| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Service de gastroentérologie (N.D., E.C., Z.C., J.M.), Départment Médecine, Faculté de Médecine, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4; Health Canada (G.M., R.A.A.), Therapeutic Drugs Programme, Life Sciences Division, Biotechnology Section, PLC2201C, Sir F. G. Banting Research Centre, Tunney’s Pasture, Ottawa, Ontario, Canada, K1A 0L2; Department of Biochem. Immunol. Microbiol.(J.B., R.A.A.), Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5; and Department Physiology (A.L.), Faculty of Veterinary Sciences, University of Extremadura, 10.07 Caceres, Spain
Address all correspondence and requests for reprints to: Dr. Jean Morisset, Service de Gastroentérologie, Département Médecine, Faculté Médecine, Sherbrooke, Québec, Canada, J1H5N4. E-mail: jmori7{at}courrier.usherb.ca
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although somatostatin receptors are coupled to multiple intracellular signaling pathways, the mechanism by which somatostatin inhibits cell growth is not completely understood. To explain this antiproliferative effect, modulation of a phosphotyrosine phosphatase (PTPase) activity has been postulated as one of the intracellular events responsible for somatostatin’s cell growth inhibition (9, 10, 11). In MIA PaCa-2 cells, a human pancreatic cancer cell line, the somatostatin analogues RC-160 and RC-121 caused rapid stimulation of a membrane PTPase activity and induced dephosphorylation of the epidermal growth factor (EGF) receptor, resulting in inhibition of the EGF proliferative activity (9, 12). A PTPase of 70 kDa, identified as SHP-1, copurified with the membrane somatostatin receptor isolated from pancreatic acinar cells expressing the sst2 receptor (13). Recently, SHP-1 was found constitutively associated with sst2, and binding of somatostatin to its receptor caused the enzyme rapid dissociation from the receptor, with an increase in its activity (14). In CHO cells transfected with the sst5 subtype, the antiproliferative effect of the somatostatin analog RC-160 was not abolished by specific inhibitors of tyrosine and serine/threonine phosphatases, indicating that a phosphatase was not involved in the negative growth signal coupled to this receptor (15). It seems, however, that a cyclic guanosine monophosphate-dependent kinase pathway was involved in this antiproliferative signal, because a specific cyclic guanosine monophosphate inhibitor abolished the growth inhibition mediated by the somatostatin analog (16).
The somatostatin analog BIM 214 also inhibited MAP kinase activation by 20% serum; this enzyme cascade is known to have a pivotal role in the signal transduction pathways leading to cell proliferation (17). It was also reported that the widespread inhibitory actions of somatostatin could be mediated by its ability to inhibit the expression of the immediate early genes c-fos and c-jun (18), as well as AP-1 binding and transcriptional activity (19).
Because pancreatic cancers have very poor prognosis, somatostatin was proposed as a potential inhibitor of pancreatic tumor growth by affecting the tumor itself (20). Upp et al. (21) reported that the somatostatin analog SMS 201–995 (SMS) inhibited growth of two xenografted human pancreatic cancers in nude mice. In vitro, this same analog caused growth inhibition of the pancreatic cancer cells AR4–2J (6) by stimulating a membrane tyrosine phosphatase activity (22). Furthermore, it was previously reported that somatostatin inhibited EGF-stimulated growth of the MIA PaCa-2 cells, a human pancreatic cancer cell line (5); this effect could not be reproduced in this same cell line and in the PANC-1 cells, another human pancreatic cancer cell line (23). Finally, Gillepsie et al. (24) were unable to detect any somatostatin receptors in these same two human pancreatic cancer cell lines. Because of these conflicting results, our study was initiated to reinvestigate the growth regulation of the MIA PaCa-2 and PANC-1 cells by somatostatin and to characterize the intracellular events mediating the action of somatostatin in these two human pancreatic cancer cell lines of ductal origin.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell culture
MIA PaCa-2 and PANC-1 pancreatic carcinoma cells were obtained
from American Type Culture Collection (Bethesda, MD). Cells were grown in DMEM containing 10% FBS,
penicillin-streptomycin, and glutamine. Cells were cultivated at 37 C
in humidified air containing 5% CO2.
Growth assays
All experiments were performed starting with confluent cells
that were subsequently plated for growth assay in 35-mm diameter dishes
[10 cm2 at 1 x 104 cells/ml (2
ml/dish)]. After the attachment phase, cells were transferred to
serum-free medium and allowed to become quiescent overnight. The next
day, fresh serum-free medium was added, and the cells were then
supplemented daily for 2 or 4 days with somatostatin (SS-14) or SMS at
concentrations from 10-12–10-6 M
alone or in combination with 1 nM EGF. Cell growth was
measured, after 2 or 4 days, with an electronic Coulter model 2m
counter and with an hemacytometer.
Survey of somatostatin receptor subtype expression by
RT-PCR
Total cellular RNA was prepared from nondiseased whole human
pancreas, cultured skin fibroblasts (strain GM38; NIGMS Human Genetic
Mutant Cell Repository, Camden, NJ), and human pancreatic
adenocarcinoma cell lines MIA PaCa-2 and PANC-1 (American Type Culture Collection, Rockville, MD) by acidified guanidium
isothiocyanate lysis and phenol extraction (25). Poly A+ messenger RNA
(mRNA) isolates from nondiseased human liver and pancreas were
purchased from CLONTECH Laboratories, Inc. (Palo Alto,
CA). The integrity of RNA preparations was verified by
formaldehyde/agarose gel electrophoresis, Northern blot hybridization
against several probes (including ß-actin, glyceraldehyde phosphate
dehydrogenase, c-myc, and c-fos), and RT-PCR for
the region spanning exons 5–8 of the human p53 tumor suppressor gene
(data nto shown). Complementary DNA (cDNA) pools were prepared in
20-µl final reaction volumes, from 1 µg total RNA or 0.5 µg
polyA+ mRNA, by oligo dT-primed RT (Superscript II) under
specified conditions (Gibco Life Technologies,
Mississauga, Ontario, Canada). cDNAs (2 ul) were amplified for human
sst subtypes 1–5 (in individual reactions) by the PCR in the presence
of 1x PCR buffer II [10 mM Tris-HCl (pH 8.3), 50
mM KCl], 1.5 mM MgCl2, 2.5 U
TaqGold DNA polymerase (ABI/Perkin-Elmer Corp.,
Mississauga, Ontario, Canada), 0.2 mM deoxynucleotide
triphosphates, and 0.2 mM each forward and reverse
oligonucleotide primers. The nucleotide sequences of the forward (F)
and reverse (R) primers for the five human somatostatin receptor
subtypes were: hsst 1 (F) 5'GCAACATGCTCATGC 3', hsst1 (R) 5'
GCGTTGTCCATCCAG3'; hsst2 (F) 5' ATGGACATGGCGGATGAGCCACTC 3', hsst2 (R)
5' TACTGGTTTGGAGGTCTCCATTGAG 3'; hsst 3 (F) 5' TGGGCACCCTCGTGCCAGCGG
3', sst3 (R) 5' GGGCGGCCGCTCCTGCCCGC 3'; sst4 (F) 5'
CTGAACCTCTTCGTGACCAG CCTT 3', sst4 (R) 5' CTGGTTGCAGGGCTTCCTGCT 3';
sst5 (F) 5' GTGCAGGAGGGCGGTACC 3', sst5 (R) 5' TGGACGCGGCTCCGTGGC 3'.
These corresponded to the bp positions recently reported by Buscail
et al. (26). For sst1, -2, -4, and -5, amplification runs
consisted of an initial 12-min activation/denaturation step at 95 C
followed by 35 cycles of denaturation (70 sec at 95 C), annealing (70
sec at 60 C), and extension (2 min at 72 C), which were then linked to
a final 10-min polishing step at 72 C. Cycling parameters were
essentially the same for sst3 except that the annealing temperature was
raised to 65 C. Equivalent quantities of nonreverse transcribed total
or poly A+ mRNAs were included in parallel PCR runs as in-line controls
for genomic DNA carryover. Amplified products (half of PCR reactions)
were resolved against 1-kbp molecular size ladder markers (Gibco Life Technologies) on 1% (wt/vol)
agarose/Tris-borate-EDTA gels, stained with ethidium bromide,
and photographed under UV light.
Preparation of plasma membrane fractions for tyrosine kinase and
tyrosine phosphatase activities
Cells were grown in Petri dishes (100 mm) until they reached
75% confluency. They were then serum-starved for 24 h and treated
with increasing concentrations of SS-14 or SMS
(10-12–10-6 M) alone or in
combination with 1 nM EGF. After various time periods of
stimulation, cells were rinsed with PBS before adding an ice-cold
hypotonic lysing buffer containing 10 mM HEPES (pH 7.2), 5
mM KCl, 1 mM dithiothreitol (DTT), 1.5
mM MgCl2, 1 mM EGTA, 1
µM aprotinin, and 2 µM leupeptin with 100
mM orthovanadate for the tyrosine kinase assay. Cells were
collected with a rubber policeman, homogenized by repeated strokes, and
centrifuged at 1,000 x g for 5 min at 4 C.
Supernatants were collected and ultracentrifuged at 50,000 x
g for 30 min at 4 C. Membranes were resuspended in the
lysing buffer and used for protein, tyrosine kinase, and tyrosine
phosphatase assays.
Tyrosine kinase and PTPase activities
Tyrosine kinase and tyrosine phosphatase activities were
measured using a nonradioactive kit. Briefly, enzyme activities were
measured by incubating a synthetic peptide substrate (corresponding to
the aminoacids 6–20 of the cell division kinase p34 cdc2, which is
biotin-labeled at the amino-terminus) or a phosphopeptide substrate
with ATP/Mg, 5x assay buffer [0.25 M Tris HCl (pH 7.8),
with or without 500 µM orthovanadate and 25
mM mercaptoethanol] and 10 µg of cell membrane for 30
min at 37 C. The reaction was stopped and an aliquot of the reaction
mixture was transferred to a microplate, where the phosphorylated or
dephosphorylated substrate was immobilized by binding to the
streptavidin-coated microplate. After subsequent washes, the fraction
of phosphorylated or dephosphorylated substrate was determined
immunochemically with a highly specific antiphosphotyrosine antibody
directly conjugated to peroxidase. The absorbance was measured at 405
nm, with a reference wavelength at 490 nm, using a microplate reader.
The results were compared with a standard curve and were expressed as
phosphate incorporated (tyrosine kinase) or phosphate released
(tyrosine phosphatase) per minute per milligram (tyrosine kinase) or
micrograms of proteins (tyrosine phosphatase).
Preparation of cytosolic fractions for MAPK activity
Cells were grown in Petri dishes (100 mm) until they reached
75% confluency. They were then serum-starved for 24 h and
pretreated for 30 min with SS-14 or SMS and stimulated for an
additional 5 min with 1 nM EGF. Cells were also exposed to
increasing concentrations of SS-14 or SMS for 5, 30, and 60 min. After
stimulation, cells were rinsed with PBS before adding an ice-cold
hypotonic lysing buffer containing 10 mM Tris HCl (pH 8.0),
5 mM KCl, 1 mM DTT, 1.5 mM
MgCl2, 1 mM EGTA, 1 µM aprotinin,
2 µM leupeptin, and 100 µM orthovanadate.
Cells were collected with a rubber policeman, homogenized by repeated
strokes, ultracentrifuged at 100,000 x g for 30 min at
4 C in a Beckman Coulter, Inc. TL 100 centrifuge (rotor,
TLS55), and the cytosolic fractions were collected. After the addition
of Laemmli buffer, samples were boiled for 5 min before the MAP kinase
assays. An aliquot of the supernatant was kept for protein assay,
determined according to Bradford (1976).
MAP kinases in gel assay
MAP kinase activities were determined in renatured SDS
polyacrylamide gels according to the method of Kameshita and Fujisawa
(27). Briefly, cell extracts (20 µg protein) were resolved on a 10%
SDS-polyacrylamide gel copolymerized with 0.25 mg/ml myelin basic
protein. After electrophoresis, gels were washed with four changes of
50 mM Tris, pH 8.0, containing 20% propanol. The gels were
then denatured with two changes, of 60 min each, of 120 ml denaturating
buffer containing 6 M guanidine hydrochloride, 50
mM Tris (pH 8.0), and 5 mM mercaptoethanol. The
enzymes on gel were then renatured with four changes (2 x 60 min,
1 x overnight, and 1 x 60 min,) of 250 ml renaturating
buffer containing 50 mM Tris (pH 8.0), 0,4% Tween 20, and
5 mM mercaptoethanol at 4 C. The renatured gels were then
incubated in an assay buffer containing 40 mM HEPES (pH
8.0), 10 mM MgCl2, 2 mM DTT, and
0.1 mM EGTA at room temperature for 30 min. The MAP kinase
activities were determined by incubating the gels into 20 ml of the
assay buffer, containing 20 µM ATP and 100 uCi
32P-ATP, at room temperature for 2 h. The reaction was
then stopped by adding 250 ml of a solution containing 5%
trichloroacetic acid and 10 mM sodium pyrophosphate,
followed by washing with the same solution nine times over a period of
1.5 h to eliminate nonspecific radioactivity in the gels. Gels
were exposed to Kodak X-OMAT film (Montréal, Québec, Canada)
overnight, at -70 C, before development. Quantification of the MAP
kinase activity was carried out with a scanning densitometer (Bio-Rad
Imagin Densitometer model GS-670, Mississauga, Ontario,
Canada).
Immune complex SHP-1, phosphatase assay, and analysis of
steady-state SHP-1 expression by Western blot hybridization
Cells were washed twice with cold PBS and lysed in Triton X-100
lysis buffer (1% Triton, 50 mM Tris-HCl (pH 7.5), 100
mM NaCl, 50 mM NaF, 5 mM EDTA, 500
µM orthovanadate, 30 mM sodium pyrophosphate,
0.1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin,
and 5 µg/ml aprotinin) for 15 min at 4 C. Insoluble material was
removed by centrifugation at 1,000 x g for 5 min at 4
C. Soluble proteins (1 mg) were incubated with 3 µg of anti-SHP-1 at
4 C. After 3 h, protein G-sepharose was added and allowed to form
complex for 1 h at 4 C. Immune complexes were washed three times
with Triton X-100 lysis buffer. An aliquot of these immunoprecipitates
was retained and added to 4x Laemmli buffer for Western blotting.
Immune complexes were then washed three times with phosphatase buffer
(50 mM HEPES (pH 7.0), 60 mM NaCl, 60
mM KCl, 0.1 mM phenylmethylsulfonyl fluoride, 1
µM leupeptin, and 5 µg/ml aprotinin). Phosphatase
activity was assayed by resuspending the final pellet in a total vol of
80 ul of the above phosphatase buffer, adjusted to pH 5.5, containing 1
mg/ml BSA, 5 mM EDTA, and 10 mM DTT. The
reaction was initiated by the addition of paranitrophenylphosphate
(pNPP) (10 mM, final concentration) as substrate, with 20
µM Microcystin LR to inhibit any serine threonine
phosphatase activity (28), for 30 min at 30 C. The reaction was stopped
by the addition of 900 µl 1 N NaOH, and the absorbance of
the samples was measured at 410 nm. For immunoblotting,
immunoprecipitated proteins were resolved through 10%
SDS-polyacrylamide gels and transferred to a nitrocellulose membrane.
The membranes were blocked with 6% milk overnight and then incubated
in TBS-Tween-3% milk in the presence of anti-SHP-1 at a dilution of
1/1000 at room temperature for 3 h or with antiphosphotyrosine
(1/200) for 4 h at room temperature. After five washes (30 min)
with TBS-Tween, membranes were incubated with antirabbit or antimouse
IgG antibodies conjugated with horseradish peroxidase for 1 h. The
SHP-1 bands, as well as the phosphotyrosine bands, were identified by
super signal reagents, and the emitted light was recorded on film. MIA
PaCa-2 and PANC-1, cultured in the log phase of growth (2 x
106 viable cells per 100-mm diameter dish) were rinsed
twice with ice-cold PBS, overlaid with 1 ml SDS/PAGE lysis buffer
[62.5 mM Tris-HCl (pH 6.8), 2% (wt/vol) SDS, 10%
(wt/vol) glycerol, 0.5% (vol/vol) ß-mercaptoethanol, and 1
mM phenylmethlysulfonylfluoride] and incubated on ice for
5 min to permit lysis. Crude extracts were then transferred to sterile
polypropylene microcentrifuge tubes, boiled for 5 min, and cleared by
centrifugation (16,000 x g for 10 min at room
temperature). Ten micrograms of protein were mixed with an equal volume
of 2x Leammli buffer, boiled for 3 min, and loaded in the individual
lanes of a 5% stacking/12.5% resolving PAGel. The samples were
fractionated by electrophoresis and electroblotted to polyvinylidene
difluoride membranes (Millipore Corp. Canada, Mississauga,
Ontario, Canada) under standard conditions. SHP-1 protein expression
was detected by chemiluminescence using a peroxidase-coupled sheep
antimouse IgG (Boehringer Canada, Laval, Québec, Canada)
directed against a mouse monoclonal antibody raised against the 12-kDa
C-terminal region (amino acids 492–597) of human breast SHP-1
(Transduction Laboratories, Inc., Lexington, KY). A total
protein lysate from Jurkat cells served as the positive control.
Statistical analysis
Results were analyzed by Student’s t test. Results
were considered significantly different from control at
P < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
shows the results of
RT-PCR profiling runs for pancreatic cDNAs generated from total RNA
(top electrophoregram) or oligodT column fractionated poly
A+ mRNA (bottom electrophoregrams). When the contribution of
nonreverse transcribed in-line control amplifications are factored into
RT-PCR runs using total RNA as cDNA template, the human pancreas shows
expression of all sst receptor subtypes except sst3. These data agree
very well with those reported by Buscail et al. (26). The
signal-to-noise ratio of the assay was increased somewhat when poly A+
mRNA was used as starting material for first-strand cDNA synthesis, but
the contribution of genomic DNA dropped to insignificant levels. Under
these conditions, the sst receptor subtype expression profile was not
only confirmed, but the increase in sensitivity provided by the
enrichment of the RNA fraction revealed discernible (albeit comparably
weak) levels of sst3. Taken together, steady-state pancreatic sst
receptor expression seems to rank in the following order: (sst1 =
sst2 = sst5) > sst4 > sst3.
|
shows data obtained after processing cDNAs derived from total
RNA from pancreas and both pancreatic adenocarcinoma cell lines
(top left electrophoregram) and for poly A+ and total
RNA-derived cDNAs from human liver and skin fibroblasts, respectively
(top right electrophoregram). When genomic DNA carryover was
factored in (bottom electrophoregram; no RT-controls), MIA
PaCa-2 cells were found to express sst1, -2, and -4 at elevated levels
and sst3 and sst5 at comparably weak levels. By contrast, PANC-1 cells
expressed sst5 predominantly, whereas the steady-state expression of
sst1, -2, and -4 were comparably weak. These data reflect those
recently reported by Fisher et al. (29), except for MIA
PaCa-2, for which these authors only detected expression of sst1. The
discrepancy could be attributed to the different primer pair sets and
cycling conditions used by these authors. Expression of sst3 was
essentially undetectable. The profiles also reveal that sst5 expression
was greatly enhanced in both adenocarcinoma lines vs.
pancreas. MIA PaCa-2 also shows elevated levels of sst4. In PANC-1
cells, sst2 and sst4 levels are lower than those encountered in the
pancreas. The specificity and semiquantitative nature of the assay was
assessed by profiling RNAs from human liver and skin fibroblasts
(top right panel). When genomic DNA carryover was factored
in (extreme right lanes), human liver showed sst receptor
subtype expression in the following rank order: (sst1 = sst2) >
sst5. Transcripts encoding sst3 and sst4 were not detected. Human GM38
skin fibroblasts had the profile: sst1 > sst5 > sst3
> sst2 > sst4.
Effects of SS-14 and SMS on basal and EGF-stimulated PANC-1 cell
growth
To investigate the regulation of the PANC-1 cell growth by
somatostatin, cells were made quiescent by serum deprivation, and their
proliferation was evaluated in response to increasing concentrations
(1012–10-6 M) of SS-14 or SMS. As
shown in Fig. 2A, addition of SS-14 or
SMS to the medium for 2 days resulted in comparable decreases in cell
proliferation, as indicated by the reduction in cell numbers. The
maximal growth inhibition was observed at 0.1 and 1 µM,
was in the order of 20%, and was significant. As a complementary
evaluation of the inhibitory effects of SS-14 and SMS on PANC-1 cell
growth, we next determined whether the two peptides can inhibit
proliferation of these PANC-1 cells stimulated by the known mitogenic
growth factor EGF (30). PANC-1 cells grown in serum-free medium for
24 h were then exposed, for 48 h, to 1 nM EGF
alone or in combination with increasing concentrations of SS-14 or SMS.
As shown in Fig. 2B, EGF caused a significant 50% increase in PANC-1
cell proliferation after 2 days, a growth rate which was reduced by
increasing concentrations of SS-14 and SMS, with a significant maximal
inhibitory effect of 47% at 0.1 and 1 µM. Inhibitory
effects of somatostatin of similar magnitude were also observed in
these cells stimulated by FGF-2, cerulein, a cholecystokinin analog,
and bombesin (data not shown).
|
, SS-14 and SMS were both associated
with maximal activation of membrane PTPase activity, with significant
increases of 50–67% at concentrations of 10 nM to 1
µM. In response to 1 µM SS-14 or SMS,
PTPase activation was maximal within 5 min (+67%), remained maximal at
30 min, and returned to control values at 60 min (Fig. 3B). This
activation was also totally inhibited by preincubation of the cells for
30 min with 100 µM orthovanadate, a specific tyrosine
phosphatase inhibitor (data not shown).
|
, SS-14 and SMS are
equipotent activators of SHP-1, with significant increases of 46% and
25%, respectively, at 1 and 5 min and a return to basal values at 30
min. This activation was specific, because it was inhibited by 100
µM orthovanadate (data not shown). Somatostatin is not
the unique SHP-1 activator in these cells, because EGF can also cause
the enzyme activation with a comparable efficacy exhibited by SS-14 or
SMS, as shown in Fig. 4B. The EGF stimulation was not affected by the
cells incubation with SS-14 or SMS for the last minute within a 5-min
stimulation by EGF (time, 1 min); with simultaneous incubations of
SS-14 or SMS with EGF for 5 min (time, 5 min); or with a 25-min
preincubation with SS-14 or SMS followed with 5 min with EGF (time, 30
min). It was recently demonstrated that SHP-1 can be phosphorylated on
tyrosine in unstimulated CHO cells transfected with the sst2 receptor,
whereas upon stimulation by SMS, a rapid and transient
dephosphorylation on tyrosine occurred (14). As shown in Fig. 5, SHP-1 is indeed phosphorylated on
tyrosine under basal condition in PANC-1 cells (line 1), but treatment
with 1 µM SS-14 failed to induce any dephosphorylation of
the enzyme after 1 (line 2), 5 (line 3), or 30 min (line 4) of
stimulation.
|
|
, SS-14
and SMS induced a concentration-dependent inhibition of basal tyrosine
kinase activity in the PANC-1 cells, with a maximal reduction of
35–40% at 1 µM. Similarly, the 32% increase in
tyrosine kinase activity, observed in response to 1 nM EGF,
was significantly reduced by increasing concentrations of SS-14 and
SMS, with a maximal inhibition of 48–58% at 1 µM of
both hormones (Fig. 6B).
|
, A and B). The effect on the p42 kinase
activity was also observed at 0.1 µM. In these same
cells, we previously reported that addition of 1 nM EGF
stimulated p42 MAPK activity by 40% (33). In this study, data indicate
that SS-14 partially, at 0.1 µM, and totally blocked, at
1 µM, EGF-stimulated p42 MAPK activity (Fig. 7, C and D).
As previously observed (33), we could not stimulate nor inhibit p44 MAP
kinase activity by somatostatin (Fig. 7B) nor by EGF (Fig. 7D).
|
, addition of SS-14 or SMS for 2 days
had no effect on MIA PaCa-2 cell growth; however, when cells were grown
in serum-free medium for 4 days, with daily addition of increasing
concentrations of SS-14 or SMS, significant growth of the MIA PaCa-2
cells was observed, with a maximal effect at 1–10 nM (Fig. 8B). After 4 days in culture, SMS was slightly more efficient (+38%)
than SS-14 (+20%) in inducing growth. To confirm the lack of
inhibitory effect of SS-14 and SMS on the MIA PaCa-2 cell growth, we
determined whether SS-14 and SMS can inhibit their growth in response
to EGF, a known mitogenic factor for these cells. Cells were then
exposed, for 48 h, to 1 nM EGF alone or in combination
with increasing concentrations of SS-14 or SMS. As shown in Fig. 8C, SS-14 or SMS failed to inhibit EGF-stimulated cell proliferation;
similar lack of inhibition was also observed in response to growth
stimulation by FGF-2, IGF-1, cerulein, bombesin, and serum (data not
shown).
|
, SMS and SS-14 induced significant
increases in membrane PTPase activity; maximal activation of 23% (SMS)
and 20% (SS-14) were obtained at 1 nM. PTPase activation
by both peptides occurred within 5 min, to reach a peak at 60 min and a
return to control values at 24 h (Fig. 9B). Furthermore, SHP-1
activity, which has been associated with the somatostatin receptor
sst2, and thought to mediate growth inhibition (14), could not be
estimated in these MIA PaCa-2 cells (data not shown); and its absence
in these cells was further confirmed by Western blot, as shown in Fig. 10.
|
|
, both peptides
dose-dependently increased tyrosine kinase activities, with maximal
activation at 1 nM with SS-14 (+ 85%) being more efficient
than SMS (+ 36%). Tyrosine kinase activation by SS-14 and SMS was
significant within 5 min (+74%, +30%), with peak activation at 30 min
(+85%, +37%) and a return to basal values at 60 min (Fig. 11B).
Genistein, a tyrosine kinase inhibitor, totally inhibited tyrosine
activation by SS-14 or SMS and caused inhibition of MIA PaCa-2 cell
proliferation (data not shown). As for the growth studies, SS-14 and
SMS failed to inhibit basal and growth factor-stimulated tyrosine
kinase activity (data not shown).
|
, A and B, 1 nM EGF alone
or in the presence of increasing concentrations
(10-9–10-6 M) of SS-14 failed to
activate p44 and p42 MAP kinase activities; a failure also observed
with increasing concentrations of SS-14 or SMS alone (data not shown),
However, as observed in Fig. 12, C and D, that 1 nM EGF
significantly increased p38 kinase activity by 3-fold, an effect which
could not be inhibited by preincubating the cells for 30 min with
increasing concentrations of SS-14. Similarly to p44 and p42 kinases,
SS-14 and SMS alone did not activate p38 kinase (data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Somatostatin is recognized as a growth-inhibitory factor in normal rat pancreas (35), in AR4–2J cells (a rat pancreatic acinar cancer cell line) (6), and in MIA PaCa-2 cells (a human pancreatic cancer cell line of ductal origin) (5, 9). Our data indicate that MIA PaCa-2 cells express sst1, -2 and -4 at elevated levels and sst3 and 5 at weak levels, whereas PANC-1 cells express sst5 predominantly and sst1, -2, and -4 at weak levels. The presence of these receptor subtypes themselves, on both cell lines, cannot explain the opposite effects of SS-14 and SMS on these cells and, therefore, suggests differences in the intracellular coupling systems.
Numerous studies reported that somatostatin can stimulate a PTPase activity (9, 10, 11) and especially that of SHP-1 (10, 14), whose activation may be one of the early steps leading to its antiproliferative action. In PANC-1 cells, we have demonstrated that SS-14 and its structural analog SMS can increase membrane PTPase activity and also that of SHP-1. The finding that somatostatin significantly stimulated SHP-1 activity maximally within 1 min suggests its early implication in the cascade reactions that it initiated. The fact that orthovanadate, a tyrosine phosphatase inhibitor, prevented SS-14 and SMS-induced growth inhibition in these cells strongly argues in favor of PTPase involvement in the somatostatin-induced antiproliferative signal (data not shown). This inhibition of PANC-1 cell growth by somatostatin substantiates previous work on the antiproliferative effect of somatostatin on tumoral pancreatic cells (5, 6). Furthermore, our data, along with those of others (9, 10, 11, 12, 13, 14), strengthens the concept that the antiproliferative action of somatostatin may involve stimulation of a PTPase activity. Our results agree with those of Lopez et al. (14), who demonstrated that SHP-1 (PTP1C) activity was stimulated in CHO cells expressing the sst2 receptor subtype. They also demonstrated that somatostatin can promote dissociation of the sst2/SHP-1 complex and induce tyrosine dephosphorylation of SHP-1, leading to its activation. Although we were able to confirm phosphorylation of SHP-1 in our study, we were unable to demonstrate its dephosphorylation in response to somatostatin, as shown by Lopez et al. (14). This discrepancy may result from higher concentrations of somatostatin receptors in transfected CHO cells than the untreated PANC-1 cells in our study.
We also observed that SHP-1 can be activated equipotently by EGF
independently of somatostatin, as recently observed in CHO cells
stimulated by insulin (36). This finding may result from the fact that
SHP-1 possesses SH2 domains involved in its association with multiple
signaling molecules (37). Although somatostatin stimulates SHP-1
activity, we could not observe further activation of the enzyme when
somatostatin was combined with EGF; this observation suggests that both
peptides may compete for the same intracellular pool of SHP-1. Again,
our data differ from those of Bousquet et al. (36), who
demonstrated that addition of the somatostatin agonist RC-160 to
insulin in CHO cells further increased SHP-1 activation above that of
insulin alone by about 50%. In their study, insulin alone increased
SHP-1 activity only by 20% at 100 nM, whereas 1
nM EGF resulted in a 50% activation in our study.
Furthermore, the CHO cells were transfected with the sst2 receptor.
Such differences may also indicate that EGF, coupling to SHP-1 via its
receptor, is much more sensitive and efficient than SHP-1 coupled to
the insulin receptor upon insulin stimulation. Indeed, 50% activation
of SHP-1 by 1 nM EGF is more efficient than 20% activation
by 100 nM insulin within 1 min for both stimuli. The
recruitment of SHP-1 by the EGF receptor, in response to EGF, may
explain why high concentrations of somatostatin are needed to inhibit
basal PANC-1 cell growth; in these cells, the EGF receptor is
overexpressed, and TGF-
, which interacts with the EGF receptor, is
also produced and released and acts as an autocrine-positive growth
factor (38).
We also examined other intracellular events known to be associated with cell proliferation and, thus, potential targets for somatostatin regulation. In these PANC-1 cells, SS-14 and its analog inhibited basal and EGF-stimulated tyrosine kinase activities; these data support the idea that somatostatin can inhibit cell growth by activating PTPases needed to dephosphorylate and inactivate tyrosine kinases associated with the growth process. Our results also demonstrated that somatostatin can also inhibit another kinase, the p42 MAPK, recognized as an important intracellular transducer whose translocation to the nucleus is associated with the induction of gene expression (34).
In these PANC-1 cells, our data suggest that somatostatin inhibition of basal and stimulated growth could involve SHP-1 activation, which in turn, can dephosphorylate tyrosine kinases. Within this proposed pathway, we were unable, however, to confirm SHP-1 dephosphorylation, postulated to be associated with its activation and its release from the somatostatin receptor (14).
We also investigated growth regulation of another human pancreatic cancer cell line, the MIA PaCa-2 cells. Contrary to growth inhibition observed in the PANC-1 cells, SS-14 and its analog SMS failed to inhibit basal and EGF-stimulated growth of these MIA PaCa-2 cells, as well as intracellular signals known to be involved in the control of growth processes. These data contrast with those of Liebow et al. (5, 9), who demonstrated that SS-14 and its analogues RC-160 and RC-121 inhibited EGF-stimulated growth of these MIA PaCa-2 cells, but agree with those reported by Gillepsie et al. (24), who found that SS-14 and RC-160 did not cause their growth inhibition when stimulated by EGF. They explained this absence of growth inhibition by a total absence of somatostatin receptors (24). Our data stress the contrary, because the MIA PaCa-2 cells express, at different levels, the five somatostatin receptor subtypes. Besides the somatostatin receptor, another important component has been identified as part of the mechanism responsible for the inhibitory action of somatostatin. Initially, many investigators (9, 10, 13) reported activation of PTPase activity associated with somatostatin binding to its receptor. Activation of this PTPase has been coupled to the antiproliferative effect of somatostatin by virtue of its ability to dephosphorylate and inactivate growth factor receptor kinases, with the discovery that SHP-1 copurified with the somatostatin receptor (13). In the MIA PaCa-2 cells, our data clearly indicate that the above described mechanism is not operating at all, probably because these cells do not have any SHP-1. This lack of SHP-1 was indeed confirmed, first, by demonstrating the total absence of any PTPase activity after immunoprecipitation with a specific SHP-1 antibody, and second, by the absence of the SHP-1 protein determined by Western blot; the PANC-1 cells on the contrary exhibited both the activity and the protein, and their growth was inhibited by somatostatin.
Although inhibition of the MIA PaCa-2 cell growth could not be seen in response to somatostatin, the hormone manifested its presence by stimulating their growth. Contrary to conventional belief that somatostatin is, above all, an inhibitory factor, its growth-promoting action has previously been observed in BON cells, human pancreatic carcinoid cells (39) in A431 cells, in human epidermoid carcinoma cells (40, 41), in cultured human meningioma cells (42), in Jurkat leukemia T cells (43), and in human Caco-2 intestinal cells (44). Although the mechanism by which somatostatin induces growth is still unclear, a reduction of cAMP production has been postulated and observed in BON cells (39), in meningioma cells (42), and in Caco-2 cells (44). In the MIA PaCa-2 cells, this reduction of cAMP production by SS-14 and SMS was not observed (data not shown); and therefore, this potential mechanism cannot be applied in these cells.
Besides SHP-1, usually associated with an inhibitory state, SHP-2 (or PTP1D) has recently been associated with growth-related processes. Its activation and association with mitogenesis have been observed in fibroblasts in response to PDGF and insulin (45, 46) and in Rat 1 cells in response to EGF (47). In our study, SS-14 and SMS significantly increased, although moderately, total PTPase activity in the MIA PaCa-2 cells. We also observed that orthovanadate inhibited the stimulatory effect of somatostatin in MIA PaCa-2 cell growth, thus suggesting the implication of some PTPases (data not shown). Furthermore, SHP-2 has been identified by immunoprecipitation in these cells, but we were unable to measure its activity; this is not surprising because, according to Rivard et al. (45), the enzyme has to be overexpressed to measure its activity. Therefore, it remains plausible that SHP-2 participates as an activator of specific intracellular pathways leading to proliferation, although we cannot yet ascertain its real implication. However, our results also showed that somatostatin stimulates the membrane PTPase activity maximally after 60 min, which coincides with the minimal tyrosine kinase activity; therefore, we cannot exclude that the late activation of PTPase activity is responsible for the negative regulation of the tyrosine kinase activity.
Tyrosine kinase activation by gastrointestinal hormones has been observed in rat pancreas (31) and in response to EGF and bombesin in MIA PaCa-2 and PANC-1 cells (33). In this study, there exists a close relationship between SS-14 and SMS growth stimulation of the MIA PaCa-2 cells and their tyrosine kinase activation; indeed, both events are concentration dependent, with a maximal response reached at the same concentration. Furthermore, this relationship is further strengthened by the observation that genistein, a tyrosine kinase inhibitor, comparatively blocked SS-14 and SMS-stimulated growth and tyrosine kinase activation.
MAP kinase activation is known to play an important role in cell proliferation (34). In the MIA PaCa-2 cells, we have previously reported a constitutive activity of the p44/p42 kinase unresponsive to growth factors, hormones, and inhibitors, and an activation of p38 kinase (a stress kinase) by growth factors and gastrointestinal hormones (33). The implication of p38 kinase in cell proliferation has not yet been determined in the MIA PaCa-2 cells, but its activation has been previously associated with T cell proliferation (48), with T cell HIV-1 replication (49), and with intestinal wound repair (50). Its activation has also been reported in rat pancreatic acini in response to CCK (51). Contrary to growth factors and gastrointestinal hormones, somatostatin did not stimulate p38 MAPK, thus suggesting that somatostatin stimulates cell growth independently of the activation of p44, p42, and p38 MAP kinases.
In two human pancreatic cancer cells, we have demonstrated that somatostatin and its analog exerted different growth responses, depending on the cellular context. The pivotal element in growth control of these cells seems to be the presence or the absence of SHP-1. The inhibitory effect of somatostatin in PANC-1 cells seems to be mediated via stimulation of a PTPase activity and especially that of SHP-1 and inhibition of membrane tyrosine kinase and of p42 MAP kinase activities. In MIA PaCa-2, SHP-1 is absent, and no antiproliferative response was observed; however, cell growth was observed in response to somatostatin, along with activation of tyrosine kinase activity. Further studies are needed to identify the exact mechanisms by which cell proliferation proceeds in response to somatostatin. Our data also pointed out that detection of SHP-1 activity or protein may become a good marker for prognosis of pancreatic cancer evolution and sensitivity to somatostatin treatment.
|
Footnotes |
|---|
2 Recipient of a Canadian Association of Gastroenterology/Hoechst
Marrion Roussel Summer Research Initiative Award.
3 Recipient of a fellowship from Junea De Extremadura.
Received June 16, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in human pancreatic cancer cells:
evidence for superagonist autocrine cycle. Proc Natl Acad Sci USA 84:7567–7570This article has been cited by other articles:
 |
|
 |
|
  E. Peverelli, G. Mantovani, D. Calebiro, A. Doni, S. Bondioni, A. Lania, P. Beck-Peccoz, and A. Spada The Third Intracellular Loop of the Human Somatostatin Receptor 5 Is Crucial for Arrestin Binding and Receptor Internalization after Somatostatin Stimulation Mol. Endocrinol., March 1, 2008; 22(3): 676 - 688. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Roosterman, O. J. Kreuzer, N. Brune, G. S. Cottrell, N. W. Bunnett, W. Meyerhof, and M. Steinhoff Agonist-Induced Endocytosis of Rat Somatostatin Receptor 1 Endocrinology, March 1, 2007; 148(3): 1050 - 1058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Zatelli, D. Piccin, F. Tagliati, A. Bottoni, A. Luchin, and E. C. degli Uberti Src Homology-2-Containing Protein Tyrosine Phosphatase-1 Restrains Cell Proliferation in Human Medullary Thyroid Carcinoma Endocrinology, June 1, 2005; 146(6): 2692 - 2698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Trapasso, S. Yendamuri, K. R. Dumon, R. Iuliano, R. Cesari, B. Feig, R. Seto, L. Infante, H. Ishii, A. Vecchione, et al. Restoration of receptor-type protein tyrosine phosphatase {eta} function inhibits human pancreatic carcinoma cell growth in vitro and in vivo Carcinogenesis, November 1, 2004; 25(11): 2107 - 2114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Ramirez, F. Gracia-Navarro, S. Garcia-Navarro, R. Torronteras, M. M. Malagon, and J. P. Castano Somatostatin Stimulates GH Secretion in Two Porcine Somatotrope Subpopulations through a cAMP-Dependent Pathway Endocrinology, March 1, 2002; 143(3): 889 - 897. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. D. Zapata, R. M. Ropero, A. M. Valencia, L. Buscail, J. I. Lopez, R. M. Martin-Orozco, J. C. Prieto, J. Angulo, C. Susini, P. Lopez-Ruiz, et al. Autocrine Regulation of Human Prostate Carcinoma Cell Proliferation by Somatostatin through the Modulation of the SH2 Domain Containing Protein Tyrosine Phosphatase (SHP)-1 J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 915 - 926. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Hennige, R. Lammers, W. Hoppner, D. Arlt, V. Strack, R. Teichmann, F. Machicao, A. Ullrich, H.-U. Haring, and M. Kellerer Inhibition of Ret Oncogene Activity by the Protein Tyrosine Phosphatase SHP1 Endocrinology, October 1, 2001; 142(10): 4441 - 4447. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yoshida, T. Ishibashi, and M. Nishio Growth-inhibitory Effect of a Streptococcal Antitumor Glycoprotein on Human Epidermoid Carcinoma A431 Cells: Involvement of Dephosphorylation of Epidermal Growth Factor Receptor Cancer Res., August 1, 2001; 61(16): 6151 - 6157. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Ceolotto, A. Gallo, M. Sartori, R. Valente, E. Baritono, A. Semplicini, and A. Avogaro Hyperglycemia Acutely Increases Monocyte Extracellular Signal-Regulated Kinase Activity in Vivo in Humans J. Clin. Endocrinol. Metab., March 1, 2001; 86(3): 1301 - 1305. [Abstract] [Full Text]
|
|
|
|
|
|
S. Charland, M.-J. Boucher, M. Houde, and N. Rivard Somatostatin Inhibits Akt Phosphorylation and Cell Cycle Entry, But Not p42/p44 Mitogen-Activated Protein (MAP) Kinase Activation in Normal and Tumoral Pancreatic Acinar Cells Endocrinology, January 1, 2001; 142(1): 121 - 128. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Sellers Prolonged Activation of Extracellular Signal-regulated Kinase by a Protein Kinase C-dependent and N17Ras-insensitive Mechanism Mediates the Proliferative Response of Gi/o-coupled Somatostatin sst4 Receptors J. Biol. Chem., August 20, 1999; 274(34): 24280 - 24288. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
