimulates uterine proliferation during gestation. Evidence is also presented that expression of MRP3 and/or PLF1, but not MRP4, is negatively regulated by feedback from the uterus. Our results are consistent with the hypothesis that MRP/PLFs stimulate uterine proliferation in vivo and that a uterine factor shuts off PLF1 and/or MRP3 synthesis in the latter half of gestation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
UNIQUE to mammals is the long gestational period during which the fetus depends on the mother for its continued nourishment and development. Implicit in this arrangement is the need for communication between the mother and fetus, which results in coordinated action of the uterus and the placenta and is essential for a successful pregnancy. Communication occurs through hormones and growth factors that are produced by the feto-placental unit and by the uterus at various stages during gestation. Among the hormone families involved in fetal/maternal communication and control of reproduction is the PRL/GH family, which includes the mitogen-regulated proteins/proliferins (MRP/PLFs). The functions currently ascribed to this family include stimulation of uterine cell proliferation (1), development of the placental capillary network (2), and inhibition of skeletal myoblast differentiation (3). If functional in vivo, the first two of these effects would result in increased uterine mass to support the fetus and increased blood flow and nutrients for fetal growth.

During pregnancy, many growth factors produced by the uterus and the fetus are believed to regulate growth and differentiation of fetal and maternal tissues. The expression of growth factors such as insulin-like growth factor, epidermal growth factor, heparin-binding epidermal growth factor, transforming growth factor type {alpha}, and platelet-derived growth factor are regulated by estrogens (4, 5, 6, 7, 8, 9, 10, 11, 12, 13). These growth factors are believed to be estromedins, mediating the uterine proliferative response to estrogen. Estrogen-mediated uterine proliferation occurs during each estrous cycle and can be easily demonstrated in the ovariectomized mouse (14, 15). During pregnancy, the uterus undergoes additional growth that is related to the presence of the fetus. A potential source of this growth signal are the MRP/PLFs, which are secreted by the placenta in midgestation (1, 16). At the peak, the amount of MRP/PLFs produced during pregancy is directly proportional to the number of fetuses (16). Thus, the MRP/PLFs could provide a signal for uterine growth that is proportional to the number of fetuses present.

Five mrp/plf messenger RNA (mRNA) sequences have been identified, one of which is an alternatively spliced form of one of the four identified gene products (17–20; Fassett JT, Nilsen-Hamilton M, Hamilton RT, manuscript submitted, GenBank accession no. AF 128884). The four mrp/plf genes are plf1, plf2, mrp3, and mrp4 (18–20; Fassett JT, Nilsen-Hamilton M, Hamilton RT, manuscript submitted, GenBank accession no. AF 128884). The sequences of the four proteins expressed from these genes vary in just a few positions. These few differences in amino acid sequence don’t enable the different proteins to be distinguished by antibodies, whereas the different mRNAs can be distinguished with specific oligonucleotide probes and by diagnostic RT-PCR, as used for this report.

The aim of the work described here was to identify the fetal-maternal interactions that might involve the actions of MRP/PLF family members. Here, we demonstrate that three mrp/plf genes (plf1,mrp3, and mrp4) are expressed in the placenta, with the most abundant mRNA being mrp3. During gestation, the mrp4 gene is expressed one day later than the mrp3 and plf1 genes. Whereas MRP3 and/or PLF1 leave the placenta and enter the bloodstream and the amniotic fluid, MRP4 is only found in the placenta. We also provide evidence that, in the second half of gestation, one or more signals from the uterus feed back to arrest production of MRP/PLF. This feedback results in a peak of MRP/PLF production in midgestation, which coincides with a large increase in uterine mass and DNA content in mid- to late gestation. The time period of expression of the mrp/plf genes relative to uterine growth is consistent with the hypothesis that one or more of these proteins may regulate uterine growth in vivo during pregnancy. This observation is consistent with our previous observation that PLF1 stimulates uterine cell proliferation (1).

From these and previous results, we propose that part of the maternal-fetal interaction in reproduction involves the production of MRP/PLFs by the placenta. These proteins stimulate uterine growth and placental vascularization. Our data also suggests that estrogens are not responsible for uterine growth during pregnancy. Cessation of uterine growth is correlated with a decrease in MRP/PLF concentrations in the placenta in late gestation. The decrease in MRP/PLFs is due to a maternal to fetal signal from the uterus, which feeds back to control MRP/PLF expression and to terminate the growth signal.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Balb/c mice. a colony originally derived from Harlan Sprague Dawley, Inc. (Indianapolis, IN), and CF1 mice, a colony derived from animals originally obtained from Charles River Laboratories, Inc. (Wilmington, MA), were maintained in university animal facilities with a 12-h light, 12-h dark cycle. All animals were housed and treated according to current NIH guidelines. Animal care was provided by an animal caretaker and an attending veterinarian. This research was conducted in accordance with the standards set forth in the NIH Guide for the Care and Use of Laboratory Animals. Animals were killed by cervical dislocation before removal of tissues for the described studies. Prior approval was obtained from the Iowa State University Committee on Animal Care for all procedures performed on the animals used in these studies.

Minced placental tissue culture and metabolic labeling with 35S-methionine
Freshly dissected placentae from pregnant CF1 mice between days 8 and 16 of gestation were rinsed in ice-cold HBSS and minced into pieces of approximately 1 mm3. For primary placental tissue culture, the minced tissues were washed with DMEM with 25 mM glucose. They were then incubated in DMEM with 2% FCS, 20 mM HEPES, 50 U/ml each of penicillin and streptomycin for 16 h at 37 C in a humidified atmosphere containing 10% CO2. After the incubation, the minced placentae were washed by suspending them in a Tris-buffered, balanced salts solution (140 mM NaCl, 5 mM KCl, 0.68 mM CaCl2, 0.49 mM MgCl2, 0.37 mM Na2HPO4, 0.25 mM Tris x HCl, pH 7.4) and collected by centrifugation. The minced and washed placentae were resuspended in DMEM (containing 1/10 the normal methionine concentration), 100 µCi/ml 35S-methionine (NEN Life Science Products, Boston, MA) or 35S-Trans label (ICN Radiochemicals, Irvine, CA), and 0.2% FCS. The placental suspensions were dispensed into the wells of multiwell tissue culture dishes (200 µl/well) and incubated at 37 C in an atmosphere of 10% CO2 for 4 to 4.5 h with gentle rocking. The medium and minced tissues were then removed and spun at 2,000 x g for 20 min to separate the remaining tissue and the medium. The supernatants were removed and used for immunoprecipitation. Duplicate 5–10 µl aliquots of the medium were removed to determine acid-insoluble cpm by precipitation with 10% trichloroacetic acid. These values were used to normalize the results of cpm incorporated into secreted MRP/PLFs so as to calculate the specific changes in secreted MRP/PLF.

Antisera
The antiserum 4269B was raised against MRP/PLFs purified from 3T3 cells. The antiserum, which was used for most RIAs and Western blots, detects the four known MRP/PLFs, PLF1, PLF2, MRP3, and MRP4. This detection was ascertained by analysis with the individual proteins expressed from cloned complementary DNAs (cDNAs) in insect or mammalian cells. The antisera, 89Rb11 and 89Rb13, were raised against MRP/PLFs purified from the conditioned medium of BN/L cells. The anti-rPLF1 serum was a gift from David Denhardt and was raised against PLF1 expressed in Escherichia coli.

Endoglycosidase H and neuraminidase treatment
Samples of medium from 35S-methionine-labeled minced placentae were incubated in 10 mM NaPi, 100 mM NaOAc, pH 5.5 for 20 h at 37 C with or without 0.2 U/ml endoglycosidase H (E.C. 3.2.1.96, Roche Molecular Biochemicals, Indianapolis, IN). Alternatively, samples were treated in 0.9 mM CaCl2 10 mM NaPi, 100 mM NaOAc, pH 5.3 with or without 0.34 U/ml neuraminidase (E.C.3.2.1.18) from Vibrio cholerae (Sigma, St. Louis, MO). The reactions were stopped by diluting the mixtures by 2-fold with twice concentrated buffer pH 7.4. The MRP/PLF was then immunoprecipitated. The proteins in the immunoprecipitates were resolved by SDS PAGE as described previously (22).

Immunoprecipitation
MRP/PLF was immunoprecipitated from the conditioned medium of metabolically labeled cells as described previously (23). Immunoprecipitates were resolved by SDS-PAGE (22). The resulting gels were impregnated with PPO, dried, and exposed to film.

RIA for MRP/PLFs
MRP/PLF standards or samples were incubated with anti-MRP/PLF antibody (1:5000) in 1.5 ml microcentrifuge tubes in buffer containing 10 mM sodium chloride, 10 mM EDTA, 1% crystalline BSA, 10 mM NaPi, pH 7.5, for a period of 6 h at 4 C. Then 125I-MRP/PLF (approximately 15,000 cpm/tube) was added, and the mixture (250 µl) was incubated for another 16 h at 4 C. The antigen-antibody complex was separated from the free 125I-MRP/PLF by incubating the solution with 1% (wt/vol) pansorbin (24, 25) for 1 h at room temperature, followed by centrifugation for 10 min at room temperature. The supernatant was then carefully removed, and the radioactivity of the pellet and the supernatant were measured in a GammaTrac 1191 radiospectrometer. The assay sensitivity, calculated as the signal that is 2 SDs away from the signal for the zero dose, was 2.8 ng/ml (0.7 ng/tube) MRP/PLF. The cpm in the pellet from reactions containing 1,000 ng/ml MRP/PLF was considered to be the nonspecific binding, and it was subtracted from the cpm of all other pellets to obtain the specifically bound 125I-MRP/PLF. The cpm in pellets from reactions containing no added nonradioactive MRP/PLF was considered to be the maximum binding. In a typical experiment 30% of 125I-MRP/PLF was bound in the absence of added MRP/PLF present in the reaction mixture (1,000 ng/ml). When normal rabbit serum was used instead of anti-MRP/PLF antiserum at 1:5,000 dilution, 4.5% of 125I-MRP/PLF was bound. The linear range of the assay is 1–100 ng/ml of MRP/PLF.

The within-assay coefficient of variation in the assay was estimated by assaying a pooled sample of maternal plasma three times in duplicates in the same assay, and was 2.2 ± 0.22 µg/ml (mean ± SD). The between-assay coefficient of variation estimated by assaying the same sample in three different assays was 2.6 ± 0.74 µg/ml.

Tissue extracts
Placentae were dissected from CF1 mice and homogenized in 0.5% Nonidet P40, 1% Trasyol, 10 mM phenylmethylsulphonyl fluoride, 20 mM HEPES, pH 7.4 (200 mg tissue per 100 µl buffer) at room temperature for 20 sec using a Tekmar tissumizer. The homogenate was placed on ice and then centrifuged at 133 x g for 15 min at 4 C. The supernatant was removed and spun at 13,000 x g at 4 C for 20 min. An aliquot of the supernatant was removed for protein analysis by the Bradford method (26) using reagents from Pierce Chemical Co. (Coomassie Plus Protein Assay Reagent, Pierce Chemical Co., Rockford, IL) and the remainder was frozen for later Western blot analysis.

Uteri were dissected from CF1 mice. The tissue was weighed and then homogenized at 4 C using a Tekmar tissumizer at a ratio of 1 g tissue per 5 ml of 0.3 M sucrose, 1 mM phenylmethylsulfonyl fluoride. The homogenate was spun three times sequentially at 3,000 x g for 20 min, 13,000 x g for 20 min, and then at 100,000 x g for 90 min. The resulting supernatant was removed, dispensed in aliquots, and stored at -70 C.

Western blot analysis
MRP/PLFs in blood sera, amniotic fluids, and extracts of placentae were detected by Western blot analysis. Samples were first resolved by SDS-PAGE (7.5–15% linear polyacrylamide gradient gels) at 12.5 mAmp/gel for 5 h at room temperature (22). The proteins were transferred to a nitrocellulose membrane using a Hoefer TE 50 apparatus at 90 V for 4 h with water cooling. The membrane was stained with 0.2% Ponceau S in 3% trichloroacetic acid to ascertain uniform transfer of proteins to the membrane. After destaining with water, the membrane was incubated for 12 h at 4 C in blocking solution (5% (wt/vol) nonfat milk in 140 mM sodium chloride, 5 mM potassium chloride, 0.4 mM sodium phosphate, 0.02% (wt/vol) sodium azide, 25 mM Tris, pH 7.4). The blocking solution was then decanted and the membrane was soaked in a fresh blocking solution containing anti-MRP antiserum to a final dilution of 1/200. The membrane was washed three times with 0.14 M NaCl, 0.4 mM NaPi, 5 mM KCl, and 25 mM Tris x HCl, pH 7.45 for 10 min each. The second wash buffer also contained 0.05% (vol/vol) NP-40. Finally, the membrane was incubated in a fresh blocking solution containing 1–5 x 105 cpm/ml of 125 I-protein A. After an additional three washes, as described above, the membrane was dried and the radioactivity detected by autoradiography.

Quantitation of radioisotope incorporated into individual protein bands
Fluororadiograms of Western blots were analyzed quantitatively from density scans obtained with an LKB Zeinah scanning densitometer (LKB Produkter AB, Bromma, Sweden). The areas under the scanned curves were determined by planimetry or with the integrator built into the densitometer. Alternatively, the amount of 125I radiolabel was determined in individual protein bands by use of a phosphorimager. The linearity of each assay was verified by measuring the output from increasing dilutions of plasma containing MRP/PLF.

Quantitation of tissue DNA content
Uteri were dissected from CF1 female mice at various stages of gestation; each sample included both horns. The total wet weight was recorded and the tissue was frozen. For analysis, sections were randomly cut from the frozen tissue, weighed, and then analyzed for DNA/g wet weight according to Burton (27). The total DNA of each uterus was determined by multiplying the DNA/g by the total uterine weight.

RNA and diagnostic RT-PCR
Frozen tissue was pulverized in liquid nitrogen using a mortar and pestle, and RNA was isolated using Tri-Reagent (Life Technologies, Inc., Rockville, MD) according to the manufacturer’s instructions. For RT, 250 ng of total RNA was incubated in 5 µl reaction mixture containing 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 50 mM Tris-HCl (pH 8.3 at RT) 112 ng poly dT primers, and 200 µM dNTPs, with or without 40 U Superscript II reverse transcriptase (Life Technologies, Inc.). The reaction mixture was incubated at 42 C for 50 min, 50 C for 10 min, then 75 C for 15 min. For PCR, the following primers were used: mrp/plf downstream exon I; 5'CTCTGCAGAGATGCTCCCTTC3' (+59 to +79), mrp/plf upstream exon V; 5'CATGATATTTCAGAAGCAGAGCAC3' (+778 to +756). These primers are complementary to the identical sequences in all known mrp/plf cDNAs. Briefly, 0.5 µl cDNA was amplified in a 25 µl reaction containing 20 pmoles of each primer, 200 µM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3) and 1 U Taq Polymerase. The thermal cycling conditions were as follows: 95 C for 2 min to denature, then 40 cycles at 95 C (30s), 66 C (1 min), and 72 C (1.5 min) to amplify with a final 3 min at 72 C for extension. The PCR products were resolved by electrophoresis through a 1.5% agarose gel and analyzed by ethidium bromide staining.

The diagnostic RT-PCR assay for the mrp/plfs is based on differences in the cDNA sequences of these closely related gene products which result in variations in restriction sites within the cDNAs. To distinguish the mrp/plf mRNAs using restriction digestion, one fifth of the reaction mixture from the RT-PCR reaction was subjected to one round of PCR using the same primers as for the original amplification but with 62.5 µM dNTPs, 0.9 mM MgCl2, and 1 µCi {alpha}32P-CTP in a final 25 µl volume. The sample was heated to 98 C for 4 min, 64 C for 1 min, then 72 C for 20 min. The radiolabeled cDNA was precipitated with 70% ethanol in the presence of 10 µg yeast transfer RNA as carrier. Digestion was carried out using 1 U each of BsoFI (New England Biolabs, Inc., Beverly, MA) and BstXI at 55 C overnight, or 5 U of NdeI at 37 C including 100 µg/ml BSA. The radiolabeled and digested products were resolved by electrophoresis through a 2% agarose gel or an 8% polyacrylamide gel. The gels were dried, and the amount of radioactivity associated with each band was determined using a phosphorimager with ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). Positive controls for identification of specific mrp/plf cDNAs were cloned cDNAs or mRNA isolated from COS cells that had been transiently transfected with specific cDNAs. The ability of the procedure to determine the relative concentrations of the four mRNAs was tested by making mixes of the standard cDNAs in various ratios, amplifying and then determining the ratio of the cDNAs in the final products. The results showed that this method faithfully reproduced the starting ratios of the mrp/plf cDNAs in the original mixture.

Estradiol-17ß analysis
Nonpregnant mice (n = 2) and mice of known gestational ages (n = 18) were killed by cervical dislocation, and a sample of systemic blood was collected by heart puncture immediately after the mice were killed. In addition, the gravid uterus was removed, and samples of both placental and uterine tissue associated with each conceptus were collected, weighed, then immediately frozen under liquid nitrogen. Tissue samples were homogenized in 1 ml deionized water using a tissue TissueTearor homogenizer. Blood plasma and tissue homogenates were frozen at -20 C until assayed for estradiol-17ß by RIA. Before RIA, aliquots of all placental homogenates, and aliquots of all uterine homogenates from a pregnant female were pooled to form a single placental tissue pool and a single uterine tissue pool. An aliquot of each tissue pool (placental and uterine) was then extracted and assayed for estradiol-17ß (28) as previously described.

Estradiol-17ß in systemic plasma was also quantitated by RIA as previously described (29). All tissue or plasma samples were evaluated together in the same assays. Intraassay coefficients of variation for estradiol-17ß using tissue or plasma pools were 3.3% and 7.4%, respectively. Values were normalized to mg wet weight of tissue.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Different tissue localization of 27- and 38-kDa MRP/PLFs
The gestational profile of placental MRP/PLFs determined by Western blot analysis is similar to the profile in the blood. Almost identical results were obtained when MRP/PLF was assayed by RIA or by Western blot, although later in gestation the amount of MRP/PLF measured by RIA tended to be higher than that measured by Western blot analysis (Fig. 1Go).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. MRP/PLF levels in placenta and maternal plasma throughout gestation. Placental extracts (150 µg protein/well) and plasma samples derived from ocular bleeds (5–10 µl/well) were collected from CF1 mice at various stages of gestation. Top panel, Samples of placental extract and plasma were resolved by electrophoresis through 7.5%–15% SDS-polyacrylamide gradient gels. The resolved proteins were transferred to nitrocellulose and analyzed by Western blot using the polyclonal antiserum 89Rb13B. The figure shows the average results from three sets of plasma samples and two sets of placental extracts. Before being averaged, the quantitative results for the plasma samples were normalized to an external plasma standard that had been run on each gel. For the placental samples, each data set was first normalized to the day 10 sample Inset, The proportionality is demonstrated between MRP/PLF and band intensity on the Western blot. {circ}, {Delta} represent two different sets of MRP/PLF standards. Bottom panel, Samples of plasma and placental extracts were analyzed by RIA to determine levels of MRP/PLFs. The data set used for Western blot analysis is a subset of the same samples as assayed by RIA. The placental samples used in the RIA analysis were different from those used for the Western blot analysis. The number of values contributing to the averages for the plasma are: 3 (days 16, 17), 5 (days 8, 9, 15), and 6 (days 10–14). Placental values are each the average of two estimates. The inset shows a typical standard curve. •, plasma; {Delta}, placenta.

 
MRP/PLF is secreted into the maternal bloodstream and the amniotic fluid (16, 29). A comparison of the MRP/PLFs in placental homogenates, amniotic fluid, and plasma samples revealed two forms of MRP/PLF that differ in their apparent molecular weights (Fig. 2Go). The estimated Mr’s of these two forms of MRP/PLF as determined by SDS-PAGE were 38 ± 1 (n = 6) and 27 ± 1 (n = 5). Only the higher molecular weight form was found in the bloodstream and in the amniotic fluid. Both forms were found in the placentae, and they were both secreted by primary minced placental cultures. Three different polyclonal antibodies raised against MRP/PLF identified the same two forms of MRP/PLF (Fig. 3Go). Each antiserum had been raised against a different preparation of MRP/PLF; two of the protein preparations were isolated from eukaryotic cells, one from BN/L cells and the other from tumor-promoter treated Swiss 3T3 cells. The third preparation was a recombinant PLF1 protein from transformed Escherichia coli. The four antisera showed the same two bands of MRP/PLF proteins at 38 and 27 kDa, although the relative intensities of the two bands varied for each antiserum, particularly for the antiserum against the recombinant bacterial protein compared with that for the purified protein produced in mammalian cells. These differences probably reflect the impact of glycosylation on the recognition by the antibodies of protein epitopes as the bacterial protein was not glycosylated whereas the other proteins used as antigens were the highly glycosylated 38-kDa forms.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. Comparison of MRP/PLF content of plasma, placenta, and amniotic fluid by Western blot. Left panel (in vivo), Samples of plasma, placentae, and amniotic fluids were resolved by SDS-PAGE and analyzed by Western blot using anti-MRP antibody, AF, d11 amniotic fluid; PA, d13 plasma; PL, d13 extract of placenta. Right panel (in vitro), Minced cultures of 13-day placentae were radiolabeled with 35S-methionine as described in Materials and Methods. MRP/PLF was immunoprecipitated and resolved by SDS-PAGE. A and B identify the positions of the 38 kDa and 27 kDa MRP/PLF protein bands, respectively.

 


View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Recognition of both forms of MRP/PLF by several antibody preparations. Four independently raised polyclonal antibodies, each to a different purified MRP/PLF protein preparation, were used to identify MRP/PLF by immunoprecipitation from the medium of 35S-methionine-labeled minced placental cultures. Three of the antibodies were raised against MRP/PLF isolated from the conditioned medium of either phorbol ester-stimulated Swiss 3T3 cells (B) or BN/L cells (A, C). These preparations consisted mostly, if not entirely, of PLF1. The fourth antibody was raised to recombinant PLF1 prepared from bacteria (anti-rPLF1). Normal rabbit serum (NRS) was used as the control serum. The last four lanes contain immunoprecipitates of the same sample of medium.

 
Different gestational profiles of individual mrp/plf gene expression
We explored the question of whether individual mrp/plf genes were regulated differently from each other through gestation. First, a profile of the expression of the two protein forms of MRP/PLF in the placenta as a function of gestation showed that the lower molecular weight form was produced with a profile that was delayed with respect to the production of the higher molecular weight form (Fig. 4AGo). The sum of both MRP/PLFs results in the pattern of placental expression shown in Fig. 1Go.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Times of appearance of the two forms of MRP/PLF and the mrp/plf mRNAs in the placenta through gestation. A, Placental extracts were prepared as described in Materials and Methods and were resolved by electrophoresis (100 µg protein/well) through 7.5%–15% SDS-polyacrylamide gradient gels. The resolved proteins were transferred to nitrocellulose and analyzed by Western blot using the polyclonal antiserum 89Rb13B. The results shown in this panel are from one of the two data sets of placental tissue that were used to obtain the average values shown in Fig. 1Go. {circ}, 27-kDa MRP/PLF; {blacksquare}, 38-kDa MRP/PLFs. B, Diagnostic RT-PCR was performed on total RNA samples isolated from placentae at various stages of development as described in Materials and Methods. The results of one of three independent data sets is shown. To obtain the values shown, the proportion of each mrp/plf was multiplied by the total amount of mrp/plf mRNA determined from Northern blot analysis of RNA isolated from each stage of gestation (31 ). The average coefficient of variation from the three data sets (24 triplicates) was 29%. The relative amounts of plf1 ({blacktriangleup}), mrp3 ({blacksquare}) and mrp4 ({circ}) mRNAs are shown as a function of gestation. C, The diagnostic RT-PCR analysis of mrp/plf mRNAs. The diagram on the left shows the fragments amplified from cDNAs derived from the four mrp/plf mRNAs. The restriction sites used to distinguish the four fragments are identified and the length of each resulting restriction fragment is shown. The data on the right shows a set of standards, one for each of the four mrp/plfs and the results from this analysis of preparations of RNA from CF1 and Balb/c placenta from gestational day 12.

 
Second, we used diagnostic RT-PCR to establish which mrp/plf genes were expressed in the placenta as a function of gestation. Three mrp/plf mRNAs are expressed in the placenta. These are plf1, mrp3, and mrp4 (Fig. 4Go, B and C; 21). Although plf2 was cloned from the placenta (19), we were unable to detect its mRNA in placental RNA samples of CF1 or Balb/c mice (Fig. 4CGo). The gestational profile of the 38-kDa protein matches the profiles of expression of mrp3 and plf1 mRNAs, and the profile of the 27-kDa protein matches the profile of mrp4 mRNA (Fig. 4Go). In each case, the mRNA level increased the day before the increase in protein level was observed. The molecular sizes of the identified protein products, 38 kDa for PLF1 and MRP3 and 27 kDa for MRP4, are consistent with the expected sizes of these proteins as determined by their expression from cDNAs in cultured cells (21).

Carbohydrate components of the MRP/PLFs
Because carbohydrate modifications can influence protein stability and access to particular tissues and cellular compartments, we examined the carbohydrate components of the two MRP/PLF protein forms. According to the cDNA sequences, all three mrp/plf genes encode polypeptides of the same size. The differences in their apparent molecular weights are expected to be a function of their different N-glycosylation patterns (Fassett JT, Nilsen-Hamilton M, Hamilton RT, manuscript submitted, GenBank accession no. AF 128884). To establish that the two MRP/PLF protein bands observed in the placenta correspond to the same-sized polypeptide chains (as expected from the cDNA sequences), minced placental cultures were labeled with 35S-methionine in the presence and absence of the inhibitor of glycosylation, tunicamycin. Medium was collected from the labeled cells and the MRP/PLF immunoprecipitated (Fig. 5Go). In the presence of tunicamycin, both protein bands collapsed to a single apparent molecular weight at 21K as expected from the cDNA sequences.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Effects of tunicamycin and neuraminidase on the apparent molecular weights of the MRP/PLFs. Placental minces were incubated with or without 5 µg/ml tunicamycin for 16 h and then labeled metabolically with 35S-Trans label as described in Materials and Methods for an additional 4 h with the continuing presence of tunicamycin. First three channels (1 2 3 ): The culture medium was immunoprecipitated using anti-MRP/PLF antibody ({alpha}-MRP/PLF), or NRS. Channels 4–15: Samples of culture medium and lysates from metabolically labeled placental minces, which had not been treated with tunicamycin or samples of plasma from mid-pregnant mice, were incubated with neuraminidase (N'ase) for 1 h at 37 C. These samples were then immunoprecipitated with antibodies directed to MRP/PLF ({alpha}-MRP/PLF) or to cathepsin L ({alpha}-CL). NRS was substituted for the antisera as controls. All samples were resolved by SDS-PAGE. The samples from metabolically labeled placental minces were visualized by fluorography. The samples of plasma were visualized by Western blot. The positions of the 38-kDa (38K), 27-kDa (27K), and nonglycosylated (NG) MRP/PLF proteins are shown by the black arrows. The position of the shifted 38-kDa MRP/PLF observed after neuraminidase treatment is shown by the shorter arrows.

 
Sialylation contributes to stability of glycoproteins in the blood and in tissues by preventing cellular uptake via the asialoglycoprotein receptor (30). To determine whether the placental MRP/PLF glycosyl groups are sialylated, we treated the samples with neuraminidase. The results revealed that the 38K form in the placenta and the plasma is sialylated (Fig. 5Go). The molecular weight shift of the 27K form after neuraminidase treatment was very small and was only observed with the secreted protein. In comparison, the molecular weight of cathepsin L, another protein secreted by placentae and immunoprecipated from the same samples, was not shifted by treatment with neuraminidase (Fig. 5Go). Thus, all the MRP/PLFs produced by the placenta are sialylated, but the 38K protein is more heavily sialylated than the 27K protein.

Different intracellular processing rates for MRP4 vs. PLF1 and MRP3
The completion of glycosylation occurs after protein synthesis and during the time that the protein is trafficking to the surface membrane for secretion. Thus, a different glycosylation profile might be accompanied by a different time period before release. The lag-times for secretion of the two forms of MRP/PLF were compared in minced placental cultures by pulse-labeling the cultures with 35S-methionine for 15 min and then measuring the secreted proteins as a function of time over the chase period which was inititated by replacing the radiolabeling medium with growth medium lacking radioisotope. There was a significantly longer delay before secretion of the 27-kDa protein (MRP4) than the 38-kDa protein (PLF1 and MRP3) (Fig. 6Go). From three different sets of time courses, the average time after the beginning of labeling before the 27-kDa MRP/PLF began to be secreted (intercept of the extrapolated line with the abscissa) was 41 ± 4 min; for the 38-kDa protein it was 25 ± 8 min. The 27-kDa protein, which appears in the medium later than the 38-kDa proteins, was not likely to be a product of the 38-kDa proteins because incubation of the medium containing a mixture of the two proteins with the cells did not result in conversion of the 38-kDa protein to the 27-kDa protein (data not shown). Thus, surprisingly, the 27-kDa protein (MRP4) with the least amount of glycosylation took the longest to traffic to the surface membrane.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. Secretion profiles of the two forms of MRP by minced placental cultures. Minced placentae were pulse-labeled for 15 min with 1,000 µC/ml 35S-methionine. The labeling medium was removed and the minced tissue was washed once with DMEM and resuspended in 1 mL of a chase medium consisting of DMEM, 0.2% FCS, 20 mM HEPES, pH 7.4. At each time point, 150 µl of medium was sampled, centrifuged to remove remaining minced placentae, and the supernatant immunoprecipitated with anti-MRP antiserum, resolved by SDS-PAGE and visualized by fluorography. The amount of radioactivity in each band was determined by scanning each band on the film using a densitometer, determining the area under each peak using a planimeter and then normalizing each value to the amount of acid precipitable radioactivity in the particular sample of medium. The resulting normalized relative cpm/band is plotted as the y-axis. TCA-precipitable cpm were determined from duplicate analyses of each sample of medium. The figure shows one of three independent experiments. From the three experiments the average x-axis intercept was determined to be 41 ± 4 min for the 27-kDa protein and 25 ± 8 min for the 38-kDa protein. {blacksquare}, 27-kDa MRP/PLF; • 38-kDa MRP/PLF.

 
Growth profile of the uterus correlates with presence of the MRP/PLFs
MRP/PLFs stimulate DNA synthesis in primary uterine cell cultures (1). If MRP/PLFs contribute significantly to regulating uterine growth during pregnancy, then the profile of uterine growth should be consistent with the period during which MRP/PLFs are produced in vivo. We examined the rate of growth in uterine DNA mass as a function of gestation and found that the uterus began to rapidly increase in DNA mass after day 8, and the majority of uterine growth occurred between days 9 and 14, during which time there was a 4-fold increase in uterine DNA content (Fig. 7Go, top panel). The rate of increase in uterine DNA content measured between days 9 and 14 was 0.2 µg DNA/uterus/day, which corresponds to an increase of 10–20% of the uterine mass per day. This profile of uterine increase is consistent with the hypothesis that local MRP/PLFs promote uterine growth.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 7. Uterine growth in relation to MRP/PLFs and estradiol-17ß levels in the uterus and placenta. Top panel, Uterine growth as a function of gestation. Uteri were dissected from CF1 female mice at various stages of gestation. Total uterine DNA content is shown as a function of gestation. The data are expressed as the averages of multiples with the error bars showing the sample SDs. NP, Nonpregnant; •, points used for determining the rate of increase in uterine DNA content in midgestation, which was determined to be 0.2 µg DNA/uterus·day. The R value for this line is 0.97. The value for each uterus was determined from four different dilutions of uterine DNA, each analyzed in duplicate. The average value for total DNA/uterus was thereby determined for each uterus. Shown are the average values for all uteri at each stage of gestation. The number of uteri contributing to each point are as follows: 2 (days 1, 4, 5, 6, 7, 8, 10), 3 (NP, day 12), 4 (days 11, 14, 16, 18, 19), 5 (day 17), 6 (days 9, 15, 17), 7 (day 13). The two average values contributing to the day 10 point were 890 and 942 µg DNA/uterus, giving a sample SD of 37, which is less than the diameter of the symbol and therefore not visible. The shaded area shows the profile for the MRP/PLFs in the placenta (shading). The vertical hatched region that passes through both panels encompasses the period of linear increase in uterine DNA. Bottom panel, estradiol-17ß profiles as a function of gestation. Estradiol-17ß was measured in samples of plasma (•), uterus ({triangleup}) and placenta ({blacktriangleup}) as described in Materials and Methods. The number of values contributing to each point are as follows: 2 (days NP, 6, 10, 18), 3 (days 8, 12, 14, 16). Sample SDs are shown. The two values contributing to the NP point for plasma estradiol-17ß were 51 and 47 pg/ml estradiol-17ß with an estimated sample SD of 3, less than the diameter of the symbol and thus not visible.

 
Estradiol-17ß profiles in the placenta, uterus and circulation during gestation
The results of many studies of the factors that regulate uterine growth in immature or ovariectomized mature female rats and mice have shown that estrogen is the major regulatory factor. Therefore, we measured the levels of estradiol-17ß in samples of plasma, uterus, and placenta at various stages in gestation. The results (Fig. 7Go, bottom panel) showed that the gestational profiles of estradiol-17ß in these tissues and in the blood stream did not correlate with the period of uterine proliferation during gestation.

Effect of steroids on MRP/PLF production by the placenta
We examined the question of whether the MRP/PLFs were induced in minced placental cultures after treatment for 24 h with estradiol-17ß in the concentration range of 10-6 to 10-9 M. The MRP/PLF proteins were detected by Western blot analysis. There was no increase in the amounts of the 38-kDa or 27-kDa proteins found in the medium or in the cells after estrogen treatment (data not shown).

Regulation of placental expression of MRP/PLF in minced placental cultures
The percent of trophoblasts that contain MRP/PLF and the MRP/PLF content of the placenta drops precipitously after day 13 (Fig 1Go; 31). To determine whether the signal(s) for this decrease in MRP/PLF expression come from the placenta or from another source, we removed placentae from animals at different days of gestation and cultured them in minced tissue culture for 16–18 h. The cultures were then labeled with 35S-methionine and the secreted, metabolically labeled MRP/PLFs were immunoprecipitated from the medium. The increase in MRP/PLFs from day 8–10 in vivo was reflected in these in vitro cultures by the increase in production of the 27-kDa and 38-kDa proteins by placental minces of increasing gestational ages from days 7–10. However, the parallel between the in vivo and in vitro results broke down after gestational day 13. Whereas the amount of the 38-kDa MRP/PLF in the placenta in vivo decreased after day 13 (shaded area in Fig. 8Go), the rate of synthesis of MRP/PLF by the placental minces was about the same in all minced placental cultures through day 17 (Fig. 8Go). By contrast, the level of expression of the 27-kDa MRP4 protein decreased after day 13 in the minced tissue cultures in the same way as was observed in the placenta in vivo (Fig. 8Go, right panel). Thus, it seems that an external signal or combination of signals is responsible for the decrease in 38-kDa MRP/PLF expression in the latter half of gestation, whereas the signal(s) necessary for regulating expression of MRP4 are present in the isolated placental tissue.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 8. Production of secreted 38-kDa MRP/PLF by minced placental tissue cultures as a function of gestational stage. Placentae were removed from pregnant CF1 mice at various stages of development and cultured for 16–18 h and then radiolabeled for an additional 4–4.5 h with 35S-methionine as described in Materials and Methods. Samples of the media were immunoprecipitated and resolved by SDS-PAGE. The amount of MRP/PLF was determined by fluorography. Left panel, The compiled results of ten experiments in which placental minces from various gestational stages were each tested in duplicate. The error bars show the sample SDs. The N values for each data point are: d8 (4 ), d9 (1 ), d10 (4 ), d11 (3 ), d13 (8 ), d14 (4 ), d16 (9 ), d17 (1 ). {circ}, 38-kDa MRP/PLF secreted by placental minces; gray area, the placental expression of the 38-kDa MRP/PLFs from data in Fig. 3Go. Right panel, Examples of the immunoprecipitates of metabolically labeled placental minces from various days of development.

 
Uterine control of MRP/PLF expression in the placenta
To identify the source of the external signal that regulates the 38-kDa MRP/PLF expression in the latter half of gestation, we added various fetal and maternal fluids and tissues to the minced placental cultures and evaluated their effects on placental production of MRP/PLFs. There was no effect of maternal serum or fetal amniotic fluid on MRP production by the placental minces (Fig. 9Go). However, strips of the uterus taken from regions of placental-uterine contact suppressed MRP/PLF production. The effect of the uterine cocultures was 2-fold. First, they suppressed the secretion of all 35S-methionine proteins (Fig. 9Go, left panel). Second, the uterine strips specifically suppressed the secretion of MRP/PLFs by late gestational placentae (Fig. 9Go, right panel; values normalized to the total secreted 35S-methionine-labeled proteins). Day 16 placentae responded to uterine coculture with a much larger specific decrease in MRP/PLF production than did day 10 placentae. Late gestational uterine strips were more effective in inhibiting MRP/PLF production than were strips from midgestational uteri (Fig. 10Go). However, there was also inhibition by midgestational uteri. Conditioned medium from cultured uterine strips did not inhibit 38-kDa MRP/PLF production by the minced placental cultures. But, uterine extracts inhibited MRP expression with late extracts from gestational uteri being more effective (Fig. 11Go). It is known that the decrease in MRP/PLF protein in vivo accompanies a decrease in mrp/plf mRNA in the placenta (16). Thus, it appears that the uterus produces one or more compounds that inhibit expression of the mrp/plfs by the placenta.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 9. Effect of various maternal and fetal tissues on the production of MRP/PLFs by minced placental cultures. Minced placental cultures from the 10th or 16th day of pregnancy were prepared as described in Materials and Methods. The minced placentae were cultured for 16 h (day 10 placentae) or 18 h (day 16 placentae) in the presence or absence of the following tissues from days 10 or 16 pregnant mice: 10% maternal serum (SE), 10% amnionic fluid (AF), and uterine strips (UT). The uterine strips had been removed from the site of attachment of the placentae to the uteri. After incubation under the conditions noted, the minced placental samples were metabolically labeled with 35S-methionine for 4 h. The results are shown with the sample SDs for duplicate samples. The same results were obtained in two independent experiments. The results are expressed as fraction of the control incubations in which the placental minces were cultured without additional body fluid or tissue. Left panel, TCA precipitable cpm per ml culture medium. Right panel, Amount of secreted 38-kDa MRP/PLFs determined from fluorograms of immunoprecipitated protein; each value for secreted MRP/PLFs was divided by the relative rate of protein synthesis (left panel) for the particular well to obtain a value for specific secretion rate of MRP/PLFs.

 


View larger version (26K):
[in this window]
[in a new window]
 
Figure 10. Effect of the uterus on the expression of MRP/PLFs by minced placental cultures. Minced placental cultures were prepared as described in Materials and Methods and cultured for 16 h in the presence or absence of small strips of uterus obtained from the region of placental contact in day 10 and day 16 uteri. The ratio of uterine to placental tissue mass was approximately 2:3. The tissues were incubated for 16 h, then metabolically labeled, and the MRP/PLFs were resolved by SDS gel electrophoresis after immunoprecipitation with anti-MRP/PLF antiserum or NRS. The positions of the 38-kDa and 27-kDa MRP/PLF proteins are shown by the arrows.

 


View larger version (33K):
[in this window]
[in a new window]
 
Figure 11. Effect of the uterine extracts on the expression of MRP/PLF by minced placental cultures. Placental minces were incubated with extracts of uteri isolated from nonpregnant (NP) or d10 and d16-pregnant mice. Alternatively, the placentae were incubated with 50% medium (CM) conditioned by 24 h culture with uterine strips. The rate of protein synthesis and the rate of MRP/PLF secretion was measured. The average results of eight independent experiments are shown with sample SDs. Individual experimental results were obtained by averaging two to three independent values in which the secreted MRP/PLF was normalized to the rate of protein synthesis in the relevant culture. These values were then averaged to obtain the results shown in this figure. The number of averaged experimental results contributing to each point were: CM (2 ), d10 extract (5 ), d16 extract (3 ), NP (5 ). Statistical analysis was done by using the paired Student’s t test. Differences were not significant for all but the effects of incubation with uterine extracts from days 10 and 16. The statistical significance of these latter two values were determined to be P = 0.07 (n = 3) and P = 0.06 (n = 5). From the pooled data for the effect of uterine extract regardless of time of collection, P = 0.007.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The mrp/plfs are expressed in midgestation during a period encompassing many events in fetal development. Some of the proteins are found in the bloodstream at high concentrations, but MRP4 is localized to the placenta. All MRP/PLFs are N-glycosylated and sialylated. The 38-kDa proteins contain more sialyl groups than MRP4. The relatively low extent of sialylation of MRP4 could make it more susceptible to removal from circulation if it is released into the blood stream. This might explain why the 38-kDa forms of MRP/PLF (PLF1 and MRP3) can be detected in the placenta, maternal blood, and the amniotic fluid, whereas MRP4 is only found in the placenta. Alternatively, MRP4 may not be released into the maternal and fetal circulation or there may be a specific receptor for MRP4 in the placenta and/or uterus that removes this protein before it can be released into the maternal or fetal circulation.

The expression of the mrp4 gene is regulated differently from plf1 and mrp3. The latter genes are expressed in the placenta with different gestational profiles and reach their peak expression earlier than mrp4. Differences in mechanisms regulating the expression of mrp4 are also evident in that the gestational profile of MRP4 expression is maintained in the isolated placentae, whereas the negative regulation on 38-kDa MRP/PLF (MRP3 and PLF1) expression is lost after the placenta is separated from the uterus. Another difference between the proteins is in their trafficking from the cells. Despite its being less glycosylated than PLF1 and MRP3, the time for MRP4 processing and secretion by the cells is longer than for the 38-kDa MRP/PLFs. Either MRP4 takes a different route through the cell’s secretory network or it is produced by a different subset of trophoblastic giant cells than produce PLF1 and MRP3.

The placental content of MRP/PLFs remains high from days 10 through 13, after which it drops off rapidly. This profile is consistent with the results of earlier studies in which the MRP/PLF content of the placenta was measured in terms of the number of giant cells that contain the protein as measured by immunohistochemistry (31). The increase in MRP/PLF production parallels the growth of the placenta and is likely due to increased numbers of trophoblastic giant cells which express mrp/plfs.

MRP/PLFs stimulate DNA synthesis in cultured primary uterine cells (1). Here we show that the period of MRP/PLF production in vivo is correlated with the period of maximum growth of the uterus. The MRP/PLF begins to be observed in the blood on day 9. The highest-circulating levels of MRP/PLF are found on day 10 (Fig. 1Go). The placental levels of MRP/PLF remain high until day 13, after which the MRP/PLF content of the placenta decreases and the rate of uterine growth slows the next day (32, Fig. 8Go).

Estrogen stimulates uterine growth in immature females and ovariectomized adult females (4, 5, 6, 7, 8, 9, 10, 11, 12, 13). Thus, although the MRP/PLF levels correlated in time with the growth period of the uterus, it was expected that uterine growth might be regulated by estrogens. Consequently, we determined the profiles of estradiol-17ß in the uterus, placentae, and blood. The results showed no correlation of the uterine growth period with the profile of estradiol in any of these tissues. Our results for the circulating levels of estradiol are consistent with those previously published (33).

Estrogen, derived from the ovaries, is required for implantation in the mouse (34). The very high concentration of uterine and placental estradiol-17ß content on day 6 that has decreased by day 8 is probably relevant to this requirement. The mechanism by which estrogen acts to permit implantation probably involves the local induction of polypeptide growth factors in the uterus (4, 5, 6, 7, 8, 9, 10, 11, 12, 13). However, this same mechanism does not seem responsible for uterine growth during pregnancy as tissue and circulating estradiol levels are low during the period of uterine growth and do not rise in the pregnant mouse until after uterine growth has ceased. Thus, the MRP/PLFs rather than estrogen are the more likely immediate regulators of uterine growth in midgestation.

The large increase in the estradiol content of the placenta and uterus around the time of implantation is followed 3 days later by a rapid increase in mrp/plf expression in the placenta. Thus, although this is a signficant time span between the two events, it is possible that the earlier increase in placental estradiol-17ß content stimulates the mid-gestational increase in MRP/PLF production by the placenta. However, this mechanism is unlikely, as we found that the production of MRP/PLF is not stimulated by estradiol-17ß in minced placental cultures.

The close correlation between the presence of MRP/PLFs in the placenta, the growth of the uterus, and the ability of MRP/PLFs to stimulate uterine cell proliferation suggests that one or more MRP/PLF regulates proliferative growth of the uterus during gestation. MRP/PLF production is proportional to the amount of fetal placental tissue, and our data suggests that it is independent of circulating estrogen levels. Thus, the MRP/PLFs would provide a signal for uterine growth in proportion to the number of fetuses present and link uterine growth to fetal mass (16).

The decrease in mrp/plf expression in late gestation seems to be largely due to feedback regulation from the uterus. Our studies of MRP/PLF production by placental minces showed that uterine extracts and strips of uterine tissue can inhibit the placental production of the MRP/PLFs in late gestation. As the strips of tissue are not in contact with the majority of the cells in the minced placental tissue, the uterine factor is presumed to be a soluble, secreted factor. Attempts to demonstrate that this factor was in the growth medium from cultured uterine cells were unsuccessful. This latter result could suggest that the factor is not secreted by uterine cells or that it is very unstable. However, not all uterine cells survive in primary culture, and dispersed cultured cells do not express all genes that are expressed in the intact tissue. Thus, we conclude, in the absence of evidence to the contrary, that the uterine inhbitory factor is probably secreted by the intact uterus. The effect of the uterine factor is specific for MRP/PLFs over other secreted proteins. In the absence of this uterine influence, the in vitro rate of production of MRP/PLF was not lower in placentae of increasing age. The uterus contains receptors for MRP/PLFs (1). Thus, it seems reasonable to propose that uterine inhibition of mrp/plf expression is part of a feedback control loop which prevents further uterine growth into late gestation.

In summary, we have demonstrated different gestational profiles of three mrp/plf genes and their protein products. One of these proteins, MRP4, does not seem to leave the placenta and is a good candidate for the proposed local placental angiogenic activity of this protein family. We also describe a newly observed uterine-placental communication in the mouse in which the uterus feeds back to inhibit mrp/plf expression. The period of maximal uterine growth is coincident with the presence of MRP/PLF. This, and our previous observation that PLF1 stimulates primary uterine cell growth, suggests that PLF1 and perhaps also MRP3 and MRP4 stimulate murine uterine growth in midgestation. The lack of correlation of uterine growth and estradiol-17ß suggests that during pregnancy, estrogens are not responsible for uterine growth. As well, estradiol-17ß does not seem responsible for the increase in mrp/plf expression by the placenta. In the second half of gestation, the uterus produces an inhibitory agent that suppresses MRP/PLF production by the trophoblasts with a resulting decrease in MRP/PLF secretion. The decrease in MRP/PLF levels is correlated with a decrease in uterine growth rate. Thus, we propose that the MRP/PLFs are the growth factors that mediate mid-gestational uterine growth. Because they are produced in proportion to fetal mass, the MRP/PLFs provide a signal to the uterus for proportional growth to accommodate the number of fetuses that it contains. In turn, we propose that the uterus feeds back to shut off MRP/PLF production in late gestation to halt further uterine growth.


    Acknowledgments
 
We thank David Denhardt for providing the anti-rPLF1antiserum. We also thank Carole Hertz for performing the estrogen assays and Lee Bendickson for help in preparation of the figures for this manuscript and for general maintenance of the laboratory.


    Footnotes
 
1 This is Journal Paper No. J-17888 of the Iowa Agriculture and Home Economics Experiment Station, Ames, Iowa, Project No. 3096. This work was partly funded by Grant HD-29087 from the National Institute of Child and Human Development. Back

2 Current address: Coron Biomedics, 755 Stanford Circle, Rochester Hills, Michigan 48309. Back

3 Current address: Muta University, P.O. Box 7, Alkarak, Jordan. Back

Received February 26, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nelson JT, Rosenzweig N, Nilsen-Hamilton M 1995 Characterization of the mitogen-regulated protein (MRP; proliferin) receptor. Endocrinology 136:283–288[Abstract]
  2. Jackson D, Volpert OL, Bouck N, Linzer DIH 1994 Stimulation and inhibition of angiogenesis by placental proliferin and proliferin-related protein. Science 266:1581–1584[Abstract/Free Full Text]
  3. Wilder E, Linzer DIH 1989 Participation of multiple factors, including proliferin, in the inhibition of myogenic differentiation. Mol Cell Biol 9:430–441[Abstract/Free Full Text]
  4. DiAugustine RP, Petrusz P, Bell GI, Brown CF, Korach KS, McLachlan JA, Teng CT 1988 Influence of estrogens on mouse uterine epidermal growth factor precursor protein and messenger ribonucleic acid. Endocrinology 122:2355–2363[Abstract/Free Full Text]
  5. Murphy LJ, Gharhar A 1990 Uterine insulin-like growth factor-1: regulation of expression and its role in estrogen-induced uterine proliferation. Endocr Rev 11:443–453[Abstract/Free Full Text]
  6. Cullinan-Bove K, Koos RD 1993 Vascular endothelial growth factor/vascular permiability factor expression in the rat uterus: rapid stimulation by estrogen correlates with estrogen-induced increases in uterine capillary permiability and growth. Endocrinology 133:829–837[Abstract/Free Full Text]
  7. Das SK, Tsukamura H, Paria BC, Andrews GK, Dey SK 1994 Differential expression of epidermal growth factor receptor (EGF-R) gene and regulation of EGF-R bioactivity by progesterone and estrogen in the adult mouse uterus. Endocrinology 134:971–981[Abstract/Free Full Text]
  8. Zhang Z, Funk C, Roy D, Glasser S, Mulholland J 1994 Heparin-binding epidermal growth factor-like growth factor is differentially regulated by progesterone and estradiol in rat uterine epithelial and stromal cells. Endocrinology 134:1089–1994[Abstract/Free Full Text]
  9. Gray K, Eitzman B, Raszmann K, Steed T, Geboff A, McLachlan J, Bidwell M 1995 Coordinate regulation by diethylstilbestrol of the platelet-derived growth factor-A (PDGF-A) and -B chains and the PDGF receptor {alpha} and ß-subunits in the mouse uterus and vagina: potential mediator of estrogen action. Endocrinology 136:2325–2340[Abstract]
  10. Rajkumar K, Dheen T, Krsek M, Murphy LJ 1996 Impaired estrogen action in the uterus of insulin-like growth factor binding protein-1 transgenic mice. Endocrinology 137:1258–1264[Abstract]
  11. Zhang Z, Laping J, Glasser S, Day P, Mulholland J 1998 Mediators of estradiol-stimulated mitosis in the rat uterine luminal epithelium. Endocrinology 139:961–966[Abstract/Free Full Text]
  12. Nelson KG, Takahashi T, Lee DC, Leutteke NC, Rossert NI, Ross K, Eitzman BE, McLachlan JA 1992 Transforming growth factor-{alpha} is a potential mediator of estrogen action in the mouse uterus. Endocrinology 131:1657–1664[Abstract/Free Full Text]
  13. Wang X, Das SK, Damm D, Klagsbrun M, Abraham J, Dey SK 1994 Differential regulation of heparin-binding epidermal growth factor-like growth factor in the adult ovariectomized mouse uterus by progesterone and estrogen. Endocrinology 135:1264–1271[Abstract]
  14. Martin L, Finn CA, Trinder G 1973 Hypertrophy and hyperplasia in the mouse uterus after estrogen treatment: an autoradiographic study. J Endocrinol 56:133–138[Abstract/Free Full Text]
  15. Quarmby VE, Korach KS 1984 The influence of 17ß-estradiol on the patterns of cell division in the uterus. Endocrinology 114:694–702[Abstract/Free Full Text]
  16. Lee S-J, Talamantes F, Wilder E, Linzer DIH, Nathans D 1988 Trophoblastic giant cells of the mouse placenta as the site of proliferin synthesis. Endocrinology 122:1761–1768[Abstract/Free Full Text]
  17. Gil-Torregrosa B, Urdiales FL, Lozano J, Mates JM, Sanchez-Jimenez F 1994 Expression of different mitogen-regulated protein/proliferin mRNAs in Ehrlich carcinoma cells. FEBS Lett 349:343–348[CrossRef][Medline]
  18. Linzer D, Nathans D 1984 Nucleotide sequence of a growth-related mRNA encoding a member of the prolactin-growth hormone family. Proc Natl Acad Sci USA 81:4255–4259[Abstract/Free Full Text]
  19. Wilder EL, Linzer DIH 1986 Expression of multiple proliferin genes in mouse cells. Mol Cell Biol 6:3283–3286[Abstract/Free Full Text]
  20. Connor AM, Waterhouse P, Khokha R, Denhardt DT 1989 Characterization of a mouse mitogen-regulated protein/proliferin gene and its promoter: a member of the growth hormone/prolactin gene superfamily. Biochim Biophys Acta 1009:75–82[Medline]
  21. Deleted in proof
  22. Nilsen-Hamilton M, Hamilton RT 1987 Detection of proteins induced by growth regulators. Methods Enzymol 147:427–444[Medline]
  23. Chiang C-P, Nilsen-Hamilton M 1986 Opposite and selective effects of EGF and TGF-ß on the production of secreted proteins by murine 3T3 cells and human fibroblasts. J Biol Chem 261:10478–10481[Abstract/Free Full Text]
  24. Frohman MA, Frohman LA, Goldman MB, Goldman JN 1979 Use of protein A-containing Staphylococcus aureus as an immunoadsorbent in radioimmunoassays to separate antibody-bound from free antigen. J Lab Clin Med 93:614–621[Medline]
  25. Ying SY 1981 Radioimmunoassay of peptide hormones using killed Staphylococcus aureus as a separating agent. Methods Enzymol 73(Pt B):245–253
  26. Bradford M 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  27. Burton K 1956 A study of the conditions and mechanism of the diphenylamine reaction for the colorimetric estimation of deoxyribonucleic acid. Biochem J 62:315–323[Medline]
  28. Anderson LH, Christenson LK, Christenson RK, Ford SP 1993 Investigations into the control of litter size in swine: II. Comparisons of morphological and functional embryonic diversity between Chinese and American breeds. J Anim Sci 71:1566–1571[Abstract]
  29. Magness RR, Ford SP 1982 Steroid concentrations in uterine lymph and uterine arterial plasma of gilts during the estrous cycle and early pregnancy. Biol Reprod 27:871–877[CrossRef][Medline]
  30. Schwartz AL 1984 The hepatic asialoglycoprotein receptor. CRC Crit Rev Biochem 16:207–233[Medline]
  31. Nilsen-Hamilton M, Jang Y-J, Delgado M, Shim J-K, Bruns K, Chiang C-P, Fang Y, Parfett CLJ, Denhardt DT, Hamilton RT 1991 Regulation of the expression of mitogen-regulated protein (MRP; proliferin) and cathepsin L in cultured cells and in the murine placenta. Mol Cell Endocrinol 77:115–122[CrossRef][Medline]
  32. Nilsen-Hamilton M, Jang Y-J, Alvarez-Azaustre E, Hamilton RT 1988 Regulation of the production of a prolactin-like protein (MRP/PLF) in 3T3 cells and in the mouse placenta. Mol Cell Endocrinol 56:179–190[CrossRef][Medline]
  33. McCormack JT, Greenwald GS 1974 Progesterone and oestradiol-17ß concentrations in the peripheral plasma during pregnancy in the mouse. J Endocrinol 62:101–107[Abstract/Free Full Text]
  34. McCormick JT, Greenwald GS 1974 Evidence for a preimplantation rise in oestradiol-17ß levels on day 4 of pregnancy in the mouse. J Reprod Fertil 41:297–301[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. A. Longo, J. A. Kennell, M. J. Ochocinska, S. E. Ross, W. S. Wright, and O. A. MacDougald
Wnt Signaling Protects 3T3-L1 Preadipocytes from Apoptosis through Induction of Insulin-like Growth Factors
J. Biol. Chem., October 4, 2002; 277(41): 38239 - 38244.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. J. Toft, S. B. Rosenberg, G. Bergers, O. Volpert, and D. I. H. Linzer
Reactivation of proliferin gene expression is associated with increased angiogenesis in a cell culture model of fibrosarcoma tumor progression
PNAS, October 16, 2001; (2001) 231364798.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. T. Fassett and M. Nilsen-Hamilton
Mrp3, a Mitogen-Regulated Protein/Proliferin Gene Expressed in Wound Healing and in Hair Follicles
Endocrinology, May 1, 2001; 142(5): 2129 - 2137.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
J. T. FASSETT, R. T. HAMILTON, and M. NILSEN-HAMILTON
Mrp4, A New Mitogen-Regulated Protein/Proliferin Gene; Unique in this Gene Family for its Expression in the Adult Mouse Tail and Ear
Endocrinology, May 1, 2000; 141(5): 1863 - 1871.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. J. Toft, S. B. Rosenberg, G. Bergers, O. Volpert, and D. I. H. Linzer
Reactivation of proliferin gene expression is associated with increased angiogenesis in a cell culture model of fibrosarcoma tumor progression
PNAS, November 6, 2001; 98(23): 13055 - 13059.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fang, Y.
Right arrow Articles by Nilsen-Hamilton, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fang, Y.
Right arrow Articles by Nilsen-Hamilton, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals