help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nelson, S.
Right arrow Articles by Clay, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nelson, S.
Right arrow Articles by Clay, C. M.
Endocrinology Vol. 140, No. 2 950-957
Copyright © 1999 by The Endocrine Society


ARTICLES

Characterization of an Intrinsically Fluorescent Gonadotropin-Releasing Hormone Receptor and Effects of Ligand Binding on Receptor Lateral Diffusion1

Scott Nelson2, Regina D. Horvat2, Jennifer Malvey, Deborah A. Roess, B. George Barisas and Colin M. Clay

Departments of Physiology (S.N., J.M., D.A.R., C.M.C.), Cell and Molecular Biology (R.D.H.), and Chemistry (B.G.B.), Colorado State University, Fort Collins, Colorado 80523

Address all correspondence and requests for reprints to: Dr. Colin M. Clay, Department of Physiology, Colorado State University, Fort Collins, Colorado 80523. E-mail: cclay{at}cvmbs.colostate.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The GnRH receptor (GnRHR) is a G protein-coupled receptor expressed by gonadotropes in the anterior pituitary gland. In the past several years, much has been learned about the structure-function relationships that exist in this receptor with regard to ligand binding and signal transduction. However, the lack of specific antibodies has precluded any analyses of the behavior of the unbound form of this receptor. We have constructed a functional GnRHR in which enhanced green fluorescent protein is fused to the carboxyl-terminus of the murine GnRHR. This fusion receptor was expressed diffusely throughout the cell, with approximately 38% of the fusion receptors colocalized with a plasma membrane marker in the gonadotrope-derived {alpha}T3 cell line, and approximately 82% of the fusion receptors colocalized with a membrane marker in Chinese hamster ovary cells. Furthermore, the fusion receptor displayed a Kd of 0.8 nM for iodinated des-Gly10,D-Ala-6-GnRH N-ethyl amide in Chinese hamster ovary cells, which was similar to the Kd of the native GnRHR expressed in {alpha}T3 cells. The surface mobility of the fusion protein was examined by fluorescence photobleaching recovery methods. In the unbound state the majority of the receptors were laterally mobile and displayed a lateral diffusion rate of 1.2–1.6 x 10-9 cm2/sec. Binding of GnRH reduced the rate of lateral diffusion over 3-fold and reduced the fraction of mobile receptors from approximately 76–91% to 44–61%. Like GnRH, the competitive GnRH antagonist antide slowed the rate of receptor diffusion approximately 3-fold. In contrast to GnRH, antide had no effect on the fraction of mobile receptors. Thus, an intrinsically fluorescent GnRHR is trafficked to the plasma membrane of mammalian cells, is capable of ligand binding and signal transduction, and allows direct observation of the GnRHR in the nonligand-bound state. Furthermore, fluorescence photobleaching recovery analysis of the GnRHR-green fluorescent protein fusion reveals fundamental differences in the membrane dynamics of the GnRHR induced by the binding of an agonist vs. that induced by the binding of an antagonist.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SINCE the elucidation of the primary amino acid sequence of GnRH over 25 yr ago, a clear picture of the key role of this molecule in controlling the reproductive function of mammals has emerged. The pulsatile discharge of GnRH from hypothalamic neurosecretory neurons not only stimulates but is obligatory for the synthesis and secretion of LH, and to a lesser extent FSH, from the anterior pituitary gland (1, 2). Not surprisingly, changes in GnRH secretory rates are a primary regulator of gonadotropin secretion (2). Similarly, changes in the number of pituitary receptors for GnRH have been implicated as an important mechanism underlying the regulation of gonadotropin secretion (3, 4, 5). Thus, changes in pituitary content and secretion of LH may not only depend on changes in GnRH availability but also on the number of GnRH receptors (GnRHR) available for binding and consequently the responsiveness of gonadotropes to GnRH (6). With the recent availability of complementary DNAs (cDNAs) encoding the GnRHR (7, 8, 9, 10, 11), researchers have found that changes in the number of GnRHRs are correlated with concomitant fluxes in steady state concentrations of messenger RNA for the GnRHR (5, 12, 13, 14, 15), thus implicating transcriptional regulation as an important component underlying the number of GnRHRs in the pituitary gland. Consistent with this, we have found that the promoter of the GnRHR gene is hormonally regulated in transgenic mice (16).

Not only has the GnRHR cDNA proven useful as a probe for gene expression, but it has also allowed investigations of the structure-function relationships that exist in this protein. In this regard, the cDNA for the murine GnRHR predicts a protein containing seven hydrophobic amino acid domains and suggests membership of the GnRHR in the G protein-coupled receptor superfamily (7), a classification that is consistent with the proposed mechanism(s) of action of GnRH (15, 17). The predicted GnRHR structure is, however, somewhat unusual in that it possesses an extremely short intracellular carboxyl-terminus of only one or two amino acids. This structural difference alone raises interesting questions about the functional domains of this molecule required for trafficking, signal transduction, and internalization. In fact, significant progress has been made in dissecting the functional domains of the GnRHR (15, 17); however, large gaps remain in our understanding of this molecule. In particular, the absence of any antibodies capable of recognizing the GnRHR in situ has precluded any analyses of the GnRHR in the unbound state. Thus, it has been difficult to monitor the rate of GnRHR biosynthesis, its trafficking through various intracellular compartments, and its behavior in the plasma membrane. Nonetheless, these steps have been implicated as important regulatory points for controlling the number of GnRHRs available for hormone binding and signal transduction (18, 19).

As an alternative to immunological detection of the GnRHR, we have generated a fusion protein consisting of codon-optimized, enhanced green fluorescent protein (GFP) derived from Aqueorea victoria (20) and the murine GnRHR. This approach was selected based on several considerations. First, the fusion of GFP to a number of different proteins has not interfered with protein function or affected the fluorescent properties of GFP (21, 22, 23, 24, 25, 26). Second, as the fusion protein is intrinsically fluorescent, there are no problems of substrate availability to an enzyme marker. Finally, as GFP fluoresces in vivo, the use of this molecule as a fluorescent tag permits real-time imaging of the fusion protein and observations of regulation and trafficking in living cells (21, 22, 23, 24, 25, 26).

In addition to allowing intracellular observations, an intrinsically fluorescent GnRHR allows the application of various laser optical methods to study the behavior of this receptor in the plasma membrane in both bound and unbound states. In fact, just such an approach was used to measure the lateral diffusion of a fusion protein consisting of the ß-adrenergic receptor and GFP by fluorescence photobleaching recovery (FPR) techniques (22). Interestingly, the ß-adrenergic receptor, which could be regarded as a prototype for signal transduction by other G protein-coupled receptors, had a very fast and apparently unrestricted lateral diffusion in the unbound state (22). Herein, we report that a C-terminal fusion of GFP to the coding region of the GnRHR results in a fusion protein that is appropriately trafficked to the plasma membrane of multiple mammalian cells and for the first time allows direct observation of the GnRHR in the nonligand-bound state.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals
Unless otherwise noted, all enzymes were obtained from New England Biolabs, Inc. (Beverly, MA). All other reagents were the highest grade available.

Preparation of murine GnRHR-GFP fusion vector
Using Deep Vent Polymerase (New England Biolabs, Inc.), a C-terminal fusion of the murine GnRHR (mGnRHR) was generated by PCR of a cDNA containing the full coding sequence of the mGnRHR in pBSK (7), using a T3-specific primer (AATTAACCCTCACTAAAGGG) and a gene-specific primer that eliminates the stop codon and substitutes a BamHI site (underlined) at its 3'-end (CAAGGATCCCCAAAGAGAAATACCCATATATG) to create an in-frame restriction site. The PCR product was then digested with EcoRI and BamHI and ligated into pEGFP-N2 (Clontech, Palo Alto, CA) cut with the same enzymes. This resulted in a fusion protein consisting of the mGnRHR, a spacer sequence consisting of amino acids IHRPVAT, and enhanced GFP. The identity of the fusion cDNA was confirmed by sequencing (Macromolecular Resources, Fort Collins, CO).

Cell culture
Cells were maintained in high glucose DMEM (Mediatech, Herndon, VA) containing 2 mM glutamine, 100 U penicillin/ml, 100 µg streptomycin/ml, and 10% FBS (Gemini Bioproducts, Calabasas, CA) and 1 x nonessential amino acids (Life Technologies, Gaithersburg, MD) in a 5% CO2, 37 C humidified environment.

Construction of stable cell lines expressing mGnRHR-GFP
{alpha}T3 cells were transfected using Lipofectamine Plus (Life Technologies) according to the manufacturer’s instructions with 8 µg mGnRHR-GFP. COS-7 and Chinese hamster ovary (CHO) cells were transfected using Lipofectamine (Life Technologies) and 16 µg mGnRHR-GFP. Sixteen hours after transfection, the medium was changed, and G-418 (Mediatech) was added to a final concentration of 500 µg/ml. After 2 weeks of selection in G418, the cells were trypsinized, diluted 1:100 in complete medium plus G418, plated in 150-mm plates, and incubated until single colonies became visible. Colonies were transferred into 24-well plates in the same medium using a sterile applicator swab and grown to confluence. A sample from each colony was examined under mercury arc lamp illumination using a x20 objective on a Nikon Optiphot (Nikon, Melville, NY) and a fluorescein-selective filter set. The clones expressing the most intense fluorescence in each cell line were used in the subsequent studies.

Confocal imaging
To assess the cellular localization of mGnRHR-GFP, the {alpha}T3, CHO, and COS-7 cell lines expressing fusion protein were plated in complete medium onto sterile no. 1 coverslips for 16–24 h before the imaging studies. Coverslips with dispersed, isolated cells were stained with 10 µg/ml ice-cold Alexa 594 concanavalin A (Con A; Molecular Probes, Inc., Eugene, OR) in PBS. The coverslips were rinsed twice with ice-cold PBS and fixed with 4% freshly prepared formaldehyde for 5 min. After a further two washes with ice-cold PBS, the coverslips were mounted in 40% glycerol, and the edges were sealed with rubber cement. Images were acquired on a Sarastro 2000 confocal laser scanning microscope (Molecular Dynamics, Inc., Sunnyvale, CA) in an epifluoresence mode. The 488- and 514-nm lines of an argon ion laser were used to excite the sample, a 595-nm dichroic mirror was used to separate red/green fluorescence, a 535-nm long-pass filter was used to isolate the green (GFP) signal, and a 600-nm long pass filter was used to further isolate the red Con A signal. A 50-µm pinhole was used. Images were saved on a optical disk, exported to Adobe PhotoShop for image processing, and printed on a Kodak color printer (Eastman Kodak Co., Rochester, NY).

Colocalization of red and green signal was quantified using ImageSpace Software (Molecular Dynamics, Inc.), and masks were generated by the Alexa 594 Con A signal. The extent of Alexa 594 Con A and mGnRHR-GFP colocalization were expressed as a percentage of the total green fluorescence within a cell using the measurement routine in the ImageSpace Software provided with the confocal microscope. One mask was generated using the red fluorescence that encompassed the entire cell to measure the total green fluorescence, and a second mask was generated using red fluorescence that demarcated the inner limit of the membrane and measured the amount of green fluorescence that was not colocalized with the membrane marker. The amount of fluorescence that colocalized with the membrane marker was determined as the difference in the total fluorescence minus the internal fluorescence. All results were expressed as a percentage of the total fluorescence for each cell. A minimum of 12 cells from each cell line were analyzed.

Scatchard analyses
Approximately 200,000 cells/well from the {alpha}T3 and {alpha}T3 mGnRHR-GFP cell lines and 100,000 cells/well from the CHO mGnRHR-GFP cell line were plated in 24-well plates (Falcon, Becton Dickinson Labware, Franklin Lakes, NJ) and cultured overnight. Concentrations of freshly prepared [125I]des-Gly10,D-Ala6-GnRH N-ethyl amide (SA, 1.5 µCi/pmol) between 4.5 nM and 20 pM in 150 ml ice-cold complete medium were then added to each well in the presence or absence of 260 nM of unlabeled des-Gly10,D-Ala6-GnRH N-ethyl amide. Cells were incubated on ice for 4 h and then washed twice with 1 ml 170 mM NaCl, 3 mM KCl, 10 mM Na2HPO4, and 4 mM K2HPO4, pH 7.4 (PBS), containing 2 mg/ml BSA. The cells were lysed in 100 µl 1% SDS and counted on an Apex Automatic {gamma}-counter (Micromedic Systems, Inc., Horsham, PA). Specific counts were determined as total counts per min bound less the counts per min bound in the presence of 260 nM of unlabeled des-Gly10,D-Ala6-GnRH N-ethyl amide. Three independent experiments were conducted, and the pooled data were analyzed by a nonlinear regression using GraphPad Prism Software (GraphPad Software, Inc., San Diego, CA). A one-site model provided the best fit of the data.

Transient transfections
CHO cells stably expressing the mGnRHR-GFP were plated at approximately 2 x 105 cells/well in six-well plates in complete medium and incubated overnight. The following morning, cells were transfected for 5 h in serum-free DMEM with 5 µl Lipofectamine (Life Technologies) and a reporter vector consisting of approximately 1500 bp of the human glycoprotein hormone {alpha}-subunit promoter fused to luciferase in pGL3 (Promega Corp., Madison, WI). To control for transfection efficiency, cells were cotransfected with 250 ng of a Rous sarcoma virus-ß-galactosidase construct (27). After 5 h of transfection, 1 ml medium containing 20% FBS, 200 U/ml penicillin, and 200 µg/ml streptomycin was added, and the cells were incubated overnight. The following morning, 0.1, 1, 10, 100, 1000 nM GnRH or 1000 nM GnRH plus 100 nM antide were added to triplicate wells and incubated for an additional 4 h. The cells were then washed twice with ice-cold PBS and lysed in 200 µl 25 mM glycylglycine (pH 7.8), 15 mM MgSO4, 1 mM dithiothreitol (freshly added), and 1% Triton X-100, and the lysate was cleared by centrifugation at 16,000 x g for 2 min. Two microliters of the lysate were assayed in 100 ml luciferase assay buffer (Promega Corp.). An additional 2 µl lysate were assayed for ß-galactosidase activity in 200 µl Galacto-Light Assay Buffer (Tropix, Bedford, MA) according to the manufacturer’s instructions using a Turner TD-20e luminometer (Turner Designs, Mountain View, CA). All luciferase values were normalized for ß-galactosidase activity by dividing the luciferase value by the ß-galactosidase value. All treatments were performed in triplicate in three independent experiments.

cAMP assays
Approximately 2 x 106 CHO mGnRHR-GFP cells were incubated with 0.1, 1, 10, 100, and 1000 nM GnRH or 1000 nM GnRH plus 100 nM antide or CHO wild-type cells with 0 or 1000 nM GnRH in a total volume of 500 µl in PBS for 1 h at 37 C. Reactions were terminated by the addition of 500 µl ice-cold 10% tricholoroacetic acid and centrifugation at 300 x g for 5 min to remove insoluble material. The supernatant was then extracted with three times with 3 ml diethyl ether, and the aqueous phase was dried under nitrogen. The residue was resuspended in a 50-mM sodium acetate buffer, pH 6.2 (PE Biosystems, Norwalk, CN), and cAMP was assayed using the TiterFluor Dual Range cAMP Enzyme-Linked ImmunoAssay (PE Biosystems) using goat antirabbit IgG-coated plates (Pierce, Rockford, IL). Fluorescence was measured using a CytoFluor 2300 plate reader (PE Biosystems). The cAMP concentration was determined from a standard curve generated at the same time as the assay.

Fringe and spot fluorescence photobleaching recovery of mGnRHR-GFP lateral diffusion
The equipment and methods used for performing spot and fringe FPR measurements have been described in detail previously (28). In these studies, all measurements were performed at 37 C using a Zeiss Axiomat-based instrument and a Zeiss x40 microscope objective. For spot FPR measurements on individual cells, a Coherent Radiation Innova 100 argon ion laser (Coherent, Palo Alto, CA) interrogated an area of the cell with a 1/e2 radius of 0.41 µm. The laser provided power of 53 microwatts (µW) in the bleaching beam and 0.2 mW in the probe beam at 488 nm. For the fringe measurements, the fringe spacing was approximately 2.2 µm, and at the sample, the illuminated area had a 1/e2 radius of 29 µm. The photometer acceptance region was large enough to encompass the entire cell. In fringe FPR measurements, higher total powers of 11 mW in the bleaching pulse and 33 µW in the probe beam were used because of the larger illuminated area. Fluorophore bleaching times were 400 and 150 msec in fringe and spot FPR measurements, respectively. In an individual FPR experiment, data were acquired for 20 sec before fluorophore bleaching and for 30 sec postbleaching at a rate of 50 msec/point. FPR data were processed as previously described (28). To assess the effect of GnRH or antide on the mGnRHR receptor dynamics, GnRH or antide was added at a final concentration of 1 µM 5 min before the acquisition of data and remained at this concentration for the duration of data acquisition, which was approximately 45 min.

Statistics
Normalized luciferase (Fig. 3AGo) and cAMP (Fig. 3BGo) data were analyzed by Dunnett’s t test (SAS Institute, Cary NC). FPR data (Tables 1Go and 2Go) were analyzed by ANOVA using SigmaStat (Jandel Scientific, San Rafel CA). If the F test was significant (P < 0.05), means were separated using the least significant difference criterion.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. The mGnRHR-GFP fusion receptor is capable of GnRH signal transduction. A, CHO mGnRHR-GFP cells were transiently transfected with a plasmid containing 1500 bp of proximal promoter from the human glycoprotein hormone {alpha}-subunit gene fused to the cDNA encoding luciferase and treated with the indicated concentrations of GnRH or antide. Values are expressed as the fold increase in luciferase expression (adjusted for ß-galactosidase) over the untreated vector and represent the mean ± SD (n = 9). B, CHO mGnRHR-GFP cells or wild-type CHO cells were incubated for 1 h in the presence of increasing doses of GnRH. The ability of antide to inhibit the cAMP response was tested by the addition of antide (100 nM) in the presence of 1000 nM GnRH. Values are expressed as the fold increase in cAMP over the untreated control value and represent the mean ± SD (n = 3). In both A and B, an asterisk indicates values that differ (P < 0.05) from untreated controls.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Lateral diffusion characteristics of mGnRHR-GFP in {alpha}T3 and CHO cells using spot FPR

 

View this table:
[in this window]
[in a new window]
 
Table 2. Lateral diffusion characteristics of mGnRHR-GFP in {alpha}T3 and CHO cells using fringe FPR

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The GnRHR-GFP fusion protein was trafficked to the plasma membrane of mammalian cells
Confocal laser scanning microscopy was used to determine whether the green signal resulting from the GnRHR-GFP fusion protein colocalizes with that of Alexa 594 Con A, a red fluorescent derivative of Con A that binds to plasma membrane carbohydrate moieties. The Alexa 594-conjugated Con A delineated the plasma membrane of each of the three cell lines constructed and is seen as the isolated red signal in Fig. 1Go, A, D, and G. A similar distribution of the green fluorescence resulting from the mGnRHR-GFP fusion is seen as the green signal in Fig. 1Go, B, E, and H. Shown in Fig. 1Go, C, F, and I, is the superimposition of the two signals; the overlap of the red and green signals is displayed in yellow. A–C are from a COS-7 mGnRHR-GFP cell line, D–F are from an {alpha}T3 GnRHR-GFP cell line, and G–I are from a CHO mGnRHR-GFP cell line.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 1. Scanning laser confocal microscopy images of cell lines expressing mGnRHR-GFP. In A, D, and G are the signals from Alexa 594 Con A. B, E, and H are the green fluorescent signals resulting from the mGnRHR-GFP fusion protein. In C, F, and I are the results of superimposition of the red and green fluorescent signals shown in yellow. A–C are images obtained from COS-7 mGnRHR-GFP cells, whereas D–F and G–I are images obtained from mGnRHR-GFP-expressing {alpha}T3 cells and CHO cells, respectively. The bar in I is 5 µm for each image. Overall magnification is x1700 for all panels.

 
The percentage of the fusion protein (green signal) that colocalized with the Alexa 594 mask (red signal) varied from 38.5 ± 12.5% in {alpha}T3 cells to 82.6 ± 7.28% in the CHO cell line. The expression level of mGnRHR-GFP in the {alpha}T3 and CHO cells was quite uniform; however, expression in the COS-7 cells was generally much lower and much more variable. For this reason, subsequent analyses were confined to the {alpha}T3 and CHO mGnRHR-GFP-expressing cell lines. Also, it is important to point out that the pattern of fusion protein expression differs markedly from that for unfused GFP. When GFP alone was expressed, it was found primarily intracellularly, with a high percentage of the protein apparently localized to the nucleus and the remainder distributed throughout the cytoplasm (data not shown). A similar distribution has been reported previously in COS-7 cells (29).

mGnRHR-GFP bound hormone with an affinity similar to that of the wild-type GnRHR and was capable of signal transduction
To determine whether the mGnRHR-GFP fusion protein displays binding kinetics similar to those of wild-type GnRHR, binding studies were performed on nontransfected {alpha}T3 cells, which normally express the GnRHR (15, 30), and on CHO and {alpha}T3 cell lines, which express mGnRHR-GFP. Iodinated des-Gly10,D-Ala6-GnRH N-ethyl amide bound to mGnRHR-GFP-expressing CHO cells with a Kd (0.8 nM), similar to that calculated for the wild-type mGnRHR expressed in nontransfected {alpha}T3 cells (Fig. 2Go). The number of receptors present in the plasma membrane of the three cell types was, however, more variable. We found approximately 13,300 and 20,800 receptors/cell in the CHO and {alpha}T3 mGnRHR-GFP cell lines, respectively. Wild-type (nontransfected) {alpha}T3 cells contained approximately 14,500 GnRHR/cell. Binding of des-Gly10,D-Ala6-GnRH N-ethyl amide to wild-type CHO cells was undetectable (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Representative Scatchard analysis of wild-type {alpha}T3 cells (squares) and mGnRHR-GFP-expressing {alpha}T3 (circles) and CHO cells (diamonds). Specific counts bound were determined as the number of counts bound in the absence of des-Gly10,D-Ala6-GnRH N-ethyl amide less those bound in the presence of 260 nM des-Gly10,D-Ala6-GnRH N-ethyl amide. The 95% confidence limits of the Kd were 0.578–1.02, 0.85–1.386, and 0.54–1.049 nM for CHO mGnRHR-GFP, {alpha}T3 mGnRHR-GFP, and {alpha}T3 cells, respectively.

 
To determine whether mGnRHR-GFP is capable of signal transduction, a plasmid containing approximately 1500 bp of proximal promoter from the human glycoprotein hormone {alpha}-subunit gene fused to the cDNA encoding luciferase was tested for GnRH responsiveness after transient transfection into the CHO mGnRHR-GFP cell line. This 1500-bp promoter region has previously been shown to be responsive to GnRH (15, 31, 32). Consistent with this, treatment of the CHO mGnRHR-GFP cell line with increasing concentrations of GnRH led to a dose-dependent increase in expression of luciferase (Fig. 3AGo). Furthermore, the addition of 100 nM antide, a competitive inhibitor of GnRH, effectively blocked GnRH stimulation of the human {alpha}-1500 promoter (Fig. 3AGo). Thus, mGnRHR-GFP not only bound hormone with an affinity similar to that of the wild-type receptor, but was also capable of transducing a GnRH signal to the level of gene expression. To further confirm that the fusion receptor was capable of signal transduction, intracellular concentrations of cAMP in the CHO mGnRHR-GFP cell line were measured 1 h after the administration of GnRH (Fig. 3BGo). Addition of GnRH to the cells led to a dose-dependent increase in the intracellular cAMP concentration with an ED50 similar to the Kd of the GnRH receptor (15). Consistent with the absence of GnRH receptors, cAMP concentrations in wild-type CHO cells were not affected by GnRH. As with the human {alpha}-1500 response, the addition of 100 nM antide effectively blocked the GnRH-stimulated increase in cAMP in CHO mGnRHR-GFP cells.

Membrane dynamics of mGnRHR-GFP
To determine whether mGnRHR-GFP was laterally mobile in the membrane, we examined its membrane dynamics in mGnRHR-GFP-expressing {alpha}T3 and CHO cells before and after binding of GnRH or antide using spot and fringe FPR methods (28). The unbound mGnRHR-GFP receptor expressed in {alpha}T3 cells displayed a lateral diffusion coefficient of approximately 1.2–1.6 x 10-9 cm2/sec whether measured by spot FPR (Table 1Go) or fringe FPR (Table 2Go). Furthermore, the estimates of the mobile fraction (%M) using either spot FPR (79% Table 1Go) or fringe FPR (76%) (Table 2Go) suggested that the majority of the receptors were laterally mobile. Similar values were obtained with the CHO mGnRHR-GFP cell line (Tables 1Go and 2Go) and mGnRHR-GFP-expressing COS-7 cells (data not shown). To examine the effect of ligand binding on diffusion of the fusion receptor, mGnRHR-GFP-expressing {alpha}T3 cells were incubated with 1 µM GnRH for 5 min before and during FPR measurements, which were completed within 45 min. The binding of GnRH not only slowed the rate of receptor lateral diffusion almost 3-fold to approximately 0.38 x 10-9 cm2/sec based on both spot (Table 1Go) and fringe FPR (Table 2Go), but reduced the fraction of mobile receptors from about 80% to 50% (Tables 1Go and 2Go). Incubation of cells with 1 µM antide reduced the rate of mGnRHR-GFP lateral diffusion to values similar to those for the GnRH-occupied receptors. In contrast, the addition of antide had little effect on the fraction of mobile receptors, which remained in the range of 75%. The effects of GnRH and antide on membrane dynamics of mGnRHR-GFP in CHO cells were similar to those observed for the mGnRHR-GFP {alpha}T3 cell line (Tables 1Go and 2Go).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GnRH is released in a pulsatile fashion by the hypothalamus and binds to specific, high affinity receptors located on gonadotrope cells in the anterior pituitary gland (2, 6). The binding of GnRH to its cognate receptor not only stimulates but is obligatory for the synthesis and secretion of LH from the pituitary gland (1, 2, 15). Accordingly, much effort has been expended toward understanding the physiological consequences of regulation of GnRH and the GnRHR. With respect to GnRHR regulation, the greatest breakthrough in recent years has arguably been the initial cloning of a cDNA encoding the mGnRHR (7). Since that time, GnRHR cDNAs have been isolated from a number of species and have proven invaluable in studying the regulation of the GnRHR at the level of gene expression (5, 12, 13, 14). In addition, the availability of these cDNAs has allowed investigators to begin to identify functional domains of the GnRHR that are involved in ligand binding, signal transduction, and internalization.

The protein predicted by the initial GnRHR cDNA isolated appears to be highly conserved across mammalian species and contains the seven hydrophobic amino acid domains that are characteristic of members of the G protein-coupled superfamily of membrane receptors (17). Consistent with this, the GnRHR is thought to be coupled to the Gq{alpha} and/or the G11{alpha} subunits of the G protein complex (33, 34). Despite the conservation of the seven putative transmembrane domains characteristic of G protein-coupled receptors, there are several unique features of the mammalian GnRHR. Perhaps most striking is the virtual absence of an intracellular carboxyl-terminus (17), a region that has been implicated in affecting the activity of other members of this class of receptors (22). This distinction alone raises questions about the potentially unique structure-function relationships in the GnRHR, and in fact, much progress has been made in this area (15, 17). Unfortunately, significant gaps remain in our understanding of the GnRHR. Of particular concern has been the absence of any antibodies capable of recognizing the native receptor in situ, thus precluding any analyses of the GnRHR in the unbound state. One approach that has been used to circumvent this problem has been to use a heterologous epitope tag fused in-frame to the GnRHR cDNA (35). As an alternative to epitope tagging, we have constructed an intrinsically fluorescent GnRHR consisting of an in-frame fusion of GFP to the carboxyl-terminus of the murine GnRHR. This fusion protein has, for the first time, allowed us to study the dynamics of not only the occupied GnRHR but also the unbound GnRHR.

Clearly, the utility of any tagged molecule depends on the degree to which the tagged form recapitulates the behavior of the wild-type form. Based on multiple lines of evidence, we suggest that the mGnRHR-GFP fusion protein displays a number of features characteristic of the wild-type mGnRHR. First, imaging by confocal laser scanning microscopy revealed that the GFP fusion receptor colocalizes with a plasma membrane marker, Con A (21). This cellular distribution of mGnRHR-GFP stands in mark contrast to unfused GFP, which is cytosolic and nuclear (29). Second, Scatchard analysis indicated that the binding characteristics of the fusion receptor are similar to those of the native or wild-type GnRHR expressed by {alpha}T3 cells. Third, using a transient expression paradigm, we found that GnRH treatment of CHO cells stably expressing mGnRHR-GFP led to a dose-dependent increase in the activity of the promoter from the human glycoprotein hormone {alpha}-subunit, a well established GnRH-responsive promoter (15, 31, 36). Additionally, the GnRH responsiveness mediated by mGnRHR-GFP was blocked by the competitive GnRH antagonist antide (37). Finally, GnRH led to a dose-dependent accumulation of cAMP after the introduction of hormone that was also inhibited by antide. Thus, an intrinsically fluorescent form of the GnRHR was appropriately trafficked to the plasma membrane, could bind ligand with an affinity similar to the native receptor, and was capable of signal transduction. Given the ability of the GFP fusion receptor to recapitulate these central characteristics of GnRH receptors, we believe that this approach may represent a useful avenue for addressing a number of basic questions regarding the biology of both the occupied and unoccupied GnRHR. Accordingly, we have used laser optical methods based on FPR (28) to examine lateral dynamics of both bound and unbound forms of the mGnRHR-GFP fusion protein in the plasma membrane of gonadotrope- and nongonadotrope-derived cell lines.

Using both spot and fringe FPR methods, we found that the rate of unbound mGnRHR-GFP lateral diffusion in the membranes of {alpha}T3, CHO, and COS-7 cells was approximately 1.2 x 10-9 cm2/sec. With the notable exception of rhodopsin, this rate of receptor diffusion is about 10-fold faster than that of most membrane proteins (38). It is important to remember, however, that many of the values reported for lateral diffusion of membrane receptors are determined after the binding of a fluorescent ligand, not in the unbound state. In fact, the rate of lateral diffusion of unbound mGnRHR-GFP is similar to that of another G protein-coupled receptor (ß-adrenergic receptor), also examined in the unbound form as a GFP fusion molecule (22). Thus, at least in the unbound state, it would not appear that the length of the intracellular carboxyl-terminus significantly impacts the rate of lateral diffusion of G protein-coupled receptors. Interestingly, the rate of diffusion of mGnRHR-GFP after GnRH binding is similar to that of the ligand-bound LH receptor (39), which has an extensive intracellular carboxyl tail, suggesting that the length of the intracellular carboxyl-terminus may not have a significant impact on lateral diffusion even in the bound form of the receptor. Clearly, one caveat of this interpretation is whether GFP itself may act as an intracellular C-terminus and thus affect the mobility of the receptor. We have attempted to address this concern by examining lateral diffusion characteristics of the wild-type receptor in {alpha}T3 cells using rhodamine-conjugated des-Gly10,D-Lys6-GnRH N-ethyl amide as the fluorophore. Although the rate of lateral diffusion using the rhodamine-labeled agonist (~0.21 x 10-9 cm2/sec) was similar to that observed for the bound form of the GFP fusion receptor, the data were highly variable, probably reflecting dissociation of the labeled ligand from the receptor during the course of FPR measurements.

It appears that the binding of ligand to the GnRHR results in two distinct and separable events. First, there is a reduction in the rate of lateral diffusion of the receptor. Second, there is a decrease in the relative number of mobile receptors. There would seem to be several plausible explanations for these postreceptor binding changes. It is possible that binding of GnRH to GnRHR may result in microaggregation of the receptors into structures that, based on the magnitude of the decrease in diffusion coefficients, may be considerably larger than receptor dimers. In fact, Janovick and Conn (40) have suggested that aggregation of the GnRHR in pituicytes occurs as an early step in GnRH signaling. In a similar vein, aggregation of ligand-occupied LH receptors into large mol wt complexes has been observed in stably transformed 293 cells (41, 42, 43). Alternatively, the binding of GnRH may alter the interactions of the GnRHR with the cytoskeleton or other plasma membrane-associated molecules (38).

One potential concern with the present data are whether the effects of GnRH binding on receptor dynamics (i.e. lateral diffusion) were the result of extensive internalization of hormone-receptor complexes. We view this as unlikely for several reasons. First, given the relatively slow rate of internalization reported for the GnRH receptor (0.4–0.7% of total binding/min) (44, 45), significant internalization would not be expected in the 30- to 45-min time frames of FPR data collection. Second, the total green fluorescent signal from CHO mGnRHR-GFP cells reflects only a minimal contribution from intracellular sources. Third, spot FPR techniques are based on focusing a laser source to probe only the plasma membrane, such that internal fluorescence contributes minimally to the measurements (46). Finally, the total green fluorescence signal from cells treated with GnRH did not diminish over time and was similar to the fluorescence signal obtained from untreated CHO cells expressing mGnRHR-GFP. Thus, we suggest that internalization was not a major factor contributing to the decrease in the mobile fraction of mGnRHR-GFP in the presence of GnRH.

Like GnRH, the binding of antide led to a reduction in the rate of lateral diffusion of mGnRHR-GFP in {alpha}T3 and CHO cells. Antide did not, however, influence the fraction of mobile receptors. This striking difference suggests that these two distinct postreceptor binding events reflect a fundamental difference in the behavior of agonist- vs. antagonist-occupied receptor. This finding is, in fact, compatible with the report by Janovick et al. (47), who found differential orientation of photoaffinity-labeled GnRH agonists and antagonists in the GnRHR. As the reduction in the rate of GnRHR-GFP lateral diffusion was similar with GnRH and antide, it would appear that at least this event may simply reflect ligand binding regardless of agonist or antagonist. In contrast, the reduction in the mobile fraction of GnRHR observed only with agonist (i.e. GnRH) presumably reflects additional interactions between the receptor and proteins necessary for signal transduction, internalization, or partitioning of the receptor into discrete membrane domains (38). If correct, the differential membrane dynamics of the GnRHR-GFP may prove a useful adjunct in the evaluation of GnRH agonists and antagonists. Additionally, an intrinsically fluorescent GnRHR could be extremely useful in evaluating mutations of the GnRHR that may affect processes such as trafficking, internalization, or receptor recycling.


    Footnotes
 
1 This work was supported by a grant from the Colorado State University Experiment Station and NIH Grant R-29-HD-32416. Back

2 These authors contributed equally to this work. Back

Received May 19, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hamernik DL, Nett TM 1988 Gonadotropin-releasing hormone increases the amount of messenger ribonucleic acid for gonadotropins in ovariectomized ewes after hypothalamic-pituitary disconnection. Endocrinology 122:959–966[Abstract/Free Full Text]
  2. Gharib SD, Wierman ME, Shupnik MA, Chin WW 1990 Molecular biology of the pituitary gonadotropins. Endocr Rev 11:177–190[Abstract/Free Full Text]
  3. Crowder ME, Nett TM 1984 Pituitary content of gonadotropins and receptors for gonadotropin-releasing hormone (GnRH) and hypothalamic content of GnRH during the periovulatory period of the ewe. Endocrinology 114:234–239[Abstract/Free Full Text]
  4. Sealfon SC, Laws SC, Wu JC, Gillo B, Miller WL 1990 Hormonal regulation of gonadotropin-releasing hormone receptors and messenger RNA activity in ovine pituitary culture. Mol Endocrinol 4:1980–1987[Abstract/Free Full Text]
  5. Hamernik DL, Clay CM, Turzillo A, Van Kirk EA, Moss GE 1995 Estradiol increases amounts of messenger ribonucleic acid for gonadotropin-releasing hormone receptors in sheep. Biol Reprod 53:179–185[Abstract]
  6. Wise ME, Nieman D, Stewart J, Nett TM 1984 Effect of number of receptors for gonadotropin-releasing hormone on the release of luteinizing hormone. Biol Reprod 31:1007–1013[Abstract]
  7. Tsutsumi M, Zhou W, Millar RP, Mellon PL, Roberts JL, Flanagan CA, Dong K, Gillo B, Sealfon SC 1992 Cloning and functional expression of a mouse gonadotropin-releasing hormone receptor. Mol Endocrinol 6:1163–1169[Abstract/Free Full Text]
  8. Reinhart J, Mertz LM, Catt KJ 1992 Molecular cloning and expression of cDNA encoding the murine gonadotropin-releasing hormone receptor. J Biol Chem 267:21281–21284[Abstract/Free Full Text]
  9. Eidne KA, Sellar RE, Couper G, Anderson L, Taylor PL 1992 Molecular cloning and characterisation of the rat pituitary gonadotropin-releasing hormone (GnRH) receptor. Mol Cell Endocrinol 90:R5–R9
  10. Chi L, Zhou W, Prikhozhan A, Flanagan C, Davidson JS, Golembo M, Illing N, Millar RP, Sealfon SC 1993 Cloning and characterization of the human GnRH receptor. Mol Cell Endocrinol 91:R1–R6
  11. Kakar SS, Rahe CH, Neill JD 1993 Molecular cloning, sequencing, and characterizing the bovine receptor for gonadotropin releasing hormone (GnRH). Dom Anim Endocrinol 10:335–342[CrossRef][Medline]
  12. Turzillo AM, Juengel JL, Nett TM 1995 Pulsatile gonadotropin-releasing hormone (GnRH) increases concentrations of GnRH receptor messenger ribonucleic acid and numbers of GnRH receptors during luteolysis in the ewe. Biol Reprod 53:418–423[Abstract]
  13. Wu JC, Sealfon SC, Miller WL 1994 Gonadal hormones and gonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid levels for GnRH receptors in sheep. Endocrinology 134:1846–1850[Abstract/Free Full Text]
  14. Turzillo AM, Campion CE, Clay CM, Nett TM 1994 Regulation of gonadotropin-releasing hormone (GnRH) receptor messenger ribonucleic acid and GnRH receptors during the early preovulatory period in the ewe. Endocrinology 135:1353–1358[Abstract]
  15. Kaiser UB, Conn PM, Chin WW 1997 Studies of gonadotropin-releasing hormone (GnRH) action using GnRH receptor-expressing pituitary cell lines. Endocr Rev 18:46–70[Abstract/Free Full Text]
  16. McCue JM, Quirk CC, Nelson SE, Bowen RA, Clay CM 1997 Expression of a murine gonadotropin-releasing hormone receptor-luciferase fusion gene in transgenic mice is diminished by immunoneutralization of gonadotropin-releasing hormone. Endocrinology 138:3154–3160[Abstract/Free Full Text]
  17. Sealfon SC, Weinstein H, Millar RP 1997 Molecular mechanisms of ligand interaction with the gonadotropin-releasing hormone receptor. Endocr Rev 18:180–205[Abstract/Free Full Text]
  18. Tsutsumi M, Laws SC, Sealfon SC 1993 Homologous up-regulation of the gonadotropin-releasing hormone receptor in {alpha}T3-1 cells is associated with unchanged receptor messenger RNA (mRNA) levels and altered mRNA activity. Mol Endocrinol 7:1625–1633[Abstract/Free Full Text]
  19. Tsutsumi M, Laws SC, Rodic V, Sealfon SC 1995 Translational regulation of the gonadotropin-releasing hormone receptor in {alpha}T3-1 cells. Endocrinology 136:1128–1136[Abstract]
  20. Chalfie M, Tu Y, Euskirchen G, Ward W, Prasher D 1994 Green fluorescent protein as a marker for gene expression. Science 263:802–805[Abstract/Free Full Text]
  21. Tarasova NI, Stauber RH, Choi JK, Hudson EA, Czerwinski G, Miller JL, Pavlakis GN, Michejda CJ, Wank SA 1997 Visualization of G protein-coupled receptor trafficking with the aid of the green fluorescent protein. J Biol Chem 272:14817–14824[Abstract/Free Full Text]
  22. Barak LS, Ferguson SSG, Zhang J, Martenson C, Meyer T, Caron MG 1997 Internal trafficking and surface mobility of a functionally intact ß-adrenergic receptor-green flourescent protein conjugate. Mol Pharmacol 51:177–184[Abstract/Free Full Text]
  23. Hampton RY, Koning A, Wright R, Rine J 1998 In vivo examination of membrane protein localization and degradation with green fluorescent protein. Proc Natl Acad Sci USA 93:828–833[Abstract/Free Full Text]
  24. Htun H, Barsony J, Renyi I, Gould DL, Hager GL 1996 Visualization of glucocorticoid receptor translocation and intracellular organization in living cells with a green fluorescent protein chimera. Proc Natl Acad Sci USA 93:4845–4850[Abstract/Free Full Text]
  25. Girotti M, Banting G 1996 TGN38-green fluorescent protein hybrids expressed in stably transfected eukaryotic cells provide a tool for the real-time, in vivo study of membrane traffic pathways and suggest a possible role for ratTGN38. J Cell Sci 109:2915–2926[Abstract]
  26. Wacker I, Kaether C, Kromer A, Migala A, Almers W, Gerdes HH 1997 Microtubule-dependent transport of secretory vesicles visualized in real time with a GFP-tagged secretory protein. J Cell Sci 110:1453–1463[Abstract]
  27. Duval DL, Nelson SE, Clay CM 1997 The tripartite basal enhancer of the gonadotropin-releasing hormone (GnRH) receptor gene promoter regulates cell-specific expression through a novel GnRH receptor activating sequence. Mol Endocrinol 11:1814–1821[Abstract/Free Full Text]
  28. Barisas BG, Munnelly HM, Roess DA 1996 Interferometric fringe patterns interrogate entire cell surfaces in fluorescence photobleaching recovery measurements of lateral diffussion. SPIE Proc 2980:523–531
  29. Moriyoshi K, Richards LJ, Akazawa C, O’Leary DDM, Nakanishi S 1996 Labeling neural cells using adenoviral gene transfer of membrane targeted GFP. Neuron 16:255–260[CrossRef][Medline]
  30. Windle JJ, Weiner RI, Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by target oncogenesis in transgenic mice. Mol Endocrinol 4:597–603[Abstract/Free Full Text]
  31. Hamernik DL, Keri RA, Clay CM, Clay JN, Sherman GB, Sawyer Jr HR, Nett TM, Nilson JH 1992 Gonadotrope- and thyrotrope-specific expression of the human and bovine glycoprotein hormone {alpha}-subunit genes is regulated by distinct cis-acting elements. Mol Endocrinol 6:1745–1755[Abstract/Free Full Text]
  32. Bokar JA, Roesler WJ, Vandenbark GR, Kaetzel DM, Hanson RW, Nilson JH 1988 Characterization of the cAMP responsive elements from the genes for the alpha-subunit of glycoprotein hormones and phosphoenolpyruvate carboxykinase (GTP). J Biol Chem 263:19740–19747[Abstract/Free Full Text]
  33. Hsieh K-P, Martin TFJ 1992 Thyrotropin-releasing hormone and gonadotropin-releasing hormone receptors activate phospholipase C by coupling to the guanosine triphosphate-binding proteins Gq and G11. Mol Endocrinol 6:1673–1681[Abstract/Free Full Text]
  34. Stanislaus D, Janovick JA, Brothers S, Conn PM 1997 Regulation of G(q/11) by the gonadotropin-releasing hormone receptor. Mol Endocrinol 11:738–746[Abstract/Free Full Text]
  35. Neill JD, Sellers JC, Musgrove LC, Duck LW 1997 Epitope-tagged gonadotropin-releasing hormone receptors heterologously-expressed in mammalian (COS-1) and insect (Sf9) cells. Mol Cell Endocrinol 127:143–154[CrossRef][Medline]
  36. Andersen B, Kennedy GC, Hamernik DL, Bokar JA, Bohinski R, Nilson JH 1990 Amplification of the transcriptional signal mediated by the tandem cAMP response elements of the glycoprotein hormone {alpha}-subunit gene occurs through several distinct mechanisms. Mol Endocrinol 4:573–582[Abstract/Free Full Text]
  37. Bagatell CJ, Conn PM, Bremmer WJ 1993 Single-dose administration of the gonadotropin-releasing hormone antagonist, Nal-Lys (antide) to healthy men. Fertil Steril 60:680–685[Medline]
  38. Edidin M 1992 Translational diffusion of membrane proteins. In: Yeagle P (ed) Current Topics in Membranes and Transport. CRC Press, Boca Raton, pp 539–572
  39. Horvat R, Roess DA 1997 Truncation of the cytoplasmic tail of the LH receptor results in an increase in the relative number of mobile LH receptors under conditions in which receptor desensitization is delayed. Biol Reprod 56:228
  40. Janovick JA, Conn PM 1996 Gonadotropin releasing hormone agonist provokes homologous receptor microaggregation: an early event in seven-transmembrane receptor mediated signaling. Endocrinology 137:3602–3605[Abstract]
  41. Roess DA, Munnelly H 1997 HCG-occupied LH receptors exhibit higher levles of fluorescence energy transfer than do LH-occupied receptors. Biol Reprod 56:228
  42. Roess DA, Philpott CJ 1996 Biological function if the hCG-occupied LH-receptor is asscociated with slow receptor rotational diffusion. Biol Reprod 54:144
  43. Roess DA, Rahman NA, Kenny N, Barisas BG 1992 Lateral and rotational dynamics of LH receptors on rat luteal cells. Biochim Biophys Acta 1137:309–316[Medline]
  44. Arora KK, Sakai A, Catt KJ 1995 Effects of second intracellular loop mutations on signal transduction and internalization of the gonadotropin-releasing hormone receptor. J Biol Chem 270:22820–22826[Abstract/Free Full Text]
  45. Pawson AJ, Katz A, Sun YM, Lopes J, Illing N, Millar RP, Davidson JS 1998 Contrasting internalization kinetics of human and chicken gonadotropin-releasing horomone receptor mediated by C-terminal tail. J Endocrinol 156:R9–R12
  46. Axelrod D, Koppel DE, Schlessinger J, Elson E, Webb WW 1976 Mobility measurement by analysis of fluorescence photobleaching kinetics. Biophys J 16:1055–1069[Medline]
  47. Janovick JA, Haviv F, Fitzpatrick TD, Conn PM 1993 Differential orientation of a GnRH agonist and antagonist in the pituitary GnRH receptor. Endocrinology 133:942–945[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
A. M. Navratil, J. G. Knoll, J. D. Whitesell, S. A. Tobet, and C. M. Clay
Neuroendocrine Plasticity in the Anterior Pituitary: Gonadotropin-Releasing Hormone-Mediated Movement in Vitro and in Vivo
Endocrinology, April 1, 2007; 148(4): 1736 - 1744.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. M. Navratil, T. A. Farmerie, J. Bogerd, T. M. Nett, and C. M. Clay
Differential Impact of Intracellular Carboxyl Terminal Domains on Lipid Raft Localization of the Murine Gonadotropin-Releasing Hormone Receptor
Biol Reprod, May 1, 2006; 74(5): 788 - 797.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Cezanne, S. Lecat, B. Lagane, C. Millot, J.-Y. Vollmer, H. Matthes, J.-L. Galzi, and A. Lopez
Dynamic Confinement of NK2 Receptors in the Plasma Membrane: IMPROVED FRAP ANALYSIS AND BIOLOGICAL RELEVANCE
J. Biol. Chem., October 22, 2004; 279(43): 45057 - 45067.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
R. P. Millar, Z.-L. Lu, A. J. Pawson, C. A. Flanagan, K. Morgan, and S. R. Maudsley
Gonadotropin-Releasing Hormone Receptors
Endocr. Rev., April 1, 2004; 25(2): 235 - 275.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
A. Blondet, M. Doghman, M. Rached, P. Durand, M. Begeot, and D. Naville
Characterization of Cell Lines Stably Expressing Human Normal or Mutated EGFP-Tagged MC4R
J. Biochem., April 1, 2004; 135(4): 541 - 546.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Qi, T. M. Nett, M. C. Allen, X. Sha, G. S. Harrison, B. A. Frederick, E. D. Crawford, and L. M. Glode
Binding and Cytotoxicity of Conjugated and Recombinant Fusion Proteins Targeted to the Gonadotropin-Releasing Hormone Receptor
Cancer Res., March 15, 2004; 64(6): 2090 - 2095.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Navratil, S. P. Bliss, K. A. Berghorn, J. M. Haughian, T. A. Farmerie, J. K. Graham, C. M. Clay, and M. S. Roberson
Constitutive Localization of the Gonadotropin-releasing Hormone (GnRH) Receptor to Low Density Membrane Microdomains Is Necessary for GnRH Signaling to ERK
J. Biol. Chem., August 22, 2003; 278(34): 31593 - 31602.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W.-H. Yang, M. Wieczorck, M. C. Allen, and T. M. Nett
Cytotoxic Activity of Gonadotropin-Releasing Hormone (GnRH)-Pokeweed Antiviral Protein Conjugates in Cell Lines Expressing GnRH Receptors
Endocrinology, April 1, 2003; 144(4): 1456 - 1463.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. D. Horvat, D. A. Roess, S. E. Nelson, B. G. Barisas, and C. M. Clay
Binding of Agonist but Not Antagonist Leads to Fluorescence Resonance Energy Transfer between Intrinsically Fluorescent Gonadotropin-Releasing Hormone Receptors
Mol. Endocrinol., May 1, 2001; 15(5): 695 - 703.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
T. Hashizume, W.-H. Yang, C. M. Clay, and T. M. Nett
Internalization Rates of Murine and Ovine Gonadotropin-Releasing Hormone Receptors
Biol Reprod, March 1, 2001; 64(3): 898 - 903.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
S. Chauvin, A. Bérault, Y. Lerrant, M. Hibert, and R. Counis
Functional Importance of Transmembrane Helix 6 Trp279 and Exoloop 3 Val299 of Rat Gonadotropin-Releasing Hormone Receptor
Mol. Pharmacol., March 1, 2000; 57(3): 625 - 633.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
A. Cornea, J. A. Janovick, X. Lin, and P. M. Conn
Simultaneous and Independent Visualization of the Gonadotropin-Releasing Hormone Receptor and Its Ligand: Evidence for Independent Processing and Recycling in Living Cells
Endocrinology, September 1, 1999; 140(9): 4272 - 4280.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
C. Blanpain, V. Wittamer, J.-M. Vanderwinden, A. Boom, B. Renneboog, B. Lee, E. Le Poul, L. El Asmar, C. Govaerts, G. Vassart, et al.
Palmitoylation of CCR5 Is Critical for Receptor Trafficking and Efficient Activation of Intracellular Signaling Pathways
J. Biol. Chem., June 22, 2001; 276(26): 23795 - 23804.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nelson, S.
Right arrow Articles by Clay, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nelson, S.
Right arrow Articles by Clay, C. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals