Endocrinology Vol. 140, No. 12 5669-5681
Copyright © 1999 by The Endocrine Society
Sterol Regulatory Element-Binding Protein-1a Binds to cis Elements in the Promoter of the Rat High Density Lipoprotein Receptor SR-BI Gene1
Dayami Lopez and
Mark P. McLean
Departments of Obstetrics and Gynecology and Biochemistry and
Molecular Biology, University of South Florida College of Medicine,
Tampa, Florida 33606
Address all correspondence and requests for reprints to: Dr. Mark P. McLean, Departments of Obstetrics and Gynecology, 4 Columbia Drive, Room 529, Tampa, Florida 33606. E-mail: mmclean{at}com1.med.usf.edu
 |
Abstract
|
|---|
The high density lipoprotein (HDL) receptor, or scavenger receptor
class B type I (SR-BI), is critical for cholesterol transport and a
potential target for hypercholesterolemic drugs. Thus, elucidation of
the mechanism underlying regulation of the HDL receptor SR-BI gene is
essential. It has been previously shown that there is a correlation
between depletion in ovarian cholesteryl ester content and increased
HDL receptor SR-BI expression in response to hormonal stimulation. We
wanted to determine whether the levels of mature sterol response
element-binding protein-1a (SREBP-1a), a key protein in the
transcriptional regulation of several genes by sterols, are affected
under these conditions. Thus, Western blot analysis was carried out.
Consistent with the possibility that SREBP-1a may be involved in the
regulation of the HDL receptor SR-BI gene, we found that mature
SREBP-1a levels increased up to 11-fold in the ovary after treatment
with 50 U hCG. This increase in mature SREBP-1a protein levels
correlated with a 30% decrease in ovarian cholesterol levels. These
changes in both SREBP-1a and cholesterol levels preceded a 2-fold
induction of HDL receptor SR-BI protein levels. To determine whether
SREBP-1a could directly regulate the expression of the rat HDL receptor
SR-BI gene, approximately 2.2 kb of the receptor SR-BI promoter were
cloned and sequenced, and deletion analysis and mobility shift assays
were performed. The results of these studies demonstrate that the rat
HDL receptor SR-BI promoter contains two sterol response elements (pSRE
and dSRE) through which SREBP-1a can bind and activate transcription of
this gene. These motifs are similar to known SRE motifs reported for
sterol-sensitive genes, and the pSRE is located between two Sp1 sites,
similar to the SRE-1 motif in the low density lipoprotein receptor. The
cysteine protease inhibitor
N-acetyl-leucyl-leucyl-norleucinal, which inhibits SREBP
degradation, enhanced the effect of SREBP-1a on the regulation of the
rat HDL receptor SR-BI gene. It has previously been shown that tropic
hormones such as hCG can also influence gene expression by increasing
cAMP levels. Consistent with this fact, we have recently shown that
steroidogenic factor-1 (SF-1) mediates cAMP activation of the HDL
receptor SR-BI gene. Thus, we decided to examine whether SREBP-1a could
cooperate with SF-1 to enhance transcription this gene. The results
confirm that indeed both SF-1 and SREBP-1a synergize to induce HDL
receptor SR-BI gene expression.
 |
Introduction
|
|---|
IT IS WELL known that plasma concentrations
of high density lipoprotein (HDL) cholesterol exhibit an inverse
relationship with the incidence of atherosclerosis and coronary heart
disease (1). This protective mechanism is thought to be due to the
ability of a HDL particle to transport excess cholesterol from cells in
the arterial wall to the liver for its disposal as bile acid (reverse
cholesterol transport) (2, 3). This lipoprotein is also involved in
providing cholesterol to nonplacental steroidogenic tissues, such as
the adrenal, ovary, and testis, for steroid hormone synthesis (4, 5).
HDL cholesterol is delivered to these tissues by a mechanism called
selective lipid uptake, a process that differs from the low density
lipoprotein (LDL) uptake pathway in that the HDL uptake pathway does
not involve endocytosis and lysosomal degradation of the lipoprotein
particle (6, 7). Instead, cholesterol (primarily in the form of
cholesteryl esters) is selectively transported into the cell from a
bound HDL, which is then released into the extracellular fluid after
its lipid content has been depleted (6, 7).
The selective cholesteryl ester uptake from a HDL particle by the liver
and steroidogenic tissues has been shown to be mediated by the recently
identified HDL receptor, or scavenger receptor class B type I (SR-BI)
(8, 9, 10, 11, 12). This receptor has been shown to be the major determinant of
plasma HDL concentrations (8, 9, 10, 11, 12), and hence, it is a key element in
cholesterol homeostasis. It has also been proposed that the HDL
receptor SR-BI could be considered a potential target for
hypercholesterolemic drugs (13, 14). Based on this, elucidating the
molecular mechanism involved in the regulation of the HDL receptor
SR-BI gene expression is extremely important. One possible regulator of
this gene appears to be cholesterol. Several reports have shown that
increased adrenal HDL receptor SR-BI gene expression was associated
with depleted cholesterol stores resulting from a deficiency in
apolipoprotein A-I (15), hepatic lipase (15), or lecithin cholesterol
acyl transferase (16) genes. These effects were not restricted to the
adrenal gland, because reductions in ovarian cholesterol levels due to
LH-induced desensitization also caused up-regulation of the HDL
receptor SR-BI gene (17). In fact, depletion of ovarian cholesteryl
ester content and increased cell surface HDL binding in response to
hormonal stimulation were reported even before the HDL receptor SR-BI
was identified (18, 19). On the contrary, feeding rats a high
cholesterol diet for 2 weeks lowered HDL receptor SR-BI expression in
liver parenchymal cells (20). These changes in HDL receptor SR-BI
expression appear to be accounted for by changes in receptor messenger
RNA (mRNA) levels (16) suggesting possible transcriptional regulation
of this gene by cholesterol.
Transcriptional regulation by cholesterol has been reported for several
genes (21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33). Each of these sterol-sensitive genes contains at least
one sterol regulatory element (SRE) in their promoter, through which a
pair of proteins, known as sterol regulatory element-binding protein-1a
and -2 (SREBP-1a and -2), activate transcription (21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33). SREBPs are
synthesized as 125-kDa precursors that are attached to the endoplasmic
reticulum membrane and the nuclear envelope (34, 35, 36). In
sterol-depleted cells, a two-step proteolytic process releases the
65-kDa NH2-terminal segment of the SREBPs, which then
enters the nucleus, binds to the SRE, and activates transcription of
the target gene (34, 35, 36). The importance of these proteins in
activating transcription of several SRE-containing genes has been
clearly demonstrated in experiments using transgenic mice
overexpressing the NH2-terminal segment of SREBP-1a (37).
In these mice, the levels of sterol-sensitive genes were increased
severalfold over control levels (37).
Sequence analysis of the human HDL receptor SR-BI promoter has revealed
the presence of a 9-bp sequence (38) containing an E box previously
shown to bind SREBP-1a (39). In addition, the mRNA for both SREBPs (-1
and -2) have been found in the adrenal and liver (35, 36). These
results suggest that SREBPs may be involved in the regulation of the
HDL receptor SR-BI gene.
In view of the current data, we cloned the rat HDL receptor SR-BI
promoter and examined whether this gene is directly controlled by
SREBP-1a. We found that SREBP-1a induces the expression of the HDL
receptor SR-BI gene. This investigation indicates that intracellular
cholesterol levels may control HDL receptor SR-BI gene transcription,
like other sterol-sensitive genes. In addition, we investigated whether
SREBP-1a can cooperate with steroidogenic factor-1 (SF-1) in
controlling HDL receptor SR-BI transcription.
 |
Materials and Methods
|
|---|
Materials
The Advantage Tth polymerase mix and the
PromoterFinder DNA Walking Kit were purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA). All oligonucleotides and
primers were synthesized by Integrated DNA Technologies, Inc.
(Coralville, IA). The pGL3 basic luciferase vector, Renilla
luciferase vector, and the Dual Luciferase Reporter Assay System were
obtained from Promega Corp. (Madison, WI). The African
green monkey kidney COS-7, human liver HepG2, rat liver Clone 9 (L9),
Chinese hamster ovary CHO-K1, mouse adrenal Y1, and human bladder HTB-9
cell lines were obtained from American Type Culture Collection (Manassas, VA). The QuickChange Site-directed
Mutagenesis Kit was purchased from Stratagene (La Jolla,
CA). The NH2-terminal segment (active fragment) of
SREBP-1a under the control of the cytomegalovirus (CMV) promoter
(SREBP-1a-pCMV5) was provided by Dr. Tim Osborne (Department of
Molecular Biology and Biochemistry, University of California-Irvine).
The murine steroidogenic factor-1 (SF-1) complementary DNA (cDNA) under
control of CMV promoter (SF-1-pCMV) was provided by Dr. Kieth L. Parker
(University of Texas Southwestern Medical Center, Dallas, TX).
[
-32P]Deoxy (d)-CTP (3000 Ci/mmol) and the T7
Sequenase DNA Sequencing Kit were purchased from Amersham Pharmacia Biotech (Arlington Heights, IL).
[
-32P]ATP (3000 Ci/mmol) and [35S]dATP
(10001500 Ci/mmol) were obtained from DuPont/New England Nuclear
(Wilmington, DE). pCR 2.1 TA cloning vector was purchased from
Invitrogen (San Diego, CA). All restriction enzymes and
the calpain inhibitor I [N-acetyl-leucyl-leucyl-norleucinal
(ALLN)]) were obtained from Roche Diagnostic Corp.
(Indianapolis, IN). DMEM-nutrient mixture F-12 (DMEM/F12) and the
5'-Rapid Amplification of cDNA Ends Kit were obtained from Life Technologies, Inc./BRL (Grand Island, NY). FBS was purchased
from Summit Biotechnology (Ft. Collins, CO). Poly(dI-dC)
was obtained from Pharmacia Biotech (Piscataway, NJ).
BioMax-MR films were obtained from Fisher Scientific
(Norcross, GA). The rabbit polyclonal anti-SREBP-1 and the horseradish
peroxidase-conjugated goat antirabbit antibodies were purchased from
Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The
SuperSignal ULTRA Chemiluminescent Substrate was obtained from
Pierce Chemical Co. (Rockford, IL). Nitrocellulose
membrane was obtained from Schleicher & Schuell, Inc.
(Keene, NH). Rivastatin from Merck & Co. (Rahway, NJ) was
provided by Dr. Gene C. Ness (Department of Biochemistry and Molecular
Biology, University of South Florida, Tampa, FL). All other chemicals
were purchased from Fisher Scientific or
Sigma (St. Louis, MO).
Animals
Twenty-eight-day-old Sprague Dawley rats were purchased from
Harlan Industries (Madison, WI). All protocols to treat animals were
approved by the University of South Florida animal care committee.
Throughout the experiment, animals had free access to food and water
and were housed under a 12-h dark, 12-h light cycle. Follicular
development and ovulation were induced in rats by injection of 8 IU
PMSG. By this method, rats ovulate approximately 72 h after
treatment with PMSG (40). Ten days postovulation, rats were injected
with 50 U hCG. Ovaries, which consist mainly of luteal tissue using
this protocol (40), were removed before hCG injection (controls) and at
3, 6, 12, and 24 h post-hCG treatment.
Western blot analysis
Ovarian tissue (100150 mg) was homogenized in 1.5 ml ice-cold
homogenization buffer, as previously described (41). Ovarian
homogenates were assayed for protein concentration by the method
developed by Bio-Rad Laboratories, Inc. (Hercules, CA),
using BSA as the standard. Ovarian proteins (50 µg) were denatured at
100 C in loading buffer (42) for 10 min and subjected to
electrophoresis on a 7.518% gradient SDS-PAGE according to the
method of Laemmli (43). After electrophoresis, samples were
electroblotted onto nitro-cellulose membranes (0.2 µm pore) in buffer
containing 0.25 M Tris-HCl (pH 8.3) and 1.92 M
glycine for 16 h at 4 C. To verify equal protein loading,
nitro-cellulose membranes were stained with 0.1% Ponceau S (in 5%
acetic acid) and destained in water. Western blot analysis of SREBP-1a
protein was carried out with a 1:1000 dilution of the rabbit polyclonal
antiserum to SREBP-1 (Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA) in 3% milk. Western blot analysis of HDL receptor
SR-BI protein was performed using a rabbit polyclonal antiserum
(Research Genetics, Inc., Huntsville, AL) raised against
amino acids 489509 (AYSESLMSPAAKGTVLQEAKL) of the rat protein (44).
HDL receptor SR-BI protein immunoreactivity was identified at its
molecular size of 82 kDa. Immunoreactive proteins were then visualized
using a 1:10,000 dilution of horseradish peroxidase-conjugated goat
antirabbit antisera (Santa Cruz Biotechnology, Inc.) in
3% milk and the SuperSignal ULTRA Chemiluminescent Substrate method
(Pierce Chemical Co.). Immunoreactive actin protein
detected using a rabbit polyclonal antibody (Sigma; 1:1000
dilution in 3% milk) was used as an internal control.
Determination of cholesterol levels
Ovarian tissue (1070 mg) was homogenized in 500 µl
chloroform-methanol (2:1). After homogenization, 125 µl 0.15
M NaCl were added, and samples were centrifuged at
2000 x g for 15 min. The lower phase was used in
cholesterol determination. Total cholesterol levels were determined
using the Cholesterol 20 Kit (Sigma) according to the
manufacturers instructions. Lipid Lin-Trol (Sigma) was
used as the assay standard.
Oil Red O lipid staining
Oil Red O lipid staining of ovarian cryosections was carried out
as previously described (45). Briefly, unfixed sections were placed in
Oil Red O staining solution for 5 min. Sections were then washed five
times in distilled water and counterstained in hematoxylin for 1 min.
Cryosections were washed twice with acid water (2 ml concentrated HCl
in 250 ml water), twice with saturated aqueous sodium bicarbonate
solution, and eight times with distilled water. Oil Red O lipid
staining was determined using an Olympus Corp. BX60
microscope (Melville, NY).
Cloning of the HDL receptor SR-BI promoter
Cloning of the HDL receptor SR-BI promoter was performed using
the Advantage Tth Polymerase Mix and the PromoterFinder DNA
Walking Kit (CLONTECH Laboratories, Inc., Palo Alto, CA).
For this, two nested primers, 1GSP1
(135CTTGATGAGCGAGGGCACCATGAG159) and 1GSP2
(105GATAACGCCGAGTGCAGCACACAG129), were designed
to the rat HDL receptor SR-BI cDNA sequence (44, 46). These primers
were then used with adaptor-specific primers in screening five separate
adaptor-ligated rat genomic libraries by PCR. The conditions for PCR
were 7 cycles of denaturation at 94 C for 2 sec and elongation at 72 C
for 3 min, followed by 40 cycles of denaturation at 94 C for 2 sec and
elongation at 67 C for 3 min. Nested PCR products were analyzed by
1.2% agarose/ethidium bromide gel electrophoresis. A second round of
nested PCR reactions was carried out using primers 2GSP1
(5'-CCTTGATGCACTGTCCCCTCGGAAT-3') and 2GSP2 (5'-
CTCCCAGGACCTTCGCACACC-CTT-3'), designed to one of the PCR products
obtained from the first nested PCR reaction. All DNA fragments were
cloned into the pCR 2.1 TA cloning vector and sequenced in both
directions using the T7 Sequenase DNA sequencing kit (Amersham Pharmacia Biotech, Arlington Heights, IL) and
[35S]deoxy-ATP (10001500 Ci/mmol; DuPont/New England
Nuclear). HDL receptor SR-BI promoter fragments obtained from both sets
of PCR reactions (designated clones I and II, respectively) were
ligated together using a shared XhoI site.
5'-Rapid amplification of cDNA ends
The transcription start site of the rat HDL receptor SR-BI gene
was mapped using the 5'-Rapid Amplification of cDNA End Kit from
Life Technologies, Inc./BRL. For this, 1 µg rat ovarian
total RNA was reverse transcribed using the primer 3GSP
(5'-GACCAGGATGTTAGGCAGTA-3'), designed to the HDL receptor SR-BI cDNA,
and reverse transcriptase. After degrading the RNA with ribonuclease H,
the single stranded cDNA was tailed with terminal deoxynucleotide
transferase and dCTP. The tailed cDNA was then used as a template for
PCR using 1GSP1 primer (see above) and the abridged anchor primer
(5'-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3'). The parameters for PCR
were denaturation at 95 C for 5 min, followed by 35 cycles of
denaturation at 95 C for 1 min, annealing at 55 C for 2 min, and
extension at 72 C for 3 min. The PCR product was then cloned into the
pCR 2.1 TA cloning vector and sequenced to determine the transcription
start site.
Plasmids for luciferase assays
All HDL receptor SR-BI promoter-luciferase gene constructs were
derivatives of the pGL3-basic luciferase vector. Standard molecular
biology techniques were used in all cloning procedures (47). To make
the p-2267 plasmid, the entire HDL receptor SR-BI promoter obtained
from the PromoterFinder DNA walking PCR reactions was used. This
promoter fragment was subcloned into pGL3-basic luciferase vector using
MluI and HindIII sites. Nested deletions of the
HDL receptor promoter were carried out using restriction enzymes. The
restriction enzymes used were BglII and HindIII
for the p-1421 fragment, XhoI and HindIII for the
p-719 fragment, and SmaI and HindIII for the
p-170 fragment. All promoter fragments were then subcloned into the
pGL3-Basic luciferase vector using those restriction enzyme sites.
Cell transfections
Cells were transfected with the specified HDL receptor SR-BI
promoter-luciferase reporter gene construct in either the presence or
absence of SREBP-1a-pCMV5 using the calcium phosphate method (48).
SF-1-pCMV was used in some experiments. Cells were first plated out in
six-well tissue culture plates at a density of 1.53.3 x
106 cells/well (depending on the cell type) and incubated
for 24 h at 37 C (5% CO2). Fresh DMEM/F12 medium and
10% FBS were added 2 h before transfections. The DNA to be
transfected was purified by ethanol precipitation, resuspended in 0.25
M calcium chloride (CaCl2), and reprecipitated
in an equal volume of 2 x HEPES buffer for 20 min at room
temperature. Precipitated DNA was then added to the culture plates.
After incubating for 4 h, the medium was replaced, and the cells
were allowed to incubate for 48 h at 37 C (5% CO2).
Either 50 µM rivastatin, 50 µg/ml ALLN, or 1
mM 8-bromo-cyclic 3',5'-AMP (8-Br-cAMP) was added to some
plates 24 h before the end of the incubation time. Cells were
washed twice with PBS, treated with a passive lysis buffer for 20 min,
and then scraped with a rubber policeman. Lysates were transferred to a
microcentrifuge tube and stored at -80 C until determination of
luciferase activity. Cotransfection of a plasmid containing the
Renilla luciferase gene under control of the simian virus 40
early enhancer/promoter region was used as a control to correct for
differences in transfection efficiencies.
Luciferase assays
Luciferase assays were performed using the Dual Luciferase
Reporter Assay System according to the manufacturers instructions
(Promega Corp., Madison, WI). Briefly, 100 µl luciferase
substrate were added to 20 µl lysate, and luciferase activity was
measured using a Turner Designs-20/20 luminometer (Sunnyvale, CA).
Site-directed mutagenesis
Site-directed mutants were obtained using the QuickChange
Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA)
according to the manufacturers protocol. Briefly, 10 ng plasmid were
incubated with 125 ng of the appropriate complementary oligonucleotides
(see below) and 1 µl dNTPs in 50 µl reaction buffer [100
mM KCl, 100 mM
(NH4)2SO4, 200 mM
Tris-HCl (pH 8.8), 20 mM MgSO4, 1% Triton
X-100, and 1 mg/ml nuclease-free BSA]. One microliter of
Pfu DNA polymerase (2.5 U/µl) was added to the
reaction, and each reaction was heated to 95 C for 30 sec followed by
35 cycles of denaturation at 95 C for 30 sec, annealing at 55 C for 1
min, and extension at 68 C for 12 min. After the cycling reaction,
samples were subjected to digestion with DpnI for 1 h
at 37 C to remove the parental DNA template. One microliter of the
mutant samples was used to transform XL-1 Blue bacterial cells. The
mutations were confirmed by sequencing using the T7 Sequenase DNA
sequencing kit and [35S]dATP.
Complementary oligonucleotides used for site-directed mutagenesis to
mutate E box-1 were M1
(5'-GGCGCATAAAACCTCTGGCTTTTTTCAGGGCTACTGCTGC-3')
and M2 (5'-CATAAAACCTCTGGCTCCCAACAGGGCTAC-3').
M1 was prepared in both the p-719 and the p-170 constructs, whereas M2
was only prepared in the p-170 construct. The oligonucleotide E2-M
(5'-CTGGCGACTGTAATTTATGCAGGGG-3') and its
complement were used to mutate the second E box found in the p-719
construct. Complementary oligonucleotides used to mutate dSRE and pSRE
were MD
(5'-CTGCCCCCCTCCCCCCCCCCTCTG-3')
and MP (5'-CCATCAGAGCCCCGCCCCCTCCCC-3'),
respectively. MD was prepared in the p-2267 construct, whereas MP was
prepared in the constructs p-2267, p-719, and p-719 with E boxes
mutated. The nucleotides that are underlined correspond to
the mutated bases.
Nuclear extracts
Nuclear proteins were prepared either from COS-7 cells
overexpressing the NH2-terminal segment (mature form) of
SREBP-1a or from ovaries isolated from rats treated with hCG for 6
h. COS 7 cells at a density of 108 cells/flask were
transiently transfected with SREBP-1a-pCMV5 plasmid (50 µg/flask)
using the calcium phosphate method (48) as described above. After
transfections, fresh DMEM/F12 medium and 10% FBS were added, and cells
were incubated for 48 h at 37 C (5% CO2). Cells were
then washed twice with PBS and treated with 10 ml 0.25% trypsin and 1
mM EDTA for 10 min. The cell pellet was recovered by
centrifugation at 500 x g for 5 min. Nuclei were
prepared as previously described (49). The nuclear pellet was
resuspended in 2.5 vol extract buffer [15 mM Tris-HCl (pH
7.5), 15 mM NaCl, 60 mM KCl, 0.34 M
sucrose, 15 mM ß-mercaptoethanol, 0.15 mM
spermine, 0.5 mM spermidine, 5% glycerol, and 0.2
mM phenylmethylsulfonylfluoride]. The suspension was
gently agitated for 30 min at 4 C. KCl was then added to a final
concentration of 300 mM. After incubation for another 30
min at 4 C, the samples were centrifuged in a microcentrifuge at top
speed for 30 min. Nuclear extracts were stored at -80 C until used.
Protein concentrations were determined using the Bio-Rad Laboratories, Inc., protein assay.
Gel mobility shift assay
Complementary oligonucleotides corresponding to the HDL receptor
SR-BI promoter regions from -1966 to -1940 (dSRE,
5'-CTGCCCCCCTCACACCCTCCTCTGTAG-3') and from -246 to -220 (pSRE,
5'-CCATCAGAGCACCGCCCACTCCCCGCC-3'), with GGG overhangs at the 5'-ends,
were synthesized and annealed in 10 mM Tris-HCl (pH 7.5), 1
mM EDTA, 25 mM NaCl, 10 mM
MgCl2, and 1 mM dithiothreitol. The
oligonucleotide probe was then labeled using the Klenow fragment of DNA
polymerase and [
-32P]dCTP (3000 Ci/mmol). In some
experiments, an oligonucleotide containing the human LDL receptor SRE-1
(5'-ATCACCCCACTGCAAACTCCTCCCCCTGC-3') (21) was also used either
32P-labeled as a positive control or unlabeled as a
competitor. Mutated-dSRE
(5'-CTGCCCCCCTCCCCCCCCC-CTCTGTAG-3')
and mutated-pSRE
(5'-CCATCAGAGCCCCGCCCCCTCCCCGCC-3')
oligonucleotides were also used in some experiments. The
underlined letters correspond to the mutated bases. In other
experiments, unlabeled distal or proximal SRE were also used as
competitors. Twenty micrograms of nuclear proteins were incubated in
either the presence or absence of competitor for 30 min at room
temperature in binding buffer [12 mM HEPES (pH 7.9), 12%
glycerol, 60 mM KCl, 1 mM EDTA, 1
mM dithiothreitol, and 4 mM Tris-HCl (pH
8.0)], 2 µg poly(dI-dC), and 0.4 µg BSA. After incubation, 100,000
cpm of the radiolabeled probe were added, and the mixture was incubated
for 15 min at 30 C. The DNA-protein complexes were resolved on a 4%
nondenaturing acrylamide gel at 4 C in 1 x Tris-borate buffer
(0.05 M Tris, 0.05 M boric acid, and 0.001
M EDTA). Gels were then vacuum-dried and exposed to
BioMax-MR films at -80 C for 1224 h.
Data analysis
Luciferase, cholesterol, and Western blot data were expressed as
the mean ± SEM. Each luciferase assay experiment was
performed in triplicate and repeated for the indicated number of times
as listed in the figure legends. Quantitation of Western blot and
DNA-protein complex signals in the mobility shift assay autoradiographs
was performed using a Hoefer scanning densitometer (San
Francisco, CA). Data from the individual parameters were compared by
ANOVA, followed by Student-Newman-Keuls multiple comparison test when
applicable (50).
 |
Results
|
|---|
As hormonal stimulation has been shown to be associated with
depletion of ovarian cholesteryl ester content (17, 18, 19), we examined
whether these conditions affect mature SREBP-1a protein levels. To
accomplish this, Western blot analysis was performed. As shown in Fig. 1
, the 65-kDa mature SREBP-1a protein was
increased 3-fold at 3 h (P < 0.002) and 11-fold
(P < 0.001) at 6 h after hCG injection. These
results correlate with our previous report showing that HDL receptor
SR-BI mRNA levels increased 2-fold at 3 h and 4-fold at 6 h
post-hCG treatment (44). However, significant increases in HDL receptor
SR-BI protein levels (2-fold; P < 0.05) were not
observed until 24 h after hCG injection (Fig. 2
).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1. Regulation of SREBP-1 protein levels in rat
ovaries by hCG. Twenty-eight-day-old-Sprague Dawley rats were treated
as described in Materials and Methods. Ovaries were
obtained before hCG (50 U) and 3 and 6 h post-hCG injection. A, A
representative Western blot is presented. B, Western blot results were
analyzed using a Hoefer scanning densitometer. The data
are presented as the mean ± SEM from two experiments
(n = 5/treatment).
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Figure 2. Regulation of HDL receptor protein levels in rat
ovaries by hCG. Twenty-eight-day-old Sprague Dawley rats were treated
as described in Materials and Methods. Ovaries were
obtained before hCG (50 U) and 6, 12, and 24 h post-hCG injection.
A, A representative Western blot for controls and 24 h post-hCG
injection is presented. B, Western blot results were analyzed using a
Hoefer scanning densitometer. The data are presented as
the mean ± SEM (n = 6/treatment).
|
|
To determine whether ovarian cholesterol levels are actually influenced
by these conditions, tissue samples were either cryosectioned and
stained with Oil Red O or homogenized as described in Materials
and Methods for cholesterol level determination. Oil Red O lipid
staining of ovarian cryosections prepared from 6 h post-hCG
treated animals showed a 20% decrease (P < 0.001) in
lipid levels compared with the staining of ovarian cryosections
prepared from control animals (data not shown). Furthermore, as shown
in Fig. 3
, ovarian total cholesterol
levels were lowered by 30% (P < 0.05) within 12
h of hCG administration. These results correlate with previous reports
showing that hCG decreases ovarian cholesterol levels (18, 19). The
data suggest that transcription of the HDL receptor SR-BI gene may be
regulated by the cellular cholesterol status and that SREBP-1a may be
involved in this regulatory process. Interestingly, ovarian cholesterol
levels returned to control levels 24 h after hCG treatment (Fig. 3
).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 3. Effect of hCG treatment on ovarian cholesterol
levels. Total cholesterol levels were determined as described in
Materials and Methods. Cholesterol values were corrected
by sample weight, and the data are presented as the percentage of
ovarian cholesterol remaining where the value for controls was set at
100%. The SEMs for the different time points were 0.04 for
6 h, 0.05 for 12 h, and 0.08 for 24 h post-hCG
injection. *, P < 0.01; **, P
< 0.05 (n = 6/treatment).
|
|
To determine whether the rat HDL receptor SR-BI promoter has a motif
through which SREBP-1a might regulate this gene, cloning of the
promoter was performed as described in Materials and
Methods. Using two primers designed to the 5'-flanking region of
the rat HDL receptor SR-BI cDNA (44, 46), a single PCR product was
obtained in four of five genomic libraries. After sequencing each
fragment, we found that the PCR product obtained in the
PvuII library (designated clone I) contained DNA sequences
overlapping with the rat HDL receptor SR-BI cDNA. The sequence of clone
I was then used to design two new gene-specific primers that would
yield genomic DNA clones with sequences further upstream. Using these
new primers, two PCR products were obtained in the EcoR V
library, the smaller of which (designated clone II) was found to
contain sequences overlapping with clone I. Clones I and II were then
ligated together using a shared XhoI site, which resulted in
a 2.2-kb DNA fragment.
The nucleotide sequence of the rat HDL receptor SR-BI promoter is shown
in Fig. 4
. This DNA segment contained a
TATA box (CATAAAA), which is 40 bp upstream of the transcription start
site mapped by 5'-rapid amplification of cDNA ends as described in
Materials and Methods (Fig. 4
). The sequence of this TATA
box is identical to that reported for the human HDL receptor SR-BI
promoter (38). The transcription start site identified in the rat
promoter is about 10 bp closer to the ATG initiation site than that
identified for the human gene (38) (Fig. 4
). Similar to the human gene,
no CAT box motif was identified in the rat promoter (38) (Fig. 4
).
After searching the entire sequence for other putative consensus sites,
we found that this DNA fragment also contains 11 E boxes (CANNTG) (39),
7 Sp1 sites, 4 estrogen receptor half-sites, 2 activator protein-1
(AP-1) sites, and 1 SF-1 site (Fig. 4
). Many of these motifs are also
found in the human HDL receptor SR-BI gene at similar positions
relative to the translation start site (38) (Fig. 4
). These include 2 E
boxes (at -1140 and -142) and 2 Sp1 sites (at -282 and -260). The
SF-1 site (5'-TCAAGGCC-3') identified in the rat HDL receptor SR-BI
promoter is 78% identical to the site found in the human gene (38)
(Fig. 4
). However, their positions within the promoter are different
(38) (Fig. 4
). The SF-1 site in the rat gene is located further
upstream (at -480) (38) (Fig. 4
).

View larger version (53K):
[in this window]
[in a new window]
|
Figure 4. Nucleotide sequence of the rat HDL receptor SR-BI
promoter. Nucleotide position +1 is assigned to the A of the ATG start
codon (boldface), and negative numbers refer to promoter
sequences. Putative SRE, AP-1, SF-1, Sp1, estrogen receptor half-site
(E1/2), E box, and TATA box motifs are underlined. The
transcription start site mapped by 5'-rapid amplification of cDNA ends
is indicated by an arrow.
|
|
In addition to these sites, two putative SREs at positions -1958
(distal SRE) and -238 (proximal SRE) relative to the translation start
site were identified in the rat HDL receptor SR-BI promoter. A
comparison between the rat HDL receptor SR-BI SREs and SRE sites
identified for other genes is shown in Table 1
. The distal SRE (dSRE) had 73%
identity to the SRE motifs identified for the rat (22) and hamster (23)
LDL receptor genes and to one of the sites identified for the human
3-hydroxy-3-methyl-glutaryl-coenzyme A synthase (HMGCoA Syn) gene (28).
The proximal SRE (pSRE) had 75% identity to the SRE motifs identified
for the human LDL receptor (21) and SREBP-2 (27) genes and to one of
the sites identified for the rat fatty acid synthase gene (25). The
pSRE is also located between two Sp1 sites (Fig. 4
), similar to the SRE
motif in the human LDL receptor promoter (21).
To examine whether SREBP-1a might regulate HDL receptor SR-BI gene
transcription, cotransfection studies were performed. For this, the
entire HDL receptor SR-BI promoter was cloned in front of the
luciferase gene as described in Materials and Methods. Then
different cell types were transfected with the HDL receptor SR-BI
promoter construct in either the presence or absence of SREBP-1a-pCMV5
plasmid. As shown in Table 2
, in all five
cell types examined, SREBP-1a significantly induced the expression of
the luciferase gene under control of the HDL receptor promoter. HTB9
cells showed the highest levels of induction by SREBP-1a (30-fold;
P < 0.001; Table 2
).
View this table:
[in this window]
[in a new window]
|
Table 2. Effects of SREBP-1a on the expression of the
luciferase gene under control of the HDL receptor promoter in different
cell types
|
|
To determine the effect of endogenously expressed SREBP on the
expression of the HDL receptor SR-BI gene, cotransfection studies were
carried out in human liver HepG2 cells. As shown in Fig. 5
, the luciferase activity of the HDL
receptor SR-BI containing construct was increased 46-fold
(P < 0.01) over that of the empty luciferase vector.
Removing cholesterol from the culture medium did not significantly
increase luciferase activity (Fig. 5
). However, when the cells were
treated with 50 µM rivastatin, a known cholesterol
biosynthesis inhibitor (51), the luciferase activity of the HDL
receptor SR-BI promoter construct was significantly induced 2-fold
(P < 0.02) over the construct cultured in the absence
of rivastatin (Fig. 5
). When the HDL receptor SR-BI promoter construct
was cotransfected in the presence of SREBP-1a, luciferase activity was
increased even more (2.4-fold; P < 0.001). These
results demonstrate that SREBP-1a regulates the expression of the HDL
receptor SR-BI gene.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 5. Effect of SREBPs on the expression of luciferase
activity under the control of the HDL receptor SR-BI promoter in HepG2
cells. The p-2267 construct was prepared by cloning the entire HDL
receptor SR-BI promoter obtained as described in Materials and
Methods in front of the luciferase gene. Cells (1.5 x
106/well) were transfected with this construct in either
the presence or absence of SREBP-1a-pCMV5 plasmid. Rivastatin (50
µM) was added to some of the plates 24 h before
lysing the cells. Luciferase activity was measured in cell lysates
48 h after transfections. The data are presented as relative
luciferase units ± SEM. The data are from a typical
experiment, performed in triplicate. This experiment was repeated
twice.
|
|
To determine which regions of the HDL receptor SR-BI promoter were
involved in this regulatory process, deletion analysis was performed.
For this, nested deletions of the HDL receptor SR-BI promoter were
prepared and cloned into the pGL3-Basic luciferase vector as described
in Materials and Methods. These constructs were then
transfected into HTB9 cells in the presence or absence of
SREBP-1a-pCMV5 plasmid. As shown in Fig. 6
, all constructs having at least one of
the SREs (p-2267, p-1421, and p-719) produced higher luciferase
activity when cotransfected in the presence of SREBP-1a (10- to
22-fold; P < 0.05) than the construct lacking both
SREs (p-170). Representing the data as fold induction, where the value
of luciferase activity for the construct transfected in the absence of
SREBP-1a was set at 1.0, demonstrated that the p-2267 construct
produced the highest fold induction by SREBP-1a (19-fold;
P < 0.01; Fig. 6
). The luciferase activities of p-1421
and p-719 were only induced 12- and 11-fold, respectively
(P < 0.05), by SREBP-1a (Fig. 6
). These results
correlate with the fact that the p-2267 construct contains both SREs,
whereas the p-1421 and p-719 constructs contain only one (Fig. 6
).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6. SREBP-1a induces the expression of the luciferase
gene through two SREs found in the HDL receptor SR-BI gene. Constructs
used in these experiments were prepared as described in
Materials and Methods. HTB9 cells (3.3 x
106/well) were transfected with the indicated construct in
either the presence or absence of SREBP-1a-pCMV5 plasmid. Luciferase
activity was measured in cell lysates 48 h after transfections.
The data are presented as relative luciferase units ±
SEM and are from two experiments, each performed in
triplicate. Numbers next to the bars indicate fold
induction by SREBP-1a.
|
|
Even though the induction of the p-170 construct luciferase activity by
SREBP-1a was never significantly higher than the basal activity of the
other deletion constructs, this construct showed induction compared
with its own basal activity (10-fold; P < 0.05; Fig. 6
). It has been shown that SREBP-1, which is identical to the adipocyte
determination- and differentiation-dependent factor 1, also binds E box
motifs and activates the transcription of genes containing these
regulatory elements in their promoters (26, 39). The p-170 construct
contains an E box motif (Figs. 4
and 6
). Interestingly, this E box is
identical to the E box found in the human HDL receptor SR-BI promoter
and is located the same distance from the TATA box as the E box motif
in the human gene (38) (Fig. 4
). Figure 7A
shows a schematic representation of
the positions of that E box in both the p-170 and p-719 constructs. The
sequences of wild-type and mutated E box motif are also shown (Fig. 7
).
When all of the E box bases in the p-170 construct were mutated to
thymidine residues (M1), the transcriptional induction of the
luciferase gene by SREBP-1a was abolished (Fig. 7
). In contrast, when
the E box was mutated such that the context of this motif appeared more
like that of the human LDL receptor SRE (Table 1
and Fig. 7
),
transcriptional activation of the luciferase gene by SREBP-1a was
increased 18-fold (Fig. 7
). In the case of the p-719 construct, which
contains one of the putative SREs (Fig. 7
), changing all of the E box
bases to thymidine residues while leaving the SRE intact did not
significantly affect (P > 0.05) transcriptional
activation of the luciferase gene by SREBP-1a. Similar results were
obtained by mutating the second E box found in the p-719 construct as
described in Materials and Methods (data not shown). These
data indicate that the SREBP-1a induction of luciferase activity in the
p-719 construct was completely due to activation through the SRE. These
results correlate with a previous study showing that even though
SREBP-1a can bind and activate both E box and SRE motifs, sterol
regulation is only mediated through a SRE motif (52).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7. SREBP-1a activates an E box found in the HDL
receptor SR-BI promoter. A, Schematic representation of the wild-type
(WT) and mutated (M1 and M2) HDL receptor SR-BI promoter-reporter
constructs. The sequences of the wild-type and mutated E box motifs are
shown. Mutations were prepared by site-directed mutagenesis as
described in Materials and Methods. M1 was prepared in
both p-170 (B) and p-719 (C) constructs, whereas M2 was only prepared
in the p-170 construct (B). HTB9 cells (3.3 x
106/well) were then transfected with the indicated
construct in either the presence or absence of SREBP-1a-pCMV5 plasmid.
Luciferase activity was measured in cell lysates 48 h after
transfection. The data are presented as the fold induction (mean
± SEM), where the value of luciferase activity for the
construct transfected in the absence of SREBP-1a was set at 1.0. The
data are from three experiments, each performed in triplicate.
|
|
It has been previously shown that the calpain inhibitor I, ALLN, which
inhibits neutral cysteine protease, prevents mature SREBP-1a
degradation (34). Thus, we examined the effect of ALLN on the
expression of the luciferase gene under control of the HDL receptor
SR-BI promoter. As shown in Fig. 8
, the
addition of 50 µg/ml ALLN to the medium of the cells enhanced
(3.4-fold; P < 0.05) the effects of SREBP-1a on the
HDL receptor SR-BI promoter activity. These results further confirm the
involvement of SREBP-1a in the regulation of the HDL receptor SR-BI
gene.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 8. Effect of calpain inhibitor I (ALLN) on the
expression of the luciferase gene under the expression of the p-719 HDL
receptor SR-BI promoter. HTB9 cells (3.3 x 106/well)
were transfected with the p-719 construct in either the presence or
absence of SREBP-1a-pCMV5 plasmid as described in Materials and
Methods. ALLN (50 µg/ml) was added to some of the plates
24 h before lysing the cells. The data are presented as relative
luciferase units ± SEM and are from a typical
experiment, performed in triplicate. This experiment was repeated
twice.
|
|
To determine whether SREBP-1a actually binds to the putative SREs found
in the HDL receptor promoter, gel mobility shift assays were performed.
Incubation of either radiolabeled dSRE or pSRE with nuclear extracts
prepared from COS-7 cells overexpressing SREBP-1a resulted in the
production of two DNA-protein complexes (designated X and Y; Fig. 9
, A and B). In both cases, the complexes
appear to be specific, because the addition of a 250-fold molar excess
of unlabeled SRE completely eliminated them (data not shown). No
DNA-protein complex was produced when either probe was incubated with
nuclear extracts from COS-7 cells not expressing SREBP-1a (data not
shown). These complexes were also observed when an oligonucleotide
containing the human LDL receptor SRE (21) motif was used as the probe
(Fig. 9A
). The formation of two complexes between SREBP-1a and an SRE
motif has been previously reported (39, 53). It has been proposed that
the top (slower migrating) complex (X) corresponds to multimeric
SREBP-1a bound to the DNA (39, 53). The slower migrating complex (X)
was more visible for the dSRE than for the pSRE when compared on the
same gel (data not shown). As shown in Fig. 9
, A and B, the addition of
a 250-fold molar excess of the human LDL receptor SRE motif to the
binding reactions of either SRE motif also reduced the formation of the
two complexes. Competition studies performed for dSRE and pSRE showed
that the two DNA-protein complexes formed for each probe were gradually
diminished as increasing levels of unlabeled human LDL receptor SRE
oligonucleotide were added (data not shown). In both cases, the amount
of competitor required to reduce complex formation was lower for
complex X than for complex Y (data not shown), suggesting that
multimeric SREBP-1a binds to the DNA with higher affinity than
monomeric SREBP-1a. The data clearly demonstrate that SREBP-1a can bind
and activate the SREs found in the HDL receptor SR-BI promoter.

View larger version (55K):
[in this window]
[in a new window]
|
Figure 9. Binding of SREBP-1a to the distal and proximal SRE
sites in the HDL receptor SR-BI promoter. 32P-Labeled,
double stranded, oligonucleotide probes (100,000 cpm/lane) containing
either dSRE (A) or pSRE (B) SREBP-binding sites were incubated with
nuclear extracts (20 µg) prepared from COS-7 cells overexpressing
SREBP-1a in the presence or absence of a 250-fold molar excess of
competitor as described in Materials and Methods.
Representative gel mobility shift assay autoradiographs are presented.
LDL receptor SRE-1, which refers to the SRE motif found in the promoter
of the human LDL receptor gene, was used as both positive control (A)
and competitor. X and Y refer to the two complexes formed by SREBP-1a
and probe. This experiment was repeated four times.
|
|
To determine whether these motifs bind ovarian SREBP-1a, binding
reactions were carried out with nuclear extracts prepared from animals
treated with hCG for 6 h. As shown, both SRE probes formed
DNA-protein complexes (Fig. 10
). These
complexes appear to be specific because the addition of 250-fold molar
excess of unlabeled SRE completely eliminated them (Fig. 10
). To
further confirm SREBP specificity to bind the HDL receptor SR-BI SREs,
mutated SRE probes were prepared and used in binding reactions. As
shown in Fig. 10
, both mutated probes failed to form a DNA-protein
complex when incubated with ovarian nuclear extracts prepared from
animals treated with hCG for 6 h. Identical results were obtained
when nuclear extracts prepared from COS-7 cells overexpressing SREBP-1a
were used in binding reactions (data not shown).

View larger version (52K):
[in this window]
[in a new window]
|
Figure 10. Binding of ovarian SREBP-1a to wild-type and
mutated SRE motifs. 32P-Labeled, double-stranded,
oligonucleotide probes (100,000 cpm/lane) containing either the
wild-type or mutated dSRE (A) or the wild-type or mutated pSRE (B)
SREBP-binding sites were incubated with ovarian nuclear extracts (20
µg) prepared from animals treated with hCG for 6 h.
Representative gel mobility shift assay autoradiographs are presented.
This experiment was repeated twice.
|
|
To examine whether these mutations have any effect on transcriptional
activation of the HDL receptor SR-BI gene by SREBP, cotransfection
studies were carried out. As shown in Fig. 11A
, in HepG2 cells, mutations in
either the distal or proximal SRE motif caused a partial reduction in
rivastatin-induced luciferase activity from the p-2267 HDL receptor
SR-BI promoter construct. However, complete loss of rivastatin-induced
luciferase activity was only observed when both SREs were mutated
(P < 0.01; Fig. 11A
). These results suggest that both
SREs are required for full SREBP-1a activation of the HDL receptor
SR-BI gene and further confirm that this regulatory process is mediated
exclusively through the SRE motifs. These mutations in the SRE motifs
did not appear to have a significant effect on SREBP-1a-induced
luciferase activity from the p-2267 construct in HTB9 cells, most
likely due to the 11 E boxes present in this gene (data not shown). As
shown in Fig. 7
, when the two E boxes present in the p-719 construct
were mutated leaving the pSRE intact, no significant change occurred in
SREBP-1a-induced luciferase activity. However, when the pSRE was
mutated and the E boxes left intact, the SREBP-1a-induced activity from
this construct was reduced by 50% (P < 0.05) but was
not completely eliminated (Fig. 11B
). These data correlate with a
previous report showing that in the absence of an intact SRE,
overexpressed SREBPs can activate gene expression through E box sites
(52). To determine whether this would be the case here, a construct
containing mutations in all three motifs (the two E boxes and the pSRE)
was analyzed. As shown in Fig. 11B
, by mutating the E boxes and the
pSRE motif simultaneously, SREBP-1a-induced activity was completely
eliminated (P < 0.001).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 11. Mutational analysis of the distal and proximal
SRE sites found in the HDL receptor SR-BI promoter. Mutations were
prepared by site-directed mutagenesis as described in Materials
and Methods. The mutations analyzed were MD (mutated dSRE), MP
(mutated pSRE), and MB (both SRE motifs mutated) in the p-2267
construct (A) and MP in constructs p-719 and p-719 with both E boxes
mutated (M-E-boxes; B). The cell type used is indicated. Transfections
were carried out as described in Materials and Methods.
Rivastatin (50 µM) was added to some of the plates
24 h before lysing the cells. Luciferase activity was measured in
cell lysates 48 h after transfection. A, The data are presented as
the fold induction (mean ± SEM), where the value of
luciferase activity for the construct not incubated with rivastatin was
set at 1.0. B, The data are presented as relative luciferase units
± SEM. In both cases, the data are from two experiments,
each performed in triplicate.
|
|
It has been previously shown that in steroidogenic tissues, hormones
such as hCG can also influence gene expression by increasing cAMP
levels (54, 55). We have recently shown that SF-1 protein mediates cAMP
induction of the rat HDL receptor SR-BI gene (56). Thus, we decided to
investigate whether SREBP-1a and SF-1 may cooperate to mediate HDL
receptor SR-BI induction in response to hCG. Thus, cotransfection
studies were carried out in both HepG2 and Y1 cells as described in
Table 3
. In HepG2 cells, which contain
endogenous SREBPs, the addition of rivastatin increased the luciferase
activity produced from the p-2267 construct by 1.8-fold (Table 3
).
However, when both rivastatin and SF-1 plus 8-Br-cAMP were present,
luciferase activity was increased dramatically (38-fold;
P < 0.001; Table 3
). A similar effect was seen in Y1
cells, which contain endogenous SF-1. In these cells, luciferase
activity from the p-2267 construct was increased by 1.5-fold in
response to 8-Br-cAMP. However, when both 8-Br-cAMP and SREBP-1a were
present, luciferase activity was significantly increased (12.6-fold;
P < 0.001; Table 3
). These results suggest that
SREBP-1a and SF-1 act synergistically to induce HDL receptor SR-BI gene
expression.
 |
Discussion
|
|---|
These experiments demonstrated that the promoter of the gene
encoding the rat HDL receptor SR-BI contains two SREs through which
SREBP-1a can bind and activate transcription of this gene. Previous
reports have shown that increases in the HDL receptor SR-BI gene
expression have been associated with depleted cholesterol stores in the
adrenal (15, 16) and ovary (17). In addition, even before the HDL
receptor SR-BI was identified, several studies showed a correlation
between the depletion in ovarian cholesteryl ester content and an
increase in cell surface HDL binding in response to hormonal
stimulation (18, 19) in agreement with the current data.
In the present report, we have shown that the increase in mature
SREBP-1a protein levels correlates with a 30% decrease in ovarian
cholesterol levels. These changes in both SREBP-1a protein and
cholesterol levels correlated with an increase in HDL receptor SR-BI
mRNA levels (44) and preceded an increase in HDL receptor SR-BI protein
levels. Ovarian cholesterol levels returned to control levels by
24 h post-hCG treatment, when HDL receptor protein levels were
maximal. These results suggest that the increase in HDL receptor SR-BI
protein assisted in replenishing ovarian cholesterol levels. Most
importantly, these results suggested that the HDL receptor SR-BI gene
may be regulated by the cellular cholesterol status and that SREBPs may
mediate this regulation. Interestingly, the increased expression of the
HDL receptor SR-BI gene in response to depleted cholesterol stores in
the LH-induced desensitized ovary paralleled increases in both HMGCoA
reductase and LDL receptor mRNA levels (17), two genes known to be
regulated by the cellular cholesterol status. The finding that SREBPs
are expressed in the adrenal gland (35, 36) suggests that SREBPs may
also regulate the HDL receptor SR-BI gene in that tissue.
In the case of the liver, inconsistent results have been obtained (20).
Feeding rats a high cholesterol diet for 2 weeks decreased HDL receptor
SR-BI expression in parenchymal cells in agreement with the findings
reported here (20). However, in Kupffer cells, the same treatment
caused an increase in receptor SR-BI expression (20). It has been shown
that in rats, parenchymal cells are the main cells responsible for both
HDL receptor SR-BI expression and selective uptake of HDL cholesteryl
esters within the liver (57, 58). Thus, it appears that in cell types
responsible for selective lipid uptake from an HDL particle, HDL
receptor SR-BI expression is up-regulated in response to depleted
cellular cholesterol levels. In the case of the liver Kupffer cells and
macrophages, where the HDL receptor SR-BI may be involved mainly in
cholesterol efflux (59, 60), receptor SR-BI expression would be
up-regulated as a result of increased cellular cholesterol levels. This
is critical considering the function of this receptor in reverse
cholesterol transport (2, 3). Whether sterol regulation of the HDL
receptor SR-BI in macrophages is mediated by SREBPs will require
further analysis.
Although SREBPs are the key regulatory factors involved in sterol
balance, it has been shown that other factors acting as coactivators
are also required. For example, in the human LDL receptor (21) and
fatty acid synthase (25) promoters, the coactivator is Sp1, whereas in
the HMGCoA synthase (28) and farnesyl diphosphate synthase (26)
promoters, the coactivator is nuclear factor-Y. To date, we have
identified seven putative binding sites for Sp1, but none for nuclear
factor-Y. The pSRE is located between two Sp1 sites, similar to the SRE
motif in the human LDL receptor promoter (21). In the case of the dSRE,
the closest putative Sp1 is 130 bp downstream. Whether any of the Sp1
sites found in the HDL receptor SR-BI promoter are important for sterol
regulation of this gene will require further analysis.
The finding that SREBP regulation of a gene in response to the cellular
cholesterol status is mediated exclusively through the SRE motifs is
common to most sterol-sensitive genes (52). However, the fact that the
HDL receptor SR-BI gene contains 11 E boxes and that some of these
elements are conserved in other species (38), one must consider the
possibility that the E box motifs may still play some role in the
regulation of this gene. As all basic helix-loop-helix proteins,
including SREBP-1a, have been shown to bind E boxes (61), further
analysis is necessary to determine whether the other helix-loop-helix
proteins might regulate HDL receptor SR-BI gene expression through the
these motifs. One candidate for this type of regulation is the upstream
stimulatory factor, which has been shown to bind and activate E boxes
found in the promoter of the SF-1 gene (62).
Another important consideration is whether SREBP regulation of the HDL
receptor SR-BI is critical in steroidogenic tissues. It has been
reported that both human (38) and rat (56) HDL receptor SR-BI promoters
contain an SF-1-binding site through which SF-1 protein binds and
activates their transcription. The gonadotropic hormone hCG is known to
induce cAMP levels (54, 55) in the ovary. In contrast to the human
gene, no cAMP response element was identified in the rat HDL receptor
SR-BI promoter (56). In the rat gene, SF-1 appears to be the major
mediator of cAMP regulation of the HDL receptor SR-BI gene (56).
However, as has been shown for a number of genes (63, 64), the simple
binding and activation of transcription by SF-1 are insufficient. For
example, the regulation of the fish gonadotropin II ß-subunit gene
requires SF-1 and estrogen receptor (63), whereas the regulation of the
bovine cholesterol side-chain cleavage cytochrome P450 gene (CYP11A)
requires SF-1 and Sp1 (64). Thus, in the present study, we decided to
investigate whether SREBP-1a may cooperate with SF-1 to mediate HDL
receptor SR-BI induction in response to tropic hormones. In the present
study we demonstrated that SREBP-1a and SF-1 act synergistically to
activate HDL receptor SR-BI gene transcription. By combining these two
mechanisms, steroidogenic tissues may ensure that cholesterol is
available when required.
In summary, the rat HDL receptor SR-BI promoter contains two SRE motifs
through which SREBP-1a binds and activates transcription of the
luciferase reporter gene. These motifs have significant identity to
SREs found in the promoters of several other sterol-regulated genes
(21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33). This investigation indicates that intracellular cholesterol
levels may control HDL receptor SR-BI gene transcription, like other
sterol-sensitive genes. Furthermore, in steroidogenic tissues, SREBP-1a
may synergize with SF-1 to induce transcription of the HDL receptor
SR-BI gene in response to hormones such as hCG.
 |
Acknowledgments
|
|---|
We thank K. Warden, F. R. Rodriguez, and T. W.
Sandhoff for their technical assistance, and Drs. T. Osborne, K.
L. Parker, and G. C. Ness for gifts of materials.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grants R29-HD-31644 and R01-HD-35163
(to M.P.M.) and American Heart Association Florida Affiliate
Post-Doctoral Fellowship 9703004 (to D.L.). 
Received April 9, 1999.
 |
References
|
|---|
-
Goldon DJ, Rifkind BM 1989 High density
lipoprotein. The clinical implications of recent studies. N Engl
J Med 321:13111316[Medline]
-
Eisenberg S 1984 High density lipoprotein
metabolism. J Lipid Res 25:10171058[Medline]
-
Tall AR 1990 Plasma high-density lipoproteins:
metabolism and relationship to atherogenesis. J Clin Invest 86:379384
-
Andersen JM, Dietschy JM 1978 Relative importance
of high and low density lipoproteins in the regulation of cholesterol
synthesis in the adrenal gland, ovary and testes of the rat. J
Biol Chem 253:90249032[Free Full Text]
-
McNamara BC, Booth R, Stainsfield DA 1981 Evidence
for an essential role for high density lipoprotein in progesterone
synthesis by rat corpus luteum. FEBS Lett 134:7982[CrossRef][Medline]
-
Leitersdorf E, Stei O, Eisenberg S, Stein Y 1984 Uptake of rat plasma HDL subfractions labeled with [3H]
cholesteryl linoleyl ether or with 125I by cultured rat
hepatocytes and adrenal cells. Biochim Biophys Acta 796:7282[Medline]
-
Reaven E, Chen YD, Spicher M, Azhard S 1984 Morphological evidence that high density lipoproteins are not
internalized by steroid-producing cells during in situ organ
perfusion. J Clin Invest 74:13841397
-
Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH,
Krieger M 1996 Identification of scavenger receptor SR-BI as a
high-density lipoprotein receptor. Science 271:518520[Abstract]
-
Rigotti A, Trigatti BL, Penman M, Rayburn H, Herz J,
Krieger M 1997 A targeted mutation of the murine gene encoding the
high-density lipoprotein (HDL) receptor scavenger receptor class B type
I reveals its key role in HDL metabolism. Proc Natl Acad Sci USA 94:1261012615[Abstract/Free Full Text]
-
Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman
ER, Krieger M 1997 Overexpression of the HDL receptor SR-BI alters
plasma HDL and bile cholesterol levels. Nature 387:414417[CrossRef][Medline]
-
Varban ML, Rinninger F, Wang N, Fairchild-Huntress
V, Dunmore JH, Fang Q, Gosselin ML, Dixon KL, Deeds JD, Acton S, Tall
AR, Huszar D 1998 Targeted mutation reveals a central role for
SR-BI in hepatic selective uptake of high density lipoprotein
cholesterol. Proc Natl Acad Sci USA 95:46194624[Abstract/Free Full Text]
-
Temel RE, Trigatti B, DeMattos RB, Azhar S, Krieger M,
Williams DL 1997 Scavenger receptor (SR-BI) is the major route for
the delivery of HDL-cholesterol to the steroidogenic pathway in
cultured mouse adrenocortical cells. Proc Natl Acad Sci USA 94:1360013605[Abstract/Free Full Text]
-
Krieger M 1998 The "best" of cholesterols, the
"worst" of cholesterols: a tale of two receptors. Proc Natl Acad
Sci USA 95:40774080[Free Full Text]
-
Husten L 1997 Receptor offers clues to how
"good" cholesterol works. Science 278:1228[Free Full Text]
-
Wang N, Weng W, Breslow JL, Tall AR 1996 Scavenger
receptor BI (SR-BI) is upregulated in adrenal gland in apolipoprotein
A-1 and hepatic lipase knock-out mice as a response to depletion of
cholesterol stores: in vivo evidence that SR-BI is a
functional high density lipoprotein receptor under feedback control.
J Biol Chem 271:2100121004[Abstract/Free Full Text]
-
Ng DS, Francone OL, Forte TM, Zhang JL, Haghpassand M,
Rubin ER 1997 Disruption of the murine lecithin: cholesterol
acyltransferase gene causes impairment of adrenal lipid delivery and
up-regulation of scavenger receptor class B type I. J Biol Chem 272:1577715781[Abstract/Free Full Text]
-
Reaven E, Nomoto A, Leers-Sucheta S, Temel R, Williams
DL, Azhar S 1998 Expression and microvillar localization of
scavenger receptor, class B, type I (a high density lipoprotein
receptor) in luteinized and hormone-desensitized rat ovarian models.
Endocrinology 139:28472856[Abstract/Free Full Text]
-
Ghosh OK, Menon KMJ 1987 Induction of
high-density-lipoprotein receptors in rat corpus luteum by human
choriogonadotropin. Biochem J 244:471479[Medline]
-
Gibori G, Chen YD, Khan I, Azhar S, Reaven GM 1984 Regulation of luteal cell lipoprotein receptors, sterol contents, and
steroidogenesis by estradiol in the pregnant rat. Endocrinology 114:609617[Abstract/Free Full Text]
-
Fluiter K, van der Westhuijzen DR, van Berkel TJC 1998 In vivo regulation of scavenger receptor BI and the
selective uptake of high density lipoprotein cholesteryl esters in rat
liver parenchymal and Kupffer cells. J Biol Chem 273:84348438[Abstract/Free Full Text]
-
Sudhof TC, Russell DW, Brown MS, Goldstein JL 1987 42 bp element from LDL receptor gene confers end-product repression by
sterols when inserted into viral TK promoter. Cell 48:10611069[CrossRef][Medline]
-
Mehta KD, Brown MS, Bilheimer DW, Goldstein JL 1991 The low density lipoprotein receptor in Xenopus laevis. II.
Feedback repression mediated by conserved sterol regulatory element.
J Biol Chem 266:1041510419[Abstract/Free Full Text]
-
Bishop RW 1992 Structure of the hamster low density
lipoprotein receptor gene. J Lipid Res 33:549557[Abstract]
-
Osborne TF 1995 Transcriptional control mechanisms
in the regulation of cholesterol balance. Crit Rev Euk Gene Exp 5:317335[Medline]
-
Magana MM, Osborne TF 1996 Two tandem binding sites
for sterol regulatory element binding proteins are required for sterol
regulation of fatty-acid synthase promoter. J Biol Chem 271:3268932694[Abstract/Free Full Text]
-
Ericsson J, Jackson SM, Lee BC, Edwards PA 1996 Sterol regulatory element binding protein binds to a cis element in the
promoter of the farnesyl diphosphate synthase gene. Proc Natl Acad Sci
USA 93:945950[Abstract/Free Full Text]
-
Sato R, Inoue J, Kawabe Y, Kodama T, Takano T, Maeda
M 1996 Sterol-dependent transcriptional regulation of sterol
regulatory element-binding protein-2. J Biol Chem 271:2646126464[Abstract/Free Full Text]
-
Smith JR, Osborne TF, Brown MS, Goldstein JL, Gil G 1988 Multiple sterol regulatory elements in promoter for hamster
3-hydroxy-3-methylglutaryl-coenzyme A synthase. J Biol Chem 263:1848018487[Abstract/Free Full Text]
-
Swinnen JV, Alen P, Heyns W, Verhoeven G 1998 Identification of Diazepam-binding inhibitor/acyl CoA binding protein
as a sterol regulatory element-binding protein-responsive gene. J
Biol Chem 273:1993819944[Abstract/Free Full Text]
-
Guan G, Dai P, Shechter I 1998 Differential
transcriptional regulation of the human squalene synthase gene by
sterol regulatory element-binding proteins (SREBP) 1a and 2 and
involvement of 5' DNA sequence elements in the regulation. J Biol
Chem 273:1252612535[Abstract/Free Full Text]
-
Goldstein JL, Brown MS 1990 Regulation of the
mevalonate pathway. Nature 343:425430[CrossRef][Medline]
-
Guan G, Dai PH, Osborne TF, Kim JB, Shechter I 1997 Multiple sequence elements are involved in the transcriptional
regulation of the human squalene synthase gene. J Biol Chem 272:1029510302[Abstract/Free Full Text]
-
Dooley KA, Millinder S, Osborne TF 1998 Sterol
regulation of 3-hydroxy-3-methylglutaryl-coenzyme A synthase gene
through a direct interaction between sterol regulatory element binding
protein and the trimeric CCAAT-binding factor/nuclear factor Y. J
Biol Chem 273:13491356[Abstract/Free Full Text]
-
Wang X, Sato R, Brown MS, Hua X, Goldstein JL 1994 SREBP-1, a membrane-bound transcription factor released by
sterol-regulated proteolysis. Cell 77:5362[CrossRef][Medline]
-
Hua X, Yokoyama C, Wu J, Briggs MR, Brown MS, Goldstein
JL, Wang X 1993 SREBP-2, a second basic-helix-loop-helix-leucine
zipper protein that stimulates transcription by binding to a sterol
regulatory element. Proc Natl Acad Sci USA 90:1160311607[Abstract/Free Full Text]
-
Yokoyama C, Wang X, Briggs MR, Admon A, Wu J, Hua X,
Goldstein JL, Brown MS 1993 SREBP-1, a basic
helix-loop-helix-leucine zipper protein that controls transcription of
the low density lipoprotein receptor gene. Cell 75:187197[CrossRef][Medline]
-
Shimano H, Horton JD, Hammer RE, Shimomura I, Brown MS,
Goldstein JL 1996 Overproduction of cholesterol and fatty acids
causes massive liver enlargement in transgenic mice expressing
truncated SREBP-1a. J Clin Invest 98:15751584[Medline]
-
Cao G, Garcia CK, Wyne KL, Schultz RA, Parker KL, Hobbs
HH 1997 Structure and localization of the human gene encoding
SR-BI/CLA-1: evidence for transcriptional control by steroidogenic
factor-1. J Biol Chem 272:3306833076[Abstract/Free Full Text]
-
Kim JB, Spotts GD, Halvorsen YD, Shih HM, Ellenberger T,
Towle HC, Spiegelman BM 1995 Dual DNA binding specificity of
ADD1/SREBP-1 controlled by a single amino acid in the basic
helix-loop-helix domain. Mol Cell Biol 15:25822588[Abstract]
-
Sandhoff TW, McLean MP 1996 Hormonal regulation of
steroidogenic acute regulatory (StAR) protein messenger ribonucleic
acid expression in the rat ovary. Endocrine 4:259267
-
McLean MP, Billheimer JT, Warden KJ, Irby RB 1995 Differential expression of hepatic sterol carrier proteins in the
streptozotocin-treated rat. Endocrinology 136:33603368[Abstract]
-
McLean MP, Nelson S, Billheimer JT, Gibori G 1992 Differential capacity for cholesterol transport and processing in large
and small rat luteal cells. Endocrinology 131:22032212[Abstract/Free Full Text]
-
Laemmli UK 1970 Cleavage of structural proteins
during the assembly of the head of bacteriophage T4. Nature 227:680685[CrossRef][Medline]
-
McLean MP, Sandhoff TW 1998 Expression and hormonal
regulation of the high-density lipoprotein (HDL) receptor scavenger
receptor class B type I messenger ribonucleic acid in the rat ovary.
Endocrine 9:243252[CrossRef][Medline]
-
Ljungberg O, Tibblin S 1979 Peroperative fat
staining of frozen sections in primary hyperparathyroidism. Am J
Pathol 95:633641[Abstract]
-
Mizutani T, Sonoda Y, Minegishi T, Wakabayashi K,
Miyamoto K 1997 Cloning, characterization, and cellular
distribution of rat scavenger receptor class B type I (SRBI) in the
ovary. Biochem Biophys Res Commun 234:499505[CrossRef][Medline]
-
Sambrook J, Fritsch EF, Maniatis T 1989 Molecular
Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold
Spring Harbor
-
Chen C, Okayama H 1988 Calcium phosphate-mediated
gene transfer: a highly efficient transfection system for stably
transforming cells with plasmid DNA. BioTechniques 6:632638[Medline]
-
Ness GC, Lopez D 1995 Transcriptional regulation of
rat hepatic low-density lipoprotein receptor and cholesterol 7
hydroxylase by thyroid hormone. Arch Biochem Biophys 323:404408[CrossRef][Medline]
-
Zar JH 1974 Biostatistical Analysis. Prentice-Hall,
Englewood Cliffs, pp 101127
-
Krol GJ, Beck GW, Ritter W, Lettieri JT, Ness GC, Lopez
D, Heller AH 1994 Determination of rivastatin levels in plasma
samples by HPLC and enzyme inhibition assays. Proc R Soc Chem 23:147156
-
Athanikar J, Osborne TF 1998 Specificity in
cholesterol regulation of gene expression by coevolution of sterol
regulatory DNA element and its binding protein. Proc Natl Acad Sci USA 95:49354940[Abstract/Free Full Text]
-
Jackson SM, Ericsson J, Mantovani R, Edwards PA 1998 Synergistic activation of transcription by nuclear factor Y and
sterol regulatory element binding protein. J Lipid Res 39:767776[Abstract/Free Full Text]
-
Menon KMJ, Gunaga KP 1974 Role of cyclic AMP in
reproductive processes. Fertil Steril 25:732750[Medline]
-
Waterman MR, Keeney DS 1996 Signal transduction
pathway combining peptide hormones and steroidogenesis. Vit Horm 52:129148[Medline]
-
Lopez D, Sandhoff TW, McLean MP 1999 Steroidogenic
factor-1 mediates 3',5'-cyclic adenosine monophosphate regulation of
the high-density lipoprotein receptor. Endocrinology 140:30343044[Abstract/Free Full Text]
-
Fluiter K, Vietsch H, Biessen EA, Kostner GM, van Berkel
TJ, Sattler W 1996 Increased selective uptake in vivo
and in vitro of oxidized cholesteryl esters from
high-density lipoprotein by rat liver parenchymal cells. Biochem J 319:471476
-
Pieters MN, Schouten D, Bakkeren HF, Esbach B, Brouwer
A, Knook DL, van Berkel TJ 1991 Selective uptake of cholesteryl
esters from apolipoprotein-E-free high-density lipoproteins by rat
parenchymal cells in vivo is efficiently coupled to bile
acid synthesis. Biochem J 280:359365
-
Pieters MN, Schouten D, Van Berkel TJ 1994 In
vitro and in vivo evidence for the role of HDL in
reverse cholesterol transport. Biochim Biophys Acta 1225:125134[Medline]
-
Ji Y, Jian B, Wang N, Sun Y, Moya ML, Phillips MC,
Rothblat GH, Swaney JB, Tall AR 1997 Scavenger receptor BI
promotes high density lipoprotein-mediated cellular cholesterol efflux.
J Biol Chem 272:2098220985[Abstract/Free Full Text]
-
Murre C, Bain G, van Dijk MA, Engel I, Furnari BA,
Massari ME, Matthews JR, Quong MW, Rivera RR, Stuiver MH 1994 Structure and function of helix-loop-helix proteins. Biochim Biophys
Acta 1218:129135[Medline]
-
Harris AN, Mellon PL 1998 The basic
helix-loop-helix, leucine zipper transcription factor, USF (upstream
stimulatory factor), is a key regulator of SF-1 (steroidogenic
factor-1) gene expression in pituitary gonadotrope and steroidogenic
cells. Mol Endocrinol 12:714726[Abstract/Free Full Text]
-
Le Drean Y, Liu D, Wong AOL, Xiong F, Hew CL 1996 Steroidogenic factor 1 and estradiol receptor act in synergism to
regulate the expression of the salmon gonadotropin II-ß subunit gene.
Mol Endocrinol 10:217229[Abstract/Free Full Text]
-
Liu Z, Simpson ER 1997 Steroidogenic factor 1
(SF-1) and SP1 are required for regulation of bovine CYP11A gene
expression in bovine luteal cells and adrenal Y1 cells. Mol Endocrinol 11:127137[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
R. L. Robker, L. K. Akison, B. D. Bennett, P. N. Thrupp, L. R. Chura, D. L. Russell, M. Lane, and R. J. Norman
Obese Women Exhibit Differences in Ovarian Metabolites, Hormones, and Gene Expression Compared with Moderate-Weight Women
J. Clin. Endocrinol. Metab.,
May 1, 2009;
94(5):
1533 - 1540.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Kuhl, S. M. Ross, and K. W. Gaido
CCAAT/Enhancer Binding Protein {beta}, But Not Steroidogenic Factor-1, Modulates the Phthalate-Induced Dysregulation of Rat Fetal Testicular Steroidogenesis
Endocrinology,
December 1, 2007;
148(12):
5851 - 5864.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Wang, A. K. Nair, and K. M. J. Menon
Ribonucleic Acid Binding Protein-Mediated Regulation of Luteinizing Hormone Receptor Expression in Granulosa Cells: Relationship to Sterol Metabolism
Mol. Endocrinol.,
September 1, 2007;
21(9):
2233 - 2241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Farke, E. Viturro, H. H. D. Meyer, and C. Albrecht
Identification of the bovine cholesterol efflux regulatory protein ABCA1 and its expression in various tissues
J Anim Sci,
November 1, 2006;
84(11):
2887 - 2894.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Lemieux, Y. Gelinas, J. Lalonde, F. Labrie, K. Cianflone, and Y. Deshaies
Hypolipidemic action of the SERM acolbifene is associated with decreased liver MTP and increased SR-BI and LDL receptors
J. Lipid Res.,
June 1, 2005;
46(6):
1285 - 1294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Richardson, I. T. Cameron, C. D. Simonis, M. C. Das, T. E. Hodge, J. Zhang, and C. D. Byrne
Insulin and Human Chorionic Gonadotropin Cause a Shift in the Balance of Sterol Regulatory Element-Binding Protein (SREBP) Isoforms Toward the SREBP-1c Isoform in Cultures of Human Granulosa Cells
J. Clin. Endocrinol. Metab.,
June 1, 2005;
90(6):
3738 - 3746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Wang and K. M. J. Menon
Regulation of Luteinizing Hormone/Chorionic Gonadotropin Receptor Messenger Ribonucleic Acid Expression in the Rat Ovary: Relationship to Cholesterol Metabolism
Endocrinology,
January 1, 2005;
146(1):
423 - 431.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Treguier, C. Doucet, M. Moreau, C. Dachet, J. Thillet, M. J. Chapman, and T. Huby
Transcription Factor Sterol Regulatory Element Binding Protein 2 Regulates Scavenger Receptor Cla-1 Gene Expression
Arterioscler. Thromb. Vasc. Biol.,
December 1, 2004;
24(12):
2358 - 2364.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Argov, U. Moallem, and D. Sklan
Lipid Transport in the Developing Bovine Follicle: Messenger RNA Expression Increases for Selective Uptake Receptors and Decreases for Endocytosis Receptors
Biol Reprod,
August 1, 2004;
71(2):
479 - 485.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sekar and J. D. Veldhuis
Involvement of Sp1 and SREBP-1a in transcriptional activation of the LDL receptor gene by insulin and LH in cultured porcine granulosa-luteal cells
Am J Physiol Endocrinol Metab,
July 1, 2004;
287(1):
E128 - E135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Yu, G. Cao, J. Repa, and H. Stangl
Sterol regulation of scavenger receptor class B type I in macrophages
J. Lipid Res.,
May 1, 2004;
45(5):
889 - 899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Horton, N. A. Shah, J. A. Warrington, N. N. Anderson, S. W. Park, M. S. Brown, and J. L. Goldstein
Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes
PNAS,
October 14, 2003;
100(21):
12027 - 12032.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Olsson, M. Bohlooly-Y, O. Brusehed, O. G. P. Isaksson, B. Ahren, S.-O. Olofsson, J. Oscarsson, and J. Tornell
Bovine growth hormone-transgenic mice have major alterations in hepatic expression of metabolic genes
Am J Physiol Endocrinol Metab,
September 1, 2003;
285(3):
E504 - E511.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rigotti, H. E. Miettinen, and M. Krieger
The Role of the High-Density Lipoprotein Receptor SR-BI in the Lipid Metabolism of Endocrine and Other Tissues
Endocr. Rev.,
June 1, 2003;
24(3):
357 - 387.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Huang, A. Inazu, M.-a. Kawashiri, A. Nohara, T. Higashikata, and H. Mabuchi
Dual effects on HDL metabolism by cholesteryl ester transfer protein inhibition in HepG2 cells
Am J Physiol Endocrinol Metab,
June 1, 2003;
284(6):
E1210 - E1219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Lay, I. Lefrere, C. Trautwein, I. Dugail, and S. Krief
Insulin and Sterol-regulatory Element-binding Protein-1c (SREBP-1C) Regulation of Gene Expression in 3T3-L1 Adipocytes. IDENTIFICATION OF CCAAT/ENHANCER-BINDING PROTEIN beta AS AN SREBP-1C TARGET
J. Biol. Chem.,
September 13, 2002;
277(38):
35625 - 35634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Lopez, M. D. Sanchez, W. Shea-Eaton, and M. P. McLean
Estrogen Activates the High-Density Lipoprotein Receptor Gene via Binding to Estrogen Response Elements and Interaction with Sterol Regulatory Element Binding Protein-1A
Endocrinology,
June 1, 2002;
143(6):
2155 - 2168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Nackley, W. Shea-Eaton, D. Lopez, and M. P. McLean
Repression of the Steroidogenic Acute Regulatory Gene by the Multifunctional Transcription Factor Yin Yang 1
Endocrinology,
March 1, 2002;
143(3):
1085 - 1096.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. G. Hullinger, R. L. Panek, X. Xu, and S. K. Karathanasis
p21-activated Kinase-1 (PAK1) Inhibition of the Human Scavenger Receptor Class B, Type I Promoter in Macrophages Is Independent of PAK1 Kinase Activity, but Requires the GTPase-binding Domain
J. Biol. Chem.,
December 7, 2001;
276(50):
46807 - 46814.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Lopez, W. Shea-Eaton, M. D. Sanchez, and M. P. McLean
DAX-1 Represses the High-Density Lipoprotein Receptor Through Interaction with Positive Regulators Sterol Regulatory Element-Binding Protein-1a and Steroidogenic Factor-1
Endocrinology,
December 1, 2001;
142(12):
5097 - 5106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Cherradi, M. Bideau, S. Arnaudeau, N. Demaurex, R. W. James, S. Azhar, and A. M. Capponi
Angiotensin II Promotes Selective Uptake of High Density Lipoprotein Cholesterol Esters in Bovine Adrenal Glomerulosa and Human Adrenocortical Carcinoma Cells Through Induction of Scavenger Receptor Class B Type I
Endocrinology,
October 1, 2001;
142(10):
4540 - 4549.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. K. Shea-Eaton, M. J. Trinidad, D. Lopez, A. Nackley, and M. P. McLean
Sterol Regulatory Element Binding Protein-1a Regulation of the Steroidogenic Acute Regulatory Protein Gene
Endocrinology,
April 1, 2001;
142(4):
1525 - 1533.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Rodriguez, J. Martinez-Gonzalez, S. Sanchez-Gomez, and L. Badimon
LDL Downregulates CYP51 in Porcine Vascular Endothelial Cells and in the Arterial Wall Through a Sterol Regulatory Element Binding Protein-2-Dependent Mechanism
Circ. Res.,
February 16, 2001;
88(3):
268 - 274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. K. Christenson, T. F. Osborne, J. M. McAllister, and J. F. Strauss III
Conditional Response of the Human Steroidogenic Acute Regulatory Protein Gene Promoter to Sterol Regulatory Element Binding Protein-1a
Endocrinology,
January 1, 2001;
142(1):
28 - 36.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Santamarina-Fojo, K. Peterson, C. Knapper, Y. Qiu, L. Freeman, J.-F. Cheng, J. Osorio, A. Remaley, X.-P. Yang, C. Haudenschild, et al.
Complete genomic sequence of the human ABCA1 gene: Analysis of the human and mouse ATP-binding cassette A promoter
PNAS,
July 5, 2000;
97(14):
7987 - 7992.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Mizutani, K. Yamada, T. Minegishi, and K. Miyamoto
Transcriptional Regulation of Rat Scavenger Receptor Class B Type I Gene
J. Biol. Chem.,
July 14, 2000;
275(29):
22512 - 22519.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Le Lay, S. Krief, C. Farnier, I. Lefrere, X. Le Liepvre, R. Bazin, P. Ferre, and I. Dugail
Cholesterol, a Cell Size-dependent Signal That Regulates Glucose Metabolism and Gene Expression in Adipocytes
J. Biol. Chem.,
May 11, 2001;
276(20):
16904 - 16910.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tsuruoka, W. Khovidhunkit, B. E. Brown, J. W. Fluhr, P. M. Elias, and K. R. Feingold
Scavenger Receptor Class B Type I Is Expressed in Cultured Keratinocytes and Epidermis. REGULATION IN RESPONSE TO CHANGES IN CHOLESTEROL HOMEOSTASIS AND BARRIER REQUIREMENTS
J. Biol. Chem.,
January 18, 2002;
277(4):
2916 - 2922.
[Abstract]
[Full Text]
[PDF]
|
 |
|