help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schrans-Stassen, B. H. G. J.
Right arrow Articles by van Pelt, A. M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schrans-Stassen, B. H. G. J.
Right arrow Articles by van Pelt, A. M. M.
Endocrinology Vol. 140, No. 12 5894-5900
Copyright © 1999 by The Endocrine Society


ARTICLES

Differential Expression of c-kit in Mouse Undifferentiated and Differentiating Type A Spermatogonia

Bianca H. G. J. Schrans-Stassen, Henk J. G. van de Kant, Dirk G. de Rooij and Ans M. M. van Pelt

Department of Cell Biology, Medical School, University of Utrecht, Utrecht 3584 CX, The Netherlands

Address all correspondence and requests for reprints to: B. H. G. J. Schrans-Stassen, Department of Cell Biology, University Medical Center Utrecht, Heidelberglaan 100, AZU Room G02.525, 3584 CX Utrecht, The Netherlands. E-mail: B.H.G.J.SchransStassen{at}lab.azu.nl


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The proto-oncogene c-kit is encoded at the white-spotting locus and in the mouse mutations at this locus affect the precursor cells of melanocytes, hematopoietic cells, and germ cells. c-kit is expressed in type A spermatogonia, but whether or not c-kit is present both in undifferentiated and differentiating type A spermatogonia or only in the latter cell type is still a matter of debate. Using the vitamin A-deficient mouse model, we studied messenger RNA (mRNA) and protein expression in undifferentiated and differentiating type A spermatogonia. Furthermore, we quantified the immuno-positive type A spermatogonia in the epithelial stages VI, VII, IX/X, and XII in normal mice to correlate c-kit expression in type A spermatogonia with the differentiation of these cells. Our results show that in the VAD situation undifferentiated type A spermatogonia express little c-kit mRNA. The A spermatogonia with a larger nucleus expressed c-Kit protein, whereas the A spermatogonia with a smaller one did not. After induction of differentiation of these cells into type A1 spermatogonia, c-kit mRNA was enhanced. The percentage of A spermatogonia expressing c-Kit protein did not change during this process, suggesting that A spermatogonia, which are committed to differentiate express c-kit. Under normal circumstances in epithelial stage VI 16% ± 2% (mean ± SD), in VII 45% ± 15%, in IX/X 78% ± 14% and in XII 90% ± 1.9% of the type A spermatogonia were c-kit positive, suggesting that Aaligned spermatogonia gradually change from c-Kit negative to c-Kit positive cells before their differentiation into A1 spermatogonia. It is concluded that c-kit can be used as a marker for differentiation of undifferentiated into differentiating type A spermatogonia.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN THE RODENT testis, two subpopulations of type A spermatogonia have been described: undifferentiated (Aundiff) and differentiating type A spermatogonia (Adiff) (1, 2). The Aundiff spermatogonia consist of the so-called Asingle (As), Apaired (Apr) and Aaligned (Aal) spermatogonia. Each epithelial cycle the Aundiff spermatogonia proliferate, forming large numbers of Aal spermatogonia that, in epithelial stages VII–VIII, differentiate without division into the first generation of differentiating spermatogonia, the type A1 spermatogonia. The A1 spermatogonia start a series of mitotic divisions generating type A2, A3, A4, In and B spermatogonia and ultimately primary spermatocytes. The differentiating type A1–4 spermatogonia are present during epithelial stages VIII until I, whereas the Aundiff spermatogonia are present throughout the epithelial cycle (3, 4).

The proto-oncogene c-kit is encoded at the white spotting locus (W) and mice with mutations at this locus are deficient in generating melanocytes, hematopoietic cells and germ cells (5, 6, 7). The presence of c-kit messenger RNA (mRNA) has been described in Adiff, Intermediate and type B spermatogonia (8, 9, 10), but it was not established whether it was also present in Aundiff. The importance of the c-kit receptor for spermatogenesis was underlined by experiments in which the c-kit antibody ACK2 was injected into adult male mice. This injection caused a depletion of Adiff spermatogonia, whereas Aundiff spermatogonia were unaffected (11, 12), suggesting that Aundiff spermatogonia do not express the c-kit receptor or that in these cells c-kit does not have a vital role. In contrast, Morena et al. (13) reported the presence of the c-Kit protein in a purified population of type A spermatogonia isolated from prepubertal rat testis. Large as well as small cells were found to be positive for c-Kit protein, and it was suggested that both Aundiff and Adiff spermatogonia express this receptor, assuming that these cell types are small and large, respectively. However, cell size is a less reliable parameter to distinguish isolated spermatogonial cell types because the size of the Aundiff spermatogonia varies greatly during the traversal of the cell cycle (14). Nevertheless, cell size can be used to study cell development in sections to compare specific cell types. For example, Kluin et al. (15) showed an increasing nuclear size of Aundiff spermatogonia in epithelial stages IV to VII, during their proliferation arrest. Dym et al. (10) also found immunohistochemical staining for c-kit in isolated A spermatogonia from prepubertal rat testes, but did not specify whether or not all these cells were c-kit positive.

The question whether or not c-kit is present in Aundiff and Adiff spermatogonia is important, because if it is only present in Adiff, Intermediate and B spermatogonia it would provide a differentiation marker, facilitating studies into the regulation of the differentiation of Aundiff spermatogonia. To answer this question we now have studied the presence of the c-kit mRNA and protein in Aundiff and Adiff spermatogonia. The well characterized vitamin A-deficient model was used to isolate Aundiff and Adiff spermatogonia (16). Vitamin A is essential for the maintenance of spermatogenesis and in vitamin A-deficient rat and mouse testes, type A spermatogonia are virtually the only germ cells that remain (17, 18, 19, 20). The remaining type A spermatogonia in VAD animals were found to be Aundiff spermatogonia arrested just before their differentiation into type A1 spermatogonia, which in the normal situation occurs in epithelial stages late VII to early VIII (17, 21, 22). In rats and mice, administration of various retinoids leads to a reinitiation of spermatogenesis in a synchronized manner, resulting in the formation of type A1 spermatogonia (17, 18, 22, 23, 24, 25, 26). c-kit mRNA expression was studied in this model in purified Aundiff and Adiff spermatogonia, using RT-PCR and in situ hybridization. Furthermore, the c-Kit protein was localized by immunohistochemistry in testes of VAD mice before and after all-trans-retinoic acid treatment and in normal mice. The results clearly indicate differences in c-kit mRNA and protein expression between Aundiff and Adiff spermatogonia.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and treatment
Breeding pairs of Nc/Cpb-U mice (Central Laboratory Animal Institute, University of Utrecht, Utrecht, The Netherlands) were fed a vitamin A-deficient diet (Teklad Trucking, Madison, WI) for at least 4 weeks. Male weanlings received the same diet until they became vitamin A-deficient. At the age of 14–16 weeks, their body weight slightly decreased and the animals began to show outer signals of deficiency (squinting eyes, upstanding hair). At this stage, animals were used for experiments (VAD animals). Some were given an ip injection of 1 mg all-trans-retinoic acid in 16% DMSO (both from Sigma, St. Louis, MO). Twenty-four hours after treatment, animals were killed, and the testes were removed. The animal experimentation was approved by the Ethical Committee for Animal Experimentation of the Medical School, University of Utrecht (Utrecht, The Netherlands).

Cell isolation
Type A spermatogonia were isolated as described by van Pelt et al. (16) with some modifications. Briefly, testes were decapsulated and tubules were teased apart. After the first enzymatic digestion in 1 mg/ml trypsin TRL, 1 mg/ml collagenase type 1 CLS-1 (both from Worthington, Freehold, NJ), 1 mg/ml hyaluronidase (Sigma) and DNase I (5 µg/ml) for 20 min at 32 C in a shaking water bath (60–80 cycles/minute) and a second enzymatic digestion in 1 mg/ml collagenase, 1 mg/ml hyaluronidase and DNase (5 µg/ml) for 40 min at 32 C, the cells were directly separated on a discontinuous Percoll gradient. Cells of fraction 3, 4, 5, and 6 were collected and cell identification was carried out as described (16). Cells of fractions with a purity of type A spermatogonia of 85% or higher were pelleted, resuspended in guanidium thiocyanate and stored at -80 C until further use. Several isolations were performed to render a total of approximately 700,000 cells per time point.

RT-PCR
Total RNA was isolated from pooled fractions of isolated type A spermatogonia from VAD mice and mice 24 h after retinoic acid treatment, using the guanidine thiocyanate method according to Chomc-zinsky and Sacchi (27). RNA was treated with RNase free DNase I (Roche Molecular Biochemicals, Mannheim, Germany) as described by Ausubel et al. (28). Complementary DNA (cDNA) was made of 500 ng total RNA using Superscript II reverse transcriptase (Life Technologies, Inc., Paisley, Scotland, UK). The reaction was performed as instructed by the manufacturer. The 3' primers used for the RT reaction were specific for c-kit (TCAACGACCTTCCCGAAGGCACCA (29) and ß-actin (GAAGCAATGCTGTCACCTTCCC (30). cDNA was purified using the QIAquick PCR purification kit (QIAGEN, Hilden, Germany) and eluted with 50 µl elution buffer. The PCR reaction was performed with 10 µl cDNA, 150 ng primer 3' and 5', 1.5 mM MgCl2, 0.2 M dNTPs, 1 x Goldstar reaction buffer and 2.5 U Goldstar Taq polymerase (Eurogentec, Seraing, Belgium) per reaction of 100 µl. The 5' primers for c-kit and ß-actin were CTGGTGGTTCAGAGTTCCATAGAC and GCGGACTGTTACTGAGCTGCGT, respectively (29, 30). ß -actin and c-kit PCR reactions were performed in two separate PCR tubes. The predicted sizes of the reaction products were 450 bp for ß-actin and 385 bp for c-kit. Amplification was performed with a Techne Dri-Block cycler (Techne Ltd., Cambridge, UK) as follows: 38 cycles, 95 C, 45 sec; 60 C, 45 sec; 72 C, 30 sec. The amplified products were analyzed on an ethidium bromide agarose gel. RT-PCR experiments were performed three times independently from each other.

Probe preparation
Riboprobes used for in situ hybridization were derived from a cDNA clone in pBluescriptIIKS, containing a fragment of 276 bp, starting 30 bp upstream from the initiator ATG of the murine kit cDNA, which was a generous gift of Dr. P. Lonai (The Weizmann Institute of Science, Israel). After linearization with SacI and BamHI, DIG-labeled antisense and sense riboprobes were made using the DIG RNA labeling kit with T3 and T7 RNA polymerase, respectively (all reagents from Roche Molecular Biochemicals). After labeling, probe length was reduced by alkaline hydrolysis and the amount of labeled probe was determined by comparison to a DIG-labeled RNA standard (Roche Molecular Biochemicals).

In situ hybridization
Testes were fixed overnight in 4% paraformaldehyde in PBS at 4 C and embedded in paraffin (Stemcowax, Adamas Instruments BV., Amerongen, The Netherlands). Five-micrometer sections were mounted on 3-aminopropyl triethoxysilane (TESPA, Sigma)-coated slides and dried overnight at 37 C. Sections were pretreated as described by Wilkinson and Green (31). Hybridization was carried out at 55 C for approximately 42 h with a probe concentration of 1 ng/µl and slides were washed under high stringency (31). After performing the final washing step at room temperature, the hybridized DIG-labeled probes were detected using immunohistochemistry. Slides were washed once in PBS and endogenous peroxidase activity was blocked with a 10 min incubation in 0.35% H2O2 (Merck, Darmstadt, Germany) in PBS. After washing twice in PBS, slides were washed once in 0.1 M Tris-HCl (Fluka Chemie AG, Buchs, Switzerland), 0.15 M NaCl (Merck, Darmstadt, Germany), pH 7.6 (TN) buffer. Sections were blocked in 10% normal horse serum (Vector Laboratories, Inc., Burlingame, CA) in TN buffer for one hour to reduce background signal. After removal of the cover slips, slides were incubated overnight at 4 C in a moist chamber with the monoclonal antibody mouse anti-DIG (1:200, Roche Molecular Biochemicals) in 10% horse serum/TN buffer. After washing with TN buffer, containing 0.2% Tween (Merck; TNT buffer) and TN buffer, respectively, sections were incubated with biotinylated antimouse IgG (1:200; ABC-peroxidase staining kit, Vector Laboratories, Inc.) in 10% horse serum/TN buffer for 1 h at room temperature. The avidin-biotin complex was prepared as described by the manufacturer (Vector Laboratories, Inc.) and incubation took place for 1 h at room temperature. After washing once in TNT buffer, twice in TN and finally in 0.05 M Tris-HCl, pH 7.6, 0.3 M NaCl and 0.2% Tween, signal was visualized using 3,3'-diaminobenzidine tetrahydrochloride 0.5 mg/ml (DAB; DAKO Corp., Carpenteria, CA) in 0.05 M Tris-HCl pH 7.6, 0.01% H2O2. Sections were counter stained with Mayer’s hematoxylin (Sigma), then washed in aquadest and tap water, respectively. Slides were mounted with Pertex (Cellpath Ltd., Hemel Hempstead, UK). Experiments were performed at least four times, using four different animals per time point.

Immunohistochemistry
The antibodies ACK2 (rat monoclonal IgG 2B, Life Technologies, Inc., Breda, The Netherlands), C-19 and M-14 (rabbit polyclonal IgG and goat polyclonal IgG, respectively, both form Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were tested for their immunoreactivity for c-Kit protein and they all showed the same staining pattern. However, M-14 turned out to give the clearest signal, and this antibody was used in further experiments. Three different badges of c-kit M14 antibody, purified by the manufacturer according standardized protocol, were used. These badges were from different lot numbers and different bleedings.

Testes of four different animals per time point were fixed overnight in Bouin’s fluid at room temperature and embedded in paraffin. Five-micrometer sections were mounted on TESPA coated slides and dried overnight at 37 C. The next day, slides were dewaxed with an extra long step in 70% ethanol to decrease the amount of picric acid in the sections. After washing in aquadest and PBS, respectively, sections were blocked for 30 min in 5% rabbit serum (Aurion ImmunoGold Reagents & Accessories, Wageningen, The Netherlands), 5% BSA fraction V in PBS. After a short wash with 0.05% acetylated BSA (BSA-c; Aurion, Wageningen, The Netherlands) sections were incubated overnight at room temperature in a moist chamber with c-kit antibody M14 (1:100; sc-1494, Santa Cruz Biotechnology, Inc.) in 0.05% BSA-c/5% rabbit serum/PBS. The next day, slides were washed with 0.05% BSA-c in PBS for one hour and then incubated with biotinylated rabbit antigoat (1:100; Aurion, Wageningen, The Netherlands) in 0.05% BSA-c/5% rabbit serum/PBS for 1 h at room temperature. Sections were washed briefly in BSA-c and PBS. Endogenous peroxidase activity was blocked with 0.35% H2O2 in PBS for 15 min after which sections were incubated at room temperature with the avidin-biotin complex (Vector Laboratories, Inc.), prepared as described by the manufacturer. After washing three times with PBS, sections were washed twice for 10 min in 0.05 M Tris-HCl pH 7.6, 0.3 M NaCl and 0.1% Tween. Signal was visualized and staining was performed as described above in the in situ hybridization protocol. As a negative control a similar immunohistochemical reaction was performed in which the antibody was blocked with a c-Kit blocking peptide (1:100; sc-1494P, Santa Cruz Biotechnology, Inc.).

Cell counts
Immunohistochemically stained and unstained type A spermatogonia were counted in stages VI, VII, IX/X, and in XII in testes of four normal adult mice. In each of these stages minimal 50 type A spermatogonia were studied for c-kit staining. Cell counts of stained and unstained type A spermatogonia were also performed in testes of four VAD and retinoic acid treated mice. Per testis, 400 type A spermatogonia were counted. In four VAD animals, the size of the nucleus of 60 stained and 60 unstained type A spermatogonia was determined.

Statistics
In case of the stage dependency data, the Friedman test was used to determine the variance, and the multiple comparisons test was used to define the significance of the differences. For evaluation of the nuclear size data, the Wilcoxon test was used.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell isolation
In our VAD model protocol, mice showing the outer signs of vitamin A-deficiency invariably had small, shrunken testes. When sections of such testes were studied microscopically besides Sertoli cells, only A spermatogonia were observed (Fig. 2Go, A, B, and E).



View larger version (142K):
[in this window]
[in a new window]
 
Figure 2. In situ hybridization and immunolocalization of c-kit mRNA and protein, respectively. Expression of c-kit mRNA in testes of VAD mice detected with antisense (A) and sense (B) c-kit probe. The expression pattern of c-kit mRNA in testes of mice treated with retinoic acid are presented in C (antisense) and D (sense), respectively. Immunolocalization of c-Kit protein was studied in testes of VAD (E), 1 mg retinoic acid treated (F and H) and normal (G) mice. A protein block was used as a negative control (H). Type A spermatogonia are indicated by arrowheads, Sertoli cells by asterisks and Leydig cells by arrows. Epithelial stages in normal testis (G) is indicated in Roman numbers. Bar, 25 µm.

 
The average yield of type A spermatogonia isolated from testes of VAD and retinoic acid treated mice was 2.5 x 104 cells/testis. Multiple cell isolations yielded about 7.4 x 105 Aundiff and 8.2 x 105 Adiff spermatogonia with purities of 86% ± 3% (mean ± SD) and 88% ± 3%, respectively. In the purified cell factions, A spermatogonia were the only germ cells present, whereas the contaminating cells were mostly Sertoli cells, peritubular cells, and also some Leydig cells. The amount of total RNA isolated was 0.97 ± 0.3 µg from the Aundiff and 2.8 ± 0.4 µg from the Adiff spermatogonia.

RT-PCR
To determine a possible difference between c-kit mRNA expression in Aundiff and Adiff spermatogonia, expression of c-kit mRNA was studied in a semiquantative way, using ß-actin mRNA as an internal standard. From both cell types, 500 ng total RNA was used for the performance of a RT-PCR reaction. Hardly any signal could be detected in Aundiff spermatogonia whereas in Adiff spermatogonia a strong signal was observed (Fig. 1Go).



View larger version (102K):
[in this window]
[in a new window]
 
Figure 1. RT-PCR analysis of Aundiff and Adiff spermatogonia. Aundiff c-kit = RT-PCR performed on Aundiff with c-kit primers. Aundiff ß-actin = RT-PCR performed on Aundiff with ß-actin primers. Adiff c-kit = RT-PCR performed on Adiff with c-kit primers. Adiff ß-actin = RT-PCR performed on Adiff with ß-actin primers. RNA Adiff c-kit = PCR performed on RNA of Adiff with c-kit primers. Adiff ß-actin = PCR performed on RNA of Adiff with ß-actin primers. Biozym low ladder; 1000, 900, 800, 700, 600, 500, 450, 400, 350, 300, 250 bp.

 
In situ hybridization
To localize the c-kit mRNA, in situ hybridizations were performed. In the VAD testis, hybridization with the c-kit antisense probe was found only in Leydig cells, no hybridization being present in Aundiff spermatogonia and Sertoli cells (Fig. 2AGo). Using the antisense probe, in testes 24 h after administration of retinoic acid, a clear signal was seen in type A spermatogonia and Leydig cells. No staining was detectable in Sertoli cells (Fig. 2CGo).

Staining was absent in the adjacent sections hybridized with the sense probe, except for some background in Leydig cells (Fig. 2BGo and 2DGo).

Immunohistochemistry
To determine whether the transcripts were actually translated into protein, immunohistochemical experiments were performed. In the VAD situation, staining for c-Kit protein was clearly seen in Leydig cells and weakly in Sertoli cells (Fig. 2EGo). The staining in Sertoli cells seemed restricted to round structures in the cytoplasm. The A spermatogonia present in the VAD testis showed variable immunoreactivity (Fig. 2EGo). Three different batches of c-kit antibody were used. With two of the batches staining of A spermatogonia was weak, whereas some A spermatogonia showed no immunoreactivity. With one batch, most of the A spermatogonia were clearly stained, and this badge was used for the photomicrographs and in stage-dependency studies. In the VAD testes, cell counts were performed and 82% ± 4% (mean ± SD; range 80–88%) of the A spermatogonia were stained (Fig 3AGo). In addition, there was a difference in morphology between the staining and nonstaining A spermatogonia. The nuclei of the staining cells were generally larger than the nonstaining ones, 9.7 ± 0.7 µm (mean ± SD) and 7.6 ± 0.2 µm, respectively (Fig. 3BGo). Twenty-four hours after administration of retinoic acid, a clear staining was seen with all three batches of c-kit antibody (Fig. 2FGo). The percentage of stained A spermatogonia appeared to be similar as in VAD animals, namely 86% ± 3% (Fig. 3AGo; range 83–88%). In both cases, also clusters of A spermatogonia were seen. In the testes of VAD as well as of retinoic acid-treated animals, these clusters always stained for c-kit.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 3. A, Percentage of stained and unstained type A spermatogonia in testis of VAD and retinoic acid treated animals (mean ± SD; n = 4) and (B) the size of the nucleus of stained and unstained A spermatogonia in testis of VAD animals in micometres (mean ± SD; n = 4; P = 0.068).

 
In the normal testis, the staining of type A spermatogonia appeared to depend on the epithelial stage. In stages IX–I, A spermatogonia generally stained positive, whereas staining A spermatogonia were less numerous in stages II–VII (Fig. 2GGo). Besides type A spermatogonia also Intermediate and B spermatogonia stained positive for c-kit. The staining of the latter spermatogonia was more intense than that of the A spermatogonia in stages VIII–I. Staining was seen until leptotene spermatocytes.

To check the specificity of the signal, immunohistochemical experiments were performed in which the antibody was blocked with the c-Kit peptide. In this situation, no staining was observed in testes of normal, VAD, or retinoic acid-treated mice (Fig. 2HGo).

To quantify the stage dependency of the staining of Aundiff and Adiff spermatogonia for c-kit, unstained and stained type A spermatogonia in stages VI, VII, IX/X, and in XII were counted. A clear difference was found in staining of type A spermatogonia in the different stages (Fig. 4Go). The percentage of stained type A spermatogonia was low in stage VI [16% ± 2%; (mean ± SD; range 12–18%)], whereas in stage VII the percentage of stained type A spermatogonia was increased (45% ± 15%; range 29–63%). The highest percentage of stained type A spermatogonia was seen in stages IX/X (78% ± 14%; range 53–89%) and XII (90% ± 1.9%; range 87–92%).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 4. Amount of stained type A spermatogonia in stages VI, VII, IX/X, and XII. Four animals were studied and per animal 50 type A spermatogonia in the corresponding epithelial stages were counted (mean ± SD; n = 4). *, Significantly different from stage VI (P < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present results, obtained by using RT-PCR, in situ hybridization and immunohistochemical techniques, indicate that there is little expression of the c-kit mRNA and protein in Aundiff spermatogonia. However, c-kit expression is clearly enhanced upon differentiation of these cells into type A1 spermatogonia.

The type A spermatogonia present in the VAD testis are Aundiff spermatogonia, apparently unable to differentiate into type A1 spermatogonia (22), and these cells are comparable to the A spermatogonia present in epithelial stages late VII and early VIII (17). Our RT-PCR and in situ hybridization experiments revealed that these Aundiff spermatogonia hardly express c-kit mRNA. Administration of retinoic acid to VAD mice induces differentiation of the A spermatogonia and this appeared to correlate with a clear enhancement of c-kit mRNA expression. The immunohistochemical results of the c-Kit antibody were variable. In the VAD testis, most A spermatogonia were weakly stained with two batches of the antibody, whereas a clear staining of these cells was found after induction of differentiation with retinoic acid. However, with one batch of antibody most A spermatogonia in the VAD testis also clearly stained for c-Kit. In view of the mRNA data, the most likely conclusion is that most A spermatogonia in the VAD testis express low levels of the c-kit receptor and that the expression of this protein is enhanced upon differentiation into A1 spermatogonia. Interestingly, about 17% of the A spermatogonia did not stain for c-Kit. Moreover, c-kit positive cells were often seen in groups, whereas groups of unstained cells were never seen. This suggests that especially the Aal spermatogonia present the c-kit receptor. Therefore we hypothesize that in the VAD situation the Aal spermatogonia, which are ready to differentiate into A1 spermatogonia, already express some c-kit receptor and that the unstained A spermatogonia are most likely the remaining undifferentiated A spermatogonia, i.e. As, Apr and possibly some Aal. After administration of retinoic acid the percentage of the stained and unstained A spermatogonia did not change. Apparently, retinoic acid did not induce c-Kit expression in the remaining c-Kit negative undifferentiated spermatogonia, which was to be expected because a population of undifferentiated spermatogonia is required to ensure long-term spermatogenesis as seen after vitamin A replacement in VAD animals. It is unlikely that c-kit expression is directly regulated by retinoic acid as no retinoic acid responsive element has been found in the promoter region of the c-kit gene (32). In accordance with this, the expression of the c-Kit protein in the Leydig cells of VAD animals was similar to that seen in retinoic acid treated and normal mouse testis.

In the normal seminiferous epithelium, the Aundiff spermatogonia proliferate from epithelial stage X until about stage III, during which they produce many Aal spermatogonia (33). Subsequently, there is a proliferation arrest until stage VIII, during which the numbers of As, Apr and Aal do hardly change. Our cell counts revealed low numbers of c-kit positive cells (about 16%) in epithelial stage VI, increasing thereafter to high percentages in stages X and XII. This suggests that Aal spermatogonia gradually develop from c-kit negative to c-kit positive cells near the end of the period of proliferation arrest. Then, in stage VIII the Aal spermatogonia differentiate into A1 spermatogonia and enter S phase. During stages IX/X and stage XII, c-kit negative A spermatogonia persist to be present which may well be the remaining Aundiff spermatogonia in these stages, consisting of As, Apr and a few Aal (3).

In view of the results both in VAD and normal mice, we hypothesize that spermatogonial stem cells (As) and Apr spermatogonia are c-kit negative. The Aal spermatogonia are also c-kit negative until during their period of proliferation arrest, at which time they prepare themselves to differentiate into A1 spermatogonia. Then they gradually accumulate some c-kit receptor and our results indicate that this process starts at about stage VI in the normal epithelium. In the VAD testis, the remaining population of A spermatogonia is comparable to that in stages VII-VIII in the normal epithelium (17), and indeed c-kit positive groups of Aal spermatogonia were observed. The induction of c-kit may already be a differentiation step or just a reversible permissive step allowing irreversible differentiation into A1 spermatogonia. As vitamin A-induced differentiation is necessary for the c-kit positive spermatogonia in the VAD testis to develop the compulsory proliferation pattern, characteristic of the differentiating spermatogonia, the latter possibility seems the most likely one.

In the VAD testes, a difference was noticed in the size of the c-Kit positive and negative A spermatogonia, the c-Kit positive cells being larger. Also, the cells in groups of A spermatogonia, being Aal spermatogonia, were always large, whereas the single cells in the sections, being either As, Apr or Aal, were often small. This suggests that in the VAD testis, the Aal spermatogonia are larger than the As and Apr spermatogonia. Probably, besides acquiring the c-kit receptor, the Aal spermatogonia also grow in size during their preparation for differentiation. This is compatible with data from Kluin et al. (15) who determined the nuclear size of mouse undifferentiated spermatogonia during epithelial stages IV to VII, being mostly Aal spermatogonia, and found an increase in nuclear size.

Orth et al. (34) studied c-kit expression in neonatal rat gonocytes, the progenitor cells of A spermatogonia. Nonmigrating gonocytes that were c-kit negative were detected, and it was suggested that these gonocytes represented a c-kit-independent subpopulation of developing germ cells. Our current data show a subpopulation of c-kit negative A spermatogonia also being present in the adult testis. In contrast, Morena et al. (35) found all type A spermatogonia to be c-kit positive after isolation of A spermatogonia from 9- day-old rats. However, among a mixture of numerous differentiating type A spermatogonia, also present at that age, the c-kit negative Aundiff spermatogonia may have been too rare to detect.

Dym et al. (10) did not specifically mention the presence or absence of c-kit negative A spermatogonia in cells purified from 9-day-old rats. However, these authors concluded that A1-A4 spermatogonia are c-kit positive and left open the possibility that the so-called A0 spermatogonia are c-kit negative. In the "A1 model" of spermatogonial multiplication and stem cell renewal, A1-A4 are the stem cells and the A0 spermatogonia are equivalent to the As and Apr spermatogonia of the "As model" (36). Explaining the present results in according to the "A1 model" we would have to conclude that the A1 daughter cells of the c-kit positive A4 spermatogonia at first do not express the c-kit receptor, in contrast to their In sisters, but acquire this only several epithelial stages later.

In accordance with results from other groups (7), we observed a strong expression of c-kit mRNA and protein in Leydig cells in testes of normal, VAD, and retinoic acid-treated animals. We also detected some immunohistochemical staining for c-kit in Sertoli cells in testes of VAD and retinoic acid-treated animals. However, mRNA of c-kit was not processed in Sertoli cells of the VAD testis, as no signal was seen with in situ hybridization, so in these cells no c-Kit protein can be formed. The staining of Sertoli cells in the VAD testis could be a vitamin A-deficiency effect. The degenerating germ cells in the VAD testis have to be removed from the tubules, and degenerating cells are phagocytized by Sertoli cells, both in vivo (37) and in vitro (38). As the degenerating cells express c-Kit protein at a high level, this could cause the signal seen in Sertoli cells.

In conclusion, in both the VAD model and in the normal situation, the only undifferentiated A spermatogonia that express c-Kit are those Aal spermatogonia that are committed to differentiate into type A1 spermatogonia. In the normal situation, this expression already starts at stage VI and gradually increases in stages VII, IX/X, and XII. Therefore c-kit may be used as a differentiation marker for the differentiation of Aal into A1 spermatogonia. As and Apr spermatogonia are very likely c-kit negative. Interestingly, a striking parallel can be seen with hematopoiesis in which the pluripotent stem cells are c-kit<low (39).


    Acknowledgments
 
Thanks to Mr. R. Scriwanek and Mr. T. van Rijn for preparing the photographs.

Received May 7, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Huckins C 1971 The spermatogonial stem cell population in adult rats. I. Their morphology, proliferation and maturation. Anat Rec 169:533–557[CrossRef][Medline]
  2. Oakberg EF 1971 Spermatogonial stem-cell renewal in the mouse. Anat Rec 169:515–531[CrossRef][Medline]
  3. de Rooij DG 1998 Stem cells in the testis. Int J Exp Pathol 79:67–80[CrossRef][Medline]
  4. de Rooij DG, Grootegoed JA 1998 Spermatogonial stem cells. Curr Opin Cell Biol 10:694–701[CrossRef][Medline]
  5. Sawada K, Sakamaki K, Nishimune Y 1991 Effect of the W mutation, for white belly spot, on testicular germ cell differentiation in mice. J Reprod Fertil 93:287–294[Abstract]
  6. Koshimizu U, Sawada K, Tajima Y, Watanabe D, Nishimune Y 1991 White-spotting mutations affect the regenerative differentiation of testicular germ cells: demonstration by experimental cryptorchidism and its surgical reversal. Biol Reprod 45:642–648[Abstract]
  7. Loveland KL, Schlatt S 1997 Stem cell factor and c-kit in the mammalian testis: lessons originating from Mother Nature’s gene knockouts. J Endocrinol 153:337–344[Abstract]
  8. Manova K, Nocka K, Besmer P, Bachvarova RF 1990 Gonadal expression of c-kit encoded at the W locus of the mouse. Development 110:1057–1069[Abstract/Free Full Text]
  9. Sorrentino V, Giorgi M, Geremia R, Besmer P, Rossi P 1991 Expression of the c-kit proto-oncogene in the murine male germ cells. Oncogene 6:149–151[Medline]
  10. Dym M, Jia MC, Dirami G, Price JM, Rabin SJ, Mocchetti I, Ravindranath N 1995 Expression of c-kit receptor and its autophosphorylation in immature rat type A spermatogonia. Biol Reprod 52:8–19[Abstract]
  11. Yoshinaga K, Nishikawa S, Ogawa M, Hayashi S, Kunisada T, Fujimoto T 1991 Role of c-kit in mouse spermatogenesis: identification of spermatogonia as a specific site of c-kit expression and function. Development 113:689–699[Abstract]
  12. Packer AI, Besmer P, Bachvarova RF 1995 Kit ligand mediates survival of type A spermatogonia and dividing spermatocytes in postnatal mouse testes. Mol Reprod Dev 42:303–310[CrossRef][Medline]
  13. Morena AR, Boitani C, Pesce M, De Felici M, Stefanini M 1996 Isolation of highly purified type A spermatogonia from prepubertal rat testis. J Androl 17:708–717[Abstract/Free Full Text]
  14. Lok D, Weenk D, de Rooij DG 1982 Morphology, proliferation, and differentiation of undifferentiated spermatogonia in the Chinese hamster and the ram. Anat Rec 203:83–99[CrossRef][Medline]
  15. Kluin PM, de Rooij DG 1981 A comparison between the morphology and cell kinetics of gonocytes and adult type undifferentiated spermatogonia in the mouse. Int J Androl 4:475–493[Medline]
  16. van Pelt AM, Morena AR, van Dissel-Emiliani FM, Boitani C, Gaemers IC, de Rooij DG, Stefanini M 1996 Isolation of the synchronized A spermatogonia from adult vitamin A-deficient rat testes. Biol Reprod 55:439–444[Abstract]
  17. van Pelt AM, de Rooij DG 1990 The origin of the synchronization of the seminiferous epithelium in vitamin A-deficient rats after vitamin A replacement. Biol Reprod 42:677–682[Abstract]
  18. van Pelt AM, de Rooij DG 1990 Synchronization of the seminiferous epithelium after vitamin A replacement in vitamin A-deficient mice. Biol Reprod 43:363–367[Abstract]
  19. Mitranond V, Sobhon P, Tosukhowong P, Chindaduangrat W 1979 Cytological changes in the testes of vitamin-A-deficient rats. I. Quantitation of germinal cells in the seminiferous tubules. Acta Anat (Basel) 103:159–168[Medline]
  20. Unni E, Rao MR, Ganguly J 1983 Histological and ultrastructural studies on the effect of vitamin A depletion and subsequent repletion with vitamin A on germ cells and Sertoli cells in rat testis. Indian J Exp Biol 21:180–192[Medline]
  21. de Rooij DG, van Pelt AMM, van de Kant HJG, van der Saag PT, Peters AHFM, Heyting C, Boer P 1994 Role of retinoids in spermatogonial proliferation and differentiation and the meiotic prophase. In: Bartke A (ed). Function of Somatic Cells in the Testis. Springer Verlag, New York, pp 345–361
  22. van Pelt AM, van Dissel-Emiliani FM, Gaemers IC, van der Burg MJ, Tanke HJ, de Rooij DG 1995 Characteristics of A spermatogonia and preleptotene spermatocytes in the vitamin A-deficient rat testis. Biol Reprod 53:570–578[Abstract]
  23. Morales C, Griswold MD 1987 Retinol-induced stage synchronization in seminiferous tubules of the rat. Endocrinology 121:432–434[Abstract]
  24. van Pelt AM, de Rooij DG 1991 Retinoic acid is able to reinitiate spermatogenesis in vitamin A-deficient rats and high replicate doses support the full development of spermatogenic cells. Endocrinology 128:697–704[Abstract]
  25. Gaemers IC, van Pelt AM, van der Saag PT, de Rooij DG 1996 All-trans-4-oxo-retinoic acid: a potent inducer of in vivo proliferation of growth-arrested A spermatogonia in the vitamin A-deficient mouse testis. Endocrinology 137:479–485[Abstract]
  26. Huang HF, Hembree WC 1979 Spermatogenic response to vitamin A in vitamin A deficient rats. Biol Reprod 21:891–904[Abstract]
  27. Chomczinsky P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidium thiocyanatephenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  28. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K 1995 Current Protocols in Molecular Biology, vol 2. John Wiley, New York
  29. Rossi P, Dolci S, Albanesi C, Grimaldi P, Geremia R 1993 Direct evidence that the mouse sex determining gene Sry is expressed in the somatic cells of male fetal gonads and in the germ cell line in the adult testis. Mol Reprod Dev 34:369–373[CrossRef][Medline]
  30. Tokunaga K, Taniguchi H, Yoda K, Shimizu M, Sakiyama S 1986 Nucleotide sequence of a full-length cDNA for mouse cytoskeletal ß-actin mRNA. Nucleic Acids Res 14:2829[Free Full Text]
  31. Wilkinson DG, Green J 1990 In situ hybridization and the three-dimensional reconstruction of serial sections. In: Copp JJ, Cockroft DL (eds) Postimplantation Embryo’s: A Practical Approach. IRL Press, Oxford, pp 155–171
  32. Hayashi S, Kunisada T, Ogawa M, Nishikawa S 1995 Identification of the control regions for mouse c-kit gene transcription induced by retinoic acid. DNA Res 2:211–218[Abstract]
  33. van Beek ME, Davids JA, van de Kant HJ, de Rooij DG 1984 Response to fission neutron irradiation of spermatogonial stem cells in different stages of the cycle of the seminiferous epithelium. Radiat Res 97:556–569[CrossRef][Medline]
  34. Orth JM, Qiu J, Jester Jr WF, Pilder S 1997 Expression of the c-kit gene is critical for migration of neonatal rat gonocytes in vitro. Biol Reprod 57:676–683[Abstract]
  35. Morena AR, Boitani C, Stefanini M 1997 Morphological and histochemical characterization of type A spermatogonia isolated from prepubertal rat testis. In: Antonio Delfino (ed) Recent Advances in Microscopy of Cells, Tissue and Organs. Rome, Italy, pp 591–594
  36. Dym M, Clermont Y 1970 Role of spermatogonia in the repair of the seminiferous epithelium following x-irradiation of the rat testis. Am J Anat 128:265–282[CrossRef][Medline]
  37. Russell LD, Ettlin RA, Hikim APS, Clegg ED 1990 Histological and histopathological evaluation of the testis. Cache River Press, Clearwater, Fl
  38. Mizuno K, Shiratsuchi A, Masamune Y, Nakanashi Y 1996 The role of Sertoli cells in the differentiation and exclusion of rat testicular germ cells in primary culture. Cell Death Differ 3:119–123[Medline]
  39. Doi H, Inaba M, Yamamoto Y, Taketani S, Mori SI, Sugihara A, Ogata H, Toki J, Hisha H, Inaba K, Sogo S, Adachi M, Matsuda T, Good RA, Ikehara S 1997 Pluripotent hemopoietic stem cells are c-kit<low. Proc Natl Acad Sci USA 94:2513–2517[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ReproductionHome page
F. Izadyar, F. Pau, J. Marh, N. Slepko, T. Wang, R. Gonzalez, T. Ramos, K. Howerton, C. Sayre, and F. Silva
Generation of multipotent cell lines from a distinct population of male germ line stem cells
Reproduction, June 1, 2008; 135(6): 771 - 784.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. Hao, M. Yamamoto, T. E. Richardson, K. M. Chapman, B. S. Denard, R. E. Hammer, G. Q. Zhao, and F. K. Hamra
Sohlh2 Knockout Mice Are Male-Sterile Because of Degeneration of Differentiating Type A Spermatogonia
Stem Cells, June 1, 2008; 26(6): 1587 - 1597.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Q. Zhou, Y. Li, R. Nie, P. Friel, D. Mitchell, R. M. Evanoff, D. Pouchnik, B. Banasik, J. R. McCarrey, C. Small, et al.
Expression of Stimulated by Retinoic Acid Gene 8 (Stra8) and Maturation of Murine Gonocytes and Spermatogonia Induced by Retinoic Acid In Vitro
Biol Reprod, March 1, 2008; 78(3): 537 - 545.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Z. He, J. Jiang, M. Kokkinaki, N. Golestaneh, M.-C. Hofmann, and M. Dym
Gdnf Upregulates c-Fos Transcription via the Ras/Erk1/2 Pathway to Promote Mouse Spermatogonial Stem Cell Proliferation
Stem Cells, January 1, 2008; 26(1): 266 - 278.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Filipponi, R. M. Hobbs, S. Ottolenghi, P. Rossi, E. A. Jannini, P. P. Pandolfi, and S. Dolci
Repression of kit Expression by Plzf in Germ Cells
Mol. Cell. Biol., October 1, 2007; 27(19): 6770 - 6781.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Z. He, J. Jiang, M.-C. Hofmann, and M. Dym
Gfra1 Silencing in Mouse Spermatogonial Stem Cells Results in Their Differentiation Via the Inactivation of RET Tyrosine Kinase
Biol Reprod, October 1, 2007; 77(4): 723 - 733.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Zhongyi, P. Rantakari, T. Lamminen, J. Toppari, and M. Poutanen
Transgenic Male Mice Expressing Human Hydroxysteroid Dehydrogenase 2 Indicate a Role for the Enzyme Independent of Its Action on Sex Steroids
Endocrinology, August 1, 2007; 148(8): 3827 - 3836.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Goel, M. Sugimoto, N. Minami, M. Yamada, S. Kume, and H. Imai
Identification, Isolation, and In Vitro Culture of Porcine Gonocytes
Biol Reprod, July 1, 2007; 77(1): 127 - 137.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Tokuda, Y. Kadokawa, H. Kurahashi, and T. Marunouchi
CDH1 Is a Specific Marker for Undifferentiated Spermatogonia in Mouse Testes
Biol Reprod, January 1, 2007; 76(1): 130 - 141.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Yoshida, M. Sukeno, T. Nakagawa, K. Ohbo, G. Nagamatsu, T. Suda, and Y.-i. Nabeshima
The first round of mouse spermatogenesis is a distinctive program that lacks the self-renewing spermatogonia stage
Development, April 15, 2006; 133(8): 1495 - 1505.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
S. M. Prabhu, M. L Meistrich, E. A McLaughlin, S. D Roman, S. Warne, S. Mendis, C. Itman, and K. L. Loveland
Expression of c-Kit receptor mRNA and protein in the developing, adult and irradiated rodent testis.
Reproduction, March 1, 2006; 131(3): 489 - 499.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. Cherqui, S. M. Kurian, O. Schussler, J. A. Hewel, J. R. Yates III, and D. R. Salomon
Isolation and Angiogenesis by Endothelial Progenitors in the Fetal Liver
Stem Cells, January 1, 2006; 24(1): 44 - 54.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
H. Khaira, D. McLean, D. A. Ohl, and G. D. Smith
Spermatogonial Stem Cell Isolation, Storage, and Transplantation
J Androl, July 1, 2005; 26(4): 442 - 450.
[Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. Takayama, T. Mishima, M. Mori, H. Jin, H. Tsukamoto, K. Takahashi, T. Takizawa, K. Kinoshita, M. Suzuki, I. Sato, et al.
Sexually Dimorphic Expression of the Novel Germ Cell Antigen TEX101 During Mouse Gonad Development
Biol Reprod, June 1, 2005; 72(6): 1315 - 1323.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
N. Sofikitis, E. Pappas, A. Kawatani, D. Baltogiannis, D. Loutradis, N. Kanakas, D. Giannakis, F. Dimitriadis, K. Tsoukanelis, I. Georgiou, et al.
Efforts to create an artificial testis: culture systems of male germ cells under biochemical conditions resembling the seminiferous tubular biochemical environment
Hum. Reprod. Update, May 1, 2005; 11(3): 229 - 259.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
H.-B. Ruan, N. Zhang, and X. Gao
Identification of a Novel Point Mutation of Mouse Proto-Oncogene c-kit Through N-Ethyl-N-nitrosourea Mutagenesis
Genetics, February 1, 2005; 169(2): 819 - 831.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M.-C. Hofmann, L. Braydich-Stolle, L. Dettin, E. Johnson, and M. Dym
Immortalization of Mouse Germ Line Stem Cells
Stem Cells, February 1, 2005; 23(2): 200 - 210.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
O. Lacham-Kaplan
In vivo and in vitro differentiation of male germ cells in the mouse
Reproduction, August 1, 2004; 128(2): 147 - 152.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
M. A. Bedell and A. M. Zama
Genetic Analysis of Kit Ligand Functions During Mouse Spermatogenesis
J Androl, March 1, 2004; 25(2): 188 - 199.
[Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. Grimaldi, F. Capolunghi, R. Geremia, and P. Rossi
Cyclic Adenosine Monophosphate (cAMP) Stimulation of the Kit Ligand Promoter in Sertoli Cells Requires an Sp1-Binding Region, a Canonical TATA Box, and a cAMP-Induced Factor Binding to an Immediately Downstream GC-Rich Element
Biol Reprod, December 1, 2003; 69(6): 1979 - 1988.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Pellegrini, P. Grimaldi, P. Rossi, R. Geremia, and S. Dolci
Developmental expression of BMP4/ALK3/SMAD5 signaling pathway in the mouse testis: a potential role of BMP4 in spermatogonia differentiation
J. Cell Sci., August 15, 2003; 116(16): 3363 - 3372.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Kanatsu-Shinohara, N. Ogonuki, K. Inoue, H. Miki, A. Ogura, S. Toyokuni, and T. Shinohara
Long-Term Proliferation in Culture and Germline Transmission of Mouse Male Germline Stem Cells
Biol Reprod, August 1, 2003; 69(2): 612 - 616.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. van den Ham, F.M.F. van Dissel-Emiliani, and A.M.M. van Pelt
Expression of the Scaffolding Subunit A of Protein Phosphatase 2A During Rat Testicular Development
Biol Reprod, April 1, 2003; 68(4): 1369 - 1375.