| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Physiology (S.N., J.M., D.A.R., C.M.C.), Cell and Molecular Biology (R.D.H.), and Chemistry (B.G.B.), Colorado State University, Fort Collins, Colorado 80523
Address all correspondence and requests for reprints to: Dr. Colin M. Clay, Department of Physiology, Colorado State University, Fort Collins, Colorado 80523. E-mail: cclay{at}cvmbs.colostate.edu
| Abstract |
|---|
|
|
|---|
T3 cell line, and
approximately 82% of the fusion receptors colocalized with a membrane
marker in Chinese hamster ovary cells. Furthermore, the fusion receptor
displayed a Kd of 0.8 nM for iodinated
des-Gly10,D-Ala-6-GnRH
N-ethyl amide in Chinese hamster ovary cells, which was
similar to the Kd of the native GnRHR expressed in
T3
cells. The surface mobility of the fusion protein was examined by
fluorescence photobleaching recovery methods. In the unbound state the
majority of the receptors were laterally mobile and displayed a lateral
diffusion rate of 1.21.6 x 10-9
cm2/sec. Binding of GnRH reduced the rate of lateral
diffusion over 3-fold and reduced the fraction of mobile receptors from
approximately 7691% to 4461%. Like GnRH, the competitive GnRH
antagonist antide slowed the rate of receptor diffusion approximately
3-fold. In contrast to GnRH, antide had no effect on the fraction of
mobile receptors. Thus, an intrinsically fluorescent GnRHR is
trafficked to the plasma membrane of mammalian cells, is capable of
ligand binding and signal transduction, and allows direct observation
of the GnRHR in the nonligand-bound state. Furthermore, fluorescence
photobleaching recovery analysis of the GnRHR-green fluorescent protein
fusion reveals fundamental differences in the membrane dynamics of the
GnRHR induced by the binding of an agonist vs. that
induced by the binding of an antagonist. | Introduction |
|---|
|
|
|---|
Not only has the GnRHR cDNA proven useful as a probe for gene expression, but it has also allowed investigations of the structure-function relationships that exist in this protein. In this regard, the cDNA for the murine GnRHR predicts a protein containing seven hydrophobic amino acid domains and suggests membership of the GnRHR in the G protein-coupled receptor superfamily (7), a classification that is consistent with the proposed mechanism(s) of action of GnRH (15, 17). The predicted GnRHR structure is, however, somewhat unusual in that it possesses an extremely short intracellular carboxyl-terminus of only one or two amino acids. This structural difference alone raises interesting questions about the functional domains of this molecule required for trafficking, signal transduction, and internalization. In fact, significant progress has been made in dissecting the functional domains of the GnRHR (15, 17); however, large gaps remain in our understanding of this molecule. In particular, the absence of any antibodies capable of recognizing the GnRHR in situ has precluded any analyses of the GnRHR in the unbound state. Thus, it has been difficult to monitor the rate of GnRHR biosynthesis, its trafficking through various intracellular compartments, and its behavior in the plasma membrane. Nonetheless, these steps have been implicated as important regulatory points for controlling the number of GnRHRs available for hormone binding and signal transduction (18, 19).
As an alternative to immunological detection of the GnRHR, we have generated a fusion protein consisting of codon-optimized, enhanced green fluorescent protein (GFP) derived from Aqueorea victoria (20) and the murine GnRHR. This approach was selected based on several considerations. First, the fusion of GFP to a number of different proteins has not interfered with protein function or affected the fluorescent properties of GFP (21, 22, 23, 24, 25, 26). Second, as the fusion protein is intrinsically fluorescent, there are no problems of substrate availability to an enzyme marker. Finally, as GFP fluoresces in vivo, the use of this molecule as a fluorescent tag permits real-time imaging of the fusion protein and observations of regulation and trafficking in living cells (21, 22, 23, 24, 25, 26).
In addition to allowing intracellular observations, an intrinsically fluorescent GnRHR allows the application of various laser optical methods to study the behavior of this receptor in the plasma membrane in both bound and unbound states. In fact, just such an approach was used to measure the lateral diffusion of a fusion protein consisting of the ß-adrenergic receptor and GFP by fluorescence photobleaching recovery (FPR) techniques (22). Interestingly, the ß-adrenergic receptor, which could be regarded as a prototype for signal transduction by other G protein-coupled receptors, had a very fast and apparently unrestricted lateral diffusion in the unbound state (22). Herein, we report that a C-terminal fusion of GFP to the coding region of the GnRHR results in a fusion protein that is appropriately trafficked to the plasma membrane of multiple mammalian cells and for the first time allows direct observation of the GnRHR in the nonligand-bound state.
| Materials and Methods |
|---|
|
|
|---|
Preparation of murine GnRHR-GFP fusion vector
Using Deep Vent Polymerase (New England Biolabs, Inc.), a C-terminal fusion of the murine GnRHR (mGnRHR) was
generated by PCR of a cDNA containing the full coding sequence of the
mGnRHR in pBSK (7), using a T3-specific primer (AATTAACCCTCACTAAAGGG)
and a gene-specific primer that eliminates the stop codon and
substitutes a BamHI site (underlined) at its
3'-end (CAAGGATCCCCAAAGAGAAATACCCATATATG) to create an
in-frame restriction site. The PCR product was then digested with
EcoRI and BamHI and ligated into
pEGFP-N2 (Clontech, Palo Alto, CA) cut with
the same enzymes. This resulted in a fusion protein consisting of the
mGnRHR, a spacer sequence consisting of amino acids IHRPVAT, and
enhanced GFP. The identity of the fusion cDNA was confirmed by
sequencing (Macromolecular Resources, Fort Collins, CO).
Cell culture
Cells were maintained in high glucose DMEM (Mediatech, Herndon,
VA) containing 2 mM glutamine, 100 U penicillin/ml, 100
µg streptomycin/ml, and 10% FBS (Gemini Bioproducts, Calabasas, CA)
and 1 x nonessential amino acids (Life Technologies,
Gaithersburg, MD) in a 5% CO2, 37 C humidified
environment.
Construction of stable cell lines expressing mGnRHR-GFP
T3 cells were transfected using Lipofectamine Plus
(Life Technologies) according to the manufacturers
instructions with 8 µg mGnRHR-GFP. COS-7 and Chinese hamster ovary
(CHO) cells were transfected using Lipofectamine (Life Technologies) and 16 µg mGnRHR-GFP. Sixteen hours after
transfection, the medium was changed, and G-418 (Mediatech) was added
to a final concentration of 500 µg/ml. After 2 weeks of selection in
G418, the cells were trypsinized, diluted 1:100 in complete medium plus
G418, plated in 150-mm plates, and incubated until single colonies
became visible. Colonies were transferred into 24-well plates in the
same medium using a sterile applicator swab and grown to confluence. A
sample from each colony was examined under mercury arc lamp
illumination using a x20 objective on a Nikon Optiphot
(Nikon, Melville, NY) and a fluorescein-selective filter
set. The clones expressing the most intense fluorescence in each cell
line were used in the subsequent studies.
Confocal imaging
To assess the cellular localization of mGnRHR-GFP, the
T3,
CHO, and COS-7 cell lines expressing fusion protein were plated in
complete medium onto sterile no. 1 coverslips for 1624 h before the
imaging studies. Coverslips with dispersed, isolated cells were stained
with 10 µg/ml ice-cold Alexa 594 concanavalin A (Con A;
Molecular Probes, Inc., Eugene, OR) in PBS. The coverslips
were rinsed twice with ice-cold PBS and fixed with 4% freshly prepared
formaldehyde for 5 min. After a further two washes with ice-cold PBS,
the coverslips were mounted in 40% glycerol, and the edges were sealed
with rubber cement. Images were acquired on a Sarastro 2000 confocal
laser scanning microscope (Molecular Dynamics, Inc.,
Sunnyvale, CA) in an epifluoresence mode. The 488- and 514-nm lines of
an argon ion laser were used to excite the sample, a 595-nm dichroic
mirror was used to separate red/green fluorescence, a 535-nm long-pass
filter was used to isolate the green (GFP) signal, and a 600-nm long
pass filter was used to further isolate the red Con A signal. A 50-µm
pinhole was used. Images were saved on a optical disk, exported to
Adobe PhotoShop for image processing, and printed on a Kodak color
printer (Eastman Kodak Co., Rochester, NY).
Colocalization of red and green signal was quantified using ImageSpace Software (Molecular Dynamics, Inc.), and masks were generated by the Alexa 594 Con A signal. The extent of Alexa 594 Con A and mGnRHR-GFP colocalization were expressed as a percentage of the total green fluorescence within a cell using the measurement routine in the ImageSpace Software provided with the confocal microscope. One mask was generated using the red fluorescence that encompassed the entire cell to measure the total green fluorescence, and a second mask was generated using red fluorescence that demarcated the inner limit of the membrane and measured the amount of green fluorescence that was not colocalized with the membrane marker. The amount of fluorescence that colocalized with the membrane marker was determined as the difference in the total fluorescence minus the internal fluorescence. All results were expressed as a percentage of the total fluorescence for each cell. A minimum of 12 cells from each cell line were analyzed.
Scatchard analyses
Approximately 200,000 cells/well from the
T3 and
T3
mGnRHR-GFP cell lines and 100,000 cells/well from the CHO mGnRHR-GFP
cell line were plated in 24-well plates (Falcon, Becton
Dickinson Labware, Franklin Lakes, NJ) and cultured overnight.
Concentrations of freshly prepared
[125I]des-Gly10,D-Ala6-GnRH
N-ethyl amide (SA, 1.5 µCi/pmol) between 4.5
nM and 20 pM in 150 ml
ice-cold complete medium were then added to each well in the presence
or absence of 260 nM of unlabeled
des-Gly10,D-Ala6-GnRH
N-ethyl amide. Cells were incubated on ice for 4 h and
then washed twice with 1 ml 170 mM NaCl, 3 mM
KCl, 10 mM Na2HPO4, and 4
mM K2HPO4, pH 7.4 (PBS), containing
2 mg/ml BSA. The cells were lysed in 100 µl 1% SDS and counted on an
Apex Automatic
-counter (Micromedic Systems, Inc., Horsham, PA).
Specific counts were determined as total counts per min bound less the
counts per min bound in the presence of 260 nM of unlabeled
des-Gly10,D-Ala6-GnRH
N-ethyl amide. Three independent experiments were conducted,
and the pooled data were analyzed by a nonlinear regression using
GraphPad Prism Software (GraphPad Software, Inc., San
Diego, CA). A one-site model provided the best fit of the data.
Transient transfections
CHO cells stably expressing the mGnRHR-GFP were plated at
approximately 2 x 105 cells/well in six-well plates
in complete medium and incubated overnight. The following morning,
cells were transfected for 5 h in serum-free DMEM with 5 µl
Lipofectamine (Life Technologies) and a reporter vector
consisting of approximately 1500 bp of the human glycoprotein hormone
-subunit promoter fused to luciferase in pGL3 (Promega Corp., Madison, WI). To control for transfection efficiency,
cells were cotransfected with 250 ng of a Rous sarcoma
virus-ß-galactosidase construct (27). After 5 h of transfection,
1 ml medium containing 20% FBS, 200 U/ml penicillin, and 200 µg/ml
streptomycin was added, and the cells were incubated overnight. The
following morning, 0.1, 1, 10, 100, 1000 nM GnRH or 1000
nM GnRH plus 100 nM antide were added to
triplicate wells and incubated for an additional 4 h. The cells
were then washed twice with ice-cold PBS and lysed in 200 µl 25
mM glycylglycine (pH 7.8), 15 mM
MgSO4, 1 mM dithiothreitol (freshly added), and
1% Triton X-100, and the lysate was cleared by centrifugation at
16,000 x g for 2 min. Two microliters of the lysate
were assayed in 100 ml luciferase assay buffer (Promega Corp.). An additional 2 µl lysate were assayed for
ß-galactosidase activity in 200 µl Galacto-Light Assay Buffer
(Tropix, Bedford, MA) according to the manufacturers instructions
using a Turner TD-20e luminometer (Turner Designs, Mountain View, CA).
All luciferase values were normalized for ß-galactosidase activity by
dividing the luciferase value by the ß-galactosidase value. All
treatments were performed in triplicate in three independent
experiments.
cAMP assays
Approximately 2 x 106 CHO mGnRHR-GFP cells
were incubated with 0.1, 1, 10, 100, and 1000 nM GnRH or
1000 nM GnRH plus 100 nM antide or CHO
wild-type cells with 0 or 1000 nM GnRH in a total volume of
500 µl in PBS for 1 h at 37 C. Reactions were terminated by the
addition of 500 µl ice-cold 10% tricholoroacetic acid and
centrifugation at 300 x g for 5 min to remove
insoluble material. The supernatant was then extracted with three times
with 3 ml diethyl ether, and the aqueous phase was dried under
nitrogen. The residue was resuspended in a 50-mM sodium
acetate buffer, pH 6.2 (PE Biosystems, Norwalk, CN), and cAMP was
assayed using the TiterFluor Dual Range cAMP Enzyme-Linked ImmunoAssay
(PE Biosystems) using goat antirabbit IgG-coated plates
(Pierce, Rockford, IL). Fluorescence was measured using a
CytoFluor 2300 plate reader (PE Biosystems). The cAMP concentration was
determined from a standard curve generated at the same time as the
assay.
Fringe and spot fluorescence photobleaching recovery of mGnRHR-GFP
lateral diffusion
The equipment and methods used for performing spot and fringe
FPR measurements have been described in detail previously (28). In
these studies, all measurements were performed at 37 C using a Zeiss
Axiomat-based instrument and a Zeiss x40 microscope objective. For
spot FPR measurements on individual cells, a Coherent Radiation Innova
100 argon ion laser (Coherent, Palo Alto, CA) interrogated an
area of the cell with a 1/e2 radius of 0.41 µm. The laser
provided power of 53 microwatts (µW) in the bleaching beam and 0.2 mW
in the probe beam at 488 nm. For the fringe measurements, the fringe
spacing was approximately 2.2 µm, and at the sample, the illuminated
area had a 1/e2 radius of 29 µm. The photometer
acceptance region was large enough to encompass the entire cell. In
fringe FPR measurements, higher total powers of 11 mW in the bleaching
pulse and 33 µW in the probe beam were used because of the larger
illuminated area. Fluorophore bleaching times were 400 and 150 msec in
fringe and spot FPR measurements, respectively. In an individual FPR
experiment, data were acquired for 20 sec before fluorophore bleaching
and for 30 sec postbleaching at a rate of 50 msec/point. FPR data were
processed as previously described (28). To assess the effect of GnRH or
antide on the mGnRHR receptor dynamics, GnRH or antide was added at a
final concentration of 1 µM 5 min before the acquisition
of data and remained at this concentration for the duration of data
acquisition, which was approximately 45 min.
Statistics
Normalized luciferase (Fig. 3A
) and cAMP (Fig. 3B
) data were
analyzed by Dunnetts t test (SAS Institute, Cary NC). FPR
data (Tables 1
and 2
) were analyzed by ANOVA using SigmaStat
(Jandel Scientific, San Rafel CA). If the F test was significant
(P < 0.05), means were separated using the least
significant difference criterion.
|
|
|
| Results |
|---|
|
|
|---|
T3 GnRHR-GFP
cell line, and GI are from a CHO mGnRHR-GFP cell line.
|
T3 cells to 82.6 ± 7.28% in the CHO cell line. The expression
level of mGnRHR-GFP in the
T3 and CHO cells was quite uniform;
however, expression in the COS-7 cells was generally much lower and
much more variable. For this reason, subsequent analyses were confined
to the
T3 and CHO mGnRHR-GFP-expressing cell lines. Also, it is
important to point out that the pattern of fusion protein expression
differs markedly from that for unfused GFP. When GFP alone was
expressed, it was found primarily intracellularly, with a high
percentage of the protein apparently localized to the nucleus and the
remainder distributed throughout the cytoplasm (data not shown). A
similar distribution has been reported previously in COS-7 cells
(29).
mGnRHR-GFP bound hormone with an affinity similar to that of the
wild-type GnRHR and was capable of signal transduction
To determine whether the mGnRHR-GFP fusion protein displays
binding kinetics similar to those of wild-type GnRHR, binding
studies were performed on nontransfected
T3 cells, which
normally express the GnRHR (15, 30), and on CHO and
T3 cell lines,
which express mGnRHR-GFP. Iodinated
des-Gly10,D-Ala6-GnRH
N-ethyl amide bound to mGnRHR-GFP-expressing CHO cells with
a Kd (0.8 nM), similar to that calculated for
the wild-type mGnRHR expressed in nontransfected
T3 cells (Fig. 2
). The number of receptors present in
the plasma membrane of the three cell types was, however, more
variable. We found approximately 13,300 and 20,800 receptors/cell in
the CHO and
T3 mGnRHR-GFP cell lines, respectively. Wild-type
(nontransfected)
T3 cells contained approximately 14,500 GnRHR/cell.
Binding of des-Gly10,D-Ala6-GnRH
N-ethyl amide to wild-type CHO cells was undetectable (data
not shown).
|
-subunit gene fused to the cDNA encoding
luciferase was tested for GnRH responsiveness after transient
transfection into the CHO mGnRHR-GFP cell line. This 1500-bp promoter
region has previously been shown to be responsive to GnRH (15, 31, 32).
Consistent with this, treatment of the CHO mGnRHR-GFP cell line
with increasing concentrations of GnRH led to a dose-dependent increase
in expression of luciferase (Fig. 3A
-1500 promoter (Fig. 3A
-1500 response, the addition of 100 nM
antide effectively blocked the GnRH-stimulated increase in cAMP in CHO
mGnRHR-GFP cells.
Membrane dynamics of mGnRHR-GFP
To determine whether mGnRHR-GFP was laterally mobile in the
membrane, we examined its membrane dynamics in mGnRHR-GFP-expressing
T3 and CHO cells before and after binding of GnRH or antide using
spot and fringe FPR methods (28). The unbound mGnRHR-GFP receptor
expressed in
T3 cells displayed a lateral diffusion coefficient of
approximately 1.21.6 x 10-9 cm2/sec
whether measured by spot FPR (Table 1
) or fringe FPR (Table 2
).
Furthermore, the estimates of the mobile fraction (%M) using either
spot FPR (79% Table 1
) or fringe FPR (76%) (Table 2
) suggested that
the majority of the receptors were laterally mobile. Similar values
were obtained with the CHO mGnRHR-GFP cell line (Tables 1
and 2
) and
mGnRHR-GFP-expressing COS-7 cells (data not shown). To examine the
effect of ligand binding on diffusion of the fusion receptor,
mGnRHR-GFP-expressing
T3 cells were incubated with 1
µM GnRH for 5 min before and during FPR measurements,
which were completed within 45 min. The binding of GnRH not only slowed
the rate of receptor lateral diffusion almost 3-fold to approximately
0.38 x 10-9 cm2/sec based on both spot
(Table 1
) and fringe FPR (Table 2
), but reduced the fraction of mobile
receptors from about 80% to 50% (Tables 1
and 2
). Incubation of cells
with 1 µM antide reduced the rate of mGnRHR-GFP lateral
diffusion to values similar to those for the GnRH-occupied receptors.
In contrast, the addition of antide had little effect on the fraction
of mobile receptors, which remained in the range of 75%. The effects
of GnRH and antide on membrane dynamics of mGnRHR-GFP in CHO cells were
similar to those observed for the mGnRHR-GFP
T3 cell line (Tables 1
and 2
).
| Discussion |
|---|
|
|
|---|
The protein predicted by the initial GnRHR cDNA isolated appears to be
highly conserved across mammalian species and contains the seven
hydrophobic amino acid domains that are characteristic of members of
the G protein-coupled superfamily of membrane receptors (17).
Consistent with this, the GnRHR is thought to be coupled to the
Gq
and/or the G11
subunits of the G
protein complex (33, 34). Despite the conservation of the seven
putative transmembrane domains characteristic of G protein-coupled
receptors, there are several unique features of the mammalian GnRHR.
Perhaps most striking is the virtual absence of an intracellular
carboxyl-terminus (17), a region that has been implicated in affecting
the activity of other members of this class of receptors (22). This
distinction alone raises questions about the potentially unique
structure-function relationships in the GnRHR, and in fact, much
progress has been made in this area (15, 17). Unfortunately,
significant gaps remain in our understanding of the GnRHR. Of
particular concern has been the absence of any antibodies capable of
recognizing the native receptor in situ, thus precluding any
analyses of the GnRHR in the unbound state. One approach that has been
used to circumvent this problem has been to use a heterologous epitope
tag fused in-frame to the GnRHR cDNA (35). As an alternative to epitope
tagging, we have constructed an intrinsically fluorescent GnRHR
consisting of an in-frame fusion of GFP to the carboxyl-terminus of the
murine GnRHR. This fusion protein has, for the first time, allowed
us to study the dynamics of not only the occupied GnRHR but also the
unbound GnRHR.
Clearly, the utility of any tagged molecule depends on the degree to
which the tagged form recapitulates the behavior of the wild-type form.
Based on multiple lines of evidence, we suggest that the mGnRHR-GFP
fusion protein displays a number of features characteristic of the
wild-type mGnRHR. First, imaging by confocal laser scanning microscopy
revealed that the GFP fusion receptor colocalizes with a plasma
membrane marker, Con A (21). This cellular distribution of mGnRHR-GFP
stands in mark contrast to unfused GFP, which is cytosolic and nuclear
(29). Second, Scatchard analysis indicated that the binding
characteristics of the fusion receptor are similar to those of the
native or wild-type GnRHR expressed by
T3 cells. Third, using a
transient expression paradigm, we found that GnRH treatment of CHO
cells stably expressing mGnRHR-GFP led to a dose-dependent increase in
the activity of the promoter from the human glycoprotein hormone
-subunit, a well established GnRH-responsive promoter (15, 31, 36).
Additionally, the GnRH responsiveness mediated by mGnRHR-GFP was
blocked by the competitive GnRH antagonist antide (37). Finally, GnRH
led to a dose-dependent accumulation of cAMP after the introduction of
hormone that was also inhibited by antide. Thus, an intrinsically
fluorescent form of the GnRHR was appropriately trafficked to the
plasma membrane, could bind ligand with an affinity similar to the
native receptor, and was capable of signal transduction. Given the
ability of the GFP fusion receptor to recapitulate these central
characteristics of GnRH receptors, we believe that this approach may
represent a useful avenue for addressing a number of basic questions
regarding the biology of both the occupied and unoccupied GnRHR.
Accordingly, we have used laser optical methods based on FPR (28) to
examine lateral dynamics of both bound and unbound forms of the
mGnRHR-GFP fusion protein in the plasma membrane of gonadotrope- and
nongonadotrope-derived cell lines.
Using both spot and fringe FPR methods, we found that the rate of
unbound mGnRHR-GFP lateral diffusion in the membranes of
T3, CHO,
and COS-7 cells was approximately 1.2 x 10-9
cm2/sec. With the notable exception of rhodopsin, this rate
of receptor diffusion is about 10-fold faster than that of most
membrane proteins (38). It is important to remember, however, that many
of the values reported for lateral diffusion of membrane receptors are
determined after the binding of a fluorescent ligand, not in the
unbound state. In fact, the rate of lateral diffusion of unbound
mGnRHR-GFP is similar to that of another G protein-coupled receptor
(ß-adrenergic receptor), also examined in the unbound form as a GFP
fusion molecule (22). Thus, at least in the unbound state, it would not
appear that the length of the intracellular carboxyl-terminus
significantly impacts the rate of lateral diffusion of G
protein-coupled receptors. Interestingly, the rate of diffusion of
mGnRHR-GFP after GnRH binding is similar to that of the ligand-bound LH
receptor (39), which has an extensive intracellular carboxyl tail,
suggesting that the length of the intracellular carboxyl-terminus may
not have a significant impact on lateral diffusion even in the bound
form of the receptor. Clearly, one caveat of this interpretation is
whether GFP itself may act as an intracellular C-terminus and thus
affect the mobility of the receptor. We have attempted to address this
concern by examining lateral diffusion characteristics of the wild-type
receptor in
T3 cells using rhodamine-conjugated
des-Gly10,D-Lys6-GnRH
N-ethyl amide as the fluorophore. Although the rate of
lateral diffusion using the rhodamine-labeled agonist (
0.21 x
10-9 cm2/sec) was similar to that observed for
the bound form of the GFP fusion receptor, the data were highly
variable, probably reflecting dissociation of the labeled ligand from
the receptor during the course of FPR measurements.
It appears that the binding of ligand to the GnRHR results in two distinct and separable events. First, there is a reduction in the rate of lateral diffusion of the receptor. Second, there is a decrease in the relative number of mobile receptors. There would seem to be several plausible explanations for these postreceptor binding changes. It is possible that binding of GnRH to GnRHR may result in microaggregation of the receptors into structures that, based on the magnitude of the decrease in diffusion coefficients, may be considerably larger than receptor dimers. In fact, Janovick and Conn (40) have suggested that aggregation of the GnRHR in pituicytes occurs as an early step in GnRH signaling. In a similar vein, aggregation of ligand-occupied LH receptors into large mol wt complexes has been observed in stably transformed 293 cells (41, 42, 43). Alternatively, the binding of GnRH may alter the interactions of the GnRHR with the cytoskeleton or other plasma membrane-associated molecules (38).
One potential concern with the present data are whether the effects of GnRH binding on receptor dynamics (i.e. lateral diffusion) were the result of extensive internalization of hormone-receptor complexes. We view this as unlikely for several reasons. First, given the relatively slow rate of internalization reported for the GnRH receptor (0.40.7% of total binding/min) (44, 45), significant internalization would not be expected in the 30- to 45-min time frames of FPR data collection. Second, the total green fluorescent signal from CHO mGnRHR-GFP cells reflects only a minimal contribution from intracellular sources. Third, spot FPR techniques are based on focusing a laser source to probe only the plasma membrane, such that internal fluorescence contributes minimally to the measurements (46). Finally, the total green fluorescence signal from cells treated with GnRH did not diminish over time and was similar to the fluorescence signal obtained from untreated CHO cells expressing mGnRHR-GFP. Thus, we suggest that internalization was not a major factor contributing to the decrease in the mobile fraction of mGnRHR-GFP in the presence of GnRH.
Like GnRH, the binding of antide led to a reduction in the rate of
lateral diffusion of mGnRHR-GFP in
T3 and CHO cells. Antide did not,
however, influence the fraction of mobile receptors. This striking
difference suggests that these two distinct postreceptor binding events
reflect a fundamental difference in the behavior of agonist-
vs. antagonist-occupied receptor. This finding is, in
fact, compatible with the report by Janovick et al. (47),
who found differential orientation of photoaffinity-labeled GnRH
agonists and antagonists in the GnRHR. As the reduction in the rate of
GnRHR-GFP lateral diffusion was similar with GnRH and antide, it would
appear that at least this event may simply reflect ligand binding
regardless of agonist or antagonist. In contrast, the reduction in the
mobile fraction of GnRHR observed only with agonist (i.e.
GnRH) presumably reflects additional interactions between the receptor
and proteins necessary for signal transduction, internalization, or
partitioning of the receptor into discrete membrane domains (38). If
correct, the differential membrane dynamics of the GnRHR-GFP may
prove a useful adjunct in the evaluation of GnRH agonists and
antagonists. Additionally, an intrinsically fluorescent GnRHR could be
extremely useful in evaluating mutations of the GnRHR that may affect
processes such as trafficking, internalization, or receptor
recycling.
| Footnotes |
|---|
2 These authors contributed equally to this work. ![]()
Received May 19, 1998.
| References |
|---|
|
|
|---|
T3-1 cells is associated with unchanged receptor
messenger RNA (mRNA) levels and altered mRNA activity. Mol Endocrinol 7:16251633
T3-1 cells. Endocrinology 136:11281136[Abstract]
-subunit genes is regulated by distinct
cis-acting elements. Mol Endocrinol 6:17451755
-subunit gene occurs through several distinct mechanisms.
Mol Endocrinol 4:573582This article has been cited by other articles:
![]() |
A. M. Navratil, J. G. Knoll, J. D. Whitesell, S. A. Tobet, and C. M. Clay Neuroendocrine Plasticity in the Anterior Pituitary: Gonadotropin-Releasing Hormone-Mediated Movement in Vitro and in Vivo Endocrinology, April 1, 2007; 148(4): 1736 - 1744. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Navratil, T. A. Farmerie, J. Bogerd, T. M. Nett, and C. M. Clay Differential Impact of Intracellular Carboxyl Terminal Domains on Lipid Raft Localization of the Murine Gonadotropin-Releasing Hormone Receptor Biol Reprod, May 1, 2006; 74(5): 788 - 797. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cezanne, S. Lecat, B. Lagane, C. Millot, J.-Y. Vollmer, H. Matthes, J.-L. Galzi, and A. Lopez Dynamic Confinement of NK2 Receptors in the Plasma Membrane: IMPROVED FRAP ANALYSIS AND BIOLOGICAL RELEVANCE J. Biol. Chem., October 22, 2004; 279(43): 45057 - 45067. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Millar, Z.-L. Lu, A. J. Pawson, C. A. Flanagan, K. Morgan, and S. R. Maudsley Gonadotropin-Releasing Hormone Receptors Endocr. Rev., April 1, 2004; 25(2): 235 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Blondet, M. Doghman, M. Rached, P. Durand, M. Begeot, and D. Naville Characterization of Cell Lines Stably Expressing Human Normal or Mutated EGFP-Tagged MC4R J. Biochem., April 1, 2004; 135(4): 541 - 546. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Qi, T. M. Nett, M. C. Allen, X. Sha, G. S. Harrison, B. A. Frederick, E. D. Crawford, and L. M. Glode Binding and Cytotoxicity of Conjugated and Recombinant Fusion Proteins Targeted to the Gonadotropin-Releasing Hormone Receptor Cancer Res., March 15, 2004; 64(6): 2090 - 2095. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Navratil, S. P. Bliss, K. A. Berghorn, J. M. Haughian, T. A. Farmerie, J. K. Graham, C. M. Clay, and M. S. Roberson Constitutive Localization of the Gonadotropin-releasing Hormone (GnRH) Receptor to Low Density Membrane Microdomains Is Necessary for GnRH Signaling to ERK J. Biol. Chem., August 22, 2003; 278(34): 31593 - 31602. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-H. Yang, M. Wieczorck, M. C. Allen, and T. M. Nett Cytotoxic Activity of Gonadotropin-Releasing Hormone (GnRH)-Pokeweed Antiviral Protein Conjugates in Cell Lines Expressing GnRH Receptors Endocrinology, April 1, 2003; 144(4): 1456 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Horvat, D. A. Roess, S. E. Nelson, B. G. Barisas, and C. M. Clay Binding of Agonist but Not Antagonist Leads to Fluorescence Resonance Energy Transfer between Intrinsically Fluorescent Gonadotropin-Releasing Hormone Receptors Mol. Endocrinol., May 1, 2001; 15(5): 695 - 703. [Abstract] [Full Text] |
||||
![]() |
T. Hashizume, W.-H. Yang, C. M. Clay, and T. M. Nett Internalization Rates of Murine and Ovine Gonadotropin-Releasing Hormone Receptors Biol Reprod, March 1, 2001; 64(3): 898 - 903. [Abstract] [Full Text] |
||||
![]() |
S. Chauvin, A. Bérault, Y. Lerrant, M. Hibert, and R. Counis Functional Importance of Transmembrane Helix 6 Trp279 and Exoloop 3 Val299 of Rat Gonadotropin-Releasing Hormone Receptor Mol. Pharmacol., March 1, 2000; 57(3): 625 - 633. [Abstract] [Full Text] |
||||
![]() |
A. Cornea, J. A. Janovick, X. Lin, and P. M. Conn Simultaneous and Independent Visualization of the Gonadotropin-Releasing Hormone Receptor and Its Ligand: Evidence for Independent Processing and Recycling in Living Cells Endocrinology, September 1, 1999; 140(9): 4272 - 4280. [Abstract] [Full Text] |
||||
![]() |
C. Blanpain, V. Wittamer, J.-M. Vanderwinden, A. Boom, B. Renneboog, B. Lee, E. Le Poul, L. El Asmar, C. Govaerts, G. Vassart, et al. Palmitoylation of CCR5 Is Critical for Receptor Trafficking and Efficient Activation of Intracellular Signaling Pathways J. Biol. Chem., June 22, 2001; 276(26): 23795 - 23804. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |