Endocrinology Vol. 140, No. 12 5915-5921
Copyright © 1999 by The Endocrine Society
Selective Expression of Neuropeptides in the Rat Mammary Gland: Somatostatin Gene Is Expressed During Lactation1
Alon Chen,
Orly Laskar-Levy and
Yitzhak Koch
Department of Neurobiology, Weizmann Institute of Science, Rehovot
76100, Israel
Address all correspondence and requests for reprints to: Dr. Y. Koch, Department of Neurobiology, Weizmann Institute of Science, Rehovot 76100, Israel. E-mail: lhkoch{at}weizmann.weizmann.ac.il
 |
Abstract
|
|---|
The existence of numerous neuropeptides in milk, in concentrations that
exceed those in maternal plasma, is well established. It is still
unclear whether these neuropeptides are produced by the mammary gland
or that the gland concentrates them from the general circulation. In
this study, we have examined the possibility that the genes of these
neuropeptides are expressed in the rat mammary gland. RNA was extracted
from the mammary glands of female rats during different stages of
reproduction as well as from other tissues such as hypothalami,
pancreas, pineal glands, small intestine, and ovaries. Following RT
reaction, the resulting cDNA were amplified by radioactive PCR using
specific oligonucleotide primers. We have used specific primers for the
following neuropeptides: galanin, somatostatin, vasoactive intestinal
peptide, TRH, GH-releasing hormone, cholecystokinin, neurotensin,
oxytocin, and relaxin. We have also used primers for serotonin
N-acetyl-transferase, the enzyme that is involved in
melatonin biosynthesis. The ribosomal protein S-16 served as an
internal control. Among all the neuropeptides that have been examined,
somatostatin was the only one that was found to be expressed in the
mammary gland. Somatostatin was expressed in the mammary gland of
lactating rats, but not of virgin rats. Expression of the somatostatin
gene was confirmed by Southern blot analysis and by sequencing of the
PCR products. Immunohistochemical studies demonstrated somatostatin
immunoreactivity in the epithelial cells that compose the secretory
alveoli and in the secretory material. In addition, we have found that
the mammary glands of the lactating rat express the PC-1 proteinase
gene that process prosomatostatin to generate somatostatin-14, but do
not express furin, the enzyme that is responsible for somatostatin-28
production. This finding substantiates previous studies that
demonstrated that only somatostatin-14 is present in milk. The finding
that most of the neuropeptides, examined by RT-PCR, are not expressed
by the mammary gland suggest that these neuropeptides are actively
concentrated by the mammary glands from the general circulation. The
GnRH gene has been previously demonstrated to be expressed in the
mammary gland, and in this study somatostatin was the only neuropeptide
that was found to be produced by the mammary gland. The observation
that only a small portion of the neuropeptides that are present in milk
are being produced by the lactating mammary gland suggest that these
neuropepetides have important functions in the biology of the suckling
neonate and probably also in the development and function of the
breast.
 |
Introduction
|
|---|
THE PRESENCE of neuropeptides in the milk
of several species, in concentrations that exceed those in maternal
plasma, has been reported. GnRH and TRH were initially identified in
milk (1), and since then numerous other neuropeptides such as oxytocin
(2), neurotensin (3), vasoactive intestinal peptide (VIP) (4),
somatostatin (SOM)-14 (5, 6), GH-releasing hormone (GHRH) (6, 7),
cholecystokinin (CCK) (8), and melatonin (9) have been found to be
present in milk of several species. For reviews, see Refs. 10, 11, 12, 13 .
These findings imply that milk is not just a nutrient source but also a
carrier of substances that can play a role in the developmental
physiology of the neonate.
The high concentration of neuropeptides in milk can be a result of a
transport mechanism that concentrate the neuropeptides from the general
circulation of the lactating mother or by gene expression in the
mammary gland (MG) tissue itself. Recently our group have demonstrated
the expression of the GnRH gene in the MG of pregnant and lactating
rats (14).
In this study, we have used radioactive RT-PCR and Southern blot
hybridization procedures to study the possible expression of several
neuropeptides in the MG of rats at different physiological states. We
have found that only SOM, in addition to GnRH, is expressed in the MG
of the lactating rat.
 |
Materials and Methods
|
|---|
Animals
Three- to four-month-old Wistar-derived female rats were
maintained under controlled environmental conditions (air conditioned
quarters, ambient temperature of 22 C, illumination between 0500 and
1900 h, relative humidity 4555%). Food and water were offered
ad libitum.
RNA preparation
The hypothalami, pancreas, pineal glands, small intestine, and
ovaries served as control tissues and were obtained from virgin rats.
The mammary glands were collected from virgin rats, pregnant rats (6th
and 19th days), lactating rats (10 and 21 days) and postlactating (1
and 2 weeks) rats. The rats were decapitated and the relevant tissues
were immediately excised and RNA was extracted. Total RNA was extracted
using Trizol RNA isolation reagent (Molecular Research Center, Inc., Cincinnati, OH) based on the acid guanidinium
thiocyanate-phenol-chloroform extraction method, according to
manufacturers recommendations.
Radioactive RT-PCR analysis
The radioactive RT-PCR procedure was performed as described by
Orly et al. (15). The indicated amounts of total RNA
(1001000 ng) were reverse transcribed for 75 min at 42 C using 500 ng
polydeoxythymidine [(pd (T)]1218 primers (no. 277858,
Pharmacia & Upjohn, Piscataway, NJ), and 0.25 U AMV
reverse transcriptase (no. M510, Promega Corp., Madison,
WI) in a 20 µl reaction containing 1 x PCR buffer (no. M190,
Promega Corp., containing: 50 mM KCl; 10
mM Tris-HCl, pH 9; and 0.1% Triton X-100), 4
mM MgCl2, 1 mM deoxy-NTPs (no.
R0181 MBI Fermentas, Vilnius, Lithuania) and 20 U RNAguard ribonuclease
inhibitor (Pharmacia & Upjohn no. 270815). The RT
reaction was terminated by heating for 5 min at 95 C, and 10 µl
1 x PCR buffer containing the following reagents were added to
the same tube: 500 ng of the appropriate oligonucleotide primers
(5060 pmol), 2 µCi [
-32P] deoxy-CTP (3000
Ci/mmol), 2.5 U Taq DNA polymerase (no. M186A, Promega Corp.), as well as 500 ng oligonucleotide primers for the
ribosomal protein S-16 as an internal control. The internal control was
examined separately when the reaction conditions did not allow four
primers at the same reaction. The volume was brought to 100 µl by the
addition of 70 µl 1 x PCR buffer containing 2.5 mM
MgCl2. PCR was performed for 2035 cycles (Mastercycler
5330, Eppendorf, Hamburg, Germany) using a denaturing
temperature of 94 C (30 sec), an annealing temperature of 58-62 C (30
sec), and extension temperature of 72 C (1 min). Twenty microliters
from the PCR products were analyzed by electrophoresis on 5%
polyacrylamide gels in 0.5 x Tris-borate-EDTA buffer. The gels
were dried under vacuum and heated (1 h; 60 C), and the various
amplified PCR bands were quantified using a phosphorimager (445 SI,
Molecular Dynamics, Inc., Jersey City, NJ). The
radioactivity in each of the PCR bands was normalized to the
radioactivity of the S-16 band as an internal control. Gels were also
exposed to x-ray film (Fuji Photo Film Co., Ltd., Tokyo,
Japan) for 216 h at -80 C and developed in CURIX 60 processor (AGFA,
Germany).
Southern analysis
The PCR products were transferred to a nylon membrane (Nytran
0.45, Schleicher & Schuell, Inc., Dassel, Germany) in
20 x SSC solution overnight. The nylon was baked in a vacuum oven
at 80 C for 2 h. Prehybridization was performed in the presence of
6 x SSC, 5 x Denhardts solution, 5 mM EDTA
and 0.2 mg/ml Salmon sperm DNA for 3 h at 60 C. Overnight
hybridization was performed in the presence of a
32P-labeled probe, specific to the somatostatin cDNA. The
corresponding band can be seen after 1 h of exposure using a
phosphorimager.
Oligonucleotide primers
We used the following specific SOM oligonucleotide primers: 5'
GCCGCGCTCTGCATCGTCCTG 3' and 5' CAGCTCCAGCCTCATCTCGTC 3' corresponding
to nucleotides 131151 (sense) and 959979 (antisense), respectively
(16). The predicted size of band is 228 bp. The oligonucleotide probe
for hybridization was 5' CAGTTCTGCCAAGAAGTACTT 3', corresponding to
nucleotides 869889. For internal control, we used primers to the
ribosomal protein S-16 as described by Foley et al. (17).
The other sets of primers that were used in this study are presented in
Table 1
.
DNA sequencing
Nucleotide sequencing of the specific PCR bands were achieved by
automated direct DNA sequencing, according to manufacturers
recommendations (PE Applied Biosystems; model 377,
Perkin-Elmer Corp., Foster City, CA).
Tissue preparation for immunocytochemistry
Mammary tissue was collected from 10 days lactating rats and 5
days lactating mice. Small pieces (<5 mm3) were fixed
immediately in 10% buffered formalin for 12 h at room
temperature, and washed once in 70% ethanol. The tissues were then
processed for paraplast embedding and sectioning. Sections (4 µm)
were mounted on glass slides, deparaffinized, and rehydrated before
immunostaining.
Immunocytochemical staining
The sections were pretreated with 0.3% hydrogen peroxide for 15
min to reduce endogenous peroxidase activity. Following three washes
with PBS (0.1 M), the sections were incubated for 2 h
in a blocking medium (PBS containing 10% normal goat serum, 2% BSA,
1% glycin, 0.5% Triton X-100) to saturate nonspecific binding sites
for IgG. The sections were incubated with antisera to somatostatin
(1:2000) (6) or with nonimmune rabbit serum (overnight at 4 C), rinsed
well, and incubated with biotinylated goat antirabbit IgG (1:200
dilution) for 90 min followed by avidin-biotin-horseradish peroxidase
complex (ABC Vectastain, Vector Laboratories, Inc., Burlingame, CA) for an additional 90 min. After each step
the sections were rinsed three times in PBS (0.1 M). The
antibody-peroxidase complex was reacted with a mixture containing
diaminobenzidine (DAB, 0.5 mg/ml) and 0.01% hydrogen peroxide. The
sections were then rinsed and mounted with Permount (Entellan,
Merck, Darmstadt, Germany). To determine the specificity
of the signals we preabsorbed aliquots of the antibody with excess
(10100 µg) of SOM-14 for 24 h. Parallel sections were stained
with hematoxylin to demonstrate the morphological structure of the
tissues.
 |
Results
|
|---|
The radioactive PCR products derived from MG, hypothalami,
pancreas, pineal glands, ovaries, and small intestine were quantified
by a phosphorimager and normalized according to the radioactivity of
the S-16, control bands. The RT-PCR products for the neuropeptides GHRH
(Fig. 1A
), galanin (Fig. 1B
), neurotensin
(Fig. 1C
), relaxin (Fig. 1D
), as well as CCK, VIP, oxytocin, TRH, and
the enzyme N-acetyl-transferase (NAT) (data not shown) were
present only in the respective control tissues (hypothalami, ovaries or
pineal glands) but not in the MG at any of its developmental stages.
The expression of the internal control, the ribosomal protein S-16, was
demonstrated in all the tissues that were examined (Fig. 1
).

View larger version (66K):
[in this window]
[in a new window]
|
Figure 1. 32P-labeled RT-PCR analysis: amplified
cDNA fragments of (A) GHRH and S-16, (B) galanin and S-16, (C)
neurotensin and S-16, and (D) relaxin and S-16 from hypothalamus,
ovary, and MG of rats. Lanes: 1, MG from virgin rats; 2, MG from
pregnant rats (19th day); 3, MG from 10th day lactating rats; 4, MG
from 21st day lactating rats (day of weaning); 5, MG from 2 weeks
postweaning rats; 6, hypothalamus (ovary in panel D); 7, negative
control (without RNA).
|
|
The design of the primers was carried out by using the Oligo 4 program.
When possible, different exons for the sense and antisense primers were
chosen to avoid false positive results, caused by DNA contamination
(Fig. 2A
). Somatostatin was the only
neuropeptide that was expressed in the lactating MG In the initial
studies (500 ng of total RNA and 35 cycles of PCR), we found that the
low levels of SOM that were expressed at the late stages of pregnancy
were increased during lactation, declined at the end of the lactation
period and further declined one week after weaning (Fig. 2B
).
Quantitative RT-PCR assays were carried out in the linear phase of
amplification (Fig. 3A
) as described by
Hannon et al. (29). Amplified SOM fragments were calibrated
by using MG tissues that were obtained from rats on the 10th day of
lactation (500 ng of total RNA and 32 cycles of PCR). When this
protocol was performed (Fig. 3B
), a SOM fragment was observed in
preparations of MG tissues that were obtained from rats only during the
intense lactation period. Indeed, it has been demonstrated that during
early involution of the MG, at the late stages of lactation, the MG has
reverted to the pattern of messenger RNA (mRNA) metabolism that is
characteristic to the stage of late pregnancy (30). The RT-PCR products
derived from hypothalami, pancreas, and mammary glands of virgin,
pregnant, and lactating rats were also hybridized with a rat SOM
32P synthetic oligonucleotide probe. The predicted 228-bp
band was detected in the hypothalami, pancreas, and MG of lactating,
but not in the MG of virgin or pregnant rats (Fig. 3C
).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 2. A, Schematic representation of the SOM transcript
detected by RT-PCR analysis. SOM cDNA is shown with the introns
(lines), exons (squares), poly-A tail
(wavy line) and location of the PCR fragment
(full square). The length in bp of each PCR fragment,
introns and exons is indicated. B, 32P-labeled RT-PCR
analysis: amplified cDNA fragments of SOM. Samples of 500 ng of total
RNA were amplified for 35 cycles. Lanes: 1, MG from virgin rats; 2, MG
from pregnant rats (6th day); 3, MG from pregnant rats (19th day); 4,
MG from 10th day lactating rats; 5, MG from the day of weaning (21st
day of lactation); 6, MG from 7 days postweaning rats; 7, hypothalamus;
8, negative control (without RNA).
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Figure 3. A, Quantitative RT-PCR assay of SOM and S-16
transcripts obtained from ten days lactating MG Using 500 ng of the
total RNA, PCR was performed for increasing numbers of amplification
cycles, and the radioactive bands were quantified by a phosphorimager.
B, 32P-labeled RT-PCR analysis: amplified SOM and S-16 cDNA
fragments from hypothalamus and MG of rats. Lanes: 1, MG from virgin
rats; 2, MG from pregnant rats (19th day); 3, MG from 10th day
lactating rats; 4, MG from 21st day lactating rats (day of weaning); 5,
MG from 2 weeks postweaning rats; 6, hypothalamus; 7, negative control (without RNA). C, Southern blot hybridization of
amplified SOM cDNA fragments: Amplified SOM cDNA fragments from
hypothalamus, MG, and pancreas of rats were hybridized to a rat SOM
32P-labeled oligonucleotide probe. Lanes: 1, MG from virgin
rats; 2, MG from 6 day pregnant rats; 3, MG from 19 day pregnant rats;
4, MG from 10 day lactating rats; 5, hypothalamus; 6, pancreas; 7,
negative control (without cDNA). D, The nucleotide sequence of the
amplified lactating MG SOM cDNA. The 228-bp product is identical to
nucleotides 131238 (exon 1) and 860979 (exon 2) of hypothalamic SOM
(17 ). The location of the primers used in the RT-PCR reaction are
underlined.
|
|
The amplified product obtained from the MG of 10-day lactating rats was
eluted from the agarose gel, and the nucleotide sequence was
determined. This sequence was identical (Fig. 3D
) to that of the
hypothalamic SOM cDNA sequence (nucleotides 131238 (exon 1) and
860979 (exon 2)) (16).
The posttranslational processing of prosomatostatin by the serine
proteinases furin and PC-1 is known to generate the two forms of SOM,
SOM-28 and SOM-14, respectively (31). Because SOM-14, but not SOM-28,
is found in milk (5, 6), we have studied the expression of the two
enzymes in the rat MG Figure 4
demonstrates that furin is expressed in the small intestine but not in
the MG (upper panel), whereas PC-1 is expressed also in the
MG of lactating, but not of virgin, rats.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 4. Amplified furin (upper panel), PC-1
(middle panel), and S-16 (lower panel)
cDNA fragments from MG and small intestine, after 1.5% agarose gel
electrophoresis and ethidium bromide staining. Lanes: 1, MG from virgin
rats; 2, MG from 10 day lactating rats; 3, small intestine; 4, negative
control (without cDNA).
|
|
The immunocytochemical localization of SOM in the rats and mice mammary
gland shows intense staining for SOM throughout the epithelial cells
cytoplasm (Fig. 5B
), and in the secretory
material (Fig. 5C
). No immunoreactivity was observed using antibody
preabsorbed with excess of SOM-14, or nonimmune serum, emphasizing the
specificity of the signals.

View larger version (89K):
[in this window]
[in a new window]
|
Figure 5. The immunocytochemical localization of
somatostatin in the mammary glands of rat and mouse. All tissues were
incubated with antiserum to SOM, nonimmune serum, or antiserum
preabsorbed with somatostatin-14 peptide, for overnight at 4 C.
Parallel sections were stained with hematoxylin. A, The photomicrograph
shows a section obtained from 10 days lactating rat MG stained with
hematoxylin. Large clusters of secretory alveoli (sa) are surrounded by
connective tissue (x160). B, The mouse MG on day 5 of lactation shows
intense staining for somatostatin throughout the cytoplasm of the
epithelial cells. The immunoreactivity is indicated by black
arrows (x360). C, High power view of the secretory alveoli of
10 day lactating rat mammary gland. Some of the alveoli are packed with
secretory material (m) showing intense staining whereas other are empty
(e) (x500).
|
|
 |
Discussion
|
|---|
The presence of numerous neuropeptides in
mammalian milk and our recent finding that GnRH is expressed by the
pregnant and lactating MG raises the question concerning the origin of
the other neuropeptides that are present in milk. By using molecular
biology techniques, we examined the expression of seven neuropeptides
(GHRH, oxytocin, TRH, neurotensin, CCK, VIP, and SOM) that are known to
be present in the milk of several species (2, 3, 4, 5, 6, 7, 10, 11, 12, 13). In addition,
we have examined the expression of galanin, a neuropeptide that is
known to be colocalized with GnRH in the preoptic hypothalamic neurons
(32, 33), and of relaxin that plays a major role in MG biology (23, 34). The expression of melatonin in the MG was studied by measuring the
expression of serotonin NAT, a key enzyme in the biosynthesis of
melatonin (26).
Our studies have demonstrated that, apart from SOM (Figs. 2
and 3
), all
other neuropeptides are not expressed in the MG (Fig. 1
). The inability
of previous studies to demonstrate the presence of mRNA for SOM (35) is
probably due to the use of low sensitivity detection methodologies. For
positive control, we have studied the expression of GHRH, oxytocin,
TRH, CCK, VIP, SOM, galanin, and neurotensin in the hypothalamus. All
these peptides were found to be expressed in the hypothalamus. It is
important to note that Strbak et al. (36) has previously
examined the expression of TRH in the MG and concluded that it is not
originated from local synthesis in the MG. Of special interest is
relaxin, which is known for its important functions in the MG, and
which has been shown to be expressed in the MG of the guinea pig (37).
In our studies, relaxin mRNA could not be detected in the rat MG,
either by hybridization of the PCR cDNA products with a
32P-labeled relaxin probe (data not shown) or by
radioactive RT-PCR analysis (Fig. 1D
). In contrast, clear evidence for
the existence of relaxin mRNA were obtained in rat ovarian samples
(Fig. 1D
, lane 6). Similarly, no relaxin mRNA could be found in the
rabbit MG (38), and no relaxin immunostaining could be observed in the
rat MG (39). Thus, taken together, these results suggest that there are
species differences in the expression of relaxin in the MG and that
relaxin is expressed in the MG of the guinea pigs, only.
Somatostatin is probably the most widely distributed neuropeptide.
Neurons containing SOM are redundant in the hypothalamus and the limbic
system, whereas smaller amounts were found in the brain stem, spinal
cord, and throughout the cerebral cortex (40). SOM is secreted from
different parts of the gastrointestinal tract and from
cells of the
endocrine pancreas (41). SOM was first discovered in human and sheep
milk (5). We and others have found that SOM levels in milk are
severalfold higher than those present in maternal plasma (5, 42, 43).
It is established that SOM-28 is the predominant form of the
neurohormone in plasma (5, 44), whereas milk contains SOM-14 but not
SOM-28 (5, 6, 42). Therefore, the relative concentration of SOM-14 in
milk is even higher than that calculated by comparing the ratio of
total SOM concentration in milk vs. plasma.
The mammalian SOM precursor, prosomatostatin, is a 92-amino acid
protein that is processed posttranslationally by proteinases to produce
SOM-14 and SOM-28. The production of the two somatostatins is
independent of each other, and SOM-14 cannot be processed from SOM-28
(31). We have found (Fig. 4
) that PC-1, the protease that produces
SOM-14, is indeed expressed in the MG tissue of the lactating rat,
whereas the furin, which is responsible for the processing of SOM-28,
is not. These finding are compatible with previous findings (5, 6, 42)
that have reported the existence of SOM-14, but not of SOM-28, in milk.
The absence of SOM-28 in milk also support the notion that the active
transport of biological substances into milk is a selective process,
and therefore not every substance that occur in the general circulation
is collected by the MG
Rao et al. (45) have demonstrated that rat milk protects SOM
from degradation in the intestinal lumen of the suckling rat. The
SOM degrading activity in suckling pups was found to be significantly
lower than in weaning pups (46). SOM was also found to be more stable
in the duodenal lumen of suckling than of adult rat, and milk-peptidase
inhibitor apparently enhanced that stability (47). In previous studies,
we have determined that about 95% of the
125I[Tyr1]-SOM that remained in the stomach,
1 h after its oral administration to 10-day-old suckling animals,
had retained its original chromatographic behavior. In contrast, most
of the radioactivity that was recovered from plasma could be
attributed to degradation products (35). These results indicate that
SOM remains largely intact in the stomach of the suckling rat and can
be absorbed from the gastrointestinal tract in a biologically active
form.
The present findings demonstrate that SOM is produced by the MG tissue
only during a restricted period of time, during lactation. The
regulation of SOM gene expression in the MG, as well as the biological
activities of SOM that is synthesized by the MG, are still unknown. SOM
may exert its bioactivity on the suckling pups as well as on the MG
itself. Evidence for a possible physiological role for SOM and GnRH
were presented recently by Gama and Alvares (48), who reported that
GnRH and SOM have exerted inhibitory effects on cell proliferation of
the gastric epithelium in suckling rats. The fact that SOM and GnRH are
expressed in the MG of lactating rats may imply that regulatory
peptides produced by the breast can play a major role in the
developmental physiology of the neonate and/or on the growth and
differentiation of the MG itself. Furthermore, the fact that only two,
GnRH and SOM, out of ten neuropeptides that have been studied so far,
are expressed in the MG of the lactating rat, imply that the production
of neuropeptides by the MG is selective and suggests that these
neuropeptides may have important physiological roles that have still to
be elucidated. These results also imply that most of the peptides that
are present in milk are actively concentrated from the general
circulation.
Somatostatin, like GnRH, is also synthesized by the human placenta (49, 50). Thus the placenta and the breast seem to serve as complementary
organs by which the mother exercises control over the development and
the metabolism of the embryo and the suckling infant. The presence of
numerous neuropeptides in milk suggests that milk is not just a
nutrient but that it provides a channel to transfer biological
information from the mother to the infant.
 |
Acknowledgments
|
|---|
The authors thank Ms. N. Ben Aroya for skillful technical
assistance.
 |
Footnotes
|
|---|
1 Dedicated to the memory of the late Otakar Koldovsky, M.D., Ph.D.,
from the University of Arizona, who passed away on April 5, 1998. This
work was supported by grants from the Israel Science Foundation
administered by The Israel Academy of Sciences and Humanities and from
The Center for Brain Development. 
Received May 5, 1999.
 |
References
|
|---|
-
Baram T, Koch Y, Hazum E, Fridkin M 1977 Gonadotropin-releasing hormone in milk. Science 198:300302[Abstract/Free Full Text]
-
Leake RD, Weitzman RE, Fisher DA 1981 Oxytocin
concentrations during the neonatal period. Biol Neonate 39:127131[Medline]
-
Werner S, Widstrom AM, Wahlberg V, Eneroth P, Winberg
J 1982 Immunoreactive calcitonin in maternal milk and serum in
relation to prolactin and neurotensin. Early Hum Dev 6:7782[CrossRef][Medline]
-
Werner H, Koch Y, Fridkin M, Fahrenkrug J, Gozes I 1985 High levels of vasoactive intestinal peptide in human milk.
Biochem Biophys Res Commun 133:228232[CrossRef][Medline]
-
Werner H, Amarant T, Millar RP, Fridkin M, Koch Y 1985 Immunoreactive and biologically active somatostatin in human and
sheep milk. Eur J Biochem 148:353357[Medline]
-
Werner H, Katz P, Fridkin M, Koch Y, Levin S 1988 Growth hormone releasing factor and somatostatin concentrations in the
milk of lactating woman. Eur J Pediatr 147:252256[CrossRef][Medline]
-
Werner H, Amarant T, Fridkin M, Koch Y 1986 Growth
hormone releasing factor-like immunoreactivity in human milk. Biochem
Biophys Res Commun 135:10841090[CrossRef][Medline]
-
Berseth CL, Michener SR, Nordyke CK, Go VLW 1990 Postpartum changes in pattern of gastrointestinal regulatory peptides
in human milk. Am J Clin Nutr 51:985990[Abstract/Free Full Text]
-
Illnerova H, Buresova M, Presl J 1993 Melatonin
rhythm in human milk. J Clin Endocrinol Metab 77:838841[Abstract]
-
Koldovsky O 1995 Hormones in milk. Vitam Horm 50:76149
-
Koch Y, Fridkin M 1992 Neurohormones in milk. In:
Mornex R, Jaffiol C, Leclere J (eds) Progress in Endocrinology. The
Parthenon Publishing Group, New York, pp 685687
-
Peaker M, Neville MC 1991 Hormones in milk:
chemical signals to the offspring? J Endocrinol 131:13[Abstract/Free Full Text]
-
Grosvenor CE, Picciano MF, Baumrucker CR 1993 Hormones and growth factors in milk. Endocr Rev 14:710728[Abstract/Free Full Text]
-
Palmon A, Ben-Aroya N, Tel-Or S, Burstein Y, Fridkin M,
Koch Y 1994 The gene for the neuropeptide gonadotropin-releasing
hormone is expressed in the mammary gland of lactating rats. Proc Natl
Acad Sci USA 91:49944996[Abstract/Free Full Text]
-
Orly J, Rei Z, Greenberg NM, Richards JS 1994 Tyrosine kinase inhibitor AG18 arrests follicle-stimulating
hormone-induced granulosa cell differentiation: use of reverse
transcriptase-polymerase chain reaction assay for multiple messenger
ribonucleic acids. Endocrinology 134:23362346[Abstract/Free Full Text]
-
Tavianini MA, Hayes TE, Magazin MD, Minth CD, Dixon
JK 1984 Isolation, characterization, and DNA sequence of the rat
somatostatin gene. J Biol Chem 259:1179811803[Abstract/Free Full Text]
-
Foley KP, Leonard MW, Engel JD 1993 Quantitation of
RNA using the polymerase chain reaction. Trends Genet 9:380385[CrossRef][Medline]
-
Kaplan LM, Spindel ER, Isselbacher KJ, Chin WW 1988 Tissue-specific expression of the rat galanin gene. Proc Natl Acad Sci
USA 85:10651069[Abstract/Free Full Text]
-
Mayo KE, Cerelli GM, Rosenfeld MG, Evans RM 1985 Characterization of cDNA and genomic clones encoding the precursor to
rat hypothalamic growth hormone-releasing factor. Nature 314:464467[CrossRef][Medline]
-
Ivell R, Richter D 1984 Structure and comparison of
the oxytocin and vasopressin genes from rat. Proc Natl Acad Sci USA 81:20062010[Abstract/Free Full Text]
-
Lee SL, Sevarino K, Roos BA, Goodman RH 1989 Characterization and expression of the gene-encoding rat
thyrotropin-releasing hormone (TRH). Ann NY Acad Sci 553:1428[Medline]
-
Kislauskis E, Bullock B, McNeil S, Dobner PR 1988 The rat gene encoding neurotensin and neuromedin N structure,
tissue-specific expression, and evolution of exon sequences. J
Biol Chem 263:49634968[Abstract/Free Full Text]
-
Hudson P, Haley J, Cronk M, Shine J, Niall H 1981 Molecular cloning and characterization of cDNA sequences coding for rat
relaxin. Nature 291:127131[CrossRef][Medline]
-
Deschenes RJ, Haun RS, Funkes CL, Dixon JE 1985 A
gene encoding rat cholecystokinin. Isolation, nucleotide sequence, and
promoter activity. J Biol Chem 260:12801286[Abstract/Free Full Text]
-
Nishizawa M, Hayakawa Y, Yanaihara N, Okamoto H 1985 Nucleotide sequence divergence and functional constraint in VIP
precursor mRNA evolution between human and rat. FEBS Lett 183:5559[CrossRef][Medline]
-
Borjigin J, Wang MM, Snyder SH 1995 Diurnal
variation in mRNA encoding serotonin N-acetyltransferase in
pineal gland. Nature 378:783785[CrossRef][Medline]
-
Misumi Y, Sohda M, Ikehara Y 1990 Sequence of the
cDNA encoding rat furin, a possible propeptide-processing endoprotease.
Nucleic Acids Res 18:6719[Free Full Text]
-
Bloomquist BT, Eipper BA, Mains RE 1991 Prohormone
converting enzymes: regulation and evaluation of function using
antisense RNA. Mol Endocrinol 5:20142024[Abstract/Free Full Text]
-
Hannon K, Smith CK, Bales KR, Santerre RF 1992 Temporal and quantitative analysis of myogenic regulatory and growth
factor gene expression in the developing mouse embryo. Dev Biol 151:137144[CrossRef][Medline]
-
Mezel VA, Nadin-Davis S 1984 Milk protein mRNAs and
poly(A) in the involuting rat mammary gland return to the levels found
during late pregnancy. Biosci Rep 4:359364[CrossRef][Medline]
-
Patel YC, Galanopoulou AS, Rabbani SN, Liu JL, Ravazzola
M, Amherdt M 1997 Somatostatin-14, somatostatin-28, and
prosomatostatin [110] are independently and efficiently processed
from prosomatostatin in the constitutive secretory pathway in islet
somatostatin tumor cells (1027B2). Mol Cell Endocrinol 131:183194[CrossRef][Medline]
-
Coen C, Montagnese C, Opacka-Juffry J 1990 Coexistence of gonadotropin-releasing hormone and galanin:
immunohistochemical and functional studies. J Neuroendocrinol 2:107111
-
Merchenthaler I, Lopez FJ, Negro-Vilar A 1990 Colocalization of galanin and luteinizing hormone-releasing hormone in
a subset of preoptic hypothalamic neurons: anatomical and functional
correlates. Proc Natl Acad Sci USA 87:63266330[Abstract/Free Full Text]
-
Bani D 1997 Relaxin: a pleiotropic hormone. Gen
Pharmacol 28:1322[Medline]
-
Koch Y, Werner H, Fridkin M 1991 Hypothalamic
hormones in milk. Endocr Regul 25:128133[Medline]
-
Strbak V, Giraud P, Resetkova E, Ouafik LH,
Dutour A, Oliver C, Povazanova K, Randuskova A 1991 Thyroliberin
(TRH) and TRH free acid (TRH-OH) present in milk do not originate from
local synthesis in mammary gland. Endocr Regul 25:134138[Medline]
-
Peaker M, Taylor E, Tashima L, Redman TL, Greenwood FC,
Bryant-Greenwood GD 1989 Relaxin detected by immunocytochemistry
and Northern analysis in the mammary gland of the guinea pig.
Endocrinology 125:693698[Abstract/Free Full Text]
-
Fields P, Kondo S, Tashima L, Bryant-Greenwood G,
Greenwood F 1995 Expression of SQ 10 (a preprorelaxin-like gene)
in the pregnant rabbit placenta and uterus. Biol Reprod 53:11391145[Abstract]
-
Fields PA, Lee AB, Heub LM, Hwang JJ, Sherwood OD 1992 Evidence for a dual source of relaxin in the pregnant rat:
immunolocalization in the corpora lutea and endometrium. Endocrinology 130:29852990[Abstract/Free Full Text]
-
Reichlin S 1983 Medical progress: somatostatin.
N Engl J Med 309:14951501[Medline]
-
Reichlin S 1983 Medical progress: somatostatin.
N Engl J Med 309:15561563[Medline]
-
Holst N, Jenssen TG, Burhel PG 1990 A
characterization of immunoreactive somatostatin in human milk. J
Pediatr Gastroenterol Nutr 10:4752[Medline]
-
Kacsoh B, Terry LC, Meyers JS, Crowley WR, Grosvenor
CE 1989 Maternal modulation of growth hormone secretion in the
neonatal rat. I. Involvement of milk factors. Endocrinology 125:13261336[Abstract/Free Full Text]
-
Peracchi M, Carola F, Cavagnini F, Benti R, Bareggi B,
Baccalazo G, Basilisco G 1998 Plasma somatostatin-like
immunoreactivity and somatostatin-28 levels in obese men. J Endocrinol
Invest 21:2023[Medline]
-
Rao RK, Davis TP, Williams C, Koldovsky O 1999 Effect of milk on somatostatin degradation in suckling rat jejunum
in vivo. J Pediatr Gastroenterol Nutr 28:8494[CrossRef][Medline]
-
Rao RK, Koldovsky O, Davis TP 1990 Inhibition of
intestinal degradation of somatostatin by rat milk. Am J Physiol
258:G426G431
-
Rao RK, Koldovsky O, Davis TP 1993 Fate of
intraduodenally administered somatostatin in rats in vivo.
Peptides 14:11991203[CrossRef][Medline]
-
Gama P, Alvares EP 1996 LHRH and somatostatin
effects on the cell proliferation of the gastric epithelium of suckling
and weaning rats. Regul Pept 63:7378[CrossRef][Medline]
-
Krieger DT 1982 Placenta as a source of "brain"
and "pituitary" hormones. Biol Reprod 26:5571[Abstract]
-
Seeburg PH, Edelman JP 1984 Characterization of
cDNA for precursor of human luteinizing hormone releasing hormone.
Nature 311:666668[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
B. G. Steinetz, L. Horton, and S. Lasano
The Source and Secretion of Immunoactive Relaxin in Rat Milk
Experimental Biology and Medicine,
May 1, 2009;
234(5):
562 - 565.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Cassoni, M. Papotti, C. Ghè, F. Catapano, A. Sapino, A. Graziani, R. Deghenghi, T. Reissmann, E. Ghigo, and G. Muccioli
Identification, Characterization, and Biological Activity of Specific Receptors for Natural (Ghrelin) and Synthetic Growth Hormone Secretagogues and Analogs in Human Breast Carcinomas and Cell Lines
J. Clin. Endocrinol. Metab.,
April 1, 2001;
86(4):
1738 - 1745.
[Abstract]
[Full Text]
|
 |
|