| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Children’s Hospital (I.K., M.H.), University of Helsinki, 00290 Helsinki, Finland; the Departments of Pediatrics (M.B., S.B.P.-T., D.B.W., M.H.) and Molecular Biology and Pharmacology (D.B.W.), Washington University, St. Louis, Missouri 63110; the Departments of Physiology (N.R., J.T., I.T.H.) and Pediatrics (J.T.), University of Turku, 20520 Turku, Finland; and the Department of Obstetrics and Gynecology, University of Oulu (J.S.T.), 90220 Oulu, Finland
Address all correspondence and requests for reprints to: Dr. Markku Heikinheimo, M.D., Ph.D., Children’s Hospital, University of Helsinki, Stenbäckinkatu 11, 00290 Helsinki, Finland. E-mail: markku.heikinheimo{at}helsinki.fi
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionNote Added in ProofReferences |
|---|
promoter/reporter gene construct in Leydig and granulosa
tumor cell lines revealed that the inhibin promoter harboring
essential GATA-binding sites can be trans-activated by
GATA-4. In light of these results, we propose that transcription
factors GATA-4 and GATA-6 play differing roles in the maturation and
function of testicular somatic cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofReferences |
|---|
The GATA-binding proteins are a family of zinc finger transcription factors that regulate gene expression, differentiation, and cell proliferation by binding to the consensus DNA sequence (A/T)GATA(A/G) (4). Three members of the GATA-binding protein family, GATA-1 (5), GATA-4 (6, 7), and GATA-6 (8, 9), have been shown to be expressed in the murine gonad and are thus of interest as potential regulators of testicular development and function. The erythroid transcription factor GATA-1 is expressed in testicular Sertoli cells in a stage-specific manner (5). The specific testicular cell types expressing GATA-4 and GATA-6 have not been elucidated. Recently, we demonstrated that GATA-4 and GATA-6 transcripts are present in granulosa and thecal cells of the postnatal mouse ovary (7), and others have shown the expression of these factors in chicken ovary (10). The exact role of these factors in the ovary remains unknown. Of interest, GATA-4 is expressed in primary and early antral follicles, whereas GATA-6 is present in late antral follicles and corpora lutea, suggesting different roles for these two related transcription factors in ovarian function and development.
In this study we have analyzed the expression and regulation of GATA-4 and GATA-6 in the developing testis to gain insight into their roles in this organ. Along with mouse testicular tissue, we have employed established murine testicular cell lines to study the cell-specific expression and regulation of GATA-4 and GATA-6 in vitro. In addition, we have manipulated hypophyseal and gonadal function in vivo to assess the effects of gonadotropins and androgens on the expression of the GATA factors in Leydig and Sertoli cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofReferences |
|---|
Gonadal cell cultures and hormonal stimulation of the
cell lines
An immortalized Leydig cell tumor line, BLT-1, established from
Leydig cell tumor, derived from a transgenic mouse line bearing the
mouse inhibin -subunit promoter/simian virus 40 T antigen fusion
gene (14) was used to study the regulation of GATA-4 and GATA-6 in
Leydig cells in vitro. Another Leydig tumor cell line,
mLTC-1 (15), was employed in parallel experiments. Both of these cell
lines exhibit properties of normal Leydig cells such as synthesis of
steroidogenetic enzymes and inhibins and are thus good models to study
the regulation of transcripts expressed in these cells. The details of
these experiments are given in the appropriate figure legends. Gonadal
cells were cultured on plastic dishes in DMEM with GlutaMAX-Ham’s F-12
(1:1; Life Technologies, Paisley, Scotland) buffered with
HEPES (20 mmol/liter) and supplemented with 10% heat-inactivated FBS
(Life Technologies), glucose (4.5 g/liter), and gentamicin
(100 mg/liter). Cells were used in immunohistochemistry after 2–3 days
in culture.
In situ hybridization
Mouse embryos or dissected tissue were washed briefly in
PBS and then frozen in O.C.T. cryopreservation solution (Tissue Tek,
Miles, Inc., Elkhart, IN). Frozen sections (10 µm) were fixed in 4%
paraformaldehyde in PBS and subjected to in situ
hybridization as previously described (16). Tissue sections were
incubated with 1 x 106 cpm 33P-labeled
(1000–3000 Ci/mmol; Amersham, Arlington Heights, IL)
antisense or sense riboprobe in a total volume of 80 µl. The
riboprobes for GATA-4 and GATA-6 were prepared as described previously
(7, 8, 17). Similarities and differences between the expression
patterns of GATA-4 and GATA-6 were studied by performing in
situ hybridization for these two transcripts on adjacent tissue
sections whenever possible. As shown previously, GATA-4 and GATA-6
probes have only minimal cross-reactivity (7). All of the in
situ hybridizations included three animals in each group and were
repeated at least three times. The results were further confirmed by
performing control in situ hybridization experiments with
GATA-4 and GATA-6 sense riboprobes. For comparisons and to elucidate
the fetal expression patterns of GATA-4 and GATA-6, in situ
hybridization was also performed for the homeobox gene Pem
(18) and
H+,K+-adenosine
triphosphatase
(H+,K+-ATPase)
(19) in section at 13.5 and 19 days postcoitum. To prepare
Pem probes, a pSK clone 20.2.8 (from C. MacLeod, University
of California-San Diego) was cut with BstXI, the resultant
vector backbone was religated and linearized with KpnI, and
then 430-nucleotide antisense riboprobes were generated with T3
polymerase. To generate antisense riboprobes for the ß-subunit of
H+,K+-ATPase,
a pSK plasmid containing the complementary DNA was linearized with
HindIII and transcribed in vitro with T3
polymerase, yielding a 1300-nucleotide probe.
Northern hybridization
Total RNA was isolated using guanidinium
thiosyanate-phenol-chloroform extraction (20) and analyzed for
expression of GATA-4 or GATA-6 message using Northern hybridization.
Twenty micrograms of denatured total RNA were subjected to
electrophoresis on a 1.2% denaturing agarose gel and then transferred
onto nylon membranes (Hybond N, Amersham). The membranes
were hybridized with 32P-labeled (800 Ci/mmol; Amersham)
RNA probes for GATA-4 (6) or GATA-6 (8). Hybridization and washing of
the membranes were performed as previously described (6). Hybridization
signals were detected by autoradiography using Kodak X-Omat AR
diagnostic film XAR5 (Eastman Kodak Co., Rochester, NY) or
by phosphoimager (Bas-500, Fuji Photo Film Co., Ltd.,
Tokyo, Japan). The intensities of the specific bands were
quantified using Tina software (Raytest, Straubenhardt, Germany) and
normalized to 28S and 18S ribosomal RNAs in the gel stained with
ethidium bromide.
Ribonuclease (RNase) protection assays
RNase protection assays were performed with a commercially
available kit (Ambion, Inc., Austin, TX) using 10 µg
total testicular RNA. 32P-Labeled (800 Ci/mmol;
Amersham) antisense riboprobe recognizing transcripts
arising from exons II and III of the Gata4 gene was prepared
by in vitro transcription of NotI-linearized G14A
plasmid (6) using T7 RNA polymerase and [-32P]CTP (650
Ci/mmol; ICN Pharmaceuticals, Inc., Costa Mesa, CA).
Antisense GATA-6 riboprobe was prepared from pCR II mGATA-6 plasmid (8)
by linearizing with PstI and using SP6 RNA polymerase.
Antisense ß-actin probe was prepared according to the manufacturer’s
recommendations (Ambion, Inc.). The sizes of full-length
and protected RNA probes were as follows: GATA-4, 491 and 430
nucleotides; GATA-6, 219 and 140 nucletotides; and ß-actin, 300 and
250 nucleotides, respectively.
Immunohistochemistry
Frozen tissue or paraffin-embedded 4% paraformaldehyde-fixed
sections from testes were harvested at different postnatal ages and
after specific treatments (indicated in the next paragraph). Cultured
Sertoli and Leydig cells were fixed in 4% paraformaldehyde. The tissue
sections and cells were then subjected to immunohistochemistry using
either affinity-purified polyclonal rabbit antimouse GATA-4 (6, 7) or
commercial polyclonal goat antimouse GATA-4 IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), monoclonal rat antimouse
GATA-1 IgG (Santa Cruz Biotechnology, Inc.), or nonimmune
IgG as the primary antibody. The avidin-biotin immunoperoxidase system
was used to visualize bound antibody (Vectastain Elite ABC
Kit, Vector Laboratories, Inc., Burlingame, CA).
3-Amino-9-ethylcarbazole (Sigma Chemical Co.) was used as
the chromogen, and the development reaction occurred in the presence of
0.03% H2O2.
In vivo manipulations of gonadal function
The hpg mice were genotyped, and testes from -/-
mice and control +/- mice were harvested for immunohistochemistry and
in situ hybridization. To inhibit the effects of FSH and LH
in juvenile rat testis, we used the GnRH receptor antagonist azaline B
(provided by J. Rivier, The Salk Institute, La Jolla, CA) (21), which
selectively blocks the secretion of gonadotropins from pituitary. The
up-regulation of apoptosis in the testes was taken as evidence of the
antigonadotropic effect of azaline B treatment. The testicular tissue
was harvested 1 day after treating 3-week-old male Sprague-Dawley rats
for 3 days with 5-µg daily doses of azaline B. The expression of
GATA-4 and GATA-6 was assessed by in situ hybridization, and
that of GATA-4 was determined by immunohistochemistry as well. To
assess the effect of androgens on the expression of GATA-4 and GATA-6,
Leydig cells were specifically destroyed by ethane-1,2-dimethane
sulfonate (EDS) in 3-month-old male Sprague-Dawley rats, and the testes
were harvested 15 days after the treatment and subjected to
immunohistochemistry for GATA-4 and in situ hybridization
for GATA-4 and GATA-6. After the administration of a single dose of
EDS, all Leydig cells are killed within 3 days (22) with no direct
action on spermatogenetic cells (23).
Transfections and GH assay
We next wanted to test whether GATA-4 would participate in the
regulation of gonadally expressed gene inhibin , which contains a
conserved GATA-binding site in its promoter. To test this hypothesis,
an inhibin promoter gene construct was designed for in
vitro trans-activation studies. The 211-base fragment
of inhibin (nucleotides -166 to +45) was cloned into the
BamHI and HindIII sites of the reporter plasmid
pTKGH (Nichols Institute Diagnostics, San Juan Capistrano,
CA). Clones were sequenced to verify the insert orientation before use
in transfection assays. The first, second, or first and second GATA
sites in the inhibin promoter (located between nucleotides -153 to
-110 as indicated:
GGAGATAAGGCTCAGGGCCACAGACATCTGCGTCAGAGATAGGAG)
were mutated by replacing the G with a C by site-directed mutagenesis
using the Gene Editor Site Directed Mutagenesis System (Promega Corp., Madison, WI). All putative clones were sequenced to
confirm the mutations before transfection assays. The Leydig tumor cell
line mLTC-1 (15) and the granulosa cell line KK-1 (14) were transfected
using DOTAP Liposomal Transfection Reagent (Boehringer Mannheim,
Indianapolis, IN) with a slight variation in the manufacturer’s
instructions. Cells were split at density of 1 x 105
the day before transfection. For each well, 0.5 µg of the appropriate
pTKGH reporter plasmid was mixed with 4 µg of the expression vector
pMT2-GATA-4 (6) or 4 µg of the control vector pMT2. The DNA was then
diluted with 20 mM HEPES buffer and added to the DOTAP, and
the transfections were carried out according to the manufacturer’s
instructions. After 6 h, the DOTAP-containing media was replaced
with fresh medium, and the cells were incubated an additional 66
h. Aliquots (100 µl) were removed for use in the human GH RIA
(Nichols Institute Diagnostics). All transfections were
carried out in triplicate and repeated at least three times to ensure
reproducibility.
Statistics
Statistical analyses were performed on the basis
of three independent experiments (for further details, see the
appropriate figure legends). The data were analyzed by one-way ANOVA,
using a Macintosh version of the SuperANOVA program (Abacus Concepts,
Inc., Berkeley, CA), followed by Duncan’s new multiple range and
Fisher’s protected least significant differences post-hoc
tests. P < 0.05 was considered statistically
significant. The results shown in the figures represent the mean
± SEM.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofReferences |
|---|
, A and D), but
little or no GATA-6 message was detected at this stage of testicular
development (Fig. 1, C and F). GATA-4 message was uniformly distributed
throughout the 13.5-day pc testes, suggesting expression in both
seminiferous tubules and interstitial cells. To emphasize the
interstitial component of the GATA-4 expression pattern, we performed
in situ hybridization for Pem, an orphan homeobox
gene known to be expressed in Sertoli and germ cells, but not in
interstitial cells (18). In contrast to the uniform distribution of
GATA-4 message in the testes, Pem transcripts were
restricted to the seminiferous tubules (Fig. 1, B and E).
|
). By this stage, GATA-6 message was
also evident in the seminiferous tubules (Fig. 2C). As a negative
control, we performed in situ hybridization for
H+,K+-ATPase (19) on adjacent tissue sections.
Whereas Gata4 (Fig. 2B), Gata6 (Fig. 2D), and
H+,K+-ATPase
(Fig. 2F) were each expressed in cells of the gastric mucosa of 19-day
pc embryos, only Gata4 (Fig. 2A) and Gata6 (Fig. 2C), but not
H+,K+-ATPase
(Fig. 2E) were expressed in the testes. Using in situ
hybridization, we could not determine the specific cell types
expressing GATA-4 and GATA-6 within the fetal seminiferous tubule,
because limitations in resolution did not allow precise distinction
between Sertoli cells and germ cells at this stage of development.
However, the resolution of these studies was sufficient to conclude
that intertubular cells, presumably Leydig cells, express GATA-4
throughout the later stages of fetal development.
|
, A and D). Expression of GATA-4 and
GATA-6 mRNA persisted in Sertoli cells through the subsequent stages of
testicular development (Fig. 3, B and E). Expression of GATA-4 was also
noted in Leydig cells of neonatal and adult animals (Fig. 3, A and B),
whereas Leydig cells were devoid of GATA-6 transcripts (Fig. 3, D and
E). These in situ hybridization results were in agreement
with those obtained with immunohistochemistry for GATA-4 on testicular
sections (see below). Transcripts for GATA-4 or GATA-6 were not
detected in germ cells at any postnatal stage of development. We also
analyzed the different stages of the seminiferous epithelial cycle for
possible variations in GATA-4 and GATA-6 expression by quantifying the
autoradiographic grain densities, but no stage specificity was detected
in the expression patterns (data not shown).
|
). This finding is
consistent with the cellular localization of GATA-4 and GATA-6
transcripts in Sertoli and Leydig cells and their absence in germ
cells, given that the germ cells greatly outnumber the somatic cells as
spermatogenesis advances toward adult stages.
|
). GATA-4 immunostaining was
particularly intense in the Sertoli cells of neonatal testes (Fig. 5A)
and appeared somewhat weaker in the juvenile and adult testes (Fig. 5, B and C). In contrast, there were no obvious differences in the
staining intensity of the Leydig cells at these different developmental
stages. No nuclear staining was detected when nonimmune serum was used
as the primary antibody (Fig. 5D).
|
, A and B). Control stainings with
nonimmune IgG showed only nonspecific cytoplasmic staining of Leydig
(Fig. 6C) and Sertoli cells, and anti-GATA-1 antibody showed nuclear
staining in Sertoli, but not Leydig, cells (results not shown), as
previously described (5). We were unable to directly assess whether the
GATA-6 protein was present in these cells, because no GATA-6 antibodies
were available.
|
) and BLT-1 (identical results were
obtained with the two cell lines). In contrast, GATA-6 message could
not be detected in these cells by Northern hybridization. In the
experiments aimed at understanding the hormonal regulation of GATA-4 in
Leydig cell lines, we used Northern hybridization to show that hCG
stimulation (100 µg/liter) results in a modest, but statistically
significant, up-regulation of GATA-4 mRNA expression (Fig. 7, A and B),
whereas progesterone significantly down-regulates GATA-4
mRNA levels (Fig. 7B). In addition, progesterone inhibited
LH receptor (LHR) expression in mLTC-1 cells (24). After blocking
steroidogenesis with the inhibitor aminoglutethimide (20 µg/liter),
we observed no significant alteration in GATA-4 mRNA levels, nor did
any of the hormonal treatments described above result in the appearance
of GATA-6 mRNA in the Leydig tumor cell lines. Given the modest nature
of the changes in the steady state levels of GATA-4 mRNA seen with
stimulations (50% increase), the biological significance of this
effect remains uncertain.
|
, A and B). The Sertoli cells in the
seminiferous tubules of hpg mice also stained for GATA-4
protein (data not shown). After abolishing mature Leydig cells in
juvenile rats by EDS treatment, the expression pattern of GATA-4 in
Sertoli cells 15 days after treatment (reflecting the lack of
testosterone action) did not differ from that in intact animals (Fig. 8, C and D). In situ hybridization confirmed the findings
obtained by immunohistochemistry for GATA-4; there was no detectable
change in GATA-6 expression by in situ hybridization after
azaline B or EDS treatment (data not shown).
|
promoter in vitro, a hormonally regulated gene in gonadal
somatic cells, were used for in vitro
trans-activation experiments. The 5'-region of the rodent
inhibin gene has been shown to contain promoter activity (25). Of
interest, this region contains a pair of consensus GATA-binding sites
between nucleotides -153 and -110 (25). To explore whether GATA-4
might regulate expression of the inhibin gene, the two gonadal cell
lines were cotransfected with an expression vector encoding GATA-4 and
inhibin promoter/hGH reporter construct. GATA-4 induced a
statistically significant increase in transcription from the inhibin
promoter in both cell lines (Fig. 9, A and B). Mutations of one or both of the GATA-binding sites of this
promoter fully abolished this trans-activation, clearly
demonstrating the significance of the binding of GATA-4 protein to one
or two of the consensus GATA-binding sites.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofReferences |
|---|
The early, intense expression of GATA-4 in Sertoli cells coincides with the proliferative phase of these cells during the first 2 postnatal weeks (26), and this transcription factor might well participate in the molecular events leading to the proliferative response. Our earlier observations in the developing mouse ovary support an association between GATA-4 expression and proliferation of specific cell types. Accordingly, GATA-4 is abundantly expressed in granulosa cells of primary and early antral follicles, i.e. during the period of active proliferation of these cells (7). When granulosa cell proliferation ceases at ovulation, atresia, or luteinization, the GATA-4 message is abruptly down-regulated.
Consistent with the embryonic and early postnatal expression patterns in vivo, GATA-4, but not GATA-6, mRNA was detected in Leydig cell lines. Both of these transcription factors were detected in Sertoli tumor cell lines (7) in agreement with their in vivo expression in Sertoli cells. Hormonal regulation of GATA-binding protein expression in gonadal cells was demonstrated in our previous paper (7). Specifically, we showed a modest up-regulation of GATA-4, but not GATA-6, in granulosa and Sertoli cells in response to gonadotropins. We have now extended these observations and shown that GATA-4 message was modestly up-regulated in Leydig cells by stimulation with hCG. Furthermore, GATA-4 message is also modestly down-regulated in response to treatments that decrease the amount of LHRs in these cells. However, the significance of the stimulation of GATA-4 mRNA levels by gonadotropins in somatic cell lines remains unclear, as the analysis of hypogonadal animals demonstrated that hypophyseal gonadotropin secretion is not required for the basal GATA-4 or GATA-6 expression in Leydig or Sertoli cells in vivo, nor is normal Leydig cell function, i.e. androgen secretion, a prerequisite for the expression of these transcription factors in Sertoli cells, as evidenced by the analysis of testis tissue from EDS-treated rats.
The expression of GATA-4 in adult Leydig cells is consistent with our in vitro findings demonstrating a relationship between the expression of LHR and GATA-4 messages in these cells. During maturation of steroidogenesis in vivo, the number of LHR increases as Leydig cells make a transition from juvenile to adult-type cells (reviewed in Ref. 27). Simultaneous with the appearance of functioning LHR, testicular testosterone production increases before and at puberty. Hence, gonadal GATA proteins are potential stimulating factors of steroidogenesis. Whether GATA-4 is directly involved in steroidogenesis remains to be established (e.g. in studies aimed at defining the target genes for these transcription factors in the gonad).
Many gonadal genes, such as aromatase, inhibin , and the
anti-Mullerian hormone (25, 28, 29), contain essential GATA motifs in
their promoters, as discussed by Yomogida et al. (5). Our
work suggests that GATA-4 can bind and trans-activate
inhibin promoter in gonadal cell lines. The overlapping expression
patterns of GATA-4 and inhibin further support the idea that GATA-4
may regulate transcription of inhibin . Accordingly, the inhibin
mRNA levels peak in term mouse testis and decline thereafter with
advancing age (30). In rodents, inhibin message and protein have
been demonstrated in Sertoli cells of immature and mature animals (31)
and in fetal and adult Leydig cells (32). Our results demonstrate that
FSH (7) and LH (the present work) slightly up-regulate GATA-4 in
Sertoli and Leydig cells, respectively, and work by others has revealed
that FSH and LH are the main regulators of inhibin in these
testicular cells (33, 34). Taken together, our present findings on the
temporospatial expression and hormonal regulation of GATA-4 support a
potential link between GATA-4 and the regulation of inhibin
expression in the gonad.
A recent paper describes trans-activation of inhibin
promoter by GATA-1 in MA10 Leydig tumor cell line (35). Given that
GATA-1 is not expressed in Leydig cells in vivo (5), the
significance of this GATA-binding protein in Leydig cell function
remains unclear. In the study by Feng et al. (35), GATA-4
was not able to activate the inhibin promoter in MA10 cells. On the
contrary, we found that GATA-4 was able to trans-activate
the inhibin promoter in another Leydig tumor cell line as well as
in a granulosa tumor cell line. In light of these results, GATA-4 may
be an important regulator of inhibin gene at least in the somatic
cells of gonads, where it is also intensely expressed in
vivo. Interactions between GATA-binding proteins and other factors
may explain cell-specific differences in gene regulation by various
GATA proteins. This is suggested by the recent observations that
multiple factors, such as GBF-B1, in addition to GATA-binding proteins
interact with GATA sites in the GnRH gene enhancer (36), and that a
protein, named FOG, binding to GATA-1 is an important cofactor for the
function of this transcription factor (37). The transcriptional
coactivator CREB-binding protein has also been shown to interact with
members of the GATA-binding family, including GATA-1, -2, -3, and -4
(38).
The expression patterns of GATA-4 and GATA-6 are overlapping, but
distinct, suggesting differential roles for these transcription factors
in the gonad. On the other hand, these factors may well complement each
others’ functions as they are expressed largely in similar cell types
in the testis and ovary. GATA-4 and GATA-6 in Sertoli and Leydig cells
may have central physiological roles in testicular development and gene
expression. In vitro trans-activation studies
suggest that GATA-4 plays a role in the regulation of inhibin gene
expression in the gonad. Although mice carrying a null mutation for
Gata4 have been created, the early embryonic lethality
precludes the use of these mutant animals for assessment of the role of
GATA-4 in developing gonads (39, 40). Future studies on tissue-specific
knockout animals for GATA factors might shed light on the role of this
transcription factor family in the gonad.
Besides gonads, GATA-4 and GATA-6 are expressed in extragonadal tissues, including heart and gut epithelium. Whether these GATA-binding proteins regulate a common group of target genes in these various tissues in unknown. However, this possibility exists, as certain putative target genes for GATA-4, such as brain-type natriuretic factor, are expressed in both testicular somatic cells and cardiomyocytes (41, 42).
|
Note Added in Proof |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofReferences |
|---|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received July 27, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofReferences |
|---|
-subunit
promoter directs SV40 T-antigen to Leydig cells in transgenic mice. Mol
Cell Endocrinol 119:135–146[CrossRef][Medline]
gene and its promoter. Biochem Biophys Res Commun 186:293–300[CrossRef][Medline]
-subunit gene
during mouse gematogenesis. Differentiation 44:62–68[CrossRef][Medline]
and ß-B
subunit messenger RNAs in immature and adult animals. Endocrinology 127:1097–1104[Abstract]
-subunit gene
in MA-10 Leydig tumor cells. Mol Endocrinol 12:378–390This article has been cited by other articles:
 |
|
 |
|
  S. Vuorenoja, A. Rivero-Muller, A. J Ziecik, I. Huhtaniemi, J. Toppari, and N. A Rahman Targeted therapy for adrenocortical tumors in transgenic mice through their LH receptor by Hecate-human chorionic gonadotropin {beta} conjugate Endocr. Relat. Cancer, June 1, 2008; 15(2): 635 - 648. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P J O'Shaughnessy, L Hu, and P J Baker Effect of germ cell depletion on levels of specific mRNA transcripts in mouse Sertoli cells and Leydig cells Reproduction, June 1, 2008; 135(6): 839 - 850. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bhardwaj, M. K. Rao, R. Kaur, M. R. Buttigieg, and M. F. Wilkinson GATA Factors and Androgen Receptor Collaborate To Transcriptionally Activate the Rhox5 Homeobox Gene in Sertoli Cells Mol. Cell. Biol., April 1, 2008; 28(7): 2138 - 2153. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jijiwa, K. Kawai, J. Fukihara, A. Nakamura, M. Hasegawa, C. Suzuki, T. Sato, A. Enomoto, N. Asai, Y. Murakumo, et al. GDNF-mediated signaling via RET tyrosine 1062 is essential for maintenance of spermatogonial stem cells. Genes Cells, April 1, 2008; 13(4): 365 - 374. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Mazaud Guittot, A. Tetu, E. Legault, N. Pilon, D. W. Silversides, and R. S. Viger The Proximal Gata4 Promoter Directs Reporter Gene Expression to Sertoli Cells During Mouse Gonadal Development Biol Reprod, January 1, 2007; 76(1): 85 - 95. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Looyenga and G. D. Hammer Origin and Identity of Adrenocortical Tumors in Inhibin Knockout Mice: Implications for Cellular Plasticity in the Adrenal Cortex Mol. Endocrinol., November 1, 2006; 20(11): 2848 - 2863. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Suzuki, M. Yagi, and K. Suzuki Duplicated insertion mutation in the microtubule-associated protein Spag5 (astrin/MAP126) and defective proliferation of immature Sertoli cells in rat hypogonadic (hgn/hgn) testes Reproduction, July 1, 2006; 132(1): 79 - 93. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Anttonen, H Parviainen, A Kyronlahti, M Bielinska, D B Wilson, O Ritvos, and M Heikinheimo GATA-4 is a granulosa cell factor employed in inhibin-{alpha} activation by the TGF-{beta} pathway. J. Mol. Endocrinol., June 1, 2006; 36(3): 557 - 568. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Perlman, T. Bouquin, B. van den Hazel, T.H. Jensen, H.T. Schambye, S. Knudsen, and J.S. Okkels Transcriptome analysis of FSH and FSH variant stimulation in granulosa cells from IVM patients reveals novel regulated genes Mol. Hum. Reprod., March 1, 2006; 12(3): 135 - 144. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.-S. Ge, Q. Dong, C. M. Sottas, V. Papadopoulos, B. R. Zirkin, and M. P. Hardy In search of rat stem Leydig cells: Identification, isolation, and lineage-specific development PNAS, February 21, 2006; 103(8): 2719 - 2724. [Abstract] [Full Text] [PDF]
|
|
