| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Cell Biology, Medical School, University of Utrecht, Utrecht 3584 CX, The Netherlands
Address all correspondence and requests for reprints to: B. H. G. J. Schrans-Stassen, Department of Cell Biology, University Medical Center Utrecht, Heidelberglaan 100, AZU Room G02.525, 3584 CX Utrecht, The Netherlands. E-mail: B.H.G.J.SchransStassen{at}lab.azu.nl
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The proto-oncogene c-kit is encoded at the white spotting locus (W) and mice with mutations at this locus are deficient in generating melanocytes, hematopoietic cells and germ cells (5, 6, 7). The presence of c-kit messenger RNA (mRNA) has been described in Adiff, Intermediate and type B spermatogonia (8, 9, 10), but it was not established whether it was also present in Aundiff. The importance of the c-kit receptor for spermatogenesis was underlined by experiments in which the c-kit antibody ACK2 was injected into adult male mice. This injection caused a depletion of Adiff spermatogonia, whereas Aundiff spermatogonia were unaffected (11, 12), suggesting that Aundiff spermatogonia do not express the c-kit receptor or that in these cells c-kit does not have a vital role. In contrast, Morena et al. (13) reported the presence of the c-Kit protein in a purified population of type A spermatogonia isolated from prepubertal rat testis. Large as well as small cells were found to be positive for c-Kit protein, and it was suggested that both Aundiff and Adiff spermatogonia express this receptor, assuming that these cell types are small and large, respectively. However, cell size is a less reliable parameter to distinguish isolated spermatogonial cell types because the size of the Aundiff spermatogonia varies greatly during the traversal of the cell cycle (14). Nevertheless, cell size can be used to study cell development in sections to compare specific cell types. For example, Kluin et al. (15) showed an increasing nuclear size of Aundiff spermatogonia in epithelial stages IV to VII, during their proliferation arrest. Dym et al. (10) also found immunohistochemical staining for c-kit in isolated A spermatogonia from prepubertal rat testes, but did not specify whether or not all these cells were c-kit positive.
The question whether or not c-kit is present in Aundiff and Adiff spermatogonia is important, because if it is only present in Adiff, Intermediate and B spermatogonia it would provide a differentiation marker, facilitating studies into the regulation of the differentiation of Aundiff spermatogonia. To answer this question we now have studied the presence of the c-kit mRNA and protein in Aundiff and Adiff spermatogonia. The well characterized vitamin A-deficient model was used to isolate Aundiff and Adiff spermatogonia (16). Vitamin A is essential for the maintenance of spermatogenesis and in vitamin A-deficient rat and mouse testes, type A spermatogonia are virtually the only germ cells that remain (17, 18, 19, 20). The remaining type A spermatogonia in VAD animals were found to be Aundiff spermatogonia arrested just before their differentiation into type A1 spermatogonia, which in the normal situation occurs in epithelial stages late VII to early VIII (17, 21, 22). In rats and mice, administration of various retinoids leads to a reinitiation of spermatogenesis in a synchronized manner, resulting in the formation of type A1 spermatogonia (17, 18, 22, 23, 24, 25, 26). c-kit mRNA expression was studied in this model in purified Aundiff and Adiff spermatogonia, using RT-PCR and in situ hybridization. Furthermore, the c-Kit protein was localized by immunohistochemistry in testes of VAD mice before and after all-trans-retinoic acid treatment and in normal mice. The results clearly indicate differences in c-kit mRNA and protein expression between Aundiff and Adiff spermatogonia.
| Materials and Methods |
|---|
|
|
|---|
Cell isolation
Type A spermatogonia were isolated as described by van Pelt
et al. (16) with some modifications. Briefly, testes were
decapsulated and tubules were teased apart. After the first enzymatic
digestion in 1 mg/ml trypsin TRL, 1 mg/ml collagenase type 1 CLS-1
(both from Worthington, Freehold, NJ), 1 mg/ml hyaluronidase
(Sigma) and DNase I (5 µg/ml) for 20 min at 32 C in a
shaking water bath (6080 cycles/minute) and a second enzymatic
digestion in 1 mg/ml collagenase, 1 mg/ml hyaluronidase and DNase (5
µg/ml) for 40 min at 32 C, the cells were directly separated on a
discontinuous Percoll gradient. Cells of fraction 3, 4, 5, and 6 were
collected and cell identification was carried out as described (16).
Cells of fractions with a purity of type A spermatogonia of 85% or
higher were pelleted, resuspended in guanidium thiocyanate and stored
at -80 C until further use. Several isolations were performed to
render a total of approximately 700,000 cells per time point.
RT-PCR
Total RNA was isolated from pooled fractions of isolated type A
spermatogonia from VAD mice and mice 24 h after retinoic acid
treatment, using the guanidine thiocyanate method according to
Chomc-zinsky and Sacchi (27). RNA was treated with RNase free DNase
I (Roche Molecular Biochemicals, Mannheim, Germany)
as described by Ausubel et al. (28). Complementary DNA
(cDNA) was made of 500 ng total RNA using Superscript II reverse
transcriptase (Life Technologies, Inc., Paisley, Scotland,
UK). The reaction was performed as instructed by the manufacturer. The
3' primers used for the RT reaction were specific for c-kit
(TCAACGACCTTCCCGAAGGCACCA (29) and ß-actin
(GAAGCAATGCTGTCACCTTCCC (30). cDNA was purified using the QIAquick PCR
purification kit (QIAGEN, Hilden, Germany) and eluted with
50 µl elution buffer. The PCR reaction was performed with 10 µl
cDNA, 150 ng primer 3' and 5', 1.5 mM MgCl2,
0.2 M dNTPs, 1 x Goldstar reaction buffer and 2.5 U
Goldstar Taq polymerase (Eurogentec, Seraing, Belgium) per
reaction of 100 µl. The 5' primers for c-kit and
ß-actin were CTGGTGGTTCAGAGTTCCATAGAC and
GCGGACTGTTACTGAGCTGCGT, respectively (29, 30). ß -actin
and c-kit PCR reactions were performed in two separate PCR
tubes. The predicted sizes of the reaction products were 450 bp for
ß-actin and 385 bp for c-kit. Amplification was
performed with a Techne Dri-Block cycler (Techne Ltd., Cambridge, UK)
as follows: 38 cycles, 95 C, 45 sec; 60 C, 45 sec; 72 C, 30 sec. The
amplified products were analyzed on an ethidium bromide agarose gel.
RT-PCR experiments were performed three times independently from each
other.
Probe preparation
Riboprobes used for in situ hybridization were
derived from a cDNA clone in pBluescriptIIKS, containing a fragment of
276 bp, starting 30 bp upstream from the initiator ATG of the murine
kit cDNA, which was a generous gift of Dr. P. Lonai (The
Weizmann Institute of Science, Israel). After linearization with
SacI and BamHI, DIG-labeled antisense and sense
riboprobes were made using the DIG RNA labeling kit with T3 and T7 RNA
polymerase, respectively (all reagents from Roche Molecular Biochemicals). After labeling, probe length was reduced by
alkaline hydrolysis and the amount of labeled probe was determined by
comparison to a DIG-labeled RNA standard (Roche Molecular Biochemicals).
In situ hybridization
Testes were fixed overnight in 4% paraformaldehyde in PBS at 4
C and embedded in paraffin (Stemcowax, Adamas Instruments BV.,
Amerongen, The Netherlands). Five-micrometer sections were mounted on
3-aminopropyl triethoxysilane (TESPA, Sigma)-coated slides
and dried overnight at 37 C. Sections were pretreated as described by
Wilkinson and Green (31). Hybridization was carried out at 55 C for
approximately 42 h with a probe concentration of 1 ng/µl and
slides were washed under high stringency (31). After performing the
final washing step at room temperature, the hybridized DIG-labeled
probes were detected using immunohistochemistry. Slides were washed
once in PBS and endogenous peroxidase activity was blocked with a 10
min incubation in 0.35% H2O2
(Merck, Darmstadt, Germany) in PBS. After washing twice in
PBS, slides were washed once in 0.1 M Tris-HCl (Fluka
Chemie AG, Buchs, Switzerland), 0.15 M NaCl
(Merck, Darmstadt, Germany), pH 7.6 (TN) buffer. Sections
were blocked in 10% normal horse serum (Vector Laboratories, Inc., Burlingame, CA) in TN buffer for one hour to reduce
background signal. After removal of the cover slips, slides were
incubated overnight at 4 C in a moist chamber with the monoclonal
antibody mouse anti-DIG (1:200, Roche Molecular Biochemicals) in 10% horse serum/TN buffer. After washing with
TN buffer, containing 0.2% Tween (Merck; TNT buffer) and
TN buffer, respectively, sections were incubated with biotinylated
antimouse IgG (1:200; ABC-peroxidase staining kit, Vector Laboratories, Inc.) in 10% horse serum/TN buffer for 1 h
at room temperature. The avidin-biotin complex was prepared as
described by the manufacturer (Vector Laboratories, Inc.)
and incubation took place for 1 h at room temperature. After
washing once in TNT buffer, twice in TN and finally in 0.05
M Tris-HCl, pH 7.6, 0.3 M NaCl and 0.2% Tween,
signal was visualized using 3,3'-diaminobenzidine tetrahydrochloride
0.5 mg/ml (DAB; DAKO Corp., Carpenteria, CA) in 0.05
M Tris-HCl pH 7.6, 0.01% H2O2.
Sections were counter stained with Mayers hematoxylin
(Sigma), then washed in aquadest and tap water,
respectively. Slides were mounted with Pertex (Cellpath Ltd., Hemel
Hempstead, UK). Experiments were performed at least four times, using
four different animals per time point.
Immunohistochemistry
The antibodies ACK2 (rat monoclonal IgG 2B, Life Technologies, Inc., Breda, The Netherlands), C-19 and M-14
(rabbit polyclonal IgG and goat polyclonal IgG, respectively, both form
Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were
tested for their immunoreactivity for c-Kit protein and they all showed
the same staining pattern. However, M-14 turned out to give the
clearest signal, and this antibody was used in further experiments.
Three different badges of c-kit M14 antibody, purified by the
manufacturer according standardized protocol, were used. These badges
were from different lot numbers and different bleedings.
Testes of four different animals per time point were fixed overnight in Bouins fluid at room temperature and embedded in paraffin. Five-micrometer sections were mounted on TESPA coated slides and dried overnight at 37 C. The next day, slides were dewaxed with an extra long step in 70% ethanol to decrease the amount of picric acid in the sections. After washing in aquadest and PBS, respectively, sections were blocked for 30 min in 5% rabbit serum (Aurion ImmunoGold Reagents & Accessories, Wageningen, The Netherlands), 5% BSA fraction V in PBS. After a short wash with 0.05% acetylated BSA (BSA-c; Aurion, Wageningen, The Netherlands) sections were incubated overnight at room temperature in a moist chamber with c-kit antibody M14 (1:100; sc-1494, Santa Cruz Biotechnology, Inc.) in 0.05% BSA-c/5% rabbit serum/PBS. The next day, slides were washed with 0.05% BSA-c in PBS for one hour and then incubated with biotinylated rabbit antigoat (1:100; Aurion, Wageningen, The Netherlands) in 0.05% BSA-c/5% rabbit serum/PBS for 1 h at room temperature. Sections were washed briefly in BSA-c and PBS. Endogenous peroxidase activity was blocked with 0.35% H2O2 in PBS for 15 min after which sections were incubated at room temperature with the avidin-biotin complex (Vector Laboratories, Inc.), prepared as described by the manufacturer. After washing three times with PBS, sections were washed twice for 10 min in 0.05 M Tris-HCl pH 7.6, 0.3 M NaCl and 0.1% Tween. Signal was visualized and staining was performed as described above in the in situ hybridization protocol. As a negative control a similar immunohistochemical reaction was performed in which the antibody was blocked with a c-Kit blocking peptide (1:100; sc-1494P, Santa Cruz Biotechnology, Inc.).
Cell counts
Immunohistochemically stained and unstained type A spermatogonia
were counted in stages VI, VII, IX/X, and in XII in testes of four
normal adult mice. In each of these stages minimal 50 type A
spermatogonia were studied for c-kit staining. Cell counts
of stained and unstained type A spermatogonia were also performed in
testes of four VAD and retinoic acid treated mice. Per testis, 400 type
A spermatogonia were counted. In four VAD animals, the size of the
nucleus of 60 stained and 60 unstained type A spermatogonia was
determined.
Statistics
In case of the stage dependency data, the Friedman test was used
to determine the variance, and the multiple comparisons test was used
to define the significance of the differences. For evaluation of the
nuclear size data, the Wilcoxon test was used.
| Results |
|---|
|
|
|---|
|
RT-PCR
To determine a possible difference between c-kit mRNA
expression in Aundiff and Adiff spermatogonia,
expression of c-kit mRNA was studied in a semiquantative
way, using ß-actin mRNA as an internal standard. From both
cell types, 500 ng total RNA was used for the performance of a RT-PCR
reaction. Hardly any signal could be detected in Aundiff
spermatogonia whereas in Adiff spermatogonia a strong
signal was observed (Fig. 1
).
|
Staining was absent in the adjacent sections hybridized with the sense
probe, except for some background in Leydig cells (Fig. 2B
and 2D
).
Immunohistochemistry
To determine whether the transcripts were actually translated into
protein, immunohistochemical experiments were performed. In the VAD
situation, staining for c-Kit protein was clearly seen in Leydig cells
and weakly in Sertoli cells (Fig. 2E
). The staining in Sertoli cells
seemed restricted to round structures in the cytoplasm. The A
spermatogonia present in the VAD testis showed variable
immunoreactivity (Fig. 2E
). Three different batches of c-kit antibody
were used. With two of the batches staining of A spermatogonia was
weak, whereas some A spermatogonia showed no immunoreactivity. With one
batch, most of the A spermatogonia were clearly stained, and this badge
was used for the photomicrographs and in stage-dependency studies. In
the VAD testes, cell counts were performed and 82% ± 4% (mean
± SD; range 8088%) of the A spermatogonia were stained
(Fig 3A
). In addition, there was a
difference in morphology between the staining and nonstaining A
spermatogonia. The nuclei of the staining cells were generally larger
than the nonstaining ones, 9.7 ± 0.7 µm (mean ±
SD) and 7.6 ± 0.2 µm, respectively (Fig. 3B
).
Twenty-four hours after administration of retinoic acid, a clear
staining was seen with all three batches of c-kit antibody
(Fig. 2F
). The percentage of stained A spermatogonia appeared to be
similar as in VAD animals, namely 86% ± 3% (Fig. 3A
; range
8388%). In both cases, also clusters of A spermatogonia were seen.
In the testes of VAD as well as of retinoic acid-treated animals, these
clusters always stained for c-kit.
|
To check the specificity of the signal, immunohistochemical experiments
were performed in which the antibody was blocked with the c-Kit
peptide. In this situation, no staining was observed in testes of
normal, VAD, or retinoic acid-treated mice (Fig. 2H
).
To quantify the stage dependency of the staining of Aundiff
and Adiff spermatogonia for c-kit, unstained and
stained type A spermatogonia in stages VI, VII, IX/X, and in XII were
counted. A clear difference was found in staining of type A
spermatogonia in the different stages (Fig. 4
). The percentage of stained type A
spermatogonia was low in stage VI [16% ± 2%; (mean ±
SD; range 1218%)], whereas in stage VII the percentage
of stained type A spermatogonia was increased (45% ± 15%; range
2963%). The highest percentage of stained type A spermatogonia was
seen in stages IX/X (78% ± 14%; range 5389%) and XII (90% ±
1.9%; range 8792%).
|
| Discussion |
|---|
|
|
|---|
The type A spermatogonia present in the VAD testis are Aundiff spermatogonia, apparently unable to differentiate into type A1 spermatogonia (22), and these cells are comparable to the A spermatogonia present in epithelial stages late VII and early VIII (17). Our RT-PCR and in situ hybridization experiments revealed that these Aundiff spermatogonia hardly express c-kit mRNA. Administration of retinoic acid to VAD mice induces differentiation of the A spermatogonia and this appeared to correlate with a clear enhancement of c-kit mRNA expression. The immunohistochemical results of the c-Kit antibody were variable. In the VAD testis, most A spermatogonia were weakly stained with two batches of the antibody, whereas a clear staining of these cells was found after induction of differentiation with retinoic acid. However, with one batch of antibody most A spermatogonia in the VAD testis also clearly stained for c-Kit. In view of the mRNA data, the most likely conclusion is that most A spermatogonia in the VAD testis express low levels of the c-kit receptor and that the expression of this protein is enhanced upon differentiation into A1 spermatogonia. Interestingly, about 17% of the A spermatogonia did not stain for c-Kit. Moreover, c-kit positive cells were often seen in groups, whereas groups of unstained cells were never seen. This suggests that especially the Aal spermatogonia present the c-kit receptor. Therefore we hypothesize that in the VAD situation the Aal spermatogonia, which are ready to differentiate into A1 spermatogonia, already express some c-kit receptor and that the unstained A spermatogonia are most likely the remaining undifferentiated A spermatogonia, i.e. As, Apr and possibly some Aal. After administration of retinoic acid the percentage of the stained and unstained A spermatogonia did not change. Apparently, retinoic acid did not induce c-Kit expression in the remaining c-Kit negative undifferentiated spermatogonia, which was to be expected because a population of undifferentiated spermatogonia is required to ensure long-term spermatogenesis as seen after vitamin A replacement in VAD animals. It is unlikely that c-kit expression is directly regulated by retinoic acid as no retinoic acid responsive element has been found in the promoter region of the c-kit gene (32). In accordance with this, the expression of the c-Kit protein in the Leydig cells of VAD animals was similar to that seen in retinoic acid treated and normal mouse testis.
In the normal seminiferous epithelium, the Aundiff spermatogonia proliferate from epithelial stage X until about stage III, during which they produce many Aal spermatogonia (33). Subsequently, there is a proliferation arrest until stage VIII, during which the numbers of As, Apr and Aal do hardly change. Our cell counts revealed low numbers of c-kit positive cells (about 16%) in epithelial stage VI, increasing thereafter to high percentages in stages X and XII. This suggests that Aal spermatogonia gradually develop from c-kit negative to c-kit positive cells near the end of the period of proliferation arrest. Then, in stage VIII the Aal spermatogonia differentiate into A1 spermatogonia and enter S phase. During stages IX/X and stage XII, c-kit negative A spermatogonia persist to be present which may well be the remaining Aundiff spermatogonia in these stages, consisting of As, Apr and a few Aal (3).
In view of the results both in VAD and normal mice, we hypothesize that spermatogonial stem cells (As) and Apr spermatogonia are c-kit negative. The Aal spermatogonia are also c-kit negative until during their period of proliferation arrest, at which time they prepare themselves to differentiate into A1 spermatogonia. Then they gradually accumulate some c-kit receptor and our results indicate that this process starts at about stage VI in the normal epithelium. In the VAD testis, the remaining population of A spermatogonia is comparable to that in stages VII-VIII in the normal epithelium (17), and indeed c-kit positive groups of Aal spermatogonia were observed. The induction of c-kit may already be a differentiation step or just a reversible permissive step allowing irreversible differentiation into A1 spermatogonia. As vitamin A-induced differentiation is necessary for the c-kit positive spermatogonia in the VAD testis to develop the compulsory proliferation pattern, characteristic of the differentiating spermatogonia, the latter possibility seems the most likely one.
In the VAD testes, a difference was noticed in the size of the c-Kit positive and negative A spermatogonia, the c-Kit positive cells being larger. Also, the cells in groups of A spermatogonia, being Aal spermatogonia, were always large, whereas the single cells in the sections, being either As, Apr or Aal, were often small. This suggests that in the VAD testis, the Aal spermatogonia are larger than the As and Apr spermatogonia. Probably, besides acquiring the c-kit receptor, the Aal spermatogonia also grow in size during their preparation for differentiation. This is compatible with data from Kluin et al. (15) who determined the nuclear size of mouse undifferentiated spermatogonia during epithelial stages IV to VII, being mostly Aal spermatogonia, and found an increase in nuclear size.
Orth et al. (34) studied c-kit expression in neonatal rat gonocytes, the progenitor cells of A spermatogonia. Nonmigrating gonocytes that were c-kit negative were detected, and it was suggested that these gonocytes represented a c-kit-independent subpopulation of developing germ cells. Our current data show a subpopulation of c-kit negative A spermatogonia also being present in the adult testis. In contrast, Morena et al. (35) found all type A spermatogonia to be c-kit positive after isolation of A spermatogonia from 9- day-old rats. However, among a mixture of numerous differentiating type A spermatogonia, also present at that age, the c-kit negative Aundiff spermatogonia may have been too rare to detect.
Dym et al. (10) did not specifically mention the presence or absence of c-kit negative A spermatogonia in cells purified from 9-day-old rats. However, these authors concluded that A1-A4 spermatogonia are c-kit positive and left open the possibility that the so-called A0 spermatogonia are c-kit negative. In the "A1 model" of spermatogonial multiplication and stem cell renewal, A1-A4 are the stem cells and the A0 spermatogonia are equivalent to the As and Apr spermatogonia of the "As model" (36). Explaining the present results in according to the "A1 model" we would have to conclude that the A1 daughter cells of the c-kit positive A4 spermatogonia at first do not express the c-kit receptor, in contrast to their In sisters, but acquire this only several epithelial stages later.
In accordance with results from other groups (7), we observed a strong expression of c-kit mRNA and protein in Leydig cells in testes of normal, VAD, and retinoic acid-treated animals. We also detected some immunohistochemical staining for c-kit in Sertoli cells in testes of VAD and retinoic acid-treated animals. However, mRNA of c-kit was not processed in Sertoli cells of the VAD testis, as no signal was seen with in situ hybridization, so in these cells no c-Kit protein can be formed. The staining of Sertoli cells in the VAD testis could be a vitamin A-deficiency effect. The degenerating germ cells in the VAD testis have to be removed from the tubules, and degenerating cells are phagocytized by Sertoli cells, both in vivo (37) and in vitro (38). As the degenerating cells express c-Kit protein at a high level, this could cause the signal seen in Sertoli cells.
In conclusion, in both the VAD model and in the normal situation, the only undifferentiated A spermatogonia that express c-Kit are those Aal spermatogonia that are committed to differentiate into type A1 spermatogonia. In the normal situation, this expression already starts at stage VI and gradually increases in stages VII, IX/X, and XII. Therefore c-kit may be used as a differentiation marker for the differentiation of Aal into A1 spermatogonia. As and Apr spermatogonia are very likely c-kit negative. Interestingly, a striking parallel can be seen with hematopoiesis in which the pluripotent stem cells are c-kit<low (39).
| Acknowledgments |
|---|
Received May 7, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
B. P. Hermann, M. Sukhwani, D. R. Simorangkir, T. Chu, T. M. Plant, and K. E. Orwig Molecular dissection of the male germ cell lineage identifies putative spermatogonial stem cells in rhesus macaques Hum. Reprod., July 1, 2009; 24(7): 1704 - 1716. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Maki, J. Pacchiarotti, T. Ramos, M. Pascual, J. Pham, J. Kinjo, S. Anorve, and F. Izadyar Phenotypic and molecular characterization of spermatogonial stem cells in adult primate testes Hum. Reprod., June 1, 2009; 24(6): 1480 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Basciani, G. De Luca, S. Dolci, M. Brama, M. Arizzi, S. Mariani, G. Rosano, G. Spera, and L. Gnessi Platelet-Derived Growth Factor Receptor {beta}-Subtype Regulates Proliferation and Migration of Gonocytes Endocrinology, December 1, 2008; 149(12): 6226 - 6235. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Dann, A. L. Alvarado, L. A. Molyneux, B. S. Denard, D. L. Garbers, and M. H. Porteus Spermatogonial Stem Cell Self-Renewal Requires OCT4, a Factor Downregulated During Retinoic Acid-Induced Differentiation Stem Cells, November 1, 2008; 26(11): 2928 - 2937. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Drobinskaya, T. Linn, T. Saric, R. G. Bretzel, H. Bohlen, J. Hescheler, and E. Kolossov Scalable Selection of Hepatocyte- and Hepatocyte Precursor-Like Cells from Culture of Differentiating Transgenically Modified Murine Embryonic Stem Cells Stem Cells, September 1, 2008; 26(9): 2245 - 2256. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Izadyar, F. Pau, J. Marh, N. Slepko, T. Wang, R. Gonzalez, T. Ramos, K. Howerton, C. Sayre, and F. Silva Generation of multipotent cell lines from a distinct population of male germ line stem cells Reproduction, June 1, 2008; 135(6): 771 - 784. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hao, M. Yamamoto, T. E. Richardson, K. M. Chapman, B. S. Denard, R. E. Hammer, G. Q. Zhao, and F. K. Hamra Sohlh2 Knockout Mice Are Male-Sterile Because of Degeneration of Differentiating Type A Spermatogonia Stem Cells, June 1, 2008; 26(6): 1587 - 1597. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhou, Y. Li, R. Nie, P. Friel, D. Mitchell, R. M. Evanoff, D. Pouchnik, B. Banasik, J. R. McCarrey, C. Small, et al. Expression of Stimulated by Retinoic Acid Gene 8 (Stra8) and Maturation of Murine Gonocytes and Spermatogonia Induced by Retinoic Acid In Vitro Biol Reprod, March 1, 2008; 78(3): 537 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. He, J. Jiang, M. Kokkinaki, N. Golestaneh, M.-C. Hofmann, and M. Dym Gdnf Upregulates c-Fos Transcription via the Ras/Erk1/2 Pathway to Promote Mouse Spermatogonial Stem Cell Proliferation Stem Cells, January 1, 2008; 26(1): 266 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Filipponi, R. M. Hobbs, S. Ottolenghi, P. Rossi, E. A. Jannini, P. P. Pandolfi, and S. Dolci Repression of kit Expression by Plzf in Germ Cells Mol. Cell. Biol., October 1, 2007; 27(19): 6770 - 6781. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. He, J. Jiang, M.-C. Hofmann, and M. Dym Gfra1 Silencing in Mouse Spermatogonial Stem Cells Results in Their Differentiation Via the Inactivation of RET Tyrosine Kinase Biol Reprod, October 1, 2007; 77(4): 723 - 733. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhongyi, P. Rantakari, T. Lamminen, J. Toppari, and M. Poutanen Transgenic Male Mice Expressing Human Hydroxysteroid Dehydrogenase 2 Indicate a Role for the Enzyme Independent of Its Action on Sex Steroids Endocrinology, August 1, 2007; 148(8): 3827 - 3836. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goel, M. Sugimoto, N. Minami, M. Yamada, S. Kume, and H. Imai Identification, Isolation, and In Vitro Culture of Porcine Gonocytes Biol Reprod, July 1, 2007; 77(1): 127 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tokuda, Y. Kadokawa, H. Kurahashi, and T. Marunouchi CDH1 Is a Specific Marker for Undifferentiated Spermatogonia in Mouse Testes Biol Reprod, January 1, 2007; 76(1): 130 - 141. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yoshida, M. Sukeno, T. Nakagawa, K. Ohbo, G. Nagamatsu, T. Suda, and Y.-i. Nabeshima The first round of mouse spermatogenesis is a distinctive program that lacks the self-renewing spermatogonia stage Development, April 15, 2006; 133(8): 1495 - 1505. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Prabhu, M. L Meistrich, E. A McLaughlin, S. D Roman, S. Warne, S. Mendis, C. Itman, and K. L. Loveland Expression of c-Kit receptor mRNA and protein in the developing, adult and irradiated rodent testis. Reproduction, March 1, 2006; 131(3): 489 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cherqui, S. M. Kurian, O. Schussler, J. A. Hewel, J. R. Yates III, and D. R. Salomon Isolation and Angiogenesis by Endothelial Progenitors in the Fetal Liver Stem Cells, January 1, 2006; 24(1): 44 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Khaira, D. McLean, D. A. Ohl, and G. D. Smith Spermatogonial Stem Cell Isolation, Storage, and Transplantation J Androl, July 1, 2005; 26(4): 442 - 450. [Full Text] [PDF] |
||||
![]() |
T. Takayama, T. Mishima, M. Mori, H. Jin, H. Tsukamoto, K. Takahashi, T. Takizawa, K. Kinoshita, M. Suzuki, I. Sato, et al. Sexually Dimorphic Expression of the Novel Germ Cell Antigen TEX101 During Mouse Gonad Development Biol Reprod, June 1, 2005; 72(6): 1315 - 1323. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sofikitis, E. Pappas, A. Kawatani, D. Baltogiannis, D. Loutradis, N. Kanakas, D. Giannakis, F. Dimitriadis, K. Tsoukanelis, I. Georgiou, et al. Efforts to create an artificial testis: culture systems of male germ cells under biochemical conditions resembling the seminiferous tubular biochemical environment Hum. Reprod. Update, May 1, 2005; 11(3): 229 - 259. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-B. Ruan, N. Zhang, and X. Gao Identification of a Novel Point Mutation of Mouse Proto-Oncogene c-kit Through N-Ethyl-N-nitrosourea Mutagenesis Genetics, February 1, 2005; 169(2): 819 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Hofmann, L. Braydich-Stolle, L. Dettin, E. Johnson, and M. Dym Immortalization of Mouse Germ Line Stem Cells Stem Cells, February 1, 2005; 23(2): 200 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Lacham-Kaplan In vivo and in vitro differentiation of male germ cells in the mouse Reproduction, August 1, 2004; 128(2): 147 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Bedell and A. M. Zama Genetic Analysis of Kit Ligand Functions During Mouse Spermatogenesis J Androl, March 1, 2004; 25(2): 188 - 199. [Full Text] [PDF] |
||||
![]() |
P. Grimaldi, F. Capolunghi, R. Geremia, and P. Rossi Cyclic Adenosine Monophosphate (cAMP) Stimulation of the Kit Ligand Promoter in Sertoli Cells Requires an Sp1-Binding Region, a Canonical TATA Box, and a cAMP-Induced Factor Binding to an Immediately Downstream GC-Rich Element Biol Reprod, December 1, 2003; 69(6): 1979 - 1988. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pellegrini, P. Grimaldi, P. Rossi, R. Geremia, and S. Dolci Developmental expression of BMP4/ALK3/SMAD5 signaling pathway in the mouse testis: a potential role of BMP4 in spermatogonia differentiation J. Cell Sci., August 15, 2003; 116(16): 3363 - 3372. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kanatsu-Shinohara, N. Ogonuki, K. Inoue, H. Miki, A. Ogura, S. Toyokuni, and T. Shinohara Long-Term Proliferation in Culture and Germline Transmission of Mouse Male Germline Stem Cells Biol Reprod, August 1, 2003; 69(2): 612 - 616. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. van den Ham, F.M.F. van Dissel-Emiliani, and A.M.M. van Pelt Expression of the Scaffolding Subunit A of Protein Phosphatase 2A During Rat Testicular Development Biol Reprod, April 1, 2003; 68(4): 1369 - 1375. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Meistrich and G. Shetty Inhibition of Spermatogonial Differentiation by Testosterone J Androl, March 1, 2003; 24(2): 135 - 148. [Full Text] [PDF] |
||||
![]() |
M.-C. Hofmann, K. S. Van Der Wee, J. L. Dargart, G. Dirami, L. Dettin, and M. Dym Establishment and Characterization of Neonatal Mouse Sertoli Cell Lines J Androl, January 1, 2003; 24(1): 120 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Izadyar, K. den Ouden, L. B. Creemers, G. Posthuma, M. Parvinen, and D. G. de Rooij Proliferation and Differentiation of Bovine Type A Spermatogonia During Long-Term Culture Biol Reprod, January 1, 2003; 68(1): 272 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Guerif, V. Cadoret, V. Rahal-Perola, J. Lansac, F. Bernex, J. Jacques Panthier, M. Therese Hochereau-de Reviers, and D. Royere Apoptosis, Onset and Maintenance of Spermatogenesis: Evidence for the Involvement of Kit in Kit-Haplodeficient Mice Biol Reprod, July 1, 2002; 67(1): 70 - 79. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.B. Creemers, X. Meng, K. den Ouden, A.M.M. van Pelt, F. Izadyar, M. Santoro, H. Sariola, and D.G. de Rooij Transplantation of Germ Cells from Glial Cell Line-Derived Neurotrophic Factor-Overexpressing Mice to Host Testes Depleted of Endogenous Spermatogenesis by Fractionated Irradiation Biol Reprod, June 1, 2002; 66(6): 1579 - 1584. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. M. van Pelt, H. L. Roepers-Gajadien, I. S. Gademan, L. B. Creemers, D. G. de Rooij, and F. M. F. van Dissel-Emiliani Establishment of Cell Lines with Rat Spermatogonial Stem Cell Characteristics Endocrinology, May 1, 2002; 143(5): 1845 - 1850. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dolci, M. Pellegrini, S. Di Agostino, R. Geremia, and P. Rossi Signaling through Extracellular Signal-regulated Kinase Is Required for Spermatogonial Proliferative Response to Stem Cell Factor J. Biol. Chem., October 19, 2001; 276(43): 40225 - 40233. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chiarini-Garcia and L. D. Russell High-Resolution Light Microscopic Characterization of Mouse Spermatogonia Biol Reprod, October 1, 2001; 65(4): 1170 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H.G.J. Schrans-Stassen, P. T.K. Saunders, H. J. Cooke, and D. G. de Rooij Nature of the Spermatogenic Arrest in Dazl -/- Mice Biol Reprod, September 1, 2001; 65(3): 771 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhao, M. A.M. Taverne, G. C. van der Weijden, M. M. Bevers, and R. van den Hurk Effect of Activin A on In Vitro Development of Rat Preantral Follicles and Localization of Activin A and Activin Receptor II Biol Reprod, September 1, 2001; 65(3): 967 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shinohara, K. E. Orwig, M. R. Avarbock, and R. L. Brinster From the Cover: Spermatogonial stem cell enrichment by multiparameter selection of mouse testis cells PNAS, July 18, 2000; 97(15): 8346 - 8351. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |