| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Center for Reproductive Biology, Department of Genetics and Cell Biology, Washington State University, Pullman, Washington 99164-4231
Address all correspondence and requests for reprints to: Michael K. Skinner, Center for Reproductive Biology, Department of Genetics and Cell Biology, Washington State University, Pullman, Washington 99164-4231. E-mail: skinner{at}mail.wsu.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The primary hormone found to influence Sertoli cell differentiation is FSH. Locally produced paracrine factors also influence Sertoli cell differentiation. The bioactive peritubular cell secretory product termed PModS acts on Sertoli cells in a manner distinct from FSH and does not involve the cAMP-protein kinase A (PKA) pathway (7). The PModS activity in the peritubular cell secretory products, PModS(S300), is a useful agent to stimulate transferrin promoter activation independent of cAMP and FSH. Therefore, the current study compares FSH and PModS(S300) activation of the transferrin promoter to provide insight into FSH actions.
Expression data on the human transferrin promoter in rat Sertoli cells suggested that a minimal promoter (i.e. proximal 580 bp) is sufficient for basal activity of the gene (8). Through deletion analysis of the human transferrin promoter, a cell type-specific region was identified within the proximal -175 bp (8). In hepatocytes, this proximal region binds HNF (proximal regions I, PRI) and c/EBP (PRII) and imparts liver specificity (9). In rat Sertoli cells, the basal transcription of the human transferrin promoter is due to the TATA box region. The increase in transcription is most likely through the combination of factors binding to the proximal sites (PRI and PRII). Interestingly, the cAMP response element binding protein (CREB) interacts with the PRII (-100) of the human transferrin promoter (10, 11). In Sertoli cells, FSH acts primarily through the cAMP-PKA pathway (12). The regulation of the transferrin gene expression by FSH appears to be in part due to the CREB binding at PRII, however, PRII shows no homology to a consensus cAMP response element (CRE) (10, 11). Deletion of sequences upstream of the -100 bp region of the human transferrin (hTf) promoter retained cAMP responsiveness (10). This proximal 100 bp of the hTf contains the CREB binding region PRII. The effects of FSH on this proximal -100 bp promoter suggests the potential involvement of response elements upstream of this 100 bp region.
Another response element that is highly conserved between the mouse and human transferrin promoters is the E-box response element. The E-box is a consensus hexanucleotide sequence (CANNTG) and binds bHLH transcription factors as heterodimers (13). The bHLH proteins are a class of transcription factors previously shown to be involved in the transcriptional control of cell specific differentiation in a number of tissues including muscle and brain (e.g. MyoD and neuroD) (14, 15). These transcription factors have a conserved HLH domain essential for dimerization and a basic domain. The paired basic domain mediates binding to a consensus E-box (CANNTG) (16). Previously Sertoli cells have been shown to express bHLH proteins in response to FSH and PModS(S300) (17). Overexpression of Id (a negatively acting HLH protein lacking a basic domain) down-regulates the mouse transferrin promoter activation (17). The down-regulation of the mouse transferrin promoter may be directly mediated at the level of the E-box in the promoter, or it may be indirect involving intermediate early-event transcription factors.
The previous observations that additional regions of the mTf promoter other than the PRII are needed for optimal FSH actions (10, 11) and that Id can alter FSH actions (17) suggest that the actions of FSH are more complex than simply a CRE element requirement. In the present study, both E-box and CRE cis-acting DNA elements were demonstrated to be required for FSH induced activation of the mouse transferrin promoter in rat Sertoli cells. Observations suggest that bHLH proteins acting at the E-box and CREB acting at the CRE-like PRII appear to cooperate for optimal FSH induced promoter activation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids
The CAT reporter plasmid (pUC8-CAT) containing -581 bp (-581
bp mTf-CAT) was generously provided by Dr. G. Stanley McKnight
(University of Washington, Seattle, WA) (22). The mouse transferrin
promoter used in the present study included the transcriptional
initiation site of the transferrin gene which is 54 bp upstream of the
start site of translation (22). The point mutations in the PRII and
E-box elements of the mTf-CAT promoter were created with a QuickChange
site-directed mutagenesis kit (Stratagene, San Diego,
CA). The introduction of the desired mutation was confirmed by
DNA sequencing of the reporter constructs (Fig. 1
).
|
CAT assay
Assay of CAT activity was performed as follows: medium was
removed from the wells, and the cells were washed once with PBS. One
hundred microliters of cell lysis buffer (Promega Corp.)
was added to each well, and incubation was carried out for 15 min at
room temperature. The wells were then scraped and buffer was collected
in 1.5-ml microfuge tubes. Tubes were heated to 65 C for 10 min to
inactivate endogenous acetylases and then centrifuged at 12,000 x
g for 10 min at 4 C to remove cell debris. An aliquot of
cell extract (54 µl) was mixed with 65 µl 0.25 M Tris.
pH 8.0, 25 µg n-butyryl coenzyme A (5 mg/ml; Sigma Chemical Co.), and 0.1 µCi(1 µl) of 14C-Chloramphenicol
(ICN, Costa Mesa, CA) and incubated overnight at 37 C. The mixture was
extracted once with 300 µl mixed xylenes and back-extracted with 100
µl of 0.25 M Tris (pH 8.0). A 200-µl aliquot of the
organic phase was counted in a scintillation counter to determine the
relative amount of CAT activity. The average conversion of CAT
substrate for treated cells ranged between 20 and 30%. This assay was
found to be linear with the protein concentration used.
Gel shift assays
Gel shift assays were performed with nuclear extracts of
isolated Sertoli cells. The Sertoli cells were isolated as described
above and cultured in 150 mm x 20 mm tissue culture dishes
(Nunclon). The cells were treated after 48 h in culture with
either FSH, PModS(S300) or not treated for controls. After 72 h,
the cells were scrapped off the tissue culture dishes and washed once
with PBS. The nuclear extracts of these cells were then prepared as
described by Guillou et al. (8). Typically 70–100 µg of
protein was obtained from 108-plated cells. The
double-stranded DNA probes with flanking sequences used in gel
retardation assays were: E-Box: GCCCAAGCAGCTGTACCATGC;
Mutated E-box: GCCCAAGCAAAATGTACCATGC; PRII:
GCGGGGTGATTGGGCAA-TTGGACT; Mutated PRII:
GCGGGGTCCTAGGCATGTTG GACT; CRE:
GTGGATGACGTCAGGTCA. The gel retardation assay used was a
modification of the protocol described by Garner and Rezvin (24). The
final reaction volume of 20 µl contained 0.5 ng (approximately 50,000
cpm) of 5'- 32P-labeled double stranded probe, 100 ng
sonicated salmon sperm DNA, 2 µg Poly dI-dC (USB), 20 µg BSA, 20
mM HEPES, pH 8.0, 4 mM Tris, pH 7.9, 50
mM KCl, 600 µM EDTA and EGTA, 500
µM DTT, and 5 µg Sertoli cell nuclear proteins. After
incubation at room temperature for 20 min, 5 µl of the reaction was
electrophoretically separated on a nondenaturing 5% polyacrylamide gel
in 0.5 x TBE. The gel was dried under vacuum and exposed to Kodak
X-OMAT AR film (Eastman Kodak Co., Rochester, NY) at -80
C for 16–18 h. For the competition experiments, excess unlabeled
oligonucleotide (250 fold in excess than labeled probe) was added in
the binding reaction.
Immunoblot procedure
A gel shift assay was performed in duplicate on the same gel
using radioactive and nonradioactive PRII or E-box oligonucleotide. The
gel shift using radioactive probes was dried and autoradiographed as
above. Gel shift assay using nonradioactive probes on the
polyacrylamide gel was electrophoretically transferred to a
nitrocellulose membrane (BA85, Schleicher & Schuell, Inc.)
by electorphoresis in Tris-glycine buffer containing 12% methanol. The
blot was then blocked in 5% nonfat milk in TBSN (50 mM
Tris, pH 7.4; 150 mM NaCl, and 0.05% Nonidt P-40) and
incubated with a 1:3000 dilution of antibodies to E12/E47, CREB and
nonimmune serum (NIS) (Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA) for 3 h. After three washes of 15 min each, the
blot was hybridized with a secondary antibody (1:3000 dilution;
directed against rabbit immunoglobin G) conjugated to alkaline
phosphatase for 1 h at room temperature. After 5 washes in TBSN,
the immune complex was detected using the Immune-Star Chemiluminescent
Protein Detection System (Bio-Rad Laboratories, Inc.). As
an internal control, a gel shift was carried out using AP-1 oligo and
blotted with c-fos, E12, USF, and SRF antibody. When AP-1
was used as a probe, a band in the blot was observed only with
c-fos antibody (data not shown).
Statistical analysis
All transfection data were obtained from a minimum of three
different experiments unless otherwise stated. Each data point (from
treatments) was converted to a relative CAT activity (control CAT
activity of WT-mTf CAT = 1) with the mean and SEM from
multiple experiments determined as indicated in the figure legends.
Data were analyzed by ANOVA as indicated in the figure legends. The CAT
reporter plasmids without mTf promoter was used as negative controls.
In response to PModS (S300), FSH, and dcAMP the relative CAT activity
of the negative control plasmid was in the range of 1.5 to 2.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Sertoli
cells were isolated from 20-day-old rat testis and cultured under serum
free conditions. After transfection, the cells were left untreated or
treated with either FSH, dbcAMP, or a partially purified bioactive
preparation from a size exclusion column termed PModS(S300) for 48
h before harvesting the cells for CAT assay. As shown in Fig. 2, FSH, cAMP, and PModS(S300) induced
12-, 14- and 8-fold stimulation of the CAT activity, respectively,
compared with untreated controls (P < 0.001). This
increase in CAT activity was significantly higher than that observed by
transfecting Sertoli cells with a plasmid containing only the CAT gene
without any promoter, (less than 2-fold stimulation, data not shown).
The increased CAT activity in response to dbcAMP suggests that the
-581bp of the proximal promoter contains a cAMP response element.
|
and has
minimal similarity to the consensus CRE site (TGACGTCA). The human PRII
sequence was more than 80% conserved in the mouse transferrin promoter
(Fig. 1B). A gel shift assay was performed to determine whether the
mouse PRII can form specific DNA protein complexes. As shown in Fig. 3, the 24-bp PRII oligonucleotide
resulted in a gel shift with multiple bands when nuclear extracts from
FSH and dbcAMP treated Sertoli cells were used in the binding reaction
(Fig. 3). The presence of multiple retarded bands raises the
possibility that PRII may bind a number of different proteins (or
isoforms) with different mobility’s in the native gel. Excess
unlabeled PRII was added to the binding reaction to confirm that the
retarded bands were specific. The excess unlabeled PRII displaced all
the observed bands suggesting that these bands were specifically due to
binding of proteins to the PRII oligonucleotide (Fig. 3). To explore
the possibility that CREB may bind to PRII, excess unlabeled consensus
CRE oligonucleotide was added to the binding reaction. Addition of
excess CRE also displaced all three of the major bands in the gel shift
reaction (Fig. 3). However, none of the bands were displaced when
either E-box or Oct1 oligonucleotides were included in the binding
reaction (data not shown). The gel shift was transferred onto a
nitrocellulose membrane and blotted with antibody to CREB to confirm
that PRII does bind CREB. As shown in Fig. 3 (blot, far
right) two bands were detected with CREB antibody which correlated
with the first two bands in the gel shift assay. As a control for the
blot experiment, a gel shift with Oct 1 oligonucleotide was transferred
onto nitrocellulose membrane and probed with CREB antibody.
Failure to detect any retarded band with CREB antibody confirmed the
specificity of the blot procedure and support the observation that CREB
is present in the complex binding to PRII. The identity of the bottom
gel shift is currently unknown and suggests that additional proteins
may also bind the PRII oligonucleotide. Further experiments were
performed with a consensus CRE oligonucleotide. This consensus CRE
(TGACGTCA) was previously shown to bind CREB (25). As shown in Fig. 4, a faint retarded complex was observed
when nuclear extracts from untreated controls (C) and PModS(S300)
treated Sertoli cells were used in the binding reaction. The intensity
of this retarded complex was increased dramatically when nuclear
extracts from either FSH- or dbcAMP-treated cells were used. This
result suggests that both these treatments increased the binding of
CREB to the consensus CRE. This retarded complex was specific due to
the ability of excess unlabeled CRE to completely displaced the CRE gel
shift. Interestingly, addition of unlabeled PRII also completely
displaced the retarded complex, confirming that PRII also bound CREB
(Fig. 4). Therefore, activation of the WT-mTfCAT in response to cAMP
(Fig. 2) appears to be mediated through the PRII site.
|
|
). In a gel shift reaction a
mutated PRII oligonucleotide (PRII1) failed to compete the retarded
bands using wild-type (WT) PRII (Fig. 3) or WT-CRE (Fig. 4) as probes.
This suggests that mutations in the PRII appear to disrupt the binding
of CREB. In transient transfection experiments, the mTf CAT construct
with mutations in the PRII region (PRII1-mTfCAT) was stimulated only
2-fold (P < 0.05) in response to dbcAMP (Fig. 2). This
is a significant reduction in the activity of the PRII1-mTfCAT promoter
when compared with the activation of the WT-mTfCAT by dbcAMP (14-fold,
P < 0.001). The data suggests that the stimulation of
the transferrin promoter by cAMP is primarily mediated through the
binding of CREB at the PRII site. However, in response to FSH the
PRII1-mTfCAT retained 40% of its activity (5-fold, P
< 0.001) compared with untreated controls but was significantly less
than the WT-mTfCAT (12-fold, P < 0.001) in response to
FSH (Fig. 2). Comparison of the PRII1-mTfCAT response to cAMP (2-fold)
and FSH (5-fold) suggested that other response elements apart from PRII
are also involved in FSH mediated activation of the transferrin
promoter. Interestingly, the activity of PRII1-mTfCAT and WT-mTfCAT was
similar in response to PModS (S300) activity (Fig. 2). This supports
the previous hypothesis (7) and provides direct evidence that PModS
(S300) activity does not act through the cAMP-PKA pathway.
Previous reports demonstrate that overexpression of the negatively
acting HLH protein Id down-regulates the mouse transferrin
promoter activity. Both PModS(S300) activity and FSH were also shown to
induce the bHLH protein activity in Sertoli cells (17). This and the
observation that a consensus E-box is present in both mouse and human
proximal transferrin promoters (Fig. 1A) suggested a potential role for
this E-box in regulating the activity of the mouse transferrin
promoter. Gel shift experiments were performed to confirm that E-box
binding proteins can bind to the transferrin E-box. As shown in Fig. 5, a specific retarded band was observed
when the mouse transferrin E-box (Tf E-box) oligonucleotide was used in
the binding reaction with nuclear extracts from Sertoli cells treated
with FSH and PModS(S300). A faint retarded band comparable to untreated
controls was also observed when nuclear extracts from dbcAMP treated
Sertoli cells were used in the binding reaction. Observations suggest
that cAMP may not induce the activity or expression of bHLH proteins
(Fig. 5). A gel shift immunoblot experiment was performed as previously
described to identify the protein(s) binding to the E-box in response
to FSH. The gel shift with nuclear extracts from FSH-treated Sertoli
cells was transferred onto a nitrocellulose membrane and blotted with
antibody to the ubiquitously expressed bHLH proteins E12/E47. The
presence of a single band comparable to the retarded band in the gel
shift assay confirmed that the product of the E2A gene E47/E12 is part
of the complex binding to the transferrin E-box. Site directed
mutations in the core nucleotides of the E-box in the 581-bp proximal
promoter were performed to investigate the role of the E-box in
regulating the mouse transferrin promoter (Fig. 1C). As shown in Fig. 5, the failure of the mutated E-box oligo to displace the retarded band
confirmed that the mutations disrupt the binding of E-box proteins.
|
) and was comparable to the WT promoter. Therefore,
mutations in the E-box had no effect on the activation of the
transferrin promoter by dbcAMP. This is consistent with the gel shift
data shown in Fig. 5 indicating the absence of a retarded band with
dbcAMP. The activity of EB1-mTfCAT construct in response to FSH was
significantly reduced (6-fold) compared with the WT promoter
(P < 0.001) (Fig. 2). Only 2-fold stimulation
(nonsignificant) was observed when the EB-1mTfCAT construct was
stimulated with PModS(S300). The transfection data using EB1-mTfCAT
suggests that the action of FSH on the mouse transferrin promoter are
mediated in part through the E-box and not exclusively through the
cAMP-PKA-mediated binding of CREB to the PRII site. This is supported
by the observation that the dbcAMP treatment had no effect on the
EB-mTfCAT promoter, but the activity of PRII-mTfCAT promoter was
completely inhibited. The testicular paracrine activity PModS(S300)
seems to primarily regulate the activity of the mouse transferrin
promoter through the binding of bHLH proteins to the E-box.
A complete inhibition in the mouse transferrin promoter activation in
response to PModS(S300) and dbcAMP was observed when either E-box or
PRII were mutated respectively. Neither of these mutations alone
completely abolished FSH actions on the mouse transferrin promoter. The
proposal was made that both these response elements are required for
optimal FSH induced activation of the promoter. To test this hypothesis
simultaneous mutations were performed in both the E-box and PRII of the
581-bp minimal promoter. The Sertoli cells were transiently transfected
with the mutated E-box and PRII sites in the promoter
(EB1-PRII1-mTfCAT) and treated with FSH. As shown in Fig. 2, the CAT
activity of the double mutant EB1-PRII1-mTf construct was comparable to
untreated controls. This observation suggests that intact E-box and
PRII sites are required for maximal stimulation of the mouse
transferrin promoter by FSH (Fig. 6). The
potential general role of both the E-box and CRE-like elements in
mediating FSH actions was examined by investigating the presence of
both of the elements in the published promoter sequences of a number of
Sertoli cell genes. As shown in Table 1,
a consensus E-box sequence was present in promoters of all the
sequences examined. Although the complete 25 bp of the PRII region was
not completely conserved, parts of the region were highly conserved.
The PRII-like domain may have the potential to regulate the PKA
mediated activation of these promoters. This is supported by the
observation that a consensus CRE site was absent from the promoters
analyzed with the exception of the inhibin promoter (Table 1). Although
this suggests the potential that both these elements may be required
for FSH actions, more direct studies with each specific promoter will
be required.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). These elements can be recognized by
trans-acting factors such as C/EBP, CREB, HNF, and COUP Tf
(8, 9, 10, 11, 32). A combinatorial effect of several such
trans-acting factors with multiple cis-acting sequences may
provide tissue specific expression of the transferrin gene. In the
current study, such cis-acting elements and trans-acting
factors involved in regulating Sertoli cell expression of the mouse
transferrin gene were investigated. Transferrin is secreted by
differentiated Sertoli cells and understanding the factors involved in
regulating the transferrin gene expression provides insight into
Sertoli cell differentiation.
Sertoli cell function is regulated primarily by the gonadotropin FSH.
The FSH receptor is coupled to the PKA pathway (33). FSH treatment
rapidly increases intracellular cAMP levels in the Sertoli cells (10).
Many of the actions of FSH in Sertoli cells can be mimicked by the cAMP
analog dbcAMP. The cAMP-PKA pathway regulates transcription through the
phosphorylation of serine 133 of the 43-kDa CREB that binds to the 8-bp
palindromic sequence (TGACGTCA) CRE site present in the promoters of a
number of genes (34, 35). The absence of a consensus CRE site in the
mouse transferrin promoter (mTf), as well as from the promoters of
other Sertoli cell genes, Table 1, suggests that either CREB or other
members of its family can bind sites other than a consensus CRE.
Alternatively, the effects of FSH/cAMP are mediated through
intermediate transcription factors which are responsive to FSH/cAMP
induction. Interestingly, the PRII site in the human transferrin
promoter binds CREB at a nonconsensus CRE site (10, 11). The
observation that mutations in the PRII site of the human transferrin
promoter can down-regulate cAMP-induced stimulation (10) suggests that
dimers of the CREB family of bZIP proteins are able to target DNA
sequences different from the consensus 8-bp CRE palindrome. The
presence of a nearly conserved PRII site in the mouse transferrin
promoter suggests that this PRII site is a potential candidate in
regulating FSH and cAMP-induced mouse transferrin gene expression. In
contrast to the human PRII sequence, the mouse PRII sequence contains
the CRE half site (CGTCA). Another response element that is more than
90% conserved in both human and mouse PRII is the C/EBP binding site
(ANNGGCAATT). In addition to CREB, the PRII of the human transferrin
promoter also can bind two additional unknown proteins SP-A and SP-D in
rat Sertoli cells (9). It is possible that transcription factors
similar to SP-A and SP-D may also bind PRII of the mouse transferrin
promoter used in the present study and impart some tissue specificity.
Our observations suggest that the PRII of the mouse transferrin
promoter also binds CREB. The presence of multiple bands in the gel
shift using PRII oligonucleotide as a probe (Fig. 3) suggests that
multiple transcription factors can bind to PRII. However, a complete
displacement of all the retarded bands with excess unlabeled consensus
CRE oligonucleotide indicates that these other unknown transcription
factors appear to be dependent on the binding of CREB or its isoforms
to PRII.
The contribution of the PRII region of the mouse transferrin promoter in the actions of FSH was investigated by examining the activity of mTf promoter with specific mutations in the PRII region in the mTf-CAT plasmids transfected into Sertoli cells. This mutation resulted in a nearly complete loss of responsiveness to cAMP and appears to be due to the loss of binding of CREB which was suggested by the gel shift data using mutated PRII (PRII1). The mutation in the PRII had no effect on the PModS(S300) activation of the mTf promoter. This confirms previous observations (7) and provides additional evidence that the actions of PModS(S300) activity are not mediated through the cAMP pathway.
Interestingly, FSH was still able to stimulate (5-fold) the PRII1 mTf CAT plasmid. If the induction of the mTf promoter were exclusively mediated through the cAMP pathway, a complete loss in promoter activation as seen with dbcAMP was anticipated. The lack of a complete loss of responsiveness implies the role of other cis acting elements and trans-acting factors in FSH mediated induction of the mTf promoter. One such trans-acting factor may be c-fos. The translation of c-fos is required for FSH- and PModS(S300)-induced transferrin promoter activation and expression of the gene (29). The activation of c-fos by FSH and PModS(S300) primarily seems to be at the level of the serum response element (SRE) (36). However, a consensus CRE site is also present in the proximal c-fos promoter. The c-fos together with c-jun as a dimer can bind to a potential AP-1 site present in the promoters of a number of genes to activate transcription (37). The absence of an AP-1 site in the proximal mouse and human transferrin promoters again suggests that intermediate transcription factor(s) under the control of c-fos may regulate the activity of the transferrin promoter. Another possibility is that a common cis acting element may control the activity of both the c-fos and transferrin promoters. One of the common cis-elements identified by comparison of the mouse transferrin promoter with the proximal promoter of c-fos was an E-box element. E-box (consensus CANNTG) elements are a motif to which the bHLH class of transcription factors bind (13). These proteins are involved in cell-specific transcriptional control in a number of tissues including muscle and brain (14, 15). The bHLH proteins have a conserved HLH domain essential for dimerization of different bHLH proteins as well as a basic domain that mediates binding to an E-box (16).
An E-box is present in the proximal c-fos promoter (-303) and mouse transferrin promoter (-327, CAGCTG). Interestingly an E-box sequence is also present in the human transferrin promoter (-506, CACCTG). The presence of an E-box suggests that bHLH proteins may regulate the transcriptional activity of these promoters. Previously we have shown that overexpression of Id (a negatively acting HLH protein lacking a basic DNA binding domain) down-regulates the mTf-CAT (17) and c-fos (unpublished observation) reporter construct in response to FSH and PModS. This down-regulation by Id implies that bHLH proteins either directly regulate the mouse transferrin promoter CAT activity by binding to the E-box or mediate activation through c-fos. Mutations in the E-box were performed to directly establish the role of the E-box in the regulation of the mouse transferrin promoter. As observed with the PRII mutations, the E-box mutations resulted in only a 6-fold stimulation of the transferrin promoter in response to FSH. The mutated E-box had no effect on cAMP induction and was comparable to the WT promoter. This transfection data are also supported by the gel shift experiments in that a retarded E-box band was observed with FSH but not with nuclear extracts from cAMP treated Sertoli cells. These observations support the role of an E-box in the regulation of the transferrin promoter by FSH and suggest involvement of multiple cis-acting element and trans-acting factors such as bHLH proteins and possibly CREB. Comparison of the response of EB1-mTfCAT to FSH and cAMP suggests that binding of bHLH proteins to the E-box is present for FSH, but not cAMP. FSH signaling events independent of the cAMP-PKA pathway may regulate the binding of bHLH proteins to the E-box. Recently, it was shown that an E-box response element is present in the proximal (-200 bp) promoter region of the regulatory subunit RIIß of the cAMP dependent PKA (38). The functional significance of the E-box in the regulation of the RIIß promoter activity is not known. It is possible that a Sertoli cell specific response to FSH, but not cAMP, may require the cell specific expression and binding of bHLH proteins to the RIIß E-box. The presence of the E2A gene product E12 or E47 in the retarded band with an E-box as a probe was demonstrated. E12 and E47 are ubiquitously expressed bHLH proteins that generally form heterodimers with cell specific bHLH protein to activate transcription. The possibility exists that E12/E47 form heterodimers with a yet unknown Sertoli cell specific bHLH protein.
In summary, the current study provides direct evidence for the first
time that the presence of both the E-box and the PRII in the
transferrin promoter is required for FSH to optimally activate the mTf
promoter. The presence of PRII is sufficient if the stimulation is
mediated primarily through the cAMP-PKA pathway. In contrast, the
effect of the testicular paracrine factor PModS(S300) activity on the
promoter is mediated primarily through the E-box response element (Fig. 6A). Observations suggest that at least two different pathways are
involved in regulating the activity of the transferrin gene in Sertoli
cells. This is interesting considering the phenotype recently reported
for the FSH ß-subunit knockout mice (39). Although fertility was
maintained in FSH ß null mutation male mice, the testis size was
significantly smaller. This appears to be due to decreased
spermatogenesis and/or Sertoli cell numbers, suggesting FSH has a role
in maintaining optimal testicular function. Combined observations
suggest that multiple factors involving diverse signal transduction and
transcription pathways appear to regulate Sertoli cell gene expression.
As shown in Fig. 6B, it is proposed that bHLH proteins may interact
with CREB or CREB-like proteins binding to the PRII. This interaction
may be direct or mediated through an adapter-type protein. This adapter
protein can be similar to CBP, which has recently been shown to bind
bHLH proteins, as well as CREB (40, 41). The complete loss in the
activity of the promoter in response to FSH with both E-box and PRII
mutations suggests that both these response elements are required for
maximal stimulation of the transferrin promoter. How these response
elements and cis-acting factors interact remains to be elucidated. The
observation that similar elements (i.e. E-box and PRII) are
present in other major Sertoli cell genes (Table 1) suggests this may
be a general phenomena for FSH activation of Sertoli cell
transcription. More direct experiments with those various promoters
will be required to test this hypothesis.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received August 4, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  M. A. Wood and W. H. Walker USF1/2 Transcription Factor DNA-Binding Activity Is Induced During Rat Sertoli Cell Differentiation Biol Reprod, January 1, 2009; 80(1): 24 - 33. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bhardwaj, M. K. Rao, R. Kaur, M. R. Buttigieg, and M. F. Wilkinson GATA Factors and Androgen Receptor Collaborate To Transcriptionally Activate the Rhox5 Homeobox Gene in Sertoli Cells Mol. Cell. Biol., April 1, 2008; 28(7): 2138 - 2153. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Muir, I. Sadler-Riggleman, and M. K. Skinner Role of the Basic Helix-Loop-Helix Transcription Factor, Scleraxis, in the Regulation of Sertoli Cell Function and Differentiation Mol. Endocrinol., August 1, 2005; 19(8): 2164 - 2174. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. H Walker and J. Cheng FSH and testosterone signaling in Sertoli cells Reproduction, July 1, 2005; 130(1): 15 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chaudhary, I. Sadler-Riggleman, J. M. Ague, and M. K. Skinner The Helix-Loop-Helix Inhibitor of Differentiation (ID) Proteins Induce Post-Mitotic Terminally Differentiated Sertoli Cells to Re-Enter the Cell Cycle and Proliferate Biol Reprod, May 1, 2005; 72(5): 1205 - 1217. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Fix, C. Jordan, P. Cano, and W. H. Walker Testosterone activates mitogen-activated protein kinase and the cAMP response element binding protein transcription factor in Sertoli cells PNAS, July 27, 2004; 101(30): 10919 - 10924. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Musikacharoen, Y. Yoshikai, and T. Matsuguchi Histone Acetylation and Activation of cAMP-response Element-binding Protein Regulate Transcriptional Activation of MKP-M in Lipopolysaccharide-stimulated Macrophages J. Biol. Chem., March 7, 2003; 278(11): 9167 - 9175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Wise, D. D. Lunstra, G. A. Rohrer, and J. J. Ford Relationships of testicular iron and ferritin concentrations with testicular weight and sperm production in boars J Anim Sci, February 1, 2003; 81(2): 503 - 511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Chaudhary and M. K. Skinner Identification of a Novel Gene Product, Sertoli Cell Gene with a Zinc Finger Domain, That Is Important for FSH Activation of Testicular Sertoli Cells Endocrinology, February 1, 2002; 143(2): 426 - 435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chaudhary and M. K. Skinner Role of the Transcriptional Coactivator CBP/p300 in Linking Basic Helix-Loop-Helix and CREB Responses for Follicle-Stimulating Hormone-Mediated Activation of the Transferrin Promoter in Sertoli Cells Biol Reprod, August 1, 2001; 65(2): 568 - 574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chaudhary, J. Johnson, G. Kim, and M. K. Skinner Hormonal Regulation and Differential Actions of the Helix-Loop-Helix Transcriptional Inhibitors of Differentiation (Id1, Id2, Id3, and Id4) in Sertoli Cells Endocrinology, May 1, 2001; 142(5): 1727 - 1736. [Abstract] [Full Text]
|
|
|
|
 |
|
 O. G. Rossler, P. Hloch, N. Schutz, T. Weitzenegger, and H. Stahl Structure and expression of the human p68 RNA helicase gene Nucleic Acids Res., February 15, 2000; 28(4): 932 - 939. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
