help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mahata, S. K.
Right arrow Articles by O’Connor, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mahata, S. K.
Right arrow Articles by O’Connor, D. T.
Endocrinology Vol. 140, No. 2 739-749
Copyright © 1999 by The Endocrine Society

ARTICLES

Neuroendocrine Cell Type-Specific and Inducible Expression of the Secretogranin II Gene: Crucial Role of Cyclic Adenosine Monophosphate and Serum Response Elements1

Sushil K. Mahata, Manjula Mahata, Carolyn V. Livsey, Hans-Hermann Gerdes, Wieland B. Huttner and Daniel T. O’Connor

Department of Medicine and Center for Molecular Genetics (S.K.M., M.M., C.V.L., D.T.O’C.), University of California, and San Diego VA Healthcare System, San Diego, California 92161; and Department of Neurobiology, Heidelberg University (H.-H.G., W.B.H.), Heidelberg, Germany

Address all correspondence and requests for reprints to: Sushil K. Mahata, Ph.D., Department of Medicine and Center for Molecular Genetics (9111H), University of California, San Diego, 3350 La Jolla Village Drive, San Diego, California 92161-9111H. E-mail: smahata{at}ucsd.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Secretogranin II, an acidic protein in the chromogranin/secretogranin family, is widely distributed in neuroendocrine secretory granules. What factors govern such widespread, yet selective, expression? The 5' deletions localized neuroendocrine cell type-specific expression to the proximal mouse secretogranin II promoter: such expression was abolished after deletion past the cAMP response element (CRE; [-67 bp]TGACGTCA[-60 bp]), and transfer of the CRE to a neutral promoter conferred 3.4- to 5.3-fold neuroendocrine selectivity. Thus, the CRE is, at least partly, sufficient to confer tissue-specific expression. Substantial (48–59%) loss of cell type-specific expression also occurred upon deletion past the serum response element (SRE; [-302 bp]GATGTCC[-296 bp]), and transfer of the SRE to a neutral promoter also conferred neuroendocrine selectivity. Expression of both the endogenous gene and the transfected secretogranin II promoter was up-regulated after secretagogues, and the degree of trans-activation of the transfected promoter (2.2- to 5.4-fold) paralleled activation of the endogenous gene (1.8- to 3.2-fold). The 5' promoter deletions revealed complete loss of secretagogue responses after deletion past the CRE. Transfer of the CRE to a neutral promoter conferred secretagogue responses (by 2.2- to 18.6-fold). Substantial (59–74%) falls in secretagogue responses also occurred after deletion past the promoter’s SRE. Transfer of the SRE to a neutral promoter conferred secretagogue responses (by 2.7- to 8.3-fold). We conclude that the CRE is a crucial determinant of cell type-specific constitutive and secretagogue-inducible expression of the secretogranin II gene and that the SRE also plays a substantial role in both processes.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
SECRETOGRANIN II, a member of the chromogranin/secretogranin secretory protein family, was initially discovered in the anterior pituitary (1). Later, secretogranin II messenger RNA (mRNA) and protein were found to be widely distributed in endocrine and neuroendocrine cells, as well as in brain (2, 3, 4). Secretogranin II is an excellent marker for the regulated secretory pathway (5, 6), a useful histological tumor marker for a variety of neoplasms arising from endocrine and neuroendocrine cells (3, 7, 8), and the precursor of the biologically active peptide secretoneurin (9), which induces dopamine release (10) in the striatum of rat brain and exerts chemotactic activity toward monocytes (11).

Secretogranin II mRNA levels are selectively elevated in the paraventricular nuclei of the hypothalamus by salt-loading (12, 13), after adrenalectomy and during lactation (14), or in other brain regions after treatment with kainic acid (15), reserpine (16), or the neurotoxin ethylcholine aziridinium (17). Other studies have shown that secretogranin II gene expression is elevated in the rat adrenal medulla after reserpine (18); in rat pheochromocytoma PC12 cells after nerve growth factor (NGF) (19) and after depolarization (20); in primary cultures of bovine chromaffin cells after forskolin (21) or histamine (22), nicotine, or prostaglandin (23); and in rat neurons after forskolin or phorbol ester [phorbol-12-myristate-13- acetate (PMA) (24)].

The secretogranin II gene (Scg2) has been isolated from both mouse (25) and rat (26), and the Scg2 locus has been positioned to human chromosome 2q35-q36, mouse chromosome 1, and rat chromosome 9 (27). The secretogranin II protein is entirely encoded by one exon (exon 2) (25). This distinguishes the genomic organization of secretogranin II gene from that of the other two classical members of the chromogranin family, chromogranin B [5 exons (28)] and chromogranin A [8 exons (29, 30, 31)]. The secretogranin II gene contains a cAMP response element [CRE: TGACGTCA (25)], which seems to be functional (32). In addition, the secretogranin II promoter is unique in the chromogranin/secretogranin protein family, in having a sequence motif compatible with a serum response element (SRE: GATGTCC) (25, 26).

What factors govern the activity of the secretogranin II gene, to yield such a widespread (yet neuroendocrine-selective) pattern of expression? The chromogranin/secretogranin proteins each have widespread neuroendocrine expression (3, 7). Comparison of the mouse chromogranin A, chromogranin B, and secretogranin II promoters reveals only two features in common: CREs 67 to 102 bp upstream of the cap sites, and TATA boxes 22 to 31 bp upstream of the cap sites (25, 28, 29). For chromogranin A, the CRE seems to be the crucial element in conferring cell-type specificity of expression, in both the mouse (33) and human (34) genes, although other elements may also be important (35). The chromogranin A CRE also seems to confer response to a variety of secretagogues, including cAMP (33), nicotinic cholinergic agonists (36, 37), NGF (38), and neuropeptides (39). Both CRE and SRE motifs occur in the secretogranin II promoter (25). Although the secretogranin II CRE is functional (32), cAMP-induced transcription was not uniform in all cell types, and no data exist on the function of the secretogranin II SRE.

To gain insight into the molecular basis for neuroendocrine cell type-specific expression of secretogranin II, we characterized the mouse secretogranin II gene promoter (to -4.5 kb upstream of the cap site [+1]) and found that the CRE, at [-67 bp] TGACGTCA [-60 bp], plays an indispensable role in neuroendocrine cell type-specific expression of the gene. The SRE region, at [-302 bp] GATGTCC [-296 bp], also played a role in such expression. We then extended our studies to explore whether the CRE or SRE are important for inducible expression, and we found that activation of secretogranin II gene expression by cAMP, nicotinic cholinergic, peptidergic, or trophic stimulation is indeed mediated largely via the CRE box, with an additional substantial role for the SRE.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Sequencing of the mouse secretogranin II promoter
A 6.3-kb EcoRI-fragment containing the 5' upstream region of the secretogranin II gene (25) was sequenced. Double-stranded DNA sequencing was performed by the automated fluorescent sequencing method, using oligonucleotide primers either to vector sequences or to mouse genomic secretogranin II sequences. Eight microliters of Prism Dye-terminator Ready Reaction Mix from PE Applied Biosystems (ABI)/Perkin-Elmer Corp. (Foster City, CA), which contains buffer, nucleotides, dye-terminators, and a specially modified FS AmpliTaq polymerase, was added to 500 ng DNA template plus 3.2 pmol of primers. Amplification was done on an MJ Research, Inc. DNA Engine PTC200 (MJ Research, Inc., Waltham, MA), with Hot Start at 96 C. Then 25 cycles were run at: 96 C for 10 sec, 52 C for 5 sec, and 60 C for 4 min. The samples were then purified on Pharmacia G50 Microspin Sepharose Columns (Pharmacia, Piscataway, NJ) to get rid of excess dye-nucleotides and were lyophilized in a Speedvac for 30 min. Three microliters of a formamide and a blue dextran dye (5:1 ratio) solution was added to the pellet, vortexed, heated to 96–100 C to get rid of secondary structures, and then quick-chilled. The samples were then loaded on a 6% polyacrylamide gel (Bio-Rad Laboratories, Inc., Hercules, CA) for 12 h at 30 watts on an ABI 373A autosequencer. The data were collected and analyzed by the ABI 2.1.1 software.

Construction of a series of secretogranin II 5' promoter deletion/luciferase reporter plasmids for transfection
The fragment (approximately 6.3 kb), containing approximately 4.5 kb promoter sequence (25), exon 1 ending approximately 100 bp in front of HindIII site, and approximately 1.8 kb of the intron, was subcloned into the EcoRI site of the pBluescript II KS ± vector (Stratagene, La Jolla, CA). This promoter plasmid ({Delta}EcoRI) was used for subsequent subcloning of fragments into the pXP1 luciferase vector (40).

The following series of 5' promoter deletion/luciferase reporter plasmids was constructed.

pXPC4500 (-4500 bp to +8 bp). The {Delta}EcoRI construct was digested with SmaI and KpnI. The pXPC1494 construct (see below) was digested with XhoI plus KpnI. The XhoI terminus was filled with Klenow fragment and then ligated to the SmaI-KpnI fragment. This construct was named pXPC4500.

pXPC1494 (-1494 bp to +8 bp). {Delta}EcoRI was digested with AvaI. The termini were filled in with Klenow fragment of DNA polymerase I, and the blunt ends were ligated into the SmaI site of the pXP1 vector.

pXPC982 (-982 bp to +8 bp). pXPC1494 was digested with KpnI and recircularized with T4 DNA ligase.

pXPC917 (-917 bp to +8 bp). pXPC1494 was digested with XhoI plus HpaI. The 5'-overhang of the XhoI site was filled in with the Klenow fragment of DNA polymerase I and ligated to the blunt end of the HpaI site.

pXPC793 (-793 bp to +8 bp). pXPC1494 was digested with XhoI plus NdeI. The 5'-overhangs of NdeI and XhoI digestion were filled in with Klenow fragment of DNA polymerase I and recircularized with T4 DNA ligase.

pXPC437 (-437 bp to +8 bp). pXPC982 was digested with XhoI plus MunI. The 5'-overhangs were filled-in with the Klenow fragment of DNA polymerase I and reclosed with T4 DNA ligase.

pXPC331 (-331 bp to +8 bp). pXPC982 was digested with XhoI plus XmnI. The 5'-overhang of XhoI was filled in with Klenow fragment of DNA polymerase I and reclosed with T4 DNA ligase.

pXPC76 (-76 bp to +8 bp). pXPC982 was digested with XhoI plus Bpu11021. The 5'-overhangs were filled in with Klenow fragment of DNA polymerase I and reclosed with T4 DNA ligase.

pXPC40 (-40 bp to +8 bp). pXPC982 was digested with BglII plus NarI. The 5'-overhangs were filled in with Klenow fragment, and the blunt ends were ligated.

Creation of pTK-SgII-CRE-Luc and pTK-SgII-{Delta}CRE-Luc promoter/luciferase reporter plasmids
A single copy of a double-stranded oligonucleotide CRE (GGTCCTGACGTCATTTCC; CRE box in bold) fragment was inserted into the polylinker immediately upstream of the heterologous herpes simplex virus thymidine kinase (TK) promoter in the luciferase reporter vector pTK-Luc (40); the resulting plasmid was called pTK-SgII-CRE-Luc. A similar construction was made with a point-mutated SgII CRE (TGA-GTAA; two point mutations shown in bold and underlined), and the plasmid was called pTK-SgII-{Delta}CRE-Luc.

c-Fos SRE and {Delta}SRE (absent SRE) promoter/luciferase reporter plasmids
These plasmids were obtained from Michael Simonson (Case Western Reserve University, Cleveland, OH) (41). In the wild-type human c-Fos promoter, the TATA box is at [-31 bp] TATAAA [-26 bp], and the SRE is at [-317] GATGTCC [-311 bp]. The SRE-Luc construct was created by ligating human c-Fos SRE-containing 28 bp oligonucleotide duplexes (ACAGGATGTCCATATTAGGACATCTGCG; SRE in bold) directly upstream from a truncated mouse c-Fos promoter (-56 bp to +109 bp), which was, in turn, fused to a luciferase reporter in the vector pSVO-Luc (41). The c-Fos SRE plasmid thus contains both a TATA box and a SRE in its promoter. The {Delta}SRE-Luc plasmid has the same mouse c-Fos promoter (-56 bp to +109 bp) fused to a luciferase reporter but lacks the SRE (41).

Cell culture and transfections
Early passage number (passage 12–25) PC12 rat pheochromocytoma cells (42) were obtained from David Schubert, Ph.D., Salk Institute, La Jolla, CA. They were cultured in high-glucose DMEM with 10% heat-inactivated horse serum, 5% heat-inactivated FBS, and 1% penicillin/streptomycin (100% stocks were 10,000 U/ml penicillin G and 10,000 µg/ml streptomycin sulfate; Life Technologies, Inc., Gaithersburg, MD). The mouse gonadotrope cell line ({alpha}T3–1) (43) and mouse hypothalamic neuronal cell line (GT1–7) (44, 45) were obtained from Pamela L. Mellon (University of California, San Diego). The {alpha}T3–1 cell line was created by targeted tumorigenesis in transgenic mice using the regulatory region from the human pituitary glycoprotein hormone {alpha}-subunit gene, and thus represents a cell from the gonadotrope lineage of the pituitary (43). The GT1–7 cell line was generated by targeted tumorigenesis in transgenic mice using the 5'-flanking region of the GnRH gene coupled to the coding region for the SV40 large T antigen and represents immortal, differentiated hypothalamic neurons (44, 45). These cells were cultured in high-glucose DMEM with 10% heat-inactivated FBS, and 1% penicillin/streptomycin. The mouse anterior pituitary corticotrope cell line AtT20 (46) was obtained from M. G. Rosenfeld’s laboratory (University of California, San Diego) and cultured in high-glucose DMEM with 10% heat-inactivated FBS, and 1% penicillin/streptomycin. The NIH-3T3 (nonneuroendocrine, control) fibroblast cell line was obtained from ATCC(American Type Culture Collection, Rockville, MD) and grown in high-glucose DMEM with 10% heat-inactivated FCS, and 1% penicillin/streptomycin. The rat somatotrope GC cell line (47) was obtained from Michael Karin’s laboratory (University of California, San Diego) and was grown in DME/F12 with 10% heat-inactivated FBS, and 1% penicillin/streptomycin. Cath-a [CNS TH (tyrosine hydroxylase-expressing] and Path-2 (adrenal TH-expressing) cell lines were obtained from Dona Chikaraishi (Tufts University School of Medicine, Boston, MA). The Cath-a cell line was derived from a TH-expressing brain stem tumor in a transgenic mouse carrying the SV40 T antigen under the transcriptional control of the rat TH 5'-flanking DNA (48). A similar approach was used (48) to obtain the Path-2 (peripheral nervous system TH expressing) cell line from an adrenal tumor. Cos-1 cells (SV40 T antigen-transformed kidney fibroblast cell line) and 293 cells (human adenovirus 5 transformed kidney epithelial cell line) were obtained from the ATCC.

Supercoiled plasmid DNA for transfection was grown in Escherichia coli strain DH-5{alpha} and purified on columns (Qiagen Inc., Chatsworth, CA). One day before transfection, cells were split onto poly-D-lysine (Sigma Chemical Co., St. Louis, MO) coated 6-cm plastic plates, at 40–50% cell confluence. Cells were transfected with 2.5 µg of supercoiled luciferase reporter plasmid DNA per plate, using either the lipofection method (49) (Lipofectamine; Gibco BRL, Bethesda, MD) or the polycationic method (Superfect reagent, Qiagen Inc.). Cells were harvested 30–36 h after transfection for constitutive expression. For inducible expression, cells were harvested 16–24 h after treatment. Cell extracts were prepared and assayed for protein (50), luciferase (51), and chloramphenicol acetyltransferase (CAT) (52). To control for differences in transfection efficiency between plasmids, transfections were accompanied by cotransfection of another reporter plasmid, pRSV-CAT (52), expressing the CAT reporter driven by the strong Rous sarcoma virus (RSV) promoter.

Northern blot analysis of mRNA
Total RNA was isolated from cells by guanidinium thiocyanate extraction (RNAzolB; Tel-Test, Friendswood, TX). RNAs (10–20 µg) were size-fractionated on denaturing 1% agarose-formaldehyde gels, transferred to nitrocellulose membranes, and fixed with UV irradiation (StrataLinker; Stratagene). The integrity of the RNA was judged by the appearance of 28S and 18S ribosomal RNA (rRNA) bands on the ethidium bromide-stained gel. The blots were prehybridized, hybridized, and washed as described (33).

Random primer-labeled (53) cDNA probes were: a 1.8-kb rat secretogranin II cDNA (54) and a 381-bp mouse cyclophilin cDNA (55), used as a normalizing probe for a housekeeping (constitutively expressed) mRNA. Expression of mRNAs was quantified using a StrataScan 7000 densitometer (Stratagene), and normalized to cyclophilin gene expression.

Chemicals
Nicotine, forskolin, and dibutyryl-cAMP were obtained from Sigma Chemical Co. Synthetic (pituitary adenylyl cyclase activating polypeptide) PACAP-38 was obtained from Peninsula Laboratories, Inc. (Belmont, CA). NGF (2.5S, murine, natural) and basic fibroblast growth factor (bFGF) (human, recombinant) were from Life Technologies (Gibco BRL).

Data presentation and analysis
Secretagogue potency was estimated as the EC50 (concentration required to give half-maximal effect) value, using the program Kaleidagraph (Synergy/Abelbeck Software, Reading, PA). We chose secretagogue doses based on 10-fold (log10) dose-response curves for each agent, and then we conducted subsequent studies at submaximal doses that were at or above the EC50 values for each drug. Transfection experiments were repeated at least three times, with three plates per condition in each experiment. Results are expressed as the mean value ± 1 SEM. Descriptive and inferential statistics were performed with the program InStat (GraphPad Software, Inc., San Diego, CA). Student’s t tests or ANOVAs were used, as appropriate. Significance was determined at the P <= 0.05 level.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Sequence of the mouse secretogranin II promoter
Sequence analysis (Fig. 1Go) of 1684 bp of the 5'-flanking region of the mouse secretogranin II gene revealed several consensus matches for cis-acting transcriptional control elements: a TATA box, at [-26 bp] TATAA [-22 bp]; a CRE, at [-67 bp] TGACGTCA [-60 bp]; and a SRE, at [-302 bp] GATGTCC [-296 bp] upstream of the cap site (+1) (Fig. 1Go). Comparison of the first 1345 bp of rat (26) and mouse (present work) secretogranin II promoters revealed a 1138/1345 = 85% homology; beyond 1345 bp, the sequence diverged substantially. The TATA box, CRE, and SRE sequences (as described above) were entirely conserved in the rat and mouse genes.



View larger version (48K):
[in this window]
[in a new window]
  		Figure 1. Mouse secretogranin II promoter sequence. Nucleotides are numbered from the transcription initiation site (+1) of the gene. Note the position of the TATA box (underlined) at [-26 bp] TATAA [-22 bp], the CRE (in bold) at [-67 bp] TGACGTCA [-60 bp], and SRE (in bold and underlined) at [-302 bp] GATGTCC [-296 bp] upstream of the cap (+1) site. Bases conserved between mouse and rat sequences are indicated by a hyphen. Gaps are indicated by a dot.

 
The endogenous secretogranin II gene in neuroendocrine cells
Basal expression. We investigated the expression of the endogenous secretogranin II gene by Northern blot in clonal cell lines. A high level of steady-state secretogranin II mRNA was observed in adrenomedullary [Path-2 (Fig. 2Go) and PC12 pheochromocytoma (Fig. 3Go)], pituitary [AtT20 corticotrope, {alpha}T3–1 gonadotrope, and GC somatotrope (Fig. 2Go)], and neuronal [Cath-a (Fig. 2Go) and GT1–7 (Fig. 4Go)] cell lines, though not in control (nonneuroendocrine, NIH-3T3) cells (Fig. 2Go).



View larger version (20K):
[in this window]
[in a new window]
  		Figure 2. Northern blot analyses of secretogranin II mRNA expression in neuroendocrine vs. control (nonneuroendocrine) cells. Control cells are NIH-3T3 fibroblasts. Neuroendocrine cells are Path-2 (peripheral TH expressing), Cath-a (central TH expressing), and pituitary cell lines (AtT20, {alpha}T3–1, and GC). The position of 18S rRNA migration is shown on the right. Cyclophilin (housekeeping) mRNA is also shown, for normalization between cell types.

 


View larger version (25K):
[in this window]
[in a new window]
  		Figure 3. Northern blot analyses of secretogranin II mRNA in vehicle- (mock) vs. NGF- (100 ng/ml; 24 h), nicotine- (0.1 mM; 24 h), dibutyryl-cAMP- (0.5 mM; 24 h), or bFGF- (20 ng/ml; 24 h) treated PC12 cells. The position of 18S rRNA migration is shown on the right. Secretogranin II and cyclophilin (housekeeping) mRNAs are shown. The densitometric values of the steady-state mRNA for secretogranin II are normalized to values obtained for cyclophilin mRNA.

 


View larger version (24K):
[in this window]
[in a new window]
  		Figure 4. Effect of the adenylyl cyclase activator forskolin (10 µM; 24 h) on secretogranin II expression in {alpha}T3–1 or GT1–7 cells, by Northern blot analysis of secretogranin II mRNA. The position of 18S rRNA migration is shown on the right. Secretogranin II and cyclophilin (housekeeping) mRNAs are shown. The densitometric values of the steady-state mRNA for secretogranin II are normalized to values obtained for cyclophilin mRNA.

 
Inducible expression. Because acetylcholine is the physiological stimulus for chromaffin cell secretion (56) of catecholamines and costored proteins, including secretogranin II, we investigated whether nicotine can stimulate expression of the secretogranin II gene. Nicotine (100 µM, 24 h) augmented expression of the secretogranin II gene by 1.8-fold (Fig. 3Go).

Because the secretogranin II promoter contains a CRE box (Fig. 1Go), reported to be functional (32), we tested its regulation by stimulants of the protein kinase A (PKA) pathway (e.g. the adenylyl cyclase activator forskolin, or the PKA activator cAMP). Forskolin (10 µM, 24 h) activated expression of the secretogranin II gene in pituitary ({alpha}T3–1) or neuronal (GT1–7) cell lines by 3.2- or 1.8-fold, respectively (Fig. 4Go), whereas dibutyryl cAMP (0.5 mM, 24 h) activated secretogranin II in adrenomedullary (PC12 pheochromocytoma) cells by 1.9-fold (Fig. 3Go). Northern blot results were confirmed in a second set of independent experiments.

The SRE may mediate responses to several growth factors (57, 58). Because the secretogranin II gene contains a SRE (Fig. 1Go), we tested the effects of NGF or bFGF in PC12 cells, and found a 2.3-fold increases in secretogranin II mRNA after either treatment (Fig. 3Go).

Expression of the transfected secretogranin II promoter: 5' promoter deletion mutants
The 4.5-kb promoter conferred expression in neuroendocrine cells, including cell lines of the adrenal medulla (rat PC12 and mouse Path-2 cells) (Fig. 5AGo), pituitary (AtT20, GC, and {alpha}T3–1) (Fig. 5BGo), and brain (GT1–7 and Cath-a) (Fig. 5CGo) but not in control (nonneuroendocrine) cells, such as NIH-3T3 fibroblasts (Fig. 5Go, A–D), 293 epithelial cells (Fig. 5DGo), or Cos-1 fibroblasts (Fig. 5DGo). Expression in neuroendocrine cells was preserved, or even enhanced, upon progressive 5' deletions down to 331 bp upstream of the cap site, after which specific expression began to fall. Of note, the SRE in this promoter is at [-302 bp] GATGTCC [-296 bp]. Further deletion past the SRE, down to -76 bp, resulted in 48–59% loss of neuroendocrine tissue-specific expression, whereas deletion to -40 bp abolished cell type-specific promoter activity. Of note, the CRE in this promoter is at [-67 bp] TGACGTCA [-60 bp], whereas the TATA box is at [-26 bp] TATAA [-22 bp].



View larger version (52K):
[in this window]
[in a new window]
  		Figure 5. 5' Deletion analysis of mouse secretogranin II promoter domains in neuroendocrine vs. control (fibroblast or epithelial) cell lines. Promoter fragments were subcloned into the polylinker region of the promoterless luciferase reporter vector pXP1 and numbered, with reference to the transcription initiation (cap) site, as +1. For example, pXPC982 spans a region from 982 bp upstream (5') of the cap site to +8 bp downstream (3') of the cap site. The promoter deletion/luciferase reporter constructs were transfected, along with a transfection control efficiency plasmid, pRSV-CAT. The results are expressed as ratios of luciferase/CAT activities. Results are mean values ± 1 SEM (n = 6 transfections for each deletion). Note that the CRE is at [-67 bp] TGACGTCA [-60 bp], whereas the SRE is at [-302 bp] GATGTCC [-296 bp], and the TATA box is at [-26 bp]TATAA[-22 bp]. A, Expression of the secretogranin II promoter in adrenomedullary (PC12 or Path-2) vs. control (NIH-3T3 fibroblast) cells; B, expression of the secretogranin II promoter in pituitary (AtT20, GC, or {alpha}T3–1) vs. control (NIH-3T3 fibroblast) cells; C, expression of the secretogranin II promoter in neurons (Cath-a or GT1–7) vs. control (NIH-3T3 fibroblast) cells; D, expression of the secretogranin II promoter in neuroendocrine (PC12) vs. nonneuroendocrine or control (NIH-3T3 fibroblast, Cos-1 SV40 transformed kidney fibroblast), and 293 (adenovirus 5 DNA transformed kidney epithelial cells) cells. Raw data after transfection with pXPC40 were (luciferase light units/20 µl of cell lysate): 148 ± 3 (PC12 cells), 88 ± 5 (NIH-3T3 cells), 128 ± 19 (293 cells), and 72 ± 3 (Cos-1 cells). The corresponding CAT values, from cotransfected pRSV-CAT, were (dpm/20 µl of cell lysate): 5500 ± 500 (PC12 cells), 6600 ± 305 (NIH-3T3 cells), 44898 ± 125 (293 cells), 37471 ± 602 (Cos-1 cells). Raw data after transfection with pXPC76 were (luciferase light units/20 µl of cell lysate): 5484 ± 551 (PC12 cells), 241 ± 7 (NIH-3T3 cells), 2319 ± 81 (293 cells), and 551 ± 71 (Cos-1 cells). The corresponding CAT values, from cotransfected pRSV-CAT, were (dpm/20 µl of cell lysate): 6500 ± 480 (PC12 cells), 7133 ± 637 (NIH-3T3 cells), 52759 ± 322 (293 cells), and 38129 ± 971 (Cos-1 cells). Raw data after transfection with pXPC331 were (luciferase light units/20 µl of cell lysate): 13396 ± 41 (PC12 cells), 834 ± 11 (NIH-3T3 cells), 8322 ± 283 (293 cells), and 2163 ± 392 (Cos-1 cells). The corresponding CAT values, from cotransfected pRSV-CAT, were (dpm/20 µl of cell lysate): 6900 ± 300 (PC12 cells), 8333 ± 664 (NIH-3T3 cells), 45503 ± 241 (293 cells), and 44494 ± 2284 (Cos-1 cells).

 
Role of the CRE and SRE in basal neuroendocrine expression: promoter domain transfers
(a) Role of the CRE domain. PC12, AtT20, or NIH-3T3 (control) cells were transfected with pTK-SgII-CRE-Luc (wild-type secretogranin II CRE) or pTK-SgII-{Delta}CRE-Luc (point mutant CRE). The secretogranin II CRE conferred 3.4- to 5.3-fold enhancement in neuroendocrine cell type-specific expression in PC12 or AtT20 cells, compared with NIH-3T3 cells (Fig. 6AGo). Neuroendocrine expression was greatly diminished (62–75% loss of activity) when cells were transfected with the secretogranin II CRE point mutant (Fig. 6AGo).



View larger version (24K):
[in this window]
[in a new window]
  		Figure 6. A, Stimulation of a heterologous TK promoter by the secretogranin II CRE site. Synthetic CRE-TK-luciferase constructs were transfected into neuroendocrine (PC12 or AtT20) or control (NIH-3T3 fibroblast) cells. The results were normalized to the activity of pTK-Luc (without a CRE) and expressed as relative luciferase activity (n = 6 transfections for each plasmid). Secretogranin II CRE point mutations are indicated in bold and underlined type. B, Role of the SRE in basal secretogranin II expression in PC12 cells. Synthetic c-Fos-SRE-luciferase constructs were transfected into neuroendocrine (PC12 or AtT20) or control (NIH-3T3 fibroblast) cells. The luciferase results are normalized to cotransfected CAT activity (n = 6 transfections for each plasmid).

 
(b) Role of the SRE domain. PC12, AtT20, or NIH-3T3 (control) cells were transfected with c-Fos-SRE-Luc (wild-type SRE) or c-Fos-{Delta}SRE-Luc (lacking an SRE). c-Fos-SRE-Luc demonstrated substantial neuroendocrine selectivity of expression, with 6.1- to 9.8-fold more expression in PC12 or AtT20 cells than in NIH-3T3 cells (Fig. 6BGo). Removal of the SRE (in c-Fos-{Delta}SRE-Luc) resulted in over 90% loss of neuroendocrine selectivity of expression (Fig. 6BGo).

Inducible expression of the secretogranin II promoter: search for cis elements mediating inducibility.
cAMP. The transfected secretogranin II promoter displayed 3-fold cAMP inducibility in neuroendocrine PC12 cells (Fig. 7AGo), and no inducibility was seen in nonneuroendocrine NIH-3T3 cells (Fig. 7BGo). The cAMP inducibility in PC12 cells was preserved until 5' deletions passed -76 bp, removing the CRE at [-67 bp] TGACGTCA [-60 bp]. All promoter deletion mutants downstream (3') of the CRE failed to respond to cAMP.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 7. cAMP-induced expression of the secretogranin II transfected promoter in neuroendocrine (PC12 cells) (A) and nonneuroendocrine (NIH-3T3 cells) (B) cells. Secretogranin II promoter progressive 5' deletion mutant/luciferase reporter plasmids were transfected, along with the transfection control efficiency plasmid, pRSV-CAT. Transfected cells were treated with either vehicle (control) or secretagogue (0.5 mM dibutyryl cAMP) for 24 h. Results are expressed as ratios of luciferase/CAT activities (n = 6 transfections for each plasmid). *, P < 0.003.

 
Nicotinic cholinergic stimulation. In bovine chromaffin cells, nicotine activates the secretogranin II gene (21, 23). In PC12 cells, we found a 2.3-fold increase in secretogranin II transfected promoter activity in PC12 cells after nicotine (Fig. 8AGo), compared with a 1.8-fold induction of the endogenous secretogranin II gene (Fig. 3Go). During serial 5' deletions, the nicotine response was retained up to -76 bp, but entirely lost at -40 bp (Fig. 8AGo), implicating the CRE at [-67 bp] TGACGTCA [-60 bp]. To determine whether the CRE is sufficient to confer a nicotine response, we transfected PC12 cells with pTK-SgII-CRE-Luc (wild-type secretogranin II CRE) or pTK-SgII-{Delta}CRE-Luc (CRE point mutant). The CRE domain conferred a 2.3-fold increment in nicotine response onto the heterologous TK promoter, but a 74% fall in this nicotine response occurred if the CRE was point-mutated (Fig. 8BGo).



View larger version (20K):
[in this window]
[in a new window]
  		Figure 8. Effects of nicotine or PACAP on the activity of secretogranin II promoter. A, Secretogranin II promoter expression in response to nicotine (500 µM) or PACAP-38 (100 nM). Secretogranin II promoter progressive 5' deletion mutant/luciferase reporter plasmids were transfected, along with the transfection control efficiency plasmid, pRSV-CAT. Transfected cells were treated with either vehicle (control) or secretagogue for 24 h. Results are expressed as ratios of luciferase/CAT activities (n = 6 transfections for each plasmid). *, P < 0.0003. B, Stimulation of a heterologous TK promoter by the secretogranin II CRE site in response to nicotine (500 µM) or PACAP-38 (100 nM). After transfection with synthetic CRE-TK-luciferase constructs, PC12 cells were treated with nicotine (500 µM) or PACAP-38 (100 nM) for 24 h. Luciferase results were normalized to CAT activity (n = 6 transfections for each plasmid). Secretogranin II CRE point mutations are indicated in bold and underlined type. *, P < 0.0001. C, Role of the SRE in inducible gene expression in PC12 cells in response to nicotine (500 µM) or PACAP38 (100 nM). Synthetic c-Fos-SRE-luciferase constructs were transfected into PC12 cells, which were treated with nicotine (500 µM) or PACAP-38 (100 nM) for 24 h. Luciferase results were normalized to CAT activity (n = 6 transfections for each plasmid). *, P < 0.0001.

 
What was the role of the SRE domain in the nicotine response? A 74% fall in the nicotinic inducibility occurred in the -76 bp promoter, compared with the -331 bp promoter (Fig. 8AGo). This region contains the SRE, at [-302 bp] GATGTCC [-296 bp]. To discern whether the SRE is sufficient to confer a nicotine response, we transfected PC12 cells with c-Fos-SRE-Luc (wild-type SRE) or c-Fos-{Delta}SRE-Luc (lacking an SRE). The c-Fos SRE conferred a nicotine response (by 2.7-fold), but a c-Fos promoter lacking an SRE failed to respond to nicotine (Fig. 8CGo).

PACAP. In addition to the classic preganglionic neurotransmitter acetylcholine, noncholinergic transmitters (such as PACAP) may stimulate catecholamine secretion and biosynthetic enzyme transcription in adrenal medullary chromaffin cells (39, 59, 60, 61, 62). In PC12 cells (Fig. 8AGo), PACAP stimulated the transfected secretogranin II promoter 5.4-fold. During 5' promoter deletions, the PACAP response was retained up to -76 bp but was entirely lost by -40 bp (Fig. 8AGo). This region contains the CRE. To discern whether the CRE is sufficient to confer a PACAP response, we transfected PC12 cells with pTK-SgII-CRE-Luc (wild-type secretogranin II CRE) or pTK-SgII-{Delta}CRE-Luc (CRE point mutant). The wild-type CRE conferred an 18.6-fold increment in PACAP response onto the heterologous TK promoter, but a 63% loss of the PACAP response was noted for the CRE point mutant (Fig. 8BGo).

Upon 5' secretogranin II promoter deletion past the SRE, 61% of the PACAP response was lost (Fig. 8AGo). To determine whether the SRE is sufficient to confer a PACAP response, we transfected PC12 cells with c-Fos-SRE-Luc (wild-type SRE) or c-Fos-{Delta}SRE-Luc (lacking the SRE). The c-Fos SRE conferred an 8.3-fold increment in PACAP response, but a 97% loss of that PACAP response was noted in the c-Fos promoter lacking an SRE (Fig. 8CGo).

Growth factors. NGF is known to augment expression of the secretogranin II gene in PC12 cells (19, 63). Here we found 2.3-fold increases in transfected secretogranin II promoter activity upon exposure to NGF or bFGF (Fig. 9AGo), compared with 2.2- to 2.3-fold increments in endogenous gene expression (Fig. 3Go). Promoter 5' deletion mutants indicated that these growth factor responses were retained up to -76 bp but were entirely lost by -40 bp (Fig. 9AGo). This region contains the CRE. To test whether the CRE is sufficient to confer trophic factor responses, we transfected PC12 cells with pTK-SgII-CRE-Luc (wild-type CRE) or pTK-SgII-{Delta}CRE-Luc (mutant CRE) plasmids. The CRE conferred 2.4-fold trophic factor responses onto the heterologous TK promoter, but a 75% decline in NGF or bFGF responses was noted for the CRE mutant construct (Fig. 9BGo).



View larger version (21K):
[in this window]
[in a new window]
  		Figure 9. Effects of NGF or bFGF on the activity of secretogranin II promoter. A, Secretogranin II promoter progressive 5' deletion mutant/luciferase reporter plasmids were transfected, along with the transfection control efficiency plasmid, pRSV-CAT. Transfected cells were treated with either vehicle (control), NGF (100 ng/ml), or bFGF (20 ng/ml) for 24 h. Results are expressed as ratios of luciferase/CAT activities (n = 6 transfections for each plasmid). *, P < 0.03. B, Stimulation of a heterologous (TK) promoter by the secretogranin II CRE site in response to NGF or bFGF. After transfection with synthetic CRE-TK luciferase constructs, PC12 cells were treated with NGF (100 ng/ml) or bFGF (20 ng/ml) for 24 h. Luciferase results were normalized to CAT activity (n = 6 transfections for each plasmid). Secretogranin II CRE point mutations are indicated in bold and underlined type. *, P < 0.007. C, Role of the SRE in inducible gene expression by PC12 cells in response to NGF or bFGF. Synthetic c-Fos-SRE luciferase constructs were transfected into PC12 cells, which were treated with NGF (100 ng/ml) or bFGF (20 ng/ml) for 24 h. Luciferase results were normalized to CAT activity (n = 6 transfections for each plasmid). *, P < 0.0001.

 
A 66% fall in NGF or bFGF stimulation occurred in the -76 bp promoter, compared with the -331 bp promoter (Fig. 9AGo). This region contains the SRE. To test whether the SRE is sufficient to confer growth factor responses, we transfected PC12 cells with c-Fos-SRE-Luc (wild-type SRE) or c-Fos-{Delta}SRE-Luc (without a SRE). The c-Fos SRE conferred NGF or bFGF responses (by 1.7- to 2.2-fold), but the c-Fos promoter lacking an SRE lost 92–94% of the response to either NGF or bFGF (Fig. 9CGo).

In comparing the relative potency (EC50 values) and efficacy (maximal effect) of several secretagogues (nicotine, PACAP, NGF, or bFGF) to activate the transfected secretogranin II promoter (Table 1Go), we found both the greatest potency (EC50 = 3.01 nM) and the greatest efficacy (4.93 luciferase light units/CAT dpm) for PACAP.


View this table:
[in this window]
[in a new window]
  		Table 1. Relative potencies and efficacies of secretagogues for activation of the transfected secretogranin II promoter

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The secretogranin II promoter is unique among chromogranin/secretogranin protein family members, in containing a SRE motif (Fig. 1Go) (25, 26). The CRE and TATA regions are the only promoter domains common to chromogranin A, chromogranin B, and secretogranin II (33). Previous reports have shown that the CRE region is crucial for neuroendocrine cell type-specific expression of mouse (33) and human (34) chromogranin A. The CRE plays critical roles for tissue-specific expression of the TH (64), neurotrophin-inducible vgf (65), and {alpha}1B-adrenergic receptor genes (66). For the well-studied chromogranin A promoter, a number of secretagogue responses also map onto the CRE box, including response to cAMP (33), nicotinic cholinergic stimulation (36), membrane depolarization (37), protein kinase C activation (37), NGF (38), and the neuropeptide PACAP (39). Do specific domains play similar roles in the secretogranin II promoter?

Northern blot analysis of steady-state secretogranin II mRNA revealed neuroendocrine expression in adrenomedullary [rat PC12 (Fig. 3Go) and mouse Path-2 (Figs. 2Go and 3Go)], pituitary [AtT20 (mouse corticotrope), GC (rat somatotrope), and {alpha}T3–1 (mouse gonadotrope) (Fig. 2Go)], and neuronal [Cath-a (mouse central TH-producing; Fig. 2Go) and GT1–7 (mouse GnRH-producing; Fig. 4Go)] cells, but no expression was detected in control (NIH-3T3 fibroblast) cells (Fig. 2Go). This is consistent with earlier observations that secretogranin II is expressed principally in endocrine cells and neurons (3).

The transfected secretogranin II promoter also displayed cell type-specific expression (Fig. 5Go), and a dramatic (95%) fall in secretogranin II promoter activity was noted upon deletion of the CRE region (Fig. 5Go), suggesting that the CRE region at ([-67 bp] TGACGTCA [-60 bp]) is necessary for tissue-specific expression, much as in chromogranin A (33). In addition, the CRE transfer experiments (Fig. 6AGo) suggest that the CRE region may be, at least partly, sufficient to confer tissue-specific expression in neuroendocrine cells.

Secretogranin II promoter 5' deletion mutants also revealed a substantial (48–59%) decrease in promoter activity upon deletion of the SRE region ([-302 bp] GATGTCC [-296 bp]) (Fig. 5Go, A–D), implicating the SRE, as well, in the tissue-specific expression of secretogranin II. A role for SRE elements in basal expression of several genes has been reported previously (67, 68, 69). To ascertain more precisely the role of the SRE in tissue-specific expression, we transfected neuroendocrine (PC12 or AtT20) or control (NIH-3T3) cells with the c-Fos chimeric promoter plasmids (Fig. 6BGo). Inclusion of an SRE in the c-Fos promoter resulted in 6.1- to 9.8-fold neuroendocrine expression, compared with that in control cells (Fig. 6BGo). Such SRE domain transfers (Fig. 6BGo) suggest that the SRE may also be, at least partly, sufficient to account for the neuroendocrine tissue-specific expression of secretogranin II.

Tissue-specific elements for rat secretogranin II gene expression are yet to be identified (26), but the 85% sequence homology between mouse and rat secretogranin II promoters (Fig. 1Go) suggests that the CRE and SRE will be important in both the mouse and rat. Recent reports revealed that a CRE cooperates with an E box (CANNTG) in directing neural cell-specific expression of the vgf gene (65). It has also been reported that the CBP (CREB-binding protein) cooperates with the serum response factor for transactivation of the c-Fos SRE (70). Because the c-Fos promoter, which contains CRE and SRE elements in similar orientation to the TATA box as that observed in the secretogranin II promoter, does not confer neuroendocrine cell type-specific expression onto c-Fos (68), it seems likely that other sequences and factors associated with the CRE and/or SRE in the secretogranin II gene provide unique information that confers neuroendocrine cell type specificity.

We also characterized promoter elements important to secretagogue-inducible expression of secretogranin II. Because the secretogranin II gene contains a CRE reported to be functional (32), we tested its regulation by the PKA pathway, using either the adenylyl cyclase stimulator forskolin or the PKA activator cAMP. Forskolin augmented secretogranin II expression in {alpha}T3–1 or GT1–7 cells (Fig. 4Go). These findings are in agreement with results in bovine chromaffin cells (23) and neurons (24, 32). Conflicting reports exist about regulation of secretogranin II expression by the PKA pathway in PC12 cells, including down-regulation by cAMP (32, 71), or no change after cAMP (71) or forskolin (20), with varying responses to cAMP in different PC12 subclones (71). Our results in very-early-passage-number (passage numbers 12–25) PC12 cells (Figs. 3Go and 7Go) are especially congruent with findings in bovine chromaffin cells (21).

Catecholamine secretion from chromaffin cells is regulated by both cholinergic (acetylcholine released from splanchnic nerve) (56) and peptidergic (substance P, PACAP, and VIP also contained in the splanchnic nerve) (39, 60, 61, 72, 73) stimuli. Because secretogranin II is costored and cosecreted with catecholamines in response to such stimuli (3), we investigated whether cholinergic or peptidergic perturbations of secretion modify secretogranin II gene expression. Both nicotine and PACAP augmented secretogranin II expression (Figs. 3Go and 8AGo). An analogous result by nicotine was reported in bovine chromaffin cells (23). Of note is the finding that PACAP seemed to be 33,223-fold more potent (3.01 nM vs. 100 µM EC50 values) and 5.2-fold more effective (maximal effect) than nicotine in activating secretogranin II expression (Table 1Go; Fig. 8AGo), even though acetylcholine (acting at nicotinic cholinergic receptors) is usually recognized as the classical neurotransmitter controlling chromaffin cell responses. The reason for such high potency of PACAP remains unknown at this time, but the result is consistent with PACAP’s action at a G protein-coupled receptor. PACAP is also a powerful activator of chromogranin A biosynthesis (39).

Secretogranin II promoter 5' deletion mutants narrowed down the nicotinic and PACAP response elements to the proximal secretogranin II promoter, especially the CRE region (Fig. 8AGo), suggesting the necessity of CRE in mediating these responses. CRE domain transfer to a heterologous TK promoter conferred responses to nicotine (by 2.3-fold) or PACAP (by 18.6-fold), indicating that CRE is also, at least partly, sufficient to mediate these responses. The crucial involvement of the CRE element in mediating nicotinic and PACAP responses of the chromogranin A gene has been documented (36, 37, 39).

We also documented involvement of the SRE in nicotinic and PACAP activation of secretogranin II gene expression (Fig. 8Go, A and C). Our results with 5' deletions past the SRE revealed a substantial decrease in nicotine (74%) or PACAP (61%) responses (Fig. 8AGo). The secretogranin II SRE is thus, at least partly, necessary to mediate the responses to nicotine or PACAP. In addition, SRE domain transfer to a neutral c-Fos promoter conferred responses to both nicotine (2.7-fold) and PACAP (8.3-fold), suggesting that this element is also, at least partly, sufficient to mediate responses to nicotine or PACAP. As in the secretogranin II gene, the SRE has also been implicated for basal and inducible expression of the atrial natriuretic factor gene (69).

Because of the well-characterized effects of SRE elements in mediating multiple growth factor effects (19, 63, 74, 75, 76), we investigated the effects of NGF or bFGF on secretogranin II expression. A 2.3-fold increase in secretogranin II mRNA was noted after NGF or bFGF (Fig. 3Go), in confirmation of previous findings (19). Secretogranin II promoter 5' deletions past the CRE box abolished the trophin responses (Fig. 9AGo), implicating the necessity of the CRE box. CRE domain transfer to a heterologous promoter also stimulated growth factor responses by 2.3-fold (Fig. 9BGo), suggesting that the CRE is necessary for these responses. Substantial (~66%) decrements in growth factor responses were noted after 5' promoter deletions past the SRE domain (Fig. 9AGo), and transfer of the SRE domain to neutral c-Fos promoter conferred growth factor responses by 2-fold (Fig. 9CGo). Thus, the SRE may, at least in part, play both necessary and sufficient roles in these responses.

In conclusion, the secretogranin II 5' flanking region is capable of conferring correct neuroendocrine cell type-specific expression onto the gene, as well as typical secretagogue responses. Both basal expression and secretagogue inducibility are localized to the proximal promoter. The proximal CRE box, at [-67 bp] TGACGTCA [-60 bp], seems to be the most crucial element in mediating these responses; whereas the SRE motif, at [-302 bp] GATGTCC [-296 bp], also has a substantial role in both responses.


   Acknowledgments
 
We thank Michael S. Simonson (Case Western Reserve University, Cleveland, OH) for the SRE-Luc plasmids.


   Footnotes
 
1 This work was supported by the Department of Veterans Affairs, NIH Grants HL-55583 (to D.T.O’C.) and DA-11311 (to S.K.M.), and the American Heart Association. The GenBank accession number is AF037451. Back

Received May 2, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rosa P, Zanini A 1981 Characterization of adenohypophysial polypeptides by two-dimensional gel electrophoresis. II. Sulfated and glycosylated polypeptides. Mol Cell Endocrinol 24:181–193[CrossRef][Medline]
  2. Rosa P, Hille A, Lee RW, Zanini A, De Camilli P, Huttner WB 1985 Secretogranins I and II: two tyrosine-sulfated secretory proteins common to a variety of cells secreting peptides by the regulated pathway. J Cell Biol 101:1999–2011[Abstract/Free Full Text]
  3. Fischer-Colbrie R, Laslop A, Kirchmair R 1995 Secretogranin II: molecular properties, regulation of biosynthesis and processing to the neuropeptide secretoneurin. Prog Neurobiol 46:49–70[CrossRef][Medline]
  4. Mahata SK, Mahata M, Marksteiner J, Sperk G, Fischer-Colbrie R, Winkler H 1991 Distribution of mRNAs for chromogranins A and B and secretogranin II in rat brain. Eur J Neurosci 3:895–904[CrossRef][Medline]
  5. Tooze SA, Weiss U, Huttner WB 1990 Requirement for GTP hydrolysis in the formation of secretory vesicles. Nature 347:207–208[CrossRef][Medline]
  6. Tooze SA, Flatmark T, Tooze J, Huttner WB 1991 Characterization of the immature secretory granule, an intermediate in granule biogenesis. J Cell Biol 115:1491–503[Abstract/Free Full Text]
  7. Huttner WB, Gerdes HH, Rosa P 1991 The granin (chromogranin/secretogranin) family. Trends Biochem Sci 16:27–30[CrossRef][Medline]
  8. Rosa P, Gerdes HH 1994 The granin protein family: markers for neuroendocrine cells and tools for the diagnosis of neuroendocrine tumors. J Endocrinol Invest 17:207–225[Medline]
  9. Kirchmair R, Hogue-Angeletti R, Gutierrez J, Fischer-Colbrie R, Winkler H 1993 Secretoneurin – a neuropeptide generated in brain, adrenal medulla and other endocrine tissues by proteolytic processing of secretogranin II (chromogranin C). Neuroscience 53:359–365[CrossRef][Medline]
  10. Saria A, Troger J, Kirchmair R, Fischer-Colbrie R, Hogue-Angeletti R, Winkler H 1993 Secretoneurin releases dopamine from rat striatal slices: a biological effect of a peptide derived from secretogranin II (chromogranin C). Neuroscience 54:1–4[CrossRef][Medline]
  11. Reinisch N, Kirchmair R, Kahler CM, Hogue-Angeletti R, Fischer-Colbrie R, Winkler H, Wiedermann CJ 1993 Attraction of human monocytes by the neuropeptide secretoneurin. FEBS Lett 334:41–44[CrossRef][Medline]
  12. Mahata SK, Mahata M, Steiner HJ, Fischer-Colbrie R, Winkler H 1992 In situ hybridization: mRNA levels of secretogranin II, neuropeptides and carboxypeptidase H in brains of salt-loaded and Brattleboro rats. Neuroscience 48:669–680[CrossRef][Medline]
  13. Mahata SK, Mahata M, Fischer-Colbrie R, Winkler H 1993 In situ hybridization: mRNA levels of secretogranin II, VGF and peptidylglycine alpha-amidating monooxygenase in brain of salt-loaded rats. Histochemistry 99:287–293[CrossRef][Medline]
  14. Mahata SK, Mahata M, Hortnagl H, Fischer-Colbrie R, Steiner HJ, Dietze O, Winkler H 1993 Concomitant changes of messenger ribonucleic acid levels of secretogranin II, VGF, vasopressin and oxytocin in the paraventricular nucleus of rats after adrenalectomy and during lactation. J Neuroendocrinol 5:323–330[CrossRef][Medline]
  15. Mahata SK, Marksteiner J, Sperk G, Mahata M, Gruber B, Fischer-Colbrie R, Winkler H 1992 Temporal lobe epilepsy of the rat: differential expression of mRNAs of chromogranin B, secretogranin II, synaptin/synaptophysin and p65 in subfield of the hippocampus. Brain Res Mol Brain Res 16:1–12[Medline]
  16. Mahata SK, Mahata M, Fischer-Colbrie R, Winkler H 1993 Reserpine causes differential changes in the mRNA levels of chromogranin B, secretogranin II, carboxypeptidase H, alpha-amidating monooxygenase, the vesicular amine transporter and of synaptin/synaptophysin in rat brain. Brain Res Mol Brain Res 19:83–92[Medline]
  17. Mahata M, Hortnagl H, Mahata SK, Fischer-Colbrie R, Winkler H 1993 Messenger RNA levels of chromogranin B, secretogranin II, and VGF in rat brain after AF64A-induced septohippocampal cholinergic lesions. J Neurochem 61:1648–1656[CrossRef][Medline]
  18. Laslop A, Mahata SK, Wolkersdorfer M, Mahata M, Srivastava M, Seidah NG, Fischer-Colbrie R, Winkler H 1994 Large dense-core vesicles in rat adrenal after reserpine: levels of mRNAs of soluble and membrane-bound constituents in chromaffin and ganglion cells indicate a biosynthesis of vesicles with higher secretory quanta. J Neurochem 62:2448–2456[Medline]
  19. Laslop A, Tschernitz C 1992 Effects of nerve growth factor on the biosynthesis of chromogranin A and B, secretogranin II and carboxypeptidase H in rat PC12 cells. Neuroscience 49:443–450[CrossRef][Medline]
  20. Tschernitz C, Laslop A, Eiter C, Kroesen S, Winkler H 1995 Biosynthesis of large dense-core vesicles in PC12 cells: effects of depolarization and second messengers on the mRNA levels of their constituents. Brain Res Mol Brain Res 31:131–140[Medline]
  21. Fischer-Colbrie R, Gutierrez J, Hsu CM, Iacangelo A, Eiden LE 1990 Sequence analysis, tissue distribution and regulation by cell depolarization, and second messengers of bovine secretogranin II (chromogranin C) mRNA. J Biol Chem 265:9208–9213[Abstract/Free Full Text]
  22. Bauer JW, Kirchmair R, Egger C, Fischer-Colbrie R 1993 Histamine induces a gene-specific synthesis regulation of secretogranin II but not of chromogranin A and B in chromaffin cells in a calcium-dependent manner. J Biol Chem 268:1586–1589[Abstract/Free Full Text]
  23. Wolkersdorfer M, Egger C, Laslop A, Fischer-Colbrie R 1996 Nicotine and prostaglandin E induce secretogranin II levels in bovine chromaffin cells. Brain Res Mol Brain Res 38:260–266[Medline]
  24. Scammell JG, Sumners C, Reutter MA, Valentine DL, Jones LC 1995 Regulation of secretogranin II mRNA in rat neuronal cultures. Brain Res Mol Brain Res 33:326–332[Medline]
  25. Schimmel A, Braunling O, Ruther U, Huttner WB, Gerdes HH 1992 The organisation of the mouse secretogranin II gene. FEBS Lett 314:375–380[CrossRef][Medline]
  26. Jones LC, Day RN, Pittler SJ, Valentine DL, Scammell JG 1996 Cell-specific expression of the rat secretogranin II promoter. Endocrinology 137:3815–3822[Abstract]
  27. Mahata SK, Kozak CA, Szpirer J, Szpirer C, Modi WS, Gerdes HH, Huttner WB, O’Connor DT 1996 Dispersion of chromogranin/secretogranin secretory protein family loci in mammalian genomes. Genomics 33:135–139[CrossRef][Medline]
  28. Pohl TM, Phillips E, Song KY, Gerdes HH, Huttner WB, Ruther U 1990 The organisation othe mouse chromogranin B (secretogranin I) gene. FEBS Lett 262:219–224[CrossRef][Medline]
  29. Wu HJ, Rozansky DJ, Parmer RJ, Gill BM, O’Connor DT 1991 Structure and function of the chromogranin A gene. Clues to evolution and tissue-specific expression. J Biol Chem 266:13130–13134[Abstract/Free Full Text]
  30. Iacangelo AL, Grimes M, Eiden LE 1991 The bovine chromogranin A gene: structural basis for hormone regulation and generation of biologically active peptides. Mol Endocrinol 5:1651–1660[Abstract]
  31. Mouland AJ, Bevan S, White JH, Hendy GN 1994 Human chromogranin A gene. Molecular cloning, structural analysis, and neuroendocrine cell-specific expression. J Biol Chem 269:6918–6926[Abstract/Free Full Text]
  32. Cibelli G, Jungling S, Schoch S, Gerdes HH, Thiel G 1996 Identification of a functional cAMP response element in the secretogranin II gene. Eur J Biochem 236:171–179[Medline]
  33. Wu H, Mahata SK, Mahata M, Webster NJ, Parmer RJ, O’Connor DT 1995 A functional cyclic AMP response element plays a crucial role in neuroendocrine cell type-specific expression of the secretory granule protein chromogranin A. J Clin Invest 96:568–578
  34. Canaff L, Bevan S, Wheeler DG, Mouland AJ, Rehfuss RP, White JH, Hendy GN 1998 Analysis of molecular mechanisms controlling neuroendocrine cell specific transcription of the chromogranin A gene. Endocrinology 139:1184–1196[Abstract/Free Full Text]
  35. Nolan EM, Cheung TC, Burton DW, Deftos LJ 1995 Identification and characterization of a neuroendocrine-specific 5'-regulatory region of the human chromogranin A gene. Endocrinology 136:5632–5638[Abstract]
  36. Tang K, Wu H, Mahata SK, Taupenot L, Rozansky DJ, Parmer RJ, O’Connor DT 1996 Stimulus-transcription coupling in pheochromocytoma cells. Promoter region-specific activation of chromogranin A biosynthesis. J Biol Chem 271:28382–28390[Abstract/Free Full Text]
  37. Tang K, Wu H, Mahata SK, Mahata M, Gill BM, Parmer RJ, O’Connor DT 1997 Stimulus coupling to transcription versus secretion in pheochromocytoma cells. Convergent and divergent signal transduction pathways and the crucial roles for route of cytosolic calcium entry and protein kinase C. J Clin Invest 100:1180–1192[Medline]
  38. Mahata SK, Mahata M, Wu H, Parmer RJ, O’Connor DT 1999 Neurotrophin activation of catecholamine storage vesicle protein gene expression: signaling to chromogranin A biosynthesis. Neuroscience 88:405–424[CrossRef][Medline]
  39. Taupenot L, Mahata SK, Wu H, O’Connor DT 1998 Peptidergic activation of transcription and secretion in chromaffin cells. Cis and trans signaling determinants of pituitary adenylyl cyclase-activating polypeptide (PACAP). J Clin Invest 101:863–876[Medline]
  40. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6:454–458[Medline]
  41. Herman WH, Simonson MS 1995 Nuclear signaling by endothelin-1. A Ras pathway for activation of the c-fos serum response element. J Biol Chem 270:11654–11661[Abstract/Free Full Text]
  42. Greene LA, Tischler AS 1976 Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci USA 73:2424–2428[Abstract/Free Full Text]
  43. Windle JJ, Weiner RI, Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Mol Endocrinol 4:597–603[Abstract]
  44. Mellon PL, Windle JJ, Goldsmith PC, Padula CA, Roberts JL, Weiner RI 1990 Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5:1–10[CrossRef][Medline]
  45. Mellon PL, Wetsel WC, Windle JJ, Valenca MM, Goldsmith PC, Whyte DB, Eraly SA, Negro-Vilar A, Weiner RI 1992 Immortalized hypothalamic gonadotropin-releasing hormone neurons. Ciba Found Symp 168:104–117; discussion 117–126[Medline]
  46. Dickerson IM, Mains RE 1990 Cell-type specific posttranslational processing of peptides by different pituitary cell lines. Endocrinology 127:133–140[Abstract]
  47. Carter Bancroft F 1981 Functionally differentiated cell lines. Alan R. Liss, Inc., New York, pp 47–59
  48. Suri C, Fung BP, Tischler AS, Chikaraishi DM 1993 Catecholaminergic cell lines from the brain and adrenal glands of tyrosine hydroxylase-SV40 T antigen transgenic mice. J Neurosci 13:1280–1291[Abstract]
  49. Felgner PL, Gadek TR, Holm M, Roman R, Chan HW, Wenz M, Northrop JP, Ringold GM, Danielsen M 1987 Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci USA 84:7413–7417[Abstract/Free Full Text]
  50. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  51. de Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725–737[Abstract/Free Full Text]
  52. Gorman CM, Moffat LF, Howard BH 1982 Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044–1051[Abstract/Free Full Text]
  53. Feinberg AP, Vogelstein B 1984 A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Addendum. Anal Biochem 137:266–267[CrossRef][Medline]
  54. Gerdes HH, Phillips E, Huttner WB 1988 The primary structure of rat secretogranin II deduced from a cDNA sequence. Nucleic Acids Res 16:11811[Free Full Text]
  55. Hasel KW, Sutcliffe JG 1990 Nucleotide sequence of a cDNA coding for mouse cyclophilin. Nucleic Acids Res 18:4019[Free Full Text]
  56. Livett BG, Boksa P, Dean DM, Mizobe F, Lindenbaum MH 1983 Use of isolated chromaffin cells to study basic release mechanisms. J Auton Nerv Syst 7:59–86[CrossRef][Medline]
  57. Hill CS, Treisman R 1995 Differential activation of c-fos promoter elements by serum, lysophosphatidic acid, G proteins and polypeptide growth factors. EMBO J 14:5037–5047[Medline]
  58. Treisman R 1990 The SRE: a growth factor responsive transcriptional regulator. Semin Cancer Biol 1:47–58[Medline]
  59. Tischler AS, Perlman RL, Costopoulos D, Horwitz J 1985 Vasoactive intestinal peptide increases tyrosine hydroxylase activity in normal and neoplastic rat chromaffin cell cultures. Neurosci Lett 61:141–146[CrossRef][Medline]
  60. Przywara DA, Guo X, Angelilli ML, Wakade TD, Wakade AR 1996 A non-cholinergic transmitter, pituitary adenylate cyclase-activating polypeptide, utilizes a novel mechanism to evoke catecholamine secretion in rat adrenal chromaffin cells. J Biol Chem 271:10545–10550[Abstract/Free Full Text]
  61. Watanabe T, Masuo Y, Matsumoto H, Suzuki N, Ohtaki T, Masuda Y, Kitada C, Tsuda M, Fujino M 1992 Pituitary adenylate cyclase activating polypeptide provokes cultured rat chromaffin cells to secrete adrenaline. Biochem Biophys Res Commun 182:403–411[CrossRef][Medline]
  62. Rius RA, Guidotti A, Costa E 1994 Pituitary adenylate cyclase activating polypeptide (PACAP) potently enhances tyrosine hydroxylase (TH) expression in adrenal chromaffin cells. Life Sci 54:1735–1743[CrossRef][Medline]
  63. Lee NH, Weinstock KG, Kirkness EF, Earle-Hughes JA, Fuldner RA, Marmaros S, Glodek A, Gocayne JD, Adams MD, Kerlavage AR, Fraser CM, Venter JC 1995 Comparative expressed-sequence-tag analysis of differential gene expression profiles in PC-12 cells before and after nerve growth factor treatment. Proc Natl Acad Sci USA 92:8303–8307
  64. Lazaroff M, Patankar S, Yoon SO, Chikaraishi DM 1995 The cyclic AMP response element directs tyrosine hydroxylase expression in catecholaminergic central and peripheral nervous system cell lines from transgenic mice. J Biol Chem 270:21579–21589[Abstract/Free Full Text]
  65. Di Rocco G, Pennuto M, Illi B, Canu N, Filocamo G, Trani E, Rinaldi AM, Possenti R, Mandolesi G, Sirinian MI, Jucker R, Levi A, Nasi S 1997 Interplay of the E box, the cyclic AMP response element, and HTF4/HEB in transcriptional regulation of the neurospecific, neurotrophin-inducible vgf gene. Mol Cell Biol 17:1244–1253[Abstract]
  66. Gao B, Chen J, Johnson C, Kunos G 1997 Both the cyclic AMP response element and the activator protein 2 binding site mediate basal and cyclic AMP-induced transcription from the dominant promoter of the rat alpha 1B-adrenergic receptor gene in DDT1MF-2 cells. Mol Pharmacol 52:1019–1026[Abstract/Free Full Text]