help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Su, J.
Right arrow Articles by Napoli, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Su, J.
Right arrow Articles by Napoli, J. L.
Endocrinology Vol. 140, No. 11 5275-5284
Copyright © 1999 by The Endocrine Society

ARTICLES

Complementary Deoxyribonucleic Acid Cloning and Enzymatic Characterization of a Novel 17ß/3{alpha}-Hydroxysteroid/Retinoid Short Chain Dehydrogenase/Reductase1

Jian Su, Min Lin and Joseph L. Napoli

Department of Biochemistry, State University of New York School of Medicine and Biomedical Sciences, Buffalo, New York 14214

Address all correspondence and requests for reprints to: Dr. Joseph L. Napoli, Department of Nutritional Sciences, 119 Morgan Hall, MC#3104, University of California, Berkeley, California 97420-3104. E-mail: jln{at}uclink4.berkeley.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
17ß-Hydroxysteroid dehydrogenases (17ßHSDs) convert androgens and estrogens between their active and inactive forms, whereas retinol dehydrogenases catalyze the conversion between retinol and retinal. Retinol dehydrogenases function in the visual cycle, in the generation of the hormone retinoic acid, and some also act on androgens. Here we report cloning and expression of a complementary DNA that encodes a new mouse liver microsomal member of the short chain dehydrogenase/reductase (SDR) superfamily and its enzymatic characterization, i.e. 17ßHSD9. Although 17ßHSD9 shares 88% amino acid identity with rat 17ßHSD6, its closest homolog, the two differ in substrate specificity. In contrast to other 17ßHSD, 17ßHSD9 has nearly equivalent activities as a 17ßHSD (with estradiol ~= adiol) and as a 3{alpha}HSD (with adiol ~= androsterone). It also recognizes retinol as substrate and represents in part the NAD+-dependent liver microsomal dehydrogenase that uses unbound retinol, but not retinol complexed with cellular retinol-binding protein. Thus, this enzyme has catalytic properties that overlap with two subgroups of SDR, 17ßHSD and retinol dehydrogenases. Inactivation of estrogen and a variety of androgens seems to be its most probable function. Because of its apparent inability to access retinol bound with cellular retinol-binding protein, a function in the pathway of retinoic acid biosynthesis seems less obvious. These data provide additional insight into the enzymology of estrogen, androgen, and retinoid metabolism and illustrate how closely related members of the SDR superfamily can have strikingly different substrate specificities.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
17-ß-HYDROXYSTEROID dehydrogenases (17ßHSDs) compose a group of at least eight distinct enzymes that interconvert androgens or estrogens between their active and relatively inactive forms (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16). These enzymes have unique tissue distribution patterns and serve as either dehydrogenases or reductases, but usually not as both. Some act predominantly with estrogens (17ßHSD1, -4, and -7), others act predominantly with androgens (17ßHSD3 and -5), whereas others metabolize both estrogens and androgens (17ßHSD2, 17ßHSD6, and Ke6). The substrate specificity and expression loci of several suggest specific functions in modifying sex hormone activity. Females express 17ßHSD1, for example, which acts as a reductase to activate estrone into estradiol in the human ovary, placenta, and breast (1, 2, 9). Males express 17ßHSD3, which functions as a reductase in the testis to activate androstenedione into testosterone (4). Both males and females express 17ßHSD2, which functions as a dehydrogenase in liver, placenta, prostate, and other tissues, but not in testis, to inactive estradiol and testosterone into estrone and androstenedione, respectively, with about equivalent efficiency (3, 10). Rat liver and prostate express 17ßHSD6, which further inactivates 5{alpha}-androstan-3{alpha},17ß-diol (adiol) into androsterone (5). With the exception of 17ßHSD4, which seems to have only a minor function in steroid metabolism (7, 13), the precise contributions to sex steroid metabolism of most of the others require further study. The very expression of so many 17ßHSDs, however, indicates the precise control mechanisms required for steroid hormone metabolism in different spatial and perhaps temporal patterns.

Most 17ßHSD enzymes belong to the superfamily of short chain dehydrogenase/reductase (SDRs), but 17ßHSD5 belongs to the aldo-keto reductase superfamily (8), and the peroxisome-localized 17ßHSD4 consists of a unique fusion of an SDR, an acyl-coenzyme A dehydrogenase, and sterol carrier protein-2 (7, 13). The SDR superfamily consists of approximately 100 different members in animals, bacteria, and plants that function in steroid, PG, and retinoid metabolism (17, 18). The members of the SDR superfamily share relatively little amino acid sequence similarity and have only about 20 strictly conserved residues. Conservation resides in the N-terminal placement of the cofactor-binding residues, catalytic and cofactor-binding residues, the sequence NNAG, and tertiary structures. As alluded to above, SDR frequently act multifunctionally, catalyzing dehydrogenations and/or reductions of seemingly disparate substrates. A single SDR, 17ßHSD2 for example, serves as a 17ßHSD with estrogen and multiple androgen substrates and as a 20{alpha}HSD with 20{alpha}-dihydroprogesterone (3, 10). Others, human retinol dehydrogenase (RoDH) for example, have activity with retinoids and as 3{alpha}HSD and 17ßHSD (14). Despite the multiple catalytic functions of SDR, some tend to cluster in major substrate-oriented groups, such as 17ßHSD and the several [RoDH1, -2, and -3; cis-retinol/androgen dehydogenase-1 (CRAD1) and -2; retSDR1; RDH4; and 11-cis-RoDH) that catalyze retinoid metabolism (19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31).

The SDR that serve as retinol dehydrogenases function in the pathway of retinoic acid biosynthesis by catalyzing the first step in the conversion of retinol (vitamin A) into the hormone retinoic acid (32, 33). Other SDR/retinol dehydrogenases function in the visual cycle by interconverting either 11-cis-retinol into 11-cis-retinal or all-trans-retinal into all-trans-retinol (22, 23, 28, 31). Rodent liver microsomes express several retinol dehydrogenases active in the biosynthesis of retinoic acid (34, 35, 36). One of these, which can use either NADP+ or NAD+ in vitro, recognizes retinol complexed with cellular retinol-binding protein (CRBP) and unbound retinol as substrates to produce retinal, the intermediate in all-trans-retinoic acid biosynthesis. At least three complementary DNAs (cDNAs) have been cloned (RoDH1–3) that appear to encode this activity (19, 20, 21). Others use NAD+in vitro and seem to recognize only unbound retinol as substrate.

Here we report cloning of a cDNA that encodes a new mouse SDR, i.e. 17ßHSD9, and its enzymatic characterization. This enzyme shares 88% amino acid identity with rat 17ßHSD6, its closest SDR homolog, but the two seem not to represent interspecies homologs. First, PCR with specific primers identified expression of a homolog of rat 17ßHSD6 in mouse, but did not amplify mouse 17ßHSD9. Moreover, 17ßHSD9 and 17ßHSD6 differ in substrate specificity. Mouse 17ßHSD9 has roughly equivalent activities as a 17ßHSD (with estradiol ~= adiol) and as a 3{alpha}HSD (with adiol ~= androsterone), whereas rat 17ßHSD6 has 10-fold greater 17ßHSD activity with adiol than it does with estradiol and has low 3{alpha}HSD with androsterone. 17ßHSD9 also recognizes retinol as substrate and contributes to the NAD+-dependent liver microsomal dehydrogenase that recognizes unbound retinol. These data provide additional insight into the enzymology of estrogen, androgen, and retinoid metabolism and illustrate how closely related SDR can have quite strikingly different substrate specificity.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
cDNA isolation
A mouse liver {lambda}gt10 cDNA library (CLONTECH Laboratories, Inc., Palo Alto, CA) was screened under low stringency conditions (hybridization at 40 C and final wash at 60 C) with a 32P-labeled probe consisting of rat RoDH1 nucleotides 298–673 (19). The first round of screening identified 189 positive plaques from approximately 3.6 x 105. The second round of screening was performed by PCR at an annealing temperature of 65 C with the sense primer TTCTAGTGCGCTGTCATC (nucleotides 197–214 of the final cDNA) designed from a partial cDNA sequence in the EST database (GenBank access no. AA239724, nucleotides 12–517) and a degenerate antisense primer GAAGA(A/G)CTT(A/G)GCATCCCA (nucleotides 1088–1105 of the final cDNA) designed from a conserved C-terminal region in the cDNAs that encodes the RoDH/CRAD family (19, 20, 21, 24, 26). Sixteen plaques were identified with the 909-bp size fragment anticipated from the primers used. To determine insert sizes in the EcoRI site of the {lambda}gt10 phages, PCR was performed with a pair of primers designed to bind to the two phage arms near the cDNA insert (left arm primer, AGCAAGTTCAGCCTGGTTAAGT; right arm primer, TTATGAGTATTTCTTCCAGGG).

The PCR products were resolved with an agarose gel, and all 16 cDNA inserts were digested with EcoRI and ligated into pBluescript II SK+. All 16 were sequenced in both directions by nested deletion. The longest (no. 55) was designated pBSK/17ßHSD9.

Expression of 17ßHSD9
The cDNA insert of pBSK/17ßHSD9 was digested from {lambda}gt10 with EcoRI and ligated into pcDNA3 to produce pcDNA3/17ßHSD9. COS cells were transfected using Lipofectamine with pcDNA3/17ßHSD9 or with pcDNA3 (mock transfection). Assays were conducted with intact plated cells for 2 h, beginning 24 h after transfection. Alternatively, cell pellets were suspended in 10 mM HEPES and 10% sucrose (pH 7.5), and homogenized with a Virsonic 60 ultrasonic wave homogenizer (Virtis, Gardener, Inc.). The homogenate was centrifuged at 800 x g for 10 min. The supernatant protein was used for enzymatic assays, unless noted otherwise. Protein concentrations were determined by the method of Bradford (37).

Enzyme assays
Incubations and analyses of products have been described in detail previously (24, 26). Assays were run for 30 min at 37 C in either 0.25 ml 10 mM cyclohexlaminoethanesulfonic acid (Ches) (pH 9) or 10 mM succinic acid (pH 5), 150 mM KCl, 2 mM EDTA, and 1.6 mM NAD+ or 2 mM NADH with the 800 x g supernatant of mock- or pcDNA3/17ßHSD9-transfected cells, unless noted otherwise. The NADH-regenerating system used in some experiments consisted of 5 U sorbitol dehydrogenase, 20 mM sorbitol, and 2 mM NADH incubated in the reaction mixture for 10 min before substrate addition. Retinoid dehydrogenase assays were quenched with 0.1 ml 0.1 M O-ethylhydroxylamine and 0.35 ml methanol, incubated at room temperature for 10 min, and extracted with 2.5 ml hexane. The retinoids in the hexane extract were quantified by normal phase HPLC with a detection limit of approximately 1 pmol (20, 21). Steroid dehydrogenase assays were performed with [3H]steroids (40–101 Ci/mmol, 20,000 dpm/reaction). Incubates were extracted with methylene chloride (4 ml), and the extracts were analyzed by TLC. 3H-Labeled steroids were detected by autoradiography. The radioactive zones were excised and counted with a liquid scintillation counter. Kinetic data were obtained under initial velocity conditions and were analyzed with Enzfitter (38).

Northern blotting
Northern blots were performed with the mouse Multiple Tissue Northern blot, which provides 2 µg poly(A)+ RNA/lane on a Nylon membrane (CLONTECH Laboratories, Inc.). The probe was a 97-base chemically synthesized oligo consisting of nucleotides 125–221 of the cDNA labeled with 32P by random priming. Prehybridization was performed in 10 ml hybridization solution (50% formamide, 5 x Denhardt’s, 0.1% SDS, 100 µg/µl denatured salmon sperm DNA, and 5 x SSPE) (SSPE = 3 M sodium chloride, 0.2 M sodium phosphate, 0.02 EDTA, pH 7) at 40 C for 4 h. Hybridization was performed overnight in the same solution containing 2 x 106 cpm probe. The final wash was performed at 55 C with 1 x SSC-0.1% SDS. Signals were visualized with a Bio-Rad Laboratories, Inc. GS-505 Molecular Imager System (Hercules, CA).

Ribonuclease (RNase) protection assays
A 17ßHSD9-specific probe was generated by digesting pBSK/17ßHSD9 with BstXI. The 3'-protruding ends were blunted with mung bean nuclease. The 347-bp nucleotide cDNA fragment (nucleotides 380–726 of the cDNA) was recovered from an agarose gel, subcloned into the EcoRV site of pBluescript II SK+, and linearized with HindIII. A 32P-labeled antisense probe was transcribed with T3 RNA polymerase (Ambion, Inc., Austin, TX) for 1 h at 37 C in 10 mM dithiothreitol; 0.5 mM each of ATP, CTP, and GTP; and 50 µCi of UTP (800 Ci/mmol). The 280-nucleotide antisense ß-actin complementary RNA probe (nucleotides 79–358) used as an internal standard was transcribed from pTRI mouse ß-actin template (Ambion, Inc.) under the same conditions. DNA templates were removed by deoxyribonuclease I digestion. Transcripts were purified with 5% polyacrylamide and 8 M urea gels. RNase protection assays were performed with the Hybspeed RPA kit (Ambion, Inc.) following the manufacturer’s directions. Briefly, total RNA (50 µg) was extracted from mouse tissues with guanidinium thiocyanate-phenol-chloroform and coprecipitated with the complementary RNA probes (1 x 105 cpm 17ßHSD9; 5 x 104 cpm ß-actin). Pellets were resuspended in 10 µl hybridization buffer (Ambion, Inc.) by four alternating 15-sec periods of vigorous vortexing and incubated at 95 C for 3 min and then at 68 C for 10 min. A 100-µl aliquot of RNase A/T1 mixture (diluted 1:100) was allowed to digest the unhybridized probes and RNA for 30 min at 37 C. Inactivation/precipitation mixture (150 µl) was added to precipitate the undigested RNA. After centrifugation, the supernatants were removed, and the pellets were dissolved in 40 µl gel loading buffer by heating at 95 C for 4 min. The samples were loaded onto 5% polyacrylamide-8 M urea gels and run at about 180 V for 3–4 h. Quantitative analysis was performed with a Molecular Imager system (Bio-Rad Laboratories, Inc.).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
cDNA and amino acid sequences
Although multiple microsomal RoDH/CRAD cDNAs have been isolated, several more enzymatic activities occur (35, 39, 40, 41). To determine whether any of the partially characterized activities are related to known isozymes, a mouse liver cDNA library was screened initially with a probe from the 5'-end of RoDH1, highly conserved among RoDH1–3 and CRAD1 and 2 (19, 20, 21, 24, 26). The second round of screening by PCR relied on a sense primer from an EST library representing an unknown SDR, but with 89% identity to RoDH1 in the first 94 amino acid residues. (These residues are highly conserved among RoDH1–3 and CRAD1 and CRAD2.) A degenerate antisense primer was designed from conserved amino acid residues (WDAKFF) in the C-termini of RoDH1–3 and CRAD1 and CRAD2. This process identified 16 clones. Four were identical. Of the 12 that differed, all had identical nucleotide sequences in their coding regions; 8 had identical nucleotide sequences in their 5'-untranslated regions (5'-UTRs) in regions of overlap, and 9 had identical nucleotide sequences in their 3'-UTRs. One had no complete coding region, and 1 was fused with another gene in its 3'-end. Five different sequences occurred, outside of the coding region, because of differences in the sequences of 5'- and/or 3'-UTRs (Table 1Go). These differences included either a 38-bp insertion and/or a 5-bp deletion in the 5'-UTRs. The longest cDNA (no. 55), designated pBSK/17ßHSD9, differed totally from the others in its 3'-UTR sequence.


View this table:
[in this window]
[in a new window]
  		Table 1. mRNA isoforms of 17ßHSD9

 
The protein encoded by pBSK/17ßHSD9 has a deduced amino acid sequence that includes the 25 conserved signature SDR residues (Fig. 1Go). Notably, the cofactor binding residues G36XXXGXG occur in the identical loci with those in RoDH1–3 and CRAD1 and CRAD2, as do the catalytic residues S164, Y176, and K180. The latter group, however, has a catalytic area sequence of GGGYCISK compared with GGFYSCSK for 17ßHSD9, perhaps contributing to differences in substrate specificity. The first 114 amino acid residues of 17ßHSD9 showed only 10 differences compared with RoDH1–3 and CRAD1 and CRAD2, which differ among each other by 7 or less residues in this area. As in other SDR that catalyze retinoid dehydrogenation, the first 18 amino acid residues of 17ßHSD9 provide a hydrophobic area sufficient to span a membrane and are adjacent to 4 hydrophilic amino acid residues, in this case RERQ, suggestive of a membrane insertion motif.



View larger version (72K):
[in this window]
[in a new window]
  		Figure 1. Nucleotide and deduced amino acid sequences of 17ßHSD9. Boldface type in the translated region denotes the amino acids conserved in many, if not most, SDR family members (18 ). The underlined nucleotide sequences denote the primers used in the second round of screening by PCR.

 
The sequence of the pBSK/17ßHSD9 insert was identical with three partial cDNA sequences in the GenBank EST database: AA239724, nucleotides 12–517; AA239189, nucleotides 900-1309; and AA239249, nucleotides 907-1087. Not only were none complete, but there were no data suggesting the 5'-most fragment and the two 3'-end fragments represented different pieces of the same cDNA.

Mouse 17ßHSD9 has closest amino acid identity with rat 17ßHSD6. Therefore, expression of a mouse liver 17ßHSD6 was demonstrated by PCR to distinguish the expression of two different genes in the mouse, 17ßHSD6 and 17ßHSD9. PCR was performed with a sense primer specific for 17ßHSD6 and a degenerate antisense primer. The primer pair amplified the expected 640-bp signal for 17ßHSD6 from both rat and mouse liver cDNA, but did not amplify segments from a mixture of rat RoDH1, -2, and -3; CRAD1 and -2; and mouse 17ßHSD9 cDNAs (Fig. 2Go).



View larger version (76K):
[in this window]
[in a new window]
  		Figure 2. Expression of 17ßHSD6 in rat and mouse liver. PCR was performed at an annealing temperature of 65 C with a sense primer specific for 17ßHSD6 (5'-GGAGACAGTGATCCTTGAC) and a degenerate antisense primer [5'-GAAGA(A/G)CTT(A/G)GCATCCCA]. The templates and primers used were: 1) a rat liver {lambda}gt11 cDNA library (CLONTECH Laboratories, Inc.) and both primers; 2) a mouse liver {lambda}gt10 cDNA library (CLONTECH Laboratories, Inc.) and both primers; 3) cDNAs of rat RoDH1, -2, and -3; mouse CRAD1 and -2; mouse 17ßHSD9; and both primers; 4) the rat liver cDNA library and antisense primer only; 5) the rat liver cDNA library and sense primer only; 6) the mouse liver cDNA library and antisense primer only; 7) the mouse liver cDNA library and sense primer only; and 8) the DNA ladder.

 
17ßHSD9 has less homology with RoDH1–3 and CRAD1 and -2 (Table 2Go). Even further away in homology are a second subgroup of retinoid-associated SDR, bovine and human 11-cis-RDH/9-cis-RDH and mouse RDH4 (22, 23, 25, 31). The various enzymes denoted as 17ßHSD (types 1–5), other than 17ßHSD6, have the lowest amino acid identity with 17ßHSD9.


View this table:
[in this window]
[in a new window]
  		Table 2. Comparison of amino acid sequences of 17ßHSD9 with related SDR

 
Tissue loci of messenger RNA (mRNA) expression
Liver expressed 17ßHSD9 as a 1.6-kb mRNA transcript (Fig. 3Go). 17ßHSD9 mRNA was not detected in any other tissue screened by either Northern analysis or the more sensitive RNase protection assay technique.



View larger version (45K):
[in this window]
[in a new window]
  		Figure 3. mRNA expression of 17ßHSD9 in mouse tissues. Top panel, RNase protection assays were performed with RNA from 2-month-old male BALB/C mice. Lane 1, Testis; lane 2, liver; lane 3, lung; lane 4, kidney; lane 5, heart; lane 6, eye; lane 7, brain; lane 8, yeast RNA; lane 9, DNA markers (200, 300, 400, and 500 bp); lane 10, probes. Bottom panel, Northern hybridization was performed as described in Materials and Methods with a commercially available mouse multiple tissue blot: 1, testis; 2, kidney; 3, skeletal muscle; 4, liver; 5, lung; 6, spleen; 7, brain; and 8, heart.

 
Enzymatic activity
Assayed with its most efficient retinoid (all-trans-retinol) and steroid (estradiol) substrates (see below), 17ßHSD9 had much greater activity with NAD+ than with NADP+ as a dehydrogenase (Table 3Go). In fact, NADP+ supported no detectable activity with estradiol, but did support retinol dehydrogenase activity, albeit at a rate 23-fold lower than that supported by NAD+. As a reductase, 17ßHSD9 had similar activity with either NADH or NADPH with both all-trans-retinal and a representative steroidal ketone, dihydro- testosterone.


View this table:
[in this window]
[in a new window]
  		Table 3. Cofactor use by 17ßHSD9

 
Recombinant 17ßHSD9 had a pH optimum for dehydrogenation of all-trans-retinol from 9–9.5. The pH optimum for estrogen dehydrogenation was broader and included the range from 8.5 to at least 9.5. Rates of reactions with both substrates were optimum with Ches buffer and were diminished at most pH values in the presence of HEPES. The rates of reduction of all-trans-retinal and dihydrotestosterone were highest at a pH of 5 with succinate buffer. Mock-transfected COS cells showed little or no activity under a variety of conditions (buffer, pH, substrate, cofactor), with one exception. At pH 5 with all-trans-retinal and NADPH, mock-transfected cells produced 241 ± 56 pmol/assay retinol, indicating the presence of an NADPH-dependent retinal dehydrogenase distinct from 17ßHSD9.

Of the retinol isomers tested, 17ßHSD9 showed the most activity with all-trans-retinol (Table 4Go). No activity was detected with either 9-cis- or 13-cis-retinol with lower amounts of protein. At relatively high protein levels, activity was observed with both 9-cis- and 13-cis-retinol, but the rates were approximately 30- and 50-fold less, respectively, than the rate with all-trans-retinol at the lower protein level.2 17ßHSD9 also was less active with 11-cis-retinol than with all-trans-retinol. Although 17ßHSD9 converted free all-trans-retinol into all-trans-retinal, it did not covert all-trans-retinol bound with CRBP, i.e. 5 µM holo-CRBP into all-trans-retinal, in the presence of either NAD+ or NADP+ under standard dehydrogenation conditions.


View this table:
[in this window]
[in a new window]
  		Table 4. Dehydrogenase activity of 17ßHSD9

 
17ßHSD9 showed the highest steroid activity as a 17ßHSD with estradiol and was approximately 14- and 50-fold less active as a 17ßHSD with dihydrotestosterone and testosterone (see Footnote 1), respectively (Table 4Go). 17ßHSD9 showed no activity as an 11ßHSD with corticosterone and was about 2-fold less active as a 3{alpha}HSD with androsterone compared with its 17ßHSD activity with estradiol. The actions of 17ßHSD9 with 3{alpha}-adiol were complex. 3{alpha}-Adiol has both 3{alpha}-hydroxyl and 17ß-hydroxyl groups capable of undergoing dehydrogenation (Fig. 4Go). Indeed, the 17ßHSD9-catalyzed reaction with 3{alpha}-adiol produced three products in proportions that changed with enzyme concentration. At the lower enzyme concentration, 17ßHSD9 recognized each of the hydroxyl groups with similar efficiencies, producing the 3{alpha}- and 17ß-dehydrogenation products (dihydrotestosterone and androsterone, respectively) in nearly equivalent amounts and only a small amount of the 3{alpha},17ß-dione product, androstandione. At the higher enzyme concentration, the major product became 3{alpha},17ß-dione.



View larger version (20K):
[in this window]
[in a new window]
  		Figure 4. Reactions catalyzed by 17ßHSD9. 17ßHSD9 shows three dehydrogenase activities: RoDH, 17ßHSD, and 3{alpha}HSD.

 
The route to androstandione from 3{alpha}-adiol at the higher 17ßHSD9 concentration probably involved 17ßHSD activity, i.e. production of androsterone, followed by 3{alpha}HSD activity, i.e. conversion of androsterone into androstandione, rather than conversion of dihydrotestosterone into the dione. The following observations support this conclusion. With 3{alpha}-adiol as substrate, 17ßHSD9 acts equally efficiently as a 17ßHSD or a 3{alpha}HSD (at the lower protein concentration), but the activity of 17ßHSD9 as a 3{alpha}HSD with androsterone exceeds its activity as a 17ßHSD with dihydrotestosterone at the higher protein concentrations. This would result in accumulation of dihydrotestosterone but conversion of the androsterone produced from 3{alpha}-adiol into androstandione.

17ßHSD9 displayed Michaelis-Menten kinetics with all-trans-retinol, but cooperative kinetics with estradiol, androsterone, and 3{alpha}-adiol (Fig. 5Go). Enzymatic efficiency was highest with the steroid substrates and was markedly lower with all-trans-retinol (Table 5Go).



View larger version (19K):
[in this window]
[in a new window]
  		Figure 5. Kinetics of recombinant 17ßHSD9 with all-trans-retinol and sterol substrates. Reactions were run with all-trans-retinol (top panel; 40 µg protein) or with steroids (bottom panel; open circles, 3{alpha}-adiol; filled squares, estradiol; filled circles, androsterone; 6 µg protein) as described in Materials and Methods.

 

View this table:
[in this window]
[in a new window]
  		Table 5. Kinetic constants of 17ßHSD9 activity with steroid and retinoid substrates

 
17ßHSD9 had lower reductase activity than dehydrogenase activity (compare the data in Table 4Go with those in Table 6Go). Moreover, no major differences were noted with 17ßHSD9 as a retinoid, 17-oxo-steroid, or 3-oxo-steroid reductase. 17ßHSD9 had no detectable reductase activity with androstenedione, consistent with its inability to dehydrogenate testosterone into androstenedione.


View this table:
[in this window]
[in a new window]
  		Table 6. Reductase activity of 17ßHSD9

 
To demonstrate the multifunctional nature of 17ßHSD9 in vivo, 5 µM all-trans-retinol, 3{alpha}-adiol, or estradiol were added individually to pcDNA3/17ßHSD9-transfected and mock-transfected COS cells. All-trans-retinol supported retinal formation in intact cells at a net rate of 180 ± 8 pmol/mg protein/2 h (mean ± SD; n = 3 plates). 3{alpha}-Adiol supported dihydrotestosterone, androsterone, and androstenedione formation at an overall net rate of 5980 ± 34 pmol/mg protein·2 h. Estradiol supported estrone formation at a net rate of 6160 ± 450 pmol/mg protein·2 h. Because these rates were not necessarily in the linear ranges, they should not be compared for relative enzyme efficiencies.

Inhibitors of 17ßHSD9 activity
Carbenoxolone and phenyl arsenoxide inhibited 17ßHSD9 activity potently (IC50 values of 5 and 20 µM, respectively; Fig. 6Go). Carbenoxolone represents a prototypical inhibitor of SDR, including RoDH and CRAD isozymes (19, 20, 24, 26). Its activity with 17ßHSD9, therefore, was anticipated. The sulfhydryl cross-linking agent phenyl arsenoxide also inhibits RoDH1 and -2 and CRAD1 and -2 potently. 4-Methylpyrazole inhibited 17ßHSD9 with an IC50 of 5.2 mM and has an IC50 of 5 mM with CRAD2, but does not inhibit RoDH isozymes even at 500 mM (19, 20, 24, 26). 4-Methylpyrazole has been associated closely with inhibiting the class I, II, and IV alcohol dehydrogenases, with Ki values ranging from micromolar to high millimolar depending on both isozyme and species.



View larger version (16K):
[in this window]
[in a new window]
  		Figure 6. Inhibitors of 17ßHSD9. The effects of carbenoxolone (open circles), phenyl arsenoxide (filled triangles), and 4-methylpyrazole (filled circles) were tested on 17ßHSD9 dehydrogenation activity with 5 µM estradiol at pH 9 in the presence of NAD+. Values are the means of three replicate determinations.

 
Subcellular locus of 17ßHSD9
Centrifugation of the 800 x g supernatant of transfected COS cells at 10,000 x g for 30 min partitioned 77% of the activity assayed with estradiol into the supernatant. Centrifugation of the supernatant at 100,000 x g for 2 h partitioned 98% of the recovered activity into the microsomal pellet.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
This work identifies a new microsomal SDR, 17ßHSD9, with unique properties compared with the distinct subgroups of SDR known to date to catalyze either steroid 17ß-hydroxyl dehydrogenation or androgen 3{alpha}-hydroxyl/retinoid dehydrogenation (RoDH1–3, CRAD1,2, retSDR1, RDH4, 11-cis-RoDH, and human RoDH). Unique properties of 17ßHSD9 include its combination of 17ßHSD, 3{alpha}HSD, and retinoid activities. Although several oxidative 17ßHSD are known (e.g. 17ßHSD2, -4, and -6), oxidative 3{alpha}HSD have been rare among steroid-metabolizing enzymes; the first example was the 3{alpha}HSD activity (14) of RoDH1 (19). The combination of 3{alpha}HSD and 17ßHSD activity suggests that 17ßHSD9 would be relevant to both potential sites of androgen inactivation (3{alpha}/17ß-hydroxyl groups) as well to estrogen inactivation. 17ßHSD9 also presents the only enzyme related to the retinoid and 3{alpha}-hydroxyl androgen dehydrogenation SDR subgroup that has appreciable 17ßHSD activity, and it is the only one related to the retinoid subgroup known to recognize estrogen as a substrate. A major function of 17ßHSD9, given its expression locus and its kinetic characteristics, could be inactivation of circulating estrogen and a broad spectrum of androgens, including 3{alpha}-adiol, dihydrotestosterone, and androsterone. 17ßHSD9 also seems to represent (at least in part) the NAD+-dependent microsomal dehydrogenase activity that converts all-trans-retinol into all-trans-retinal in vitro, but does not recognize efficiently the CRBP-retinol complex (35, 36). Early evidence for the occurrence of a retinol dehydrogenase that recognized holo-CRBP as substrate included higher rates of retinal formation with NADP+ vs. NAD+ for liver microsomal retinol dehydrogenation when retinol was presented bound with CRBP. On the other hand, NAD+ supported the higher rate of retinal formation when unbound retinol was added to the incubation medium. These data suggested the expression of at least two enzymes, one that preferred NADP+ in vitro and recognized holo-CRBP and another that preferred NAD+ in vitro and used free retinol as substrate. Cloning and expression of the cDNA encoding 17ßHSD9 and characterization of its catalytic characteristics confirm this observation and extend it to demonstrate that retinoid activity represents only one aspect of its properties.

A function for 17ßHSD9 in liver all-trans-retinol metabolism seems somewhat uncertain because of its apparent inability to access retinol bound to CRBP. Rodent liver has a retinol concentration of approximately 5 µM, but a CRBP concentration of approximately 7 µM (42). Remeasurement under equilibrium conditions has provided a Kd of about 0.1 nM for CRBP binding with retinol (43). Under these conditions, the concentration of the non-CRBP-associated retinol would be approximately 0.25 nM, 20,000-fold lower than the total retinol concentration. Not only does the equilibrium lie overwhelmingly in favor of the CRBP-bound state, retinol apparently has a slow off-rate in vivo. Two well known facts support this idea. 1) Retinol isolates from liver homogenates bound with CRBP despite the capacity of biological membranes to sequester far more retinol than occurs in vivo (44). 2) Routine purification of holo-CRBP by size-exclusion chromatography takes hours through a matrix that readily binds free retinol, yet the CRBP emerges in the holo form (45). Thus, holo-CRBP represents the major physiological form of retinol in liver and free retinol has an exceedingly low concentration. Because microsomal RoDH isozymes occur that recognize both holo-CRBP and free retinol as substrates, a function seems problematic for the several dehydrogenases that recognize only free retinol, such as 17ßHSD9. This concern also pertains to soluble enzymes that do not access retinol bound with holo-CRBP, especially those with relatively high Km values for retinol, such as ADH isozymes.

Would an NAD+-dependent RoDH contribute more to retinoic acid biosynthesis than an NADP+-preferring RoDH because the ratio NAD+/NADH reportedly nears approximately 1000 compared with approximately 0.01 for NADP+/NADPH (46)? Not necessarily, because these ratios were measured in liver and may not pertain to other tissues, nor should these ratios remain fixed under all dietary/metabolic conditions or in all subcellular compartments. Perhaps more importantly, net directions taken by reversible metabolic reactions depend on complex input. The concentrations and affinity constants of both the substrate/product pair and reduced/oxidized forms of cofactors, not the oxidized/reduced cofactor ratio, determine the net direction of a reversible dehydrogenation. Generally, reversible metabolic reactions are driven in the direction of the final product by thermodynamically favored (irreversible) reactions that affect the concentrations of one or more of the reactants/products. The biosynthesis of retinoic acid from retinol includes such a step, the irreversible conversion of the intermediate retinal into retinoic acid by retinal dehydrogenases. This more complete appraisal of factors that influence the net flux of reversible reactions and recognition of the physiological substrate (holo-CRBP) positions the NADP+-preferring RoDHs in the pathway of retinoic acid biosynthesis. Additionally, the NADP+-preferring RoDHs do use NAD+ in vitro, albeit less efficiently than NADP+. Nevertheless, use of both cofactors in vitro introduces uncertainty about the cofactor used in vivo; it would depend on the concentrations of NADP+ and NAD+ and their relative Kd values.

In summary, this work reports a new mouse SDR with a primary amino acid sequence closest to that of rat 17ßHSD6, but with catalytic properties that overlap two subgroups of SDR, the steroid-metabolizing 17ßHSD and the androgen/retinoid-metabolizing RoDH and CRAD enzymes. Inactivation of estrogen and a variety of androgens represents the most probable function of 17ßHSD9. Because of its apparent inability to access retinol bound to CRBP, a role for 17ßHSD9 in the pathway of retinoic acid biosynthesis seems less certain.


   Footnotes
 
1 This work was supported by NIH Grant DK-36870. Back

2 The higher protein levels used for all-trans-retinol and estradiol were out of the linear rate range and therefore were not used to compare the all-trans- with the cis-retinol activities of 17ßHSD9. Back

Received May 21, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Peltoketo H, Isomaa V, Mäentausta O, Vihko R 1988 Complete amino acid sequence of human placental 17ß-hydroxysteroid dehydrogenase deduced from cDNA. FEBS Lett 239:73–77[CrossRef][Medline]
  2. The VL, Labrie C, Zhao HF, Couet J, Lachance Y, Simard J, Leblanc G, Cote J, Berube D, Gagne R 1989 Characterization of cDNAs for human estradiol 17ß-dehydrogenase and assignment of the gene to chromosome 17: evidence of two mRNA species with distinct 5'-termini in human placenta. Mol Endocrinol 3:1301–1309[Abstract]
  3. Wu L, Einstein M, Geissler WM, Chan HK, Elliston KO, Andersson S 1993 Expression cloning and characterization of human 17ß-hydroxysteroid dehydrogenase type 2, a microsomal enzyme possessing 20{alpha}-hydroxysteroid dehydrogenase activity. J Biol Chem 268:12964–12969[Abstract/Free Full Text]
  4. Geissler WM, Davis DL, Wu L, Bradshaw KD, Patel S, Mendonca BB, Elliston KO, Wilson JD, Russell DW, Andersson S 1994 Male pseudohermaphroditism caused by mutations of testicular 17ß-hydroxysteroid dehydrogenase. Nat Genet 7:34–39[CrossRef][Medline]
  5. Ghersevich S, Nokelainen P, Poutanen M, Orava M, Autio-Harmainen H, Rajaniemi H, Vihko R 1994 Rat 17ß-hydroxysteroid dehydrogenase type 1:primary structure and regulation of enzyme expression in rat ovary by diethylstilbestrol and gonadotropins in vivo. Endocrinology 135:1477–1487[Abstract]
  6. Adamski J, Normand T, Leenders F, Monte D, Begue A, Stehelin D, Jungblut PW, de Launoit Y 1995 Molecular cloning of a novel widely expressed human 80 kDa 17ß-hydroxysteroid dehydrogenase IV. Biochem J 311:437–443
  7. Normand T, Husen B, Leenders F, Pelczar H, Baert JL, Begue A, Flourens AC, Adamski J, de Launoit Y 1995 Molecular characterization of mouse 17ß-hydroxysteroid dehydrogenase IV. J Steroid Biochem Mol Biol 55:541–548[CrossRef][Medline]
  8. Deyashiki Y, Ohshima K, Nakanishi M, Sato K, Matsuura K, Hara A 1995 Molecular cloning and characterization of mouse estradiol 17ß-dehydrogenase (A-specific), a member of the aldoketoreductase family. J Biol Chem 270:10461–10467[Abstract/Free Full Text]
  9. Nokelainen P, Puranen T, Peltoketo H, Orava M, Vihko P, Vihko R 1996 Molecular cloning of mouse 17ß-hydroxysteroid dehydrogenase type 1 and characterization of enzyme activity. Eur J Biochem 236:482–490[Medline]
  10. Akinola LA, Poutanen M, Vihko R 1996 Cloning of rat 17ß-hydroxysteroid dehydrogenase type 2 and characterization of tissue distribution and catalytic activity of rat type 1 and type 2 enzymes. Endocrinology 137:1572–1579[Abstract]
  11. Mustonen MVJ, Poutanen MH, Isomaa VV, Vihko PT, Vihko RK 1997 Cloning of mouse 17ß-hydroxysteroid dehydrogenase type 2, and analysing expression of the mRNAs for types 1, 2, 3, 4 and 5 in mouse embryos and adult tissues. Biochem J 325:199–205
  12. Sha JA, Dudley K, Rajapaksha WR, O’Shaughnessy PJ 1997 Sequence of mouse 17ß-hydroxysteroid dehydrogenase type 3 cDNA and tissue distribution of the type 1 and type 3 isoform mRNAs. J Steroid Biochem Mol Biol 60:19–24[CrossRef][Medline]
  13. Qin YM, Poutanen MH, Helander HM, Kvist AP, Siivari KM, Schmitz W, Conzelmann E, Hellman U, Hiltunen JK 1997 Peroxisomal multifunctional enzyme of ß-oxidation metabolizing D-3-hydroxyacyl-CoA esters in rat liver: molecular cloning, expression and characterization. Biochem J 321:21–28
  14. Biswas MG, Russell DW 1997 Expression cloning and characterization of oxidative 17ß-and 3{alpha}-hydroxysteroid dehydrogenases from rat and human prostate. J Biol Chem 272:15959–15966[Abstract/Free Full Text]
  15. Nokelainen P, Peltoketo H, Vihko R, Vihko P 1998 Expression cloning of a novel estrogenic mouse 17ß-hydroxysteroid dehydrogenase/17-ketosteroid reductase (m17HSD7), previously described as a prolactin receptor-associated protein (PRAP) in rat. Mol Endocrinol 12:1048–1059[Abstract/Free Full Text]
  16. Fomitcheva J, Baker ME, Anderson E, Lee GY, Aziz N 1998 Characterization of Ke6, a new 17ß-hydroxysteroid dehydrogenase, and its expression in gonadal tissues. J Biol Chem 273:22664–22671[Abstract/Free Full Text]
  17. Baker ME 1996 Unusual evolution of 11ß- and 17ß-hydroxysteroid and retinol dehydrogenases. BioEssays 18:63–70[CrossRef][Medline]
  18. Jörnvall H, Persson B, Krook M, Atrian S, Gonzàlex-Duarte JJ, Ghosh D 1995 Short-chain dehydrogenases/reductases (SDR). Biochemistry 34:6003–6013[CrossRef][Medline]
  19. Chai X, Boerman MH, Zhai Y, Napoli JL 1995 Cloning of a cDNA for liver microsomal retinol dehydrogenase: a tissue-specific, short-chain alcohol dehydrogenase. J Biol Chem 270:3900–3904[Abstract/Free Full Text]
  20. Chai X, Zhai Y, Popescu G, Napoli JL 1995 Cloning of a cDNA for a second retinol dehydrogenase type II. Expression of its mRNA relative to type I. J Biol Chem 270:28408–28412[Abstract/Free Full Text]
  21. Chai X, Zhai Y, Napoli JL 1996 Cloning of a rat cDNA encoding retinol dehydrogenase isozyme type III. Gene 169:219–222[CrossRef][Medline]
  22. Simon A, Hellman U, Wernstedt C, Eriksson U 1995 The retinal pigment epithelial-specific 11-cis retinol dehydrogenase belongs to the family of short chain alcohol dehydrogenases. J Biol Chem 270:1107–1112[Abstract/Free Full Text]
  23. Driessen CA, Janssen BP, Winkens HJ, van Vugt AH, de Leeuw TL, Janssen JJ 1995 Cloning and expression of a cDNA encoding bovine retinal pigment epithelial 11-cis retinol dehydrogenase. Invest Ophthal Visual Sci 36:1988–1996[Abstract/Free Full Text]
  24. Chai X, Zhai Y, Napoli JL 1997 cDNA cloning and characterization of a cis-retinol/3{alpha}-hydroxysterol short-chain dehydrogenase. J Biol Chem 272:33125–33131[Abstract/Free Full Text]
  25. Romert A, Tuvendal P, Simon A, Dencker L, Eriksson U 1998 The identification of a 9-cis retinol dehydrogenase in the mouse embryo reveals a pathway for synthesis of 9-cis retinoic acid. Proc Natl Acad Sci USA 95:4404–4409[Abstract/Free Full Text]
  26. Su J, Chai X, Kahn B, Napoli JL 1998 cDNA cloning, tissue distribution, and substrate characteristics of a cis-retinol/3{alpha}-hydroxysterol short-chain dehydrogenase isozyme. J Biol Chem 273:17910–17916[Abstract/Free Full Text]
  27. Mertz JR, Shang E, Piantedosi R, Wei S, Wolgemuth DJ, Blaner WS 1997 Identification and characterization of a stereospecific human enzyme that catalyzes 9-cis-retinol oxidation: a possible role in 9-cis-retinoic acid formation. J Biol Chem 272:11744–11749[Abstract/Free Full Text]
  28. Haeseleer F, Huang J, Lebioda L, Saari JC, Palczewski K 1998 Molecular characterization of a novel short-chain dehydrogenase/reductase that reduces all-trans-retinal. J Biol Chem 273:21790–21799[Abstract/Free Full Text]
  29. Gough WH, VanOoteghem S, Sint T, Kedishvili NY 1998 cDNA cloning and characterization of a new human microsomal NAD+-dependent dehydrogenase that oxidizes all-trans-retinol and 3{alpha}-hydroxysteroids. J Biol Chem 273:19778–19785[Abstract/Free Full Text]
  30. Jurukovski V, Markova NG, Karaman-Jurukovska N, Randolph RK, Su J, Napoli JL, Simon M 1999 Cloning and characterization of retinol dehydrogenase transcripts expressed in human epidermal keratinocytes. Mol Genet Metab 67:62–73[CrossRef][Medline]
  31. Simon A, Lagercrantz J, Bajalica-Lagercrantz S, Eriksson U 1996 Primary structure of human 11-cis retinol dehydrogenase and organization and chromosomal localization of the corresponding gene. Genomics 36:424–430[CrossRef][Medline]
  32. Napoli JL 1996 Retinoic acid biosynthesis and metabolism. FASEB J 10:993–1001[Abstract]
  33. Napoli JL 1997 Retinoid binding proteins redirect retinoid metabolism. Semin Cell Mol Biol 8:403–415
  34. Posch KC, Boerman MH, Burns RD, Napoli JL 1991 Holocellular retinol binding protein as a substrate for microsomal retinal synthesis. Biochemistry 30:6224–6230[CrossRef][Medline]
  35. Napoli JL, Posch KC, Burns RD 1992 Microsomal retinal synthesis: retinol vs. holo-CRBP as substrate and evaluation of NADP, NAD and NADPH as cofactors. Biochim Biophys Acta 1120:183–186[CrossRef][Medline]
  36. Boerman MH, Napoli JL 1995 Characterization of a microsomal retinol dehydrogenase: a short-chain alcohol dehydrogenase with integral and peripheral membrane forms that interacts with holo-CRBP (type I). Biochemistry 34:7027–7037[CrossRef][Medline]
  37. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  38. Leatherbarrow RJ 1987 Enzfitter: A Non Linear Regression Data Analysis Program. Elsevier-Biosoft, Cambridge
  39. Ottonello S, Scita G, Mantovani G, Cavazzini D, Rossi GL 1993 Retinol bound to cellular retinol-binding protein is a substrate for cytosolic retinoic acid synthesis. J Biol Chem 268:27133–27142[Abstract/Free Full Text]
  40. Boerman MH, Napoli JL 1996 Cellular retinol-binding protein-supported retinoic acid synthesis. Relative roles of microsomes and cytosol. J Biol Chem 271:5610- 5616[Abstract/Free Full Text]
  41. Huang DY, Ichikawa Y 1997 Purification and characterization of a novel cytosolic NADP(H)-dependent retinol oxidoreductase from rabbit liver. Biochim Biophys Acta 1338:47–59[CrossRef][Medline]
  42. Harrison EH, Blaner WS, Goodman DS, Ross AC 1987 Subcellular localization of retinoids, retinoid-binding proteins, and acyl-CoA:retinol acyltransferase in rat liver. J Lipid Res 28:973–981[Abstract]
  43. Li E, Qian SJ, Winter NS, d’Avignon A, Levin MS, Gordon JI 1991 Fluorine nuclear magnetic resonance analysis of the ligand binding properties of two homologous rat cellular retinol-binding proteins expressed in Escherichia coli. J Biol Chem 266:3622–3629[Abstract/Free Full Text]
  44. Ong DE, Newcomer ME, Chytil F 1994 Cellular retinoid-binding proteins. In: Sporn MB, Roberts AB, Goodman DS (eds) The Retinoids: Biology, Chemistry and Medicine, ed 2. Raven Press, New York, pp 283–317
  45. Ong D, Chytil F 1980 Purification of cellular retinol and retinoic acid-binding proteins from rat tissue. Methods Enzymol 67:288–296[Medline]
  46. Veech RL, Eggleston LV, Krebs HA 1969 The redox state of free nicotinamide-adenine dinucleotide phosphate in the cytoplasm of rat liver. Biochem J 115:609–619[Medline]



This article has been cited by other articles:


Home page
 FASEB J.Home page
M. Zhang, P. Hu, C. R. Krois, M. A. Kane, and J. L. Napoli
Altered vitamin A homeostasis and increased size and adiposity in the rdh1-null mouse
FASEB J, September 1, 2007; 21(11): 2886 - 2896.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
W. Qiu, M. Zhou, F. Labrie, and S.-X. Lin
Crystal Structures of the Multispecific 17{beta}-Hydroxysteroid Dehydrogenase Type 5: Critical Androgen Regulation in Human Peripheral Tissues
Mol. Endocrinol., July 1, 2004; 18(7): 1798 - 1807.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M.-S. Song, W. Chen, M. Zhang, and J. L. Napoli
Identification of a Mouse Short-chain Dehydrogenase/Reductase Gene, Retinol Dehydrogenase-similar: FUNCTION OF NON-CATALYTIC AMINO ACID RESIDUES IN ENZYME ACTIVITY
J. Biol. Chem., October 10, 2003; 278(41): 40079 - 40087.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
B. N. Rexer and D. E. Ong
A Novel Short-Chain Alcohol Dehydrogenase from Rats with Retinol Dehydrogenase Activity, Cyclically Expressed in Uterine Epithelium
Biol Reprod, November 1, 2002; 67(5): 1555 - 1564.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. M. Soref, Y.-P. Di, L. Hayden, Y. H. Zhao, M. A. Satre, and R. Wu
Characterization of a Novel Airway Epithelial Cell-specific Short Chain Alcohol Dehydrogenase/Reductase Gene Whose Expression Is Up-regulated by Retinoids and Is Involved in the Metabolism of Retinol
J. Biol. Chem., June 22, 2001; 276(26): 24194 - 24202.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. V. Chetyrkin, O. V. Belyaeva, W. H. Gough, and N. Y. Kedishvili
Characterization of a Novel Type of Human Microsomal 3alpha -Hydroxysteroid Dehydrogenase. UNIQUE TISSUE DISTRIBUTION AND CATALYTIC PROPERTIES
J. Biol. Chem., June 15, 2001; 276(25): 22278 - 22286.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G.-F. Jang, J. P. Van Hooser, V. Kuksa, J. K. McBee, Y.-G. He, J. J. M. Janssen, C. A. G. G. Driessen, and K. Palczewski
Characterization of a Dehydrogenase Activity Responsible for Oxidation of 11-cis-Retinol in the Retinal Pigment Epithelium of Mice with a Disrupted RDH5 Gene. A MODEL FOR THE HUMAN HEREDITARY DISEASE FUNDUS ALBIPUNCTATUS
J. Biol. Chem., August 24, 2001; 276(35): 32456 - 32465.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Su, J.
Right arrow Articles by Napoli, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Su, J.
Right arrow Articles by Napoli, J. L.

HOME