help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sellitti, D. F.
Right arrow Articles by Doi, S. Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sellitti, D. F.
Right arrow Articles by Doi, S. Q.
Endocrinology Vol. 140, No. 3 1365-1374
Copyright © 1999 by The Endocrine Society

ARTICLES

Regulation of Natriuretic Peptide Receptors by Thyrotropin in FRTL-5 Rat Thyroid Cells: Evidence for Nonguanylate Cyclase Atrial Natriuretic Factor-Binding Sites in Cells Lacking the Natriuretic Peptide Receptor C

Donald F. Sellitti and Sonia Q. Doi

Department of Medicine, Endocrinology and Nephrology Divisions, Uniformed Services University of the Health Sciences, Bethesda, Maryland 20814-4799

Address all correspondence and requests for reprints to: Donald F. Sellitti, Ph.D., Medicine Department, Room A 3060, Uniformed Services University of the Health Sciences, 4301 Jones Bridge Road, Bethesda, Maryland 20814-4799. E-mail: dsellitti{at}mxa.usuhs.mil


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Natriuretic peptide receptors (NPR) are expressed in thyroid-derived cells, including the rat FRTL-5 thyroid cell line. We have previously demonstrated that atrial natriuretic factor (ANF) binding consistent with the NPR-A receptor is significantly increased in FRTL-5 cells cultured in the presence of TSH. The purpose of the present study was to determine whether TSH treatment, therefore, results in higher levels of ANF-induced intracellular cGMP, and whether TSH elicits similar effects on cGMP signaling through the NPR-B receptor. We now show that contrary to expectation, long term exposure to 1 mIU/ml bovine TSH (6H medium) does not significantly alter maximal ANF-induced cGMP formation. Moreover, TSH treatment decreased C-type natriuretic peptide (CNP)-induced cGMP generation in FRTL-5 cells, suggesting a down-regulation of NPR-B. A similar effect of TSH on ANF- and CNP-induced cGMP was observed in FRTL cells, the precursor of the FRTL-5 cell line. Scatchard analysis of [125I]ANF binding in TSH-treated (6H) FRTL-5 cultures indicated a 5.6-fold increase in high affinity ANF-binding sites compared with TSH-deficient (5H) cultures [binding capacity (Bmax) of 6H cells, 227.2 ± 33.7 fmol/mg protein; Bmax of 5H cells, 40.2 ± 4.7 fmol/mg protein]. The effect of TSH on [125I]ANF binding was mimicked by forskolin and (Bu)2cAMP, indicating receptor up-regulation via a cAMP pathway. High affinity [125I]CNP-binding sites were present in much lower abundance (Bmax of 5H, 0.80 ± 0.06 fmol/mg protein), and no effect of TSH treatment on them could be demonstrated. However, low affinity [125I]CNP binding was increased by TSH. RT-PCR confirmed the presence of both NPR-A and NPR-B transcripts in FRTL-5 cells and showed that TSH treatment significantly decreased NPR-B, but not NPR-A. NPR-C transcript was not detectable by RT-PCR in FRTL-5 cells cultured in high TSH medium, suggesting that the ANF-binding sites increased by TSH are not NPR-C. Both CNP and ANF transcript were also expressed in FRTL-5 cells, and CNP was increased by TSH. Together the data support the down-regulation of functional NPR-B and no change in functional NPR-A by TSH. The vast majority of ANF-binding sites in FRTL-5 cells, therefore, are not coupled to cGMP production and may represent a novel or altered form of NPR that is regulated by TSH independently of NPR-A and NPR-B.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE NATRIURETIC peptides [atrial natriuretic factor (ANF), brain natriuretic peptide (BNP), and C-type natriuretic peptide (CNP)] constitute a family of small polypeptides that possess a 17-member disulfide ring as a common structural feature (1). ANF, the first member of this family identified, is secreted by atrial myocytes and exerts effects on diverse systems (renal, cardiovascular, and central nervous systems) to regulate blood pressure, fluid transport, and electrolyte homeostasis (2, 3, 4). The natriuretic peptides also have potentially important stimulatory or inhibitory activities in endocrine organs, including inhibition of aldosterone and renin secretion and stimulation of androgen secretion (5, 6, 7, 8).

Cellular effects of natriuretic peptides are mediated through membrane-bound receptors (NPR), of which three distinct subtypes have been characterized (9). Two of these, NPR-A and NPR-B, possess an intrinsic guanylate cyclase activity that increases intracellular cGMP upon binding natriuretic peptides. ANF and BNP are selective for the NPR-A receptor, whereas CNP is selective for NPR-B (10, 11). A third NPR subtype, NPR-C, contains only a short intracellular domain, which is not coupled to cGMP formation but may be involved in other signal transduction pathways (12).

The coexpression of natriuretic peptides and their receptors in a variety of tissues [e.g. bone (13), ovary (14), and vasculature (15)] has led several investigators to propose the existence of natriuretic peptide systems involved in autocrine/paracrine regulation in addition to endocrine regulation by circulating ANF. We have previously proposed that the thyroid gland contains such a natriuretic peptide system, because immunoreactive natriuretic peptide was detected in both human (16) and porcine (17) thyroid, and high affinity ANF-binding sites were detected in early passage cultures of both human (18) and porcine (17) thyroid cells. At least one function of the natriuretic peptide system in the human thyroid could be the regulation of thyroid hormone secretion, because decreased thyroglobulin secretion has been observed in cultured human thyroid cells exposed to increasing concentrations of ANF (19).

The FRTL-5 cell line is a continuous diploid cell line derived from rat thyroid follicular cells that is frequently used in studies of cell regulation and signal transduction in the thyroid cell (20). Our previous work has identified some of the elements of an autocrine natriuretic peptide system in these cells, including the presence of an ANF-like immunoreactivity in intracellular granules and its secretion into the medium (21), the presence of high affinity [125I]ANF-binding sites (22), and ANF- and CNP-induced increases in intracellular cGMP. The inability of the ring-deleted ANF analog C-ANF (4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23) to displace [125I]ANF binding in FRTL-5 suggests the absence of NPR-C (22, 23), and the ANF- and CNP-stimulated cGMP generation suggests the presence of NPR-A and NPR-B, respectively. Comparatively much higher increases in ANF-induced cGMP in FRTL-5 cells than in primary cultures of mammalian thyroid cells (22) suggest that this cell line is a useful model of cGMP regulatory pathways in the thyroid cell (24). Moreover, the apparent absence of NPR-C in these cells would appear to recommend these cells as a model for the independent regulation of membrane guanylate cyclases (NPR-A and NPR-B) in mammalian cells.

As TSH is the principal hormonal regulator of thyroid function (25), we have studied its role in the regulation of the natriuretic peptide system in the FRTL-5 model. Long term culture of FRTL-5 cells in the presence of TSH (1 mU/ml) resulted in a marked increase in ANF binding with no change in receptor affinity (22). In addition, we showed that immunoreactive natriuretic peptide expression in FRTL-5 cells was dependent on the presence of TSH in the medium (21). To date, however, we have not characterized the effects of TSH on the expression of specific NPR subtypes. In the present report, therefore, we have studied the role of TSH in regulating individual NPR subtypes using both natriuretic peptide-induced cGMP production and natriuretic peptide binding with NPR-A- and NPR-B-specific ligands. The effects of TSH on both NPR subtype and natriuretic peptide expression were examined using RT-PCR.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
Rat ANF [ANF-(99–126)], CNP-22, and 125I-labeled [Tyr0]CNP (SA, 1000 Ci/mmol) were purchased from Peninsula Laboratories, Inc. (Belmont, CA). [125I]rat ANF (SA, 2200 Ci/mmol) was obtained from New England Nuclear (Boston, MA). TSH from bovine pituitary (2 IU/mg protein), forskolin, (Bu)2cAMP, and phorbol 12-myristate 13-acetate (PMA) were purchased from Sigma Chemical Co. (St. Louis, MO). A23187 (free acid) was obtained from Calbiochem-Novabiochem Corp. (La Jolla, CA).

Cell culture
FRTL-5 cells (American Type Culture Collection, Manassas, VA; ATCC CRL 8305, F1 subclone) were obtained originally from Dr. Leonard Kohn (NIH, Bethesda, MD). Cells were grown in 6H medium [Coon’s Modified Ham’s F-12 Medium (Sigma Chemical Co.) supplemented with 5% calf serum (BioWhittaker, Inc., Walkersville, MD), 1 mM nonessential amino acids (BioWhittaker, Inc.), and a six-hormone mixture (TSH, insulin, somatostatin, hydrocortisone, transferrin, and glycyl-histidyl-lysine)] as previously described (26). Cells were also maintained in 5H medium, identical to the above except for the absence of TSH.

FRTL cells (ATCC CRL 1468) were purchased from American Type Culture Collection and, after plating in 6H medium, were maintained in either 6H or 5H medium before cGMP assay as described below.

cGMP assay
FRTL-5 cells were grown to confluence in Coon’s 6H medium (1 mU/ml TSH) in 24-well plates and, after washing, were incubated with either 6H medium or 5H medium (0 TSH) for an additional 7 days. At assay, growth medium was aspirated, and culture wells received 0.4 ml MEM containing 1 mM CaCl2, 1 mM MgSO4, 1% BSA, 0.5 mM isobutylmethylxanthine, and either ANF or CNP (0–1 µM). After a 20-min incubation at 37 C, medium was aspirated, wells received 0.5 ml of a 0.1 M HCl solution containing 0.1 mM CaCl2, and these samples were stored at -70 C for determination of cGMP content by RIA (Biomedical Technologies, Staughton, MA). All samples were diluted 1:5 in acetate buffer and acetylated before being assayed. An identical procedure was used to determine ANF- and CNP-stimulated cGMP accumulation in FRTL cells. Maximal cGMP accumulation and EC50 were determined by sigmoid fit to cGMP generation data (r2 = 0.97–0.99 for all curves) using In-Plot software (GraphPad, San Diego, CA).

RIA for cAMP (Biomedical Technologies) was performed as described above for cGMP to determine the EC50 of TSH-induced cAMP production in FRTL-5 cells.

[125I]ANF and [125I]CNP binding assays
The binding of 125I-labeled rat ANF-(99–126) and 125I-labeled [Tyr0]CNP to cell surface receptors in cultured FRTL-5 cells was assessed using an assay modified from that described by Leitman et al. (27). To investigate the influence of TSH on ANF and CNP binding, FRTL-5 cells were grown to confluence in 6H medium in 24-well plates, followed by a 7-day incubation in either 6H or 5H medium as described above. In the CNP binding assay, wells were washed with DMEM, then incubated for 60 min at 23 C in a total volume of 200 µl buffer (25 mM HEPES and 2 mg/ml BSA in DMEM) containing 0.1 nM 125I-labeled [Tyr0]CNP (Peninsula Laboratories, Inc.) and increasing concentrations of unlabeled CNP. After washing them with HBSS, the cells were solubilized in 0.1 M NaOH, and radioactivity was counted in a {gamma}-counter. Maximal binding capacity (Bmax) and Kd were calculated from saturation analysis of the binding data using MacLIGAND (version 4.93). ANF binding was determined by an identical procedure, except that cells were exposed to 0.1 nM [125I]rat ANF-(99–126) and increasing concentrations of rat ANF-(99–126).

In studies of the influence of TSH second messenger pathways on [125I]rat ANF-(99–126) binding, FRTL-5 cells were grown to confluence in 24-well plates in 6H medium, which was replaced with 5H medium for 2 days before beginning a 4-day treatment with various agents. Treatment medium consisted of 5H medium with the addition of TSH (1 mIU/ml), forskolin (10 µM), (Bu)2cAMP (1 mM), A23187 (2 µM), or PMA (160 nM). At assay, individual wells were washed with DMEM, then received 0.1 nM [125I]rat ANF-(99–126) in binding buffer for 1 h at 23 C. Nonspecific binding was determined in a parallel plate in which cells received 1 µM unlabeled rat ANF-(99–126) in addition to [125I]rat ANF. After incubation, cell extracts were prepared and counted as described above. Specific binding (total ANF binding minus ANF binding in the presence of 1 µM ANF) was normalized to cellular protein (Bio-Rad Laboratories, Inc., Richmond, CA) and compared between treatment groups using ANOVA followed by a Tukey-Kramer multiple comparisons test.

The relationship of [125I]ANF binding to TSH dose was determined in a similar manner by comparing specific ANF binding in FRTL-5 cells exposed to a range of TSH concentrations (0–1 mIU/ml) for 4 days. The EC50 of the TSH effect on [125I]ANF binding was determined by fitting a competition curve to the binding data using In-Plot software.

RT-PCR
Rat kidney and heart polyadenylated [poly(A)+] messenger RNA (mRNA; 1 µg/µl) were purchased from Clontech (Palo Alto, CA). Rat thyroid mRNA was prepared from a pool of 50 rat thyroids purchased from Pel-Freez Biologicals (Rogers, AK) using a Mini RiboSep Ultra mRNA isolation kit (Collaborative Biomedical Products, Bedford, MA). Briefly, thyroids were pulverized in a liquid nitrogen-cooled mortar, homogenized (15 sec; Tissue-tearor, BioSpec Products, Inc.) and then incubated (45 C, 2 h) in a lysis buffer containing 200 µg/ml proteinase K. Lysate was incubated (23 C, 1 h) with oligo(deoxythymidine)-cellulose, and after washing, mRNA was eluted, then precipitated with ethanol-sodium acetate. The mRNA pellet was washed and resuspended in diethylpyrocarbonate-treated H2O to a final concentration of 800 ng/µl.

Poly(A)+ mRNA was also isolated from FRTL-5 cells and FRTL cells grown in both 5H and 6H medium. FRTL-5 cells were grown to confluence in 162-cm2 culture flasks in 6H medium, then received either 5H or 6H medium for 5–8 days before collection by trypsinization. Poly(A)+ mRNA was prepared from the cell pellet using the Mini Ribo Sep Ultra mRNA isolation kit. FRTL cells were grown to confluence in 162-cm2 culture flasks in 6H medium, then maintained on 6H until the cells were collected by trysinization. Poly(A)+ mRNA was prepared as described above.

RT of mRNA and PCR amplification of RT reaction product was accomplished using the following primers (underlined bases represent the addition of G clamps and restriction sites to the 5'-ends of certain primers): NPR-A: sense, ttccaaggtgtgacaggata; antisense, cacaactctgagaccagc (358 bp); NPR-B: sense, gggtcgaccaccaggtgtatgcccgagagcca; antisense, ggaagcttccgtcccgtccaccaaatctgctt (670 bp); NPR-C: sense, gggtcgacatcgtgcgccacatccaggccagt; antisense, ggaagctttccaaagtaatcaccaataacctcctgggtacccgc (570 bp); ANF: sense, gggggtaggattgacaggatt; antisense, tccaggagggtattcacc (171 bp); and CNP: sense, ttcgggacctgcgtgtggaca; antisense, ccctcccaaataataataaa (346 bp).

RT was performed in a DNA thermal cycler (Perkin Elmer) in a reaction volume of 20µl containing 5 mM MgCl2, 1 x PCR buffer II (Perkin-Elmer, Norwalk, CT), 1 mM deoxy-NTP, 1 U/µl ribonuclease inhibitor, 2.5 U/µl Moloney leukemia virus reverse transcriptase, and 0.75 µM antisense primer. A 15-min RT cycle at 42 C was followed by a 5-min denaturation cycle (99 C) and cooling to 4 C. PCR amplification was performed in a final volume of 100 µl containing 20 µl complementary DNA (cDNA) product, AmpliTaq polymerase (2.5 U/100 µl; Perkin-Elmer), 1.5–2.0 mM MgCl2, 1 x PCR buffer II (Perkin-Elmer), 0.2 mM deoxy-NTP, and 0.15 mM sense and antisense primers. Samples were subjected to 30 amplification cycles of denaturation (95 C, 1 min), annealing (57–60 C, 1 min), and extension (72 C, 1 min). Optimized RT-PCR conditions for each primer set are described in the figure legends. Reaction products were electrophoresed on 4% Tris acetate EDTA (TAE) agarose gels containing ethidium bromide and were visualized by UV transillumination. NPR expression in each sample was compared with the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) amplified by RT-PCR using specific primers (Clontech). Densitometric analysis of negative images of transilluminated gels was performed using NIH Image version 1.4 software.

DNA sequencing
The identity of cDNA products resulting from RT-PCR was confirmed by DNA sequencing. After RT-PCR, as described above, cDNA was dried in a DNA SpeedVac (Savant Instruments, Inc., Farmingdale, NY) and subjected to electrophoresis (80 V, 70 min) on a 2% agarose-Tris borate EDTA (TBE) gel (Mupid-2, EY Laboratories, San Mateo, CA). cDNA products of the expected sizes were cut from the gel, purified by extraction on GlasPac (Vangard International, Inc., Neptune, NJ), and sequenced using an ABI Prism dye terminator cycle sequencing kit (Perkin-Elmer) followed by automated analysis with an ABI Prism 377 DNA sequencer (Perkin-Elmer). Sequencing was performed on NPR-A, NPR-B, and CNP from FRTL-5 6H cells, and NPR-C from rat thyroid.

Statistical analysis
Comparisons between treatment groups were made by ANOVA followed by Student-Newman-Keuls multiple comparisons test to assess statistical significance. Analyses were performed with Instat software (GraphPad Software, Inc., San Diego, CA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effect of TSH on NP-induced cGMP production
To determine the effect of TSH on the expression of functional guanylate cyclase-coupled NPR-A and NPR-B receptors in FRTL-5 cells, we measured intracellular cGMP production in cells grown in 5H or 6H medium in response to increasing concentrations of either ANF or CNP (Fig. 1Go). A representative experiment with confluent cells maintained in 6H medium is shown in Fig. 1AGo. Both ANF and CNP increased cGMP production to a level of approximately 150 times the control value, with ANF stimulation producing only a slightly higher maximum than CNP. Figure 1BGo shows a parallel experiment in which cells were grown to confluence, then received 5H medium for 7 days before stimulation with either ANF or CNP. In contrast to the 6H cells, the 5H cells exhibited a greater cGMP stimulation with CNP than with ANF. The results of three such experiments with parallel cultures maintained in either 6H or 5H medium are shown in Fig. 1CGo. In 6H cells, ANF and CNP produced similar maximal elevations in intracellular cGMP (ANF, 15.65 ± 5.88 pmol/ml; CNP, 14.54 ± 5.22 pmol/ml). However, in 5H cells, CNP induced a significantly greater cGMP production than did ANF (ANF, 15.75 ± 1.18 pmol/ml; CNP, 33.99 ± 2.23 pmol/ml). Moreover, whereas maximal cGMP stimulation by ANF did not differ appreciably between 5H and 6H cells, cGMP stimulation by CNP was significantly increased in 5H compared with 6H cultures (Fig. 1CGo). The estimated EC50 of the cGMP stimulation by either ANF or CNP was unchanged between 5H and 6H cells (ANF, 12.8 ± 2.6 nM in 6H cells and 13.3 ± 2.9 nM in 5H cells; CNP, 33.4 ± 10.0 nM in 6H cells and 34.5 ± 7.9 nM in 5H cells), indicating that TSH treatment had no effect on NPR affinity.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 1. Effect of TSH on natriuretic peptide-induced cGMP generation in FRTL-5 cells. A, Single experiment comparing ANF- and CNP-induced cGMP in cells exposed to 6H medium for 7 days; B, parallel experiment comparing ANF- and CNP-induced cGMP in cells exposed to 5H medium for 7 days; C, maximal natriuretic peptide-induced cGMP accumulation (mean ± SEM determined from a total of three experiments) in 6H and 5H cells. Maximal values and EC50 were calculated by sigmoid fit to the cGMP data. The differences between treatment groups were analyzed by ANOVA followed by a Student-Newman Keuls multiple comparisons test. CNP-induced cGMP was significantly greater in 5H cells than in 6H (P < 0.05).

 
These data suggest that neither functional NPR-A nor NPR-B receptors are up-regulated in FRTL-5 cells under high TSH conditions. On the contrary, functional NPR-B receptors appear to be reduced in cells grown in high TSH (6H) medium compared with low TSH medium.

Effect of TSH on 125I-labeled ANF and125I-labeled [Tyr0]CNP binding in FRTL-5 cells
A representative experiment demonstrating [125I]ANF binding to 5H and 6H FRTL-5 cells is shown in Fig. 2Go. In this experiment, FRTL-5 cells were grown to confluence in 6H medium, then received either 5H or 6H medium for 4 days before assay. In confirmation of our earlier report, these data show that specific high affinity ANF binding in FRTL-5 cells is markedly increased in cells grown in 6H medium (1 mIU/ml bovine TSH) compared with that in a parallel culture that received 5H medium. Scatchard analysis of these data and data from two similar experiments indicated a 5.6-fold greater number of specific [125I]ANF-binding sites in 6H cells compared with 5H cells (Table 1Go). Nonspecific binding, normalized to total cellular protein, did not differ between 5H and 6H cells (data not shown). ANF binding affinity, although higher in 5H cells, was not significantly different between the two groups (Table 1Go).



View larger version (15K):
[in this window]
[in a new window]
  		Figure 2. Effect of TSH on the displacement of [125I]rat ANF-(99–126) binding from FRTL-5 cells by rat ANF-(99–126). After reaching confluence in Coon’s 6H medium, FRTL-5 cells were washed with Hanks’ Balanced Salt Solution and received either 5H (open circles) or 6H (closed circles) medium for 4 days. [125I]ANF binding was determined in the presence of increasing concentrations of rat ANF-(99–126) and was normalized to total cellular protein. The Bmax and Kd were determined using Ligand.

 

View this table:
[in this window]
[in a new window]
  		Table 1. Kinetic parameters of [125I]ANF-(99–126) and 125I-labeled [Tyro]CNP binding in FRTL-5 cells

 
To investigate the second messenger pathways underlying the increased [125I]ANF binding in TSH-treated cells, specific ANF binding was determined in FRTL-5 cells exposed to either TSH or to activators of the major TSH signaling pathways (adenylate cyclase and inositol phospholipid; Fig. 3AGo). Both forskolin and (Bu)2cAMP, which mimic TSH activation of adenylate cyclase, increased specific [125I]ANF binding to the same degree as 1 mIU TSH (~2-fold), whereas the calcium ionophore A23187, which mimics signaling via the calcium/phosphoinositol pathway, elevated ANF binding by only about 60%. PMA, which activates protein kinase C in imitation of the phospholipid/diacylglyerol pathway, in contrast, significantly inhibited specific ANF binding to about 50% of the control value. As TSH is more potent in stimulating the adenylate cyclase/cAMP pathway than the inositol phospholipid pathway in FRTL-5 cells, we also investigated the dose relatedness of the TSH effect on ANF binding (Fig. 3BGo). Specific [125I]ANF binding was significantly different from the control value at a concentration of 0.032 mIU/ml and was observed to increase with TSH in dose-dependent fashion with an EC50 of 0.18 mIU/ml. In a separate experiment (data not illustrated), we showed that the EC50 of TSH-induced cAMP formation in FRTL-5 cells is 0.6 mIU/ml.



View larger version (40K):
[in this window]
[in a new window]
  		Figure 3. Effects of compounds mimicking TSH signaling (A) and effect of TSH dose (B) on specific [125I]rat ANF-(99–126) binding in FRTL-5 cells. A, After growth to confluence in 24-well plates and a 2-day pretreatment in 5H medium, cells received the following 4-day treatments in 5H medium: control (5H medium only), TSH (1 mIU/ml), forskolin (10 µM), (Bu)2cAMP (dbcAMP; 1 mM), A23187 (2 µM), and PMA (160 nM). Specific [125I]ANF binding was determined as described in Materials and Methods. Each value represents the mean ± SEM of the combined data from two separate experiments, each with four replicates per treatment. *, P < 0.001 vs. control; #, P < 0.01 vs. control. B, Cells grown to confluence, then maintained in 5H medium for 7 days, received TSH in increasing doses (0–1 mIU/ml) for 4 days before determination of specific [125I]ANF binding. Each data point represents three replicates ± SD.

 
We have previously reported a highly unusual property of the [125I]ANF-binding sites in FRTL-5 cells in which ANF binding is increased rather than decreased in the presence of CNP. Figure 4Go compares the ability of CNP to increase [125I]ANF binding in 5H and 6H cells. As we reported earlier, coexposure with CNP (1 µM) significantly increases [125I]ANF binding in 6H cells. In contrast, in 5H cells, CNP had no significant effect on [125I]ANF binding. ANF (1 µM) inhibited ANF binding to the same degree in both 5H and 6H cells.



View larger version (25K):
[in this window]
[in a new window]
  		Figure 4. Effect of TSH on CNP modulation of [125I]rat ANF-(99–126) binding in FRTL-5 cells. [125I]ANF binding was determined in confluent cultures in either 5H or 6H medium that received rat ANF-(99–126) (1 µM), CNP-22 (1 µM), or vehicle (control). Each value represents the mean ± SEM of six determinations. *, P < 0.001 vs. control.

 
As CNP is thought to be the natural ligand of NPR-B, we also examined the binding of 125I-labeled [Tyr0]CNP to FRTL-5 cells grown under 6H and 5H conditions. Figure 5AGo shows binding data from a representative experiment in which cells received either 5H or 6H medium for 7 days before assay. Like [125I]ANF binding, total 125I-labeled [Tyr0]CNP binding normalized to cellular protein content was increased in 6H FRTL-5 cells compared with that in 5H cells. However, unlike [125I]ANF binding (Fig. 2Go), most of the increased [125I]CNP binding in 6H cells was of very low affinity. Only a small percentage of total [125I]CNP binding was displaced with increasing unlabeled peptide in either 6H or 5H cells. This displacement by low concentrations of CNP is emphasized in Fig. 5Go, B and C (binding data from Fig. 5AGo rescaled).



View larger version (21K):
[in this window]
[in a new window]
  		Figure 5. Effect of TSH on the displacement of 125I-labeled [Tyr0]CNP binding from FRTL-5 cells by increasing concentrations of CNP. After reaching confluence in 6H medium, cells received either 5H (open circles) or 6H (closed circles) medium for 7 days before assay. 125I-Labeled [Tyr0]CNP binding was determined in the presence of increasing concentrations of CNP. A, Comparison of CNP binding in 5H and 6H cells normalized to total cellular protein. B, 125I-Labeled [Tyr0]CNP binding to FRTL-5 cells grown in 6H medium. C, Binding to cells grown in 5H medium rescaled from A to emphasize high affinity binding.

 
Analysis of the binding data from 6H cells using Ligand confirmed that most of the CNP binding in the 6H cells was either nonspecific or of very low affinity (Kd = 8.5 µM). However, the analysis also revealed the presence of a low concentration of high affinity 125I-labeled [Tyr0]CNP binding sites (Kd = 0.65 nM). Ligand analysis of CNP binding in 5H cells revealed the presence of only the high affinity site. The results of three such CNP binding studies are shown in Table 1Go. Ligand analysis of CNP binding to 5H cells in all three experiments consistently showed the presence of a high affinity site in very low abundance. It is noteworthy that the concentration of the high affinity CNP-binding sites was only about 2% of the high affinity ANF-binding site concentration in identically treated 5H cells. CNP binding was of comparatively higher affinity (~7-fold) than ANF binding in similarly treated cells (Table 1Go).

Due to binding variation introduced by abundant low affinity/nonspecific CNP sites in the 6H cells, high affinity binding could only be reliably demonstrated in these cells in a single study (Table 1Go), where its concentration (1.1 fmol/mg) was not markedly different from the concentration of CNP-binding sites in 5H cells.

RT-PCR of NPR expression
The results of RT-PCR for the three NPR subtypes in whole rat thyroid and FRTL-5 cells are shown in Fig. 6Go. Rat kidney served as a control. NPR-A transcript was present in all tissues tested and showed less variation among kidney, thyroid, and FRTL-5 cells than did either NPR-B or NPR-C. Relative NPR-B expression was much higher in cultured FRTL-5 cells than in either whole kidney or whole thyroid. In addition, NPR-B was greater in FRTL-5 cells maintained in 5H medium than in cells grown in 6H. NPR-C transcript was most prominent in the kidney and, although distinctly expressed in whole rat thyroid, was virtually undetectable in FRTL-5 cells. (A faint amplimer of the expected size was detected in 5H cells, but not in 6H cells.) Sequencing of NPR-A and NPR-B amplimers from FRTL-5 and of NPR-C amplimer from rat thyroid confirmed their identity as rat NPR subtypes.



View larger version (63K):
[in this window]
[in a new window]
  		Figure 6. RT-PCR of NPR-A, NPR-B, and NPR-C in rat kidney (RK), rat thyroid (RT), and FRTL-5 cells cultured in the presence (6H) or absence (5H) of 1 mIU/ml TSH. Poly(A)+ mRNA was prepared from thyroid and FRTL-5 cells as described in Materials and Methods; rat kidney mRNA was purchased from Clontech. A total of 250 ng mRNA was used for NPR-A, NPR-B, and GAPDH reactions, and 1 µg was used for NPR-C.

 
Relative levels of NPR-A and NPR-B expression were compared by densitometry in FRTL-5 5H and 6H cells in a total of four separate experiments (Fig. 7Go). Results showed that levels of NPR-B normalized to GAPDH were significantly higher in 5H FRTL-5 cells than in 6H cells. NPR-A transcript was also higher in 5H cells than in 6H cells, but the difference did not attain significance.



View larger version (21K):
[in this window]
[in a new window]
  		Figure 7. Effect of TSH on NPR-A and NPR-B transcript levels in FRTL-5 cells. Poly(A)+ mRNA was extracted from parallel cultures of FRTL-5 cells grown to confluence in 5H or 6H medium in a total of four separate experiments. Each RT-PCR reaction for NPR-A and NPR-B used 10 ng mRNA. RT-PCR for NPR-A was performed at an annealing temperature of 55 C with 1.5 mM MgCl2 for 30 cycles; RT-PCR for NPR-B was performed at an annealing temperature of 60 C with 1.5 mM MgCl2 for 30 cycles. Densitometric measurements of each NPR reaction product were normalized to densitometric measurements of GAPDH PCR product. 5H NPR-B expression was significantly greater than 6H (P < 0.05) using Student’s t test.

 
Differences between whole thyroid and FRTL-5 cells in NPR transcript levels (Fig. 6Go) could reflect either the contribution of nonfollicular cell mRNA (e.g. endothelial cells) in the whole thyroid or a modulation of the NPR profile of the follicular cell in vitro. As one interpretation of the data presented in Fig. 6Go is that NPR-C expression in native thyroid had been lost in the process of transformation from normal thyroid follicular cells to the FRTL-5 cell line, we also performed RT-PCR for NPR-C on mRNA extracted from FRTL cells, the slow growing precursor to FRTL-5. As with FRTL-5, FRTL cells were found to express only minimally detectable levels of NPR-C (data not shown).

FRTL cells were also similar to FRTL-5 in their expression of NPR-A and NPR-B. Figure 8AGo shows that FRTL cells grown in 6H medium, like FRTL-5 grown under the same conditions, have a higher maximal response to ANF than to CNP. Figure 8BGo in contrast shows that in FRTL cells grown in 5H medium, CNP is a more effective stimulant of cGMP formation than is ANF. As with FRTL-5 cells, although ANF-stimulated cGMP per confluent well is little changed by eliminating TSH [15.8 pmol/ml (6H) vs. 18.0 pmol/ml (5H)], CNP-stimulated cGMP is increased approximately 2.5-fold [9.9 pmol/ml (6H) vs. 25.0 pmol/ml (5H)] after the elimination of TSH from the medium.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 8. Effect of TSH on natriuretic peptide-induced cGMP in FRTL cells. A, Cells grown in 6H medium; B, cells grown in 5H medium. Closed circles represent stimulation by ANF; open circles represent stimulation by CNP.

 
RT-PCR of natriuretic peptide expression
Expressions of ANF and CNP are compared in kidney, heart, thyroid, and FRTL-5 cells (6H and 5H) in Fig. 9Go. CNP transcript was lowest in heart and kidney and was highest in thyroid and FRTL-5 cells. ANF transcript, on the other hand, could be detected in FRTL-5 cells, but not in rat thyroid. CNP expression in FRTL-5 cells was markedly elevated by TSH treatment.



View larger version (36K):
[in this window]
[in a new window]
  		Figure 9. RT-PCR of CNP and ANF in rat kidney, heart, and thyroid and FRTL-5 cells (grown in 5H and 6H media). Poly(A)+ mRNA for rat kidney and thyroid were purchased from Clontech; rat thyroid and FRTL-5 mRNA was prepared as described in Materials and Methods. A total of 250 ng mRNA was used for each reaction. RT-PCR for CNP was performed at an annealing temperature of 57 C with 2.0 mM MgCl2 for 35 cycles; RT-PCR for ANF was performed at an annealing temperature of 55 C with 1.0 mM MgCl2 for 40 cycles.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In an earlier study, we observed that FRTL-5 cells grown in a high TSH medium exhibited a marked increase in specific [125I]ANF-binding sites over similar cultures maintained in the absence of TSH (22). As competitive binding studies with C-ANF-(4–23) indicated a paucity or absence of NPR-C in FRTL-5 cells (22), we speculated that the ANF-binding sites up-regulated by TSH might be NPR of the guanylate cyclase type (i.e. NPR-A).

Surprisingly, the results of the present study suggest that neither NPR-A nor NPR-B is up-regulated by TSH in FRTL-5 cells. In contrast, as indicated in Fig. 1CGo, long term cultivation of FRTL-5 cells in the absence of TSH resulted in a 2-fold increase in CNP-induced cGMP without significantly affecting ANF-induced cGMP. Similar results were observed in FRTL cells. These results support the down-regulation of NPR-B, but not NPR-A, in the presence of TSH. The results of RT-PCR studies mirror these findings in showing significantly greater levels of NPR-B transcript in 5H FRTL-5 cells than in 6H cells, suggesting that the down-regulation of NPR-B in 6H cells is initiated at the level of the mRNA transcript. The reduction in NPR-B transcript levels, in turn, could be due to effects of TSH on RNA stability or to transcriptional regulation of NPR-B expression.

Data on the independent regulation of NPR-A and NPR-B are limited (11). Cell systems showing a differential regulation of these two receptor subtypes include the vascular smooth muscle cell undergoing a transition to the synthetic phenotype (28) and the renal cortex of salt-depleted animals (29). The present results with TSH in FRTL-5 cells, in addition, support an independent regulation of NPR-A and NPR-B by glycoprotein hormones such as TSH. TSH has been shown to down-regulate the expression of its own receptor in FRTL-5 cells by increasing intracellular cAMP (30). A similar regulatory pathway could suppress NPR-B transcription in the presence of elevated levels of TSH. NPR-A, on the other hand may have different upstream regulatory elements or trans-acting factors that do not respond to the cAMP signal generated by TSH binding.

The differential regulation by TSH of two receptors that share cGMP generation as a final common pathway could have functional importance in the thyroid. Recent reports have begun to define physiological roles for the cGMP pathway in thyroid cells (24, 31). Bocanera et al. (24) demonstrated that activation of the guanylate cyclase-cGMP pathway by nitric oxide in calf thyroid cells significantly inhibits iodide uptake, a limiting step in thyroid hormone biosynthesis. Moreover, Rassmussen et al. (31) suggested that the effects of the cytokine interleukin-1ß in thyroid cells (inhibition of thyroglobulin and cAMP release and stimulation of interleukin-6 release) are exerted through activation of the cGMP signaling pathway. Similarly, activation of NPR-A or NPR-B in the thyroid by ANF and CNP, respectively, might be expected to play an inhibitory role in thyroid hormone production. Unlike the nitric oxide/soluble guanylate cyclase/cGMP signaling pathway, which is apparently independent of TSH regulation (24, 31), the CNP/NPR-B guanylate cyclase/cGMP pathway, as we show in the present report, is modulated by TSH.

The detection of ANF mRNA by RT-PCR in FRTL-5 cells in the present report supports and extends an earlier study that demonstrated ANF transcript in (human) thyroid (32) and is the first to our knowledge to demonstrate CNP transcript in the thyroid and thyroid-derived cells. We have also detected CNP transcript by RT-PCR in human thyroid (unpublished data). Comparatively higher levels of this transcript in the rat thyroid than in either kidney or heart (Fig. 6Go) suggest that CNP could play a prominent autocrine or paracrine role in the thyroid gland. In an earlier report (21) we demonstrated ANF-like immunoreactivity in FRTL-5 that was secreted into the medium after stimulation by the calcium ionophore A23187. Expression of this immunoreactivity (in the form of intracellular granules) was TSH dependent; in the absence of TSH in the medium, the ANF-like immunoreactivity was virtually undetectable. Although this immunoreactivity was detected using a monoclonal antibody raised against rat ANF-(99–126), its cross-reactivity with CNP was not tested and cannot be ruled out. The results of the present study support the increased expression of natriuretic peptide transcript in FRTL-5 cells by TSH. CNP transcript in particular is markedly elevated in cells grown in a high TSH medium. The functional significance of up-regulation of CNP expression but down-regulation of its receptor by TSH is not known, but could involve optimization of paracrine CNP signaling from follicular cells to nonfollicular cells in the thyroid.

In marked contrast to the cGMP generation data, ANF binding data, in agreement with our earlier study (22), indicated the presence of ANF receptors that were increased in concentration by TSH. This TSH-dependent ANF-binding site is not consistent with the NPR-C subtype, as RT-PCR for the NPR-C subtype failed to show a cDNA product of the expected 570 bp size in FRTL-5 cells grown in 6H medium. This supports our earlier findings of the absence of NPR-C in FRTL-5 cells grown in a high TSH medium, as demonstrated using competition with C-ANF-(4–23) (23). The preference of the FRTL-5 binding sites for [125I]ANF rather than [125I]CNP in competition binding experiments suggests, moreover, that it is distinct from the NPR-B subtype, whose natural ligand has been identified as CNP (10). This is supported by a previous report in which we showed that CNP is unable to displace [125I]ANF binding in FRTL-5 cells (23).

A relatively mundane explanation of the discrepancy between the cGMP generation results and ANF binding data would be that maximal cGMP levels do not provide an accurate reflection of functional NPR-A and NPR-B protein levels due to intracellular constraints on guanylate cyclase activity and cGMP accumulation (e.g. the availability of GTP and the presence of phosphodiesterases). However, several lines of evidence suggest that maximal cGMP levels provide an accurate measure of guanylate cyclase-coupled NPR, and therefore, that most ANF-binding sites in FRTL-5 cells are not guanylate cyclase coupled. Firstly, basal levels of cGMP production were consistently higher in 6H cells than in 5H cells (data not shown), arguing against substrate limitation in 6H cultures. Secondly, in 5H cells, CNP induced cGMP levels as high as 34 pmol/ml, suggesting the availability of sufficient substrate (GTP) and sufficient isobutylmethylxanthine inhibition of phosphodiesterase to allow cGMP production to attain at least this level after stimulation by natriuretic peptide. However, in both 5H and 6H cells, ANF-induced cGMP reached only 16 pmol/ml. Therefore, the lower levels of ANF-induced cGMP cannot be ascribed to a limiting amount of substrate or to greater phosphodiesterase activity, but probably reflect an intrinsically lower concentration of functional NPR-A protein. Secondly, as the EC50 of cGMP generation induced by either ANF or CNP was not altered by TSH treatment, changes in cGMP maxima can be taken to reflect changes in NPR concentration rather than changes in receptor affinity. Taken together, these data strongly suggest that TSH is unable to alter the concentration of functional NPR-A protein, yet is able to raise the total number of [125I]ANF-binding sites by 5.7-fold.

Further evidence for a nonguanylate cyclase-coupled ANF-binding site is obtained from a direct comparison of the [125I]ANF and [125I]CNP binding data. High affinity [125I]CNP-binding sites are in very low abundance (~0.8 fmol/µg protein) in 5H cells compared with the concentration of high affinity ANF-binding sites (40 fmol/µg protein), yet CNP is able to induce a 2-fold higher level of cGMP generation than ANF. The difference in cGMP generation cannot be ascribed to a higher affinity of CNP binding to its receptor, because, in fact, the EC50 of ANF-induced cGMP (13.3 nM) is slightly lower than that of CNP (34.5 nM). Similarly, in 6H cells, there is an approximately 200-fold higher concentration of high affinity ANF-binding sites than CNP-binding sites, yet levels of cGMP generated by these two natriuretic peptides are almost identical. The best explanation of these data is that the high affinity [125I]CNP-binding sites represent functional NPR-B, but that only a small fraction of the total ANF-binding sites in FRTL-5 cells is functional NPR-A. The remaining [125I]ANF binding, of greater abundance and up-regulated by TSH, does not elicit cGMP production. Therefore, despite resembling NPR-A in ligand specificity, the majority of [125I]ANF-binding sites in FRTL-5 cells are not coupled to guanylate cyclase activity.

The results of the present study suggest that the up-regulation of the [125I]ANF-binding sites by TSH is mediated primarily via an adenylate cyclase/cAMP second messenger pathway, because a greater than 2-fold increase in specific ANF binding by TSH was mimicked by forskolin and (Bu)2cAMP, but not by A23187 or PMA, which mimic, respectively, the Ca2+/inositol triphosphate and diacylglycerol/protein kinase C branches of the inositol-phospholipid pathway (25). Moreover, the EC50 of [125I]ANF binding up-regulation by TSH was 0.18 mIU/ml, consistent with TSH stimulation of cAMP in FRTL-5 cells (EC50 = 0.60 mIU/ml), but not with activation of the inositol-phospholipid pathway, which requires a 103–104 times higher concentration of TSH (33). Although probably not involved in mediating the effects of low concentrations of TSH on ANF binding, the inositol phospholipid pathway is shown here to have a potential role in regulating this binding site. The PMA-mediated decrease in [125I]ANF binding is consistent with earlier reports of protein kinase C-mediated down-regulation of both NPR-C and NPR-A expression (34, 35) and suggests that PKC activation can oppose the role of TSH in up-regulating ANF-binding sites in FRTL-5 cells.

Another characteristic of the TSH up-regulated [125I]ANF-binding sites that distinguishes them from previously described NPR-A was noted in a recent study in which we showed that CNP does not compete with ANF binding in FRTL-5 cells but, instead, increases the affinity of this site for ANF (23). To our knowledge, the ability of one natriuretic peptide to increase the affinity of binding of another has not been previously reported. [CNP has generally been shown to compete with ANF binding to NPR-A, albeit at a very low affinity (10).] We suggested that this could represent an allosteric modulation of the ANF-binding site by CNP. The results of the present study indicate that the ability of CNP to modulate ANF binding is abolished in the absence of TSH. The present study also shows that very low affinity CNP binding is markedly increased by TSH. This low affinity CNP binding conceivably could represent a regulatory site associated with the [125I]ANF-binding site, both of which are up-regulated by TSH. Recent data showing that NPR-A can associate with NPR-B to form heteromeric receptors suggests one possible mode in which CNP can allosterically regulate ANF binding (36). On the other hand, CNP could influence ANF binding via non-NPR CNP-binding sites (e.g. calmodulin) (37).

One possible explanation of the up-regulation of ANF binding in the face of unchanged cGMP production is that these sites represent NPR-A in which binding of ANF is uncoupled from activation of guanylate cyclase by posttranscriptional modification of the receptor protein. Possible mechanisms for this deactivation could include phosphorylation (38), or dephosphorylation of the receptor (39), or monomerization of an active multimeric holoreceptor (40, 41). However, posttranscriptional modulation of NPR-A does not explain the clearly independent regulation of the two ANF-binding proteins by TSH. For example, dephosphorylation of NPR-A causes only a partial desensitization (loss of guanylate cyclase activity) (39), suggesting that up-regulation of the binding site concentration by TSH should have resulted in at least a modest increase in cGMP. Of particular interest is our observation that measurements of functional NPR-A and NPR-B protein by cGMP stimulation assay in 5H and 6H cells are reflected in the relative transcript levels of these two receptor subtypes. At both the level of biologically active protein and the transcript level, NPR-A showed almost no change in response to TSH.

An alternative explanation of these observations is that the TSH-up-regulated binding site is a receptor form distinct from the NPR-A receptor subtype. Ohyama et al. (42) have identified a distinct form of rat NPR-B that possesses a 75-bp deletion in the cDNA coding for the intracellular kinase-like domain and is unable to generate cGMP upon binding CNP. This alternate form of the NPR-B receptor is widely distributed throughout rat tissues and is particularly abundant in the brain. The presence of a similarly altered form of the NPR-A receptor, with mutations or deletions in its kinase-like or guanylate cyclase domains and therefore lacking in the ability to induce cGMP formation, could be advanced to explain the results of the present study. Expression of this receptor, like many other thyroid-specific proteins, but unlike NPR-A and NPR-B, could undergo positive regulation by TSH via a TSH/cAMP/protein kinase A cascade (25).

The functional significance of a large pool of nonguanylate cyclase-coupled ANF-binding sites in rat thyroid-derived cells is unclear. As FRTL-5 cells lack the NPR-C receptor, the abundant ANF-binding sites could assume the function of ligand internalization performed by NPR-C in many other cell types. Alternatively, these ANF-binding sites could be involved in nonguanylate cyclase signal transduction as has been suggested for the NPR-C receptor (12, 43, 44). Regardless of its nature, the presence of the nonguanylate cyclase-coupled [125I]ANF-binding site in FRTL-5 cells suggests that caution should be used in equating high affinity [125I]ANF-binding sites with an active NPR-A guanylate cyclase in cultured cell lines. As we have demonstrated here, a marked hormonal up-regulation of these binding sites may have little or no effect on intracellular signaling through cGMP.

In summary, the present results point to the existence of a complex natriuretic peptide system in the FRTL-5 thyroid follicular cell, consisting of endogenous natriuretic peptide (ANF and CNP) and guanylate cyclase-coupled receptors (NPR-A and NPR-B) that are differentially regulated by TSH. In addition, increased [125I]ANF binding in TSH-treated cells concomitant with unchanged or decreased cGMP generation suggests the existence of a large population of nonguanylate cyclase-coupled NPR whose nature and function remain to be determined.


   Acknowledgments
 
The authors thank Ms. Joan McMillen for her expert preparation of this manuscript, and Ms. Allyson Himelfarb and Ms. Maria Bomfim for their technical assistance.

Received June 9, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Flynn T 1997 The biochemistry of atrial natriuretic peptides. In: Samson WK, Levin ER (eds) Natriuretic Peptides in Health and Disease. Humana Press, Totowa, pp 1–19
  2. Espiner E 1997 Physiology of natriuretic peptides. Cardiovascular function. In: Samson WK, Levin ER (eds) Natriuretic Peptides in Health and Disease. Humana Press, Totowa, pp 123–146
  3. Meyer M, Forssmann WG 1997 Renal actions of atrial natriuretic peptide. In: Samson WK, Levin ER (eds) Natriuretic Peptides in Health and Disease. Humana Press, Totowa, pp 147–170
  4. Ferguson A 1997 Natriuretic peptide actions in the brain. In: Samson WK, Levin ER (eds) Natriuretic Peptides in Health and Disease. Humana Press, Totowa, pp 211–221
  5. Atarashi K, Mulrow PJ, Franco-Saenz R, Snajdar R, Rapp J 1984 Inhibition of aldosterone production by an atrial extract. Science 224:992–994[Abstract/Free Full Text]
  6. Ganguly A 1992 Atrial natriuretic peptide-induced inhibition of aldosterone secretion: a quest for mediators. Am J Physiol 263:E181–E194
  7. Kurtz A, Bruna RD, Preilschifter J, Taugner R, Bauer C 1986 Atrial natriuretic peptide inhibits renin released from juxtaglomerular cells by a cGMP-mediated process. Proc Natl Acac Sci USA 83:4769–4773[Abstract/Free Full Text]
  8. Khurana ML, Pandey KN 1993 Receptor-mediated stimulatory effect of atrial natriuretic factor, brain natriuretic peptide, and C-type natriuretic peptide on testosterone production in purified mouse Leydig cells: activation of cholesterol side-chain cleavage enzyme. Endocrinology 133:2141–2149[Abstract/Free Full Text]
  9. Anand-Srivastava MB, Trachte GJ 1993 Atrial natriuretic factor receptors and signal transduction mechanisms. Pharmacol Rev 45:55–497
  10. Koller KJ, Lowe DG, Bennet GL, Minamino N, Kangawa K, Matsuo H, Goeddel, DV 1991 Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science 252:120–123[Abstract/Free Full Text]
  11. Lowe D 1997 The guanylyl cyclase-B receptor. In: Samson WK, Levin ER (eds) Natriuretic Peptides in Health and Disease. Humana Press, Totowa, pp 35–50
  12. Levin ER 1993 Natriuretic peptide C-receptor: more than a clearance receptor. Am J Physiol 264:E483–E489
  13. Suda M, Tanaka K, Fukushima M, Natsui K, Yasoda A, Komatsu Y, Ogawa Y, Itoh H, Nakao K 1996 C-type natriuretic peptide as an autocrine/paracrine regulator of osteoblast. Evidence for possible presence of bone natriuretic peptide system. Biochem Biophys Res Commun 223:1–6
  14. Jankowski M, Reis AM, Mukaddam-Daher S, Dam TV, Farookhi R, Gutkowska J 1997 C-type natriuretic peptide and the guanylyl cyclase receptors in the rat ovary are modulated by the estrous cycle. Biol Reprod 56:59–66[Abstract]
  15. Suga S-I, Itoh H, Komatsu Y, Ishida H, Igaki T, Yamashita J, Doi K, Chun T-H, Yoshimasa T, Tanaka I, Nakao K 1998 Regulation of endothelial production of C-type natriuretic peptide by interaction between endothelial cells and macrophages. Endocrinology 139:1920–1926[Abstract/Free Full Text]
  16. Sellitti DS, Hughes CE 1990 Immunoreactive atrial natriuretic peptide in the thyroid gland. Regul Pept 27:285–298[CrossRef][Medline]
  17. Hughes CE, Sellitti SF 1991 Thyroidal ANF: a possible mediator of autocrine regulation in the porcine thyroid gland. Peptides 12:705–714[CrossRef][Medline]
  18. Sellitti DF, Tseng Y-CL, Wartofsky L 1989 Receptors for atrial natriuretic peptide (ANP) and regulation of thyroglobulin secretion by ANP in human thyroid cells. Life Sci 45:793–801[CrossRef][Medline]
  19. Tseng Y-CL, Lahiri S, Sellitti DF, Burman KD, D’Avis JC, Wartofsky L 1990 Characterization by affinity cross-linking of a receptor for atrial natriuretic peptide in cultured human thyroid cells associated with reductions in both adenosine 3',5'-monophosphate production and thyroglobulin secretion. J Clin Endocrinol Metab 70:528–533[Abstract/Free Full Text]
  20. Kohn LD, Shimura H, Shimura Y, Hidaka A, Giuliani C, Napolitano G, Ohmori M, Laglia G, Saji M 1995 The thyrotropin receptor. Vitam Horm 50:287–384[Medline]
  21. Sellitti DF, Hughes CE, Hensen SA, Vincent MM 1992 Secretion of immunoreactive ANF from FRTL-5 rat thyroid cells: regulation by calcium ionophore A23187. Regul Pept 41:257–273[CrossRef][Medline]
  22. Doi SQ, Sellitti DF 1994 Atrial natriuretic factor (ANF) binds to thyrotropin-regulated receptors in FRTL-5 cells and increases thyroglobulin mRNA. Peptides 15:475–481[CrossRef][Medline]
  23. Sellitti DF, Doi SQ 1994 C-Type natriuretic peptide (CNP) increases [125I]ANF binding to FRTL-5 thyroid cells by increasing ANF receptor affinity. Peptides 15:1249–1253[CrossRef][Medline]
  24. Bocanera LV, Krawiec L, Silberschmidt D, Pignataro O, Juvenal GJ, Pregliasco LB, Pisarev MA 1997 Role of cyclic 3'5'guanosine monophosphate and nitric oxide in the regulation of iodide uptake in calf thyroid cells. J Endocrinol 155:451–457[Abstract/Free Full Text]
  25. Rapoport B, Spaulding SW 1996 Mechanism of action of thyrotropin and other thyroid growth factors. In: Braverman LE, Utiger RD (eds) Werner and Ingbar’s The Thyroid, ed 7. Lippencott-Raven, Philadelphia, pp 209–219
  26. Ambesi-Impiombato FS, Picone R, Tramontano D 1982 Influence of hormones and serum on growth and differentiation of the thyroid cell strain FRTL. In: Sato GH, Pardee A, Sirbasku DA (eds) Growth of Cells in Hormonally Defined Media. Cold Spring Harbor Symposium on Cell Proliferation, Cold Spring Harbor Laboratory, Cold Spring Harbor, pp 483–492
  27. Leitman DC, Murad F 1986 Comparison of binding and cyclic GMP accumulation by atrial natriuretic peptides in endothelial cells. Biochim Biophys Acta 885:74–79[Medline]
  28. Suga S-I, Nakao K, Kishimoto I, Hosoda K, Mukoyama M, Arai H, Shirakami G, Ogawa Y, Komatsu Y, Nakagawa O, Hama N, Imura H 1994 Phenotype-related alteration of natriuretic peptide receptors in aortic smooth muscle cells. Circ Res 71:34–39[Abstract/Free Full Text]
  29. Fraenkel MB, Aldred GP, McDougall JG 1994 Sodium status affects GC-B natriuretic peptide receptor mRNA levels, but not GC-A or C receptor mRNA levels in the sheep kidney. Clin Sci 86:517–522[Medline]
  30. Saji M, Ikuyama S, Akamizu T, Kohn LD 1991 Increases in cytosolic Ca++ down regulate thyrotropin receptor gene expression by a mechanism different from the cAMP signal. Biochem Biophys Res Commun 176:94–101[CrossRef][Medline]
  31. Rasmussen AK, Diamant M, Blichert-Toft M, Bendtzen K, Feldt-Rasmussen U 1997 The effects of interleukin-1B (IL-1B) on human thyrocyte functions are counteracted by the IL-1 receptor antagonist. Endocrinology 138:2043–2048[Abstract/Free Full Text]
  32. Gerbes AL, Dagnino L, Nguyen T, Nemer M 1994 Transcription of brain natriuretic peptide and atrial natriuretic peptide genes in human tissues. Clin Endocrinol Metab 78:1307–1311
  33. Sho K, Okajima F, Majid MA, Kondo Y 1991 Reciprocal modulation of thyrotropin actions by P1-purinergic agonists in FRTL-5 thyroid cells. Inhibition of cAMP pathway and stimulation of phospholipase C-Ca2+ pathway. J Biol Chem 266:12180–12184[Abstract/Free Full Text]
  34. Potter LR, Garbers DL 1994 Protein kinase C-dependent desensitization of the atrial natriuretic peptide receptor is mediated by dephosphorylation. J Biol Chem 269:1436–1442
  35. Paulding WR, Sumners C 1996 Protein kinase C modulates natriuretic peptide receptors in astroglial cultures from rat brain. Am J Physiol 270:C740–C747
  36. Chinkers M, Wilson E 1992 Ligand-independent oligomerization of natriuretic peptide receptors. Identification of heteromeric receptors and a dominant negative mutant. J Biol Chem 267:18589–18597[Abstract/Free Full Text]
  37. Hosang K, Scheit KH 1994 cDNA cloning identified a calmodulin-binding protein in bovine seminal plasma as bovine C-type natriuretic peptide. DNA Cell Biol 13:409–417[Medline]
  38. Koller KJ, Lipari MT, Goeddel DV 1993 Proper glycosylation and phosphorylation of the type A natriuretic peptide receptor are required for hormone-stimulated guanylyl cyclase activity. J Biol Chem 268:5997–6003[Abstract/Free Full Text]
  39. Potter R, Garbers DL 1992 Dephosphorylation of the guanyl cyclase-A receptor causes desensitization. J Biol Chem 267:14531–14534[Abstract/Free Full Text]
  40. Garbers DL 1993 Guanylyl cyclase receptors and their ligands. Adv Second Messenger Phosphoprotein Res 28:91–95[Medline]
  41. Jewett JRS, Koller KJ, Goeddel DV, Lowe DG 1993 Hormonal induction of low affinity receptor guanylyl cyclase. EMBO J 12:769–777[Medline]
  42. Ohyama Y, Miyamoto K, Saito Y, Minamino N, Kangawa K, Matsuo H 1992 Cloning and characterization of two forms of C-type natriuretic peptide receptor in rat brain. Biochem Biophys Res Commun 183:743–749[CrossRef][Medline]
  43. Anand-Srivastava MB, Sairam MR, Cantin M 1990 Ring-deleted analogs of atrial natriuretic factor inhibit adenylate cyclase/cAMP system. J Biol Chem 265:8566–8572[Abstract/Free Full Text]
  44. Anand-Srivastava MB, Sehl PD, Lowe DG 1996 Cytoplasmic domain of natriuretic peptide receptor-C inhibits adenylyl cyclase. Involvement of a pertussis toxin-sensitive G protein. J Biol Chem 271:19324–19329[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
H. Chusho, Y. Ogawa, N. Tamura, M. Suda, A. Yasoda, T. Miyazawa, I. Kishimoto, Y. Komatsu, H. Itoh, K. Tanaka, et al.
Genetic Models Reveal That Brain Natriuretic Peptide Can Signal through Different Tissue-Specific Receptor-Mediated Pathways
Endocrinology, October 1, 2000; 141(10): 3807 - 3813.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sellitti, D. F.
Right arrow Articles by Doi, S. Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sellitti, D. F.
Right arrow Articles by Doi, S. Q.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals