| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Internal Medicine and Pediatrics, Divisions of Adult and Pediatric Endocrinology, University of Iowa and the Iowa City Veterans Affairs Medical Center, Iowa City, Iowa 52246
Address all correspondence and requests for reprints to: Dr. William Sivitz, Department of Internal Medicine, The University of Iowa Hospitals and Clinics, 3E-17 VA, Iowa City, Iowa 52246. E-mail: william-sivitz{at}uiowa.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Leptin, compared with vehicle, did not alter BAT UCP-1 or UCP-3 mRNA or protein expression when administered to normal ad libitum fed rats. Fasting significantly decreased BAT UCP-1 and UCP-3 mRNA expression, to 31% and 30% of ad libitum fed controls, respectively, effects which were prevented by administration of leptin to fasted rats. Fasting also significantly decreased BAT UCP-1 protein expression, to 67% of control; however, that effect was not prevented by leptin treatment. Fasting also decreased BAT UCP-3 protein, to 85% of control, an effect that was not statistically significant. Fasting, with or without leptin administration, did not affect BAT UCP-2 mRNA; however, leptin administration to ad libitum fed rats significantly increased BAT UCP-2 mRNA, to 138% of control. Fasting significantly enhanced gastrocnemius muscle UCP-3 mRNA (411% of control) and protein expression (168% of control), whereas leptin administration to fasted rats did not alter either of these effects.
In summary, UCP subtype mRNA and protein are regulated in tissue- and subtype-specific fashion by leptin and food restriction. Under certain conditions, the effects of these perturbations on UCP mRNA and protein are discordant.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Three UCP subtypes have now been identified. UCP-1 is a 32-kDa protein encoded by a nuclear (rather than mitochondrial gene), is localized to the inner mitochondrial membrane, and is abundantly expressed in rodent brown adipose tissue (BAT) (2, 3). Consistent with physiologic energy demands, UCP-1 is expressed at higher levels during cold exposure and decreased by fasting (2, 4). UCP-1 messenger RNA (mRNA) expression is also enhanced by adrenergic stimulation, independent of cold exposure (2) and by specific activation of the ß3 adrenergic receptor (5). Leptin treatment enhances (6) or does not alter (7) BAT UCP-1 mRNA, compared with untreated ad libitum fed controls. Further, exogenous leptin prevents the decrease in UCP-1 message that occurs as a result of food restriction in the form of pair-feeding to leptin-treated rats (6, 7).
Recently, two additional UCP subtypes have been identified, UCP-2 (8, 9) and UCP-3 (10, 11, 12), each with considerable homology to the BAT UCP (now termed UCP-1). UCP-2 is expressed in a variety of tissues [including adipose tissue, muscle, heart, and liver and pancreatic islets (8, 9, 13, 14)] and is responsive to nutritional regulation (8). Levels of rat pancreatic islet UCP-2 mRNA are enhanced by recombinant adenoviral-induced leptin expression (13). UCP-3 is 73% homologous to UCP-2 in humans and is predominantly expressed in human and rodent skeletal muscle and in rodent BAT (10, 11, 12). ß3 adrenergic agonist and leptin treatment increased rodent white adipose tissue UCP-3 mRNA, and thyroid hormone increased UCP-3 message in skeletal muscle (11). Food deprivation decreased UCP-3 mRNA in brown fat (11). Interestingly, 50% food deprivation (15) or food restriction, in the form of pair-feeding to leptin-treated rats (7), decreases [but fasting increases (11, 15)] UCP-3 message in skeletal muscle.
Although the above studies are beginning to elucidate the regulation of UCP expression by leptin and nutrient deprivation, results to date have focused on the expression of leptin mRNA. It is not currently known whether these changes in UCP message levels reflect actual UCP protein expression. In the current study, we examined the regulation of UCP subtype expression in BAT and gastrocnemius muscle of leptin- or vehicle-treated normal rats, either fed ad libitum or fasted during the period of leptin administration. In addition to assessing mRNA, we also measured UCP subtype protein expression using subtype specific antibodies.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Animal experiments
These studies were performed using male Sprague Dawley rats (350–400 µg, 12–14 weeks old). All studies were
approved by our institutional Animal Care Committee. Rats were fed and
maintained according to standard NIH guidelines. Room temperature was
maintained at 25 C. Two groups of experiments were performed.
Group I experiments examined 27 normal rats subdivided into 3 subgroups
of 9 each: 1) 2-day ad libitum fed, vehicle-treated rats; 2)
2-day fasted, vehicle-treated rats; and 3) 2-day fasted, leptin-treated
rats. Fasting was initiated at 1600 h. All animals had free access
to water. Leptin (200 µg) or an equivalent volume of vehicle (PBS, pH
6.8) was initially administered by sc injection at 1600 h and then
repeated every 8 h for 6 doses. Subsequently, rats were killed in
the afternoon from 1300 h to 1500 h (final leptin or vehicle
injection at 0800 h that morning). Rats were anesthetized with
methoxyfluorane by inhalation. Blood was sampled by open-chest cardiac
puncture, collected in heparinized tubes, and spun to obtain
approximately 2 cc of plasma for analysis of plasma insulin and
glucose. The right and left BAT fat pads and gastrocnemius muscles were
dissected free, frozen in liquid nitrogen, and stored at -70 C until
used for RNA or protein extraction. Characteristics of these animals
are listed in Table 1
.
|
.
|
The sense and antisense primers, CAGGCTTCCAGTACTATTAGGT and TGCCAGTATGTGGTGGTTCACAAG (positions 142–163 and 604–627, respectively, GenBank Accession M11814) were used to generate a 486-bp UCP-1 complementary DNA (cDNA) probe by standard PCR methodology (18). The cDNA fragments were labeled with 32P, using a nick translation kit (Boehringer Mannheim, Indianapolis, IN), and unincorporated nucleotide was removed using Microcon-100 filter units (Amicon, Inc, Beverly, MA). Hybridization of cDNA was performed, as described, by the manufacturer of GeneScreen nylon membranes (NEN, Boston, MA). A 32P-labeled rat ß-actin riboprobe was synthesized from pTRI-ß-Actin-Rat (Ambion, Inc.) using a MAXIscript in vitro transcription kit (Ambion, Inc.), and the probe was hybridized as recommended by the manufacturer.
The blots were washed twice (for 20 min each) in 2x saline-sodium citrate and 0.1% SDS at room temperature and twice (for 20 min each) in 0.1x saline-sodium citrate and 0.1% SDS at 60 C followed by autoradiography at -60 C. After hybridization to the UCP-1 cDNA probe, blots were erased by two exposures of 15 min each to 0.1% SDS at 95 C for subsequent hybridization to the actin riboprobe. mRNA levels were quantified by densitometry using a Scan Jet 4c scanner (Hewlett-Packard Co., Palo Alto, CA) equipped with a transilluminator and image analysis software (SigmaGel, Jandel Scientific, San Rafael, CA). Each sample represented RNA from epididymal or BAT of a single rat.
RNA quantification by ribonuclease (RNase) protection assay
(RPA)
RNase protection was carried out using the RPA II kit
(Ambion, Inc.). Protected fragments were separated on
denaturing 5% acrylamide gels, which were dried and exposed to film in
cassettes with intensifying screens at -60 C. Bands corresponding to
protected fragments were quantified by densitometry, as described for
Northern analysis. Specific riboprobes for RPA were generated as
follows.
UCP-2 mRNA
Sense and antisense primers, CAGTTCTACACCAAGGGCTCAGAG and
TCTGTCATGAGGTTGGCTTTCAG, were synthesized corresponding to positions
313–336 and 613–635, respectively (nucleotide numbering in this text
is expressed relative to the ATG start site of translation), of the
mouse UCP2 cDNA (GenBank Accession no. U94593) and were used to amplify
a cDNA fragment of the rat gene by RT-PCR using rat epididymal fat
total RNA as template. This generated a 323-bp product, as predicted
from the known mouse UCP-2 sequence. The PCR product was directly
ligated into plasmid pCR3-Uni (Invitrogen, Carlsbad, CA).
The product was sequenced, using a Sequenase 2 kit (United States Biochemical Corp., Cleveland, OH), and was found completely
homologous to the subsequently reported rat gene (GenBank Accession no.
AF039033). As expected, based upon its sequence, linearization with the
restriction enzyme BstYI, followed by transcription from the SP6
promoter, produced a 203-nucleotide runoff transcript, which
protected a 123-nucleotide fragment of the mature rat UCP-2
mRNA.
UCP-3 mRNA
The sense PCR primer TACAGAGGGACTATGGATG, corresponding to
positions 463–481 of the rat UCP-3 sequence (GenBank Accession
U92069), and antisense primer
CTCTAGCATTTAGGTGACACTATAGAACAGCTTCTCCTTGATGATG, whose 3' terminal 19
nucleotides (corresponding to positions 591–609 of rat UCP-3) and
adjacent 20 nucleotides to the SP6 promoter were used to generate a
174-bp PCR product by RT-PCR using rat BAT RNA as template. This
product was sequenced by the DNA core of our Diabetes and Endocrine
Research Center, and the amplified region was found 100% homologous to
the reported rat UCP-3 sequence. After purification, using a
Microcon-100 filter unit, the PCR product was used directly as template
for run-off transcription, generating a 150-nucleotide fragment
predicted to protect 147 nucleotides of the mature rat UCP-3 mRNA.
Actin mRNA
pTRI-Actin-Rat, purchased in linearized form, was used to
generate 218 nucleotide run-off RNA transcripts from the SP6 promoter
predicted to protect 125 nucleotides of mature actin mRNA.
Immunoblot analysis of rat UCP subtypes
Interscapular BAT and gastrocnemius muscle from group I and II
rats, as well as epididymal fat of a vehicle-treated control rat, were
homogenized, using a polytron probe (Tekmar, Cincinnati, OH), for 5 sec
(fat) or 20 sec (muscle) in ice-cold radioimmunoprecipitation assay
lysis buffer [50 mM Tris (pH 7.4), 150
mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, and
0.1% SDS] containing 1 mM phenylmethlysulfonylflouride,
0.01 mM leupeptin, and 5 µg/ml aprotinin. Muscle tissue
was then sonicated for 7 sec. Homogenates were agitated at 4 C for 30
min, centrifuged, and spun at 3000 x g for 5 min; and
the supernatant was centrifuged again at 50,000 x g
for 30 min. Protein content of the detergent-solubilized extract
(supernatant) was determined by the Bradford method using a kit
purchased from Bio-Rad Laboratories, Inc.
(Hercules, CA). Protein was separated on 12.5% polyacrylamide reducing
gels, at 250 V for 90 min, and was electroblotted to Hybond-ECL
nitrocellulose membranes (Amersham, Arlington Heights,
IL). Blots were blocked with 5% BSA in PBS with 0.01% Tween-20
(PBS-Tween) for 10 min and incubated with affinity-purified antibody to
UCP-1 (0.5 µg/ml), UCP-2 (2 µg/ml), or UCP-3 (2 µg/ml) for 60 min
at room temperature. Blots were then washed in PBS-Tween for 10 min and
incubated with goat antirabbit horseradish peroxidase-conjugated
secondary antibody, 1:5000, for 60 min at room temperature; washed in
PBS-Tween; and developed by chemiluminescent detection using a standard
kit (ECL-kit, Amersham). UCP subtype expression was quantified by
densitometry using a Hewlett-Packard Co. Scan Jet 4c
scanner equipped with a transilluminator and image analysis software
(SigmaGel, Jandel Scientific). Based on immunoblots performed on
differing amounts of loaded protein, the densitometric measurements
were in a range wherein signal intensity was proportional to UCP
content. Results were normalized to the mean of two control samples
included on all blots. Even loading was confirmed by amido black
staining of the blots.
To ascertain the specificity of the first antibody reactions, incubations were carried out in the presence or absence of specific peptide to which these antibodies were raised (10 µg/ml) and in the presence of unrelated peptides (10 µg/ml) of similar length. To further ascertain antibody specificity, we examined the tissue distribution of UCP-1 and UCP-3 protein to determine whether this conformed with expectations based on the reported mRNA distributions (2, 10, 11, 12). We also examined immunoreactivity in mitochondrial fractions, compared with whole tissue extracts of BAT, gastrocnemius muscle, liver, and brain of a 14-week-old normal male Sprague Dawley rat. Mitochondrial fractions were prepared as described by Cannon and Lindberg (19). Tissues were placed (5% wt/vol) in ice-cold 0.25 M sucrose buffered with 5 mM N-Tris[hydroxymethyl]methyl-2-aminoethanesulfonic acid (pH 7.2) and homogenized with 6–8 strokes using a Teflon glass homogenizer. The homogenate was filtered through 2 layers of gauze and centrifuged at 8500 x g for 10 min. The pellet was resuspended in the sucrose buffer, diluted to the original volume, and centrifuged at 700 x g for 10 min. The supernatant was decanted and centrifuged at 8500 x g for 10 min, and the pellet was washed with 100 mM KCl containing 20 mM K-N-Tris[hydroxymethyl]methyl-2-aminoethanesulfonic acid (pH 7.2) and resuspended in the same buffer. This suspension (designated mitochondrial fraction) and a portion of the original filtered tissue homogenate (designated whole tissue fraction) were combined with an equal volume of radioimmunoprecipitation assay lysis buffer, mixed by 10 strokes in a Dounce homogenizer, spun at 14,000 x g, and the pellet was discarded. Protein was determined by the Bradford method, as described above, and the solubilized extracts were subjected to immunoblot analysis for UCP-1 and UCP-3, as described above. Immunoblotting was also performed using rabbit anti-MnSOD as first antibody to document enrichment of this known mitochondrial protein (20) in our mitochondrial fractions, compared with whole tissue extracts. The specificity of the rabbit anti-MnSOD antibody has been previously documented (21). Although raised against human MnSOD, the antibody is reactive with MnSOD in rat tissues, as well (22).
Plasma assays
Rat insulin was determined by RIA using a kit also purchased
from Linco, Inc. (St. Louis, MO). Interassay CV, in our hands, is 2%
at 0.5 ng/ml; and the assay range is 0.1–10 ng/ml. Plasma glucose
was measured using a YSI analyzer (Yellow Springs Instruments, Yellow
Springs, OH).
Statistical analysis
Data were analyzed by one-way ANOVA (group I experiments) using
the Newman-Keuls method for pairwise comparisons or by the 2-tailed,
unpaired t test (group II).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). As we previously observed
(23), 48-h leptin-treated and vehicle-treated fasted rats lost similar
amounts of weight and considerably more than vehicle-treated ad
libitum fed controls (Table 1). Also, as we previously reported
(23), leptin-treated, fasted rats had a lower plasma insulin and
glucose than vehicle-treated fasted rats (Table 1).
Figure 1 illustrates representative
examples of our RPAs for UCP-2 and UCP-3. As seen, per total RNA
loaded, UCP-3 is expressed at higher levels in BAT, compared with
gastrocnemius muscle (Fig. 1A). We also examined UCP-2 and UCP-3 in
total RNA isolated from epididymal fat and BAT. RNA samples were
protected by both probes within the same reaction mix. Although not
quantified in molar terms, it is clear that UCP-2 is expressed at
higher levels in epididymal fat than BAT, whereas the reverse is true
for UCP-3.
|
; and see Fig. 5).
This effect, for both UCP subtypes, was prevented by leptin
administration to the fasted animals. As opposed to UCP-1 and UCP-3,
fasting had no effect on BAT UCP-2 mRNA levels. Leptin treatment of
normal ad libitum fed rats, compared with vehicle treatment,
did not alter the expression of either BAT UCP-1 or BAT UCP-3 message
(see Fig. 6). However, leptin treatment of ad libitum fed
rats increased BAT UCP-2 mRNA expression (see Fig. 6).
|
|
|
, 4, 5, and 6). Although not rigidly quantified,
UCP-1 protein in BAT seemed extremely abundant, because serial blots
(including differing amounts of solubilized protein) showed that
adequate signal intensity, with near-complete elimination of background
noise, could be obtained by adding only 0.1 µg protein per lane. As
demonstrated, using competition by the specific peptides to which the
antibodies were raised, antibody to UCP-1 and UCP-3 identified specific
bands, which migrated as expected, based on molecular weight (Figs. 3 and 4). The specificity of these
antibodies was further confirmed by the finding that UCP-1
immunoreactivity was found in BAT but not in gastrocnemius muscle,
liver, or brain (Fig. 3); whereas UCP-3 immunoreactivity was evident in
BAT and gastrocnemius muscle but not in the other tissues examined
(Fig. 4). These tissue distributions conform to expectations based on
the known distributions of UCP-1 and UCP-3 mRNA (2, 10, 11, 12). Finally,
UCP-1 and UCP-3 immunoreactivity were both enriched in mitochondrial
fractions from these tissues, as opposed to whole tissue extracts
(Figs. 3 and 4). In contrast to UCP-1 and UCP-3, we could not detect
specific UCP-2 immunoreactivity in extracts of BAT or gastrocnemius
muscle using our UCP-2 antibody.
|
|
and 5), although the magnitude of this effect
was less than that observed for UCP-1 message. In sharp contrast to the
observed changes in BAT UCP-1 mRNA, leptin administration to fasted
rats did not prevent the decrease in UCP-1 protein. A similar trend was
observed for UCP-3 protein (Figs. 4 and 5); however, these results did
not achieve statistical significance. Consistent with the effects on
BAT mRNA, we observed no change in UCP-1 or UCP-3 protein in BAT of
leptin-treated ad libitum fed rats, compared with
vehicle-treated controls (Fig. 6).
We also measured UCP-3 mRNA and protein expression in gastrocnemius
muscle (
Figs. 7–9). UCP-3 antibody
labeled multiple bands separated by electrophoresis of protein
extracted from this tissue (Fig. 8).
Although addition of the UCP-3 peptide enhanced signals from several of
these bands and increased the background, only a doublet, migrating as
expected, could be specifically inhibited. Fasting increased the
expression of both gastrocnemius UCP-3 mRNA and protein (
Figs. 7–9). However, unlike our observations
in BAT, leptin administration to the fasted rats did not alter this
effect. Leptin administration to ad libitum fed rats
increased gastrocnemius UCP-3 mRNA expression, compared with
vehicle-treated ad libitum fed controls (Fig. 9). A similar
trend was also observed for UCP-3 protein; however, this did not
achieve statistical significance (Fig. 9). As expected, based on the
known specificity of UCP-1 for BAT (2), we could not detect UCP-1 mRNA
or protein in gastrocnemius muscle. UCP-2 mRNA, although detectable by
RPA in gastrocnemius muscle, was not quantified. Unlike BAT, where
UCP-2 mRNA signals were weak but suitable for quantification (Fig. 1),
we could not accurately measure the band density of gastrocnemius UCP-2
mRNA.
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recent reports show that food restriction, in the form of pair-feeding to leptin-treated normal rats, reduces BAT UCP-1 (6, 7) and UCP-3 (7) mRNA expression, relative to ad libitum fed, nonleptin-treated controls. Leptin treatment, in these studies, prevented the decrease in UCP-1 mRNA (7) or resulted in an increase in UCP-1 (6) and UCP-3 (7) over and above control ad libitum fed rats. Hence, our results are consistent in showing a reduction in UCP subtype expression with fasting and prevention of these effects by leptin. The exact effects of leptin in food-restricted or fasted rats, i.e. whether to prevent a decrease or induce an actual increase in UCP expression, probably differ as to the strain of animal studied or dose, duration, and means of leptin treatment, i.e. by repeated sc injection in our studies or by intracerebroventricular (7) or continuous sc infusion (6) in the other above-mentioned reports.
Cusin et al. also examined UCP-3 message in skeletal muscle (7). These investigators reported that intracerebroventricular leptin increased UCP-3 mRNA, relative to untreated pair-fed controls. However, UCP-3 mRNA was reduced in these partially food-restricted (pair-fed) rats, relative to ad libitum controls, so the effect of leptin was to maintain UCP-3 mRNA expression, in spite of food restriction. These results, on first thought, differ from our findings for gastrocnemius muscle of fasted rats, wherein fasting increased UCP-3 mRNA. However, this is consistent with previously reported studies showing that food restriction decreases (7, 15) but fasting increases (11, 15) UCP-3 message in skeletal muscle. In fact, the regulation of UCPs could be quite volatile, in the face of nutritional perturbation, as further evidenced by observations that fasting for 2 days reduced UCP-1 mRNA (whereas prolonged fasting actually increased UCP-1 message) (4). Of course, a number of factors (including strain of rat, method of leptin treatment, or specific muscle type) might be responsible for differences between studies.
Reported studies of in vivo leptin treatment and/or nutritional deprivation, on UCP subtype expression, to date have examined expression only at the mRNA level. We report here that fasting reduced BAT UCP-1 protein in total tissue extracts, albeit to a lesser extent than is the case for its mRNA. However, in contrast to the effects of leptin administration on UCP-1 mRNA, leptin administration to fasted rats had no effect at all in preventing the decrease in UCP-1 protein. We observed a similar trend, with respect to the effects of fasting and leptin on BAT UCP-3 protein; however, these effects fell short of statistical significance. Similar to its effect on gastrocnemius muscle UCP-3 mRNA, fasting substantially increased gastrocnemius UCP-3 protein content.
The discordance between the effects of leptin on BAT UCP-1 protein and mRNA suggest that posttranscriptional mechanisms are operative in regulating UCP-1 expression. Translational control of UCP-1 expression has been previously suggested in studies of aging rats. Yamashita et al. (26) observed increased UCP-1 mRNA levels in BAT of old (compared with young) rats, in spite of observations that mitochondrial thermogenic activity decreased with aging and that mitochondrial UCP content did not change. Translational control of other genes may also be important in regulating BAT thermogenesis. Lipoprotein lipase provides energy in the form of fatty acids for BAT nonshivering thermogenesis. Klingenspor et al. (27) found evidence for both pre- and posttranslational control of BAT lipoprotein lipase activity, dependent on the duration of cold exposure.
Our data suggest that BAT UCP-1 and UCP-3 are regulated, in coordinate
fashion, by fasting and leptin (Fig. 5). For both subtypes, fasting
decreased (and leptin prevented the decrease in) mRNA. Also, for both
subtypes, leptin administration to ad libitum fed rats did
not alter their mRNA or protein expression (Fig. 6). If food
restriction decreases (but leptin increases) BAT UCP-1 and UCP-3 mRNA,
then the lack of an effect of leptin administration to ad
libitum fed rats may be attributable to the offsetting effects of
leptin-induced decreased food intake and the of effect of leptin
per se. In contrast to BAT UCP-1 and UCP-3, BAT UCP-2 mRNA
may be regulated differently. BAT UCP-2 message was not altered by
fasting, with or without leptin, but increased in leptin-treated
ad libitum fed rats. However, the abundance of UCP-2 may be
lower in BAT than UCP-1 and UCP-3 because we were not able to detect
UCP-2 protein by immunoblotting and because UCP-2 mRNA signals by RPA
were not as strong as for UCP-3. In this regard, UCP-1 protein seemed
extremely abundant, based on the ease of detection in spite of marked
dilution of the tissue extract. However, we must be cautious about such
comparisons, because these methods do not quantify UCP subtypes in
molar terms.
Limitations inherent to this study, as well as the other above
mentioned in vivo studies of leptin administration, cause
difficulty in separating direct effects of leptin on UCP expression
from secondary metabolic effects. In particular, insulinemia is
decreased when leptin is administered to either fasted or ad
libitum fed rats (23, 28). However, it would seem that the
increase in BAT UCP-1 and UCP-3 mRNA in leptin-treated fasted rats,
compared with control, was not likely related to the relative decrease
in insulin (Table 1). Fasting alone, compared with ad
libitum feeding, markedly reduced UCP-1 and UCP-3 expression; so
it seems unlikely that further reduction in insulin would reverse this
decrease. Further, Geleon et al. (29) observed that insulin
increased UCP-1 expression when administered to rodents.
Another limitation to the current study is that leptin was administered
by intermittent injection, likely resulting in fluctuations in plasma
leptin according to time after last injection. Whether the results
would have been different had leptin been delivered in continuous
fashion is unknown. However, the rats in this study did receive
substantial leptin exposure, based upon the expected decrease in plasma
insulin with concurrent reduced or unchanged glycemia (23, 28) and body
weight responses (Tables 1 and 2). It should also be noted that actual
responses to administered leptin may have multiple determinants,
including efficiency and extent of transport into the central nervous
system, neuronal exposure, and possibly binding to plasma proteins.
These factors are, as yet, poorly understood and therefore difficult to
control in the experimental setting.
Although the effect of leptin in preventing the fasting-induced decrease in BAT UCP-1 and UCP-3 mRNA did not extend to UCP protein expression, the data are consistent with the general concept that leptin modulates the neuroendocrine response to fasting. In this regard, Ahima et al. (30) found that leptin substantially blunted fasting-induced alterations in the gonadal, adrenal, and thyroid axes of male mice and prevented the starvation-induced delay in ovulation in female mice. However, it is of interest that leptin also enhances some normal responses to fasting, including the above mentioned decrease in plasma insulin and a decrease in plasma IGF-1, which we have previously reported (23).
In summary, we have shown that UCP subtype mRNA and protein are regulated by leptin and food restriction. These changes are tissue- and UCP subtype-specific. Under certain conditions, the effects of leptin on UCP-1 and UCP-3 protein and mRNA may be discordant. The results of this study suggest that UCP expression may be regulated in multiple ways, involving both the level of mRNA abundance and posttranscriptional mechanisms.
|
Footnotes |
|---|
Received August 17, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  B. A. Henry, F. R. Dunshea, M. Gould, and I. J. Clarke Profiling Postprandial Thermogenesis in Muscle and Fat of Sheep and the Central Effect of Leptin Administration Endocrinology, April 1, 2008; 149(4): 2019 - 2026. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Sebastiani, C. Giordano, C. Nediani, C. Travaglini, E. Borchi, M. Zani, M. Feccia, M. Mancini, V. Petrozza, A. Cossarizza, et al. Induction of Mitochondrial Biogenesis Is a Maladaptive Mechanism in Mitochondrial Cardiomyopathies J. Am. Coll. Cardiol., October 2, 2007; 50(14): 1362 - 1369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Somoza, R. Guzman, V. Cano, B. Merino, P. Ramos, C. Diez-Fernandez, M. S. Fernandez-Alfonso, and M. Ruiz-Gayo Induction of Cardiac Uncoupling Protein-2 Expression and Adenosine 5'-Monophosphate-Activated Protein Kinase Phosphorylation during Early States of Diet-Induced Obesity in Mice Endocrinology, March 1, 2007; 148(3): 924 - 931. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Leibowitz-Amit, G. Tsarfaty, Y. Abargil, G. M. Yerushalmi, J. Horev, and I. Tsarfaty Mimp, a Mitochondrial Carrier Homologue, Inhibits Met-HGF/SF-Induced Scattering and Tumorigenicity by Altering Met-HGF/SF Signaling Pathways. Cancer Res., September 1, 2006; 66(17): 8687 - 8697. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Murray, M. Panagia, D. Hauton, G. F. Gibbons, and K. Clarke Plasma Free Fatty Acids and Peroxisome Proliferator-Activated Receptor {alpha} in the Control of Myocardial Uncoupling Protein Levels Diabetes, December 1, 2005; 54(12): 3496 - 3502. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. T. Putman, W. T. Dixon, J. A. Pearcey, I. M. MacLean, M. J. Jendral, M. Kiricsi, G. K. Murdoch, and D. Pette Chronic low-frequency stimulation upregulates uncoupling protein-3 in transforming rat fast-twitch skeletal muscle Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2004; 287(6): R1419 - R1426. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Q. Xiao, K. L. Grove, and M. S. Smith Metabolic Adaptations in Skeletal Muscle during Lactation: Complementary Deoxyribonucleic Acid Microarray and Real-Time Polymerase Chain Reaction Analysis of Gene Expression Endocrinology, November 1, 2004; 145(11): 5344 - 5354. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Q. Xiao, K. L. Grove, B. E. Grayson, and M. S. Smith Inhibition of Uncoupling Protein Expression during Lactation: Role of Leptin Endocrinology, February 1, 2004; 145(2): 830 - 838. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. J. Ellacott, C. B. Lawrence, L. E. Pritchard, and S. M. Luckman Repeated administration of the anorectic factor prolactin-releasing peptide leads to tolerance to its effects on energy homeostasis Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2003; 285(5): R1005 - R1010. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Zigman and J. K. Elmquist Minireview: From Anorexia to Obesity--The Yin and Yang of Body Weight Control Endocrinology, September 1, 2003; 144(9): 3749 - 3756. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. T Putman, M. Kiricsi, J. Pearcey, I. M MacLean, J. A Bamford, G. K Murdoch, W. T Dixon, and D. Pette AMPK activation increases uncoupling protein-3 expression and mitochondrial enzyme activities in rat muscle without fibre type transitions J. Physiol., August 15, 2003; 551(1): 169 - 178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Almind, R. N. Kulkarni, S. M. Lannon, and C. R. Kahn Identification of Interactive Loci Linked to Insulin and Leptin in Mice With Genetic Insulin Resistance Diabetes, June 1, 2003; 52(6): 1535 - 1543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Fekete, S. Sarkar, W. M. Rand, J. W. Harney, C. H. Emerson, A. C. Bianco, and R. M. Lechan Agouti-Related Protein (AGRP) Has a Central Inhibitory Action on the Hypothalamic-Pituitary-Thyroid (HPT) Axis; Comparisons between the Effect of AGRP and Neuropeptide Y on Energy Homeostasis and the HPT Axis Endocrinology, October 1, 2002; 143(10): 3846 - 3853. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Calsbeek, T. L. Thompson, J. A. Dahl, N. R. Stob, J. T. Brozinick Jr., J. O. Hill, and M. S. Hickey Metabolic and anthropometric factors related to skeletal muscle UCP3 gene expression in healthy human adults Am J Physiol Endocrinol Metab, October 1, 2002; 283(4): E631 - E637. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. M Rodriguez, M. P Portillo, C. Pico, M T. Macarulla, and A. Palou Olive oil feeding up-regulates uncoupling protein genes in rat brown adipose tissue and skeletal muscle Am. J. Clinical Nutrition, February 1, 2002; 75(2): 213 - 220. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. D. Fink, Y.-S. Hong, M. M. Mathahs, T. D. Scholz, J. S. Dillon, and W. I. Sivitz UCP2-dependent Proton Leak in Isolated Mammalian Mitochondria J. Biol. Chem., February 1, 2002; 277(6): 3918 - 3925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. U. Devaskar, R. Anthony, and W. Hay Jr. Ontogeny and insulin regulation of fetal ovine white adipose tissue leptin expression Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2002; 282(2): R431 - R438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Kotz, C. Wang, A. S. Levine, and C. J. Billington Urocortin in the hypothalamic PVN increases leptin and affects uncoupling proteins-1 and -3 in rats Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2002; 282(2): R546 - R551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Bezaire, W. Hofmann, J. K. G. Kramer, L. P. Kozak, and M.-E. Harper Effects of fasting on muscle mitochondrial energetics and fatty acid metabolism in Ucp3(-/-) and wild-type mice Am J Physiol Endocrinol Metab, November 1, 2001; 281(5): E975 - E982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Arai, K. Kim, K. Kaneko, M. Iketani, A. Otagiri, N. Yamauchi, and T. Shibasaki Nicotine infusion alters leptin and uncoupling protein 1 mRNA expression in adipose tissues of rats Am J Physiol Endocrinol Metab, June 1, 2001; 280(6): E867 - E876. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Himms-Hagen and M.-E. Harper Physiological Role of UCP3 May Be Export of Fatty Acids from Mitochondria When Fatty Acid Oxidation Predominates: An Hypothesis Experimental Biology and Medicine, February 1, 2001; 226(2): 78 - 84. [Abstract] [Full Text]
|
|
|
|
|
|
Y. Hong, B. D. Fink, J. S. Dillon, and W. I. Sivitz Effects of Adenoviral Overexpression of Uncoupling Protein-2 and -3 on Mitochondrial Respiration in Insulinoma Cells Endocrinology, January 1, 2001; 142(1): 249 - 256. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Himms-Hagen, A. Melnyk, M. C. Zingaretti, E. Ceresi, G. Barbatelli, and S. Cinti Multilocular fat cells in WAT of CL-316243-treated rats derive directly from white adipocytes Am J Physiol Cell Physiol, September 1, 2000; 279(3): C670 - C681. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Hildebrandt and P. D. Neufer Exercise attenuates the fasting-induced transcriptional activation of metabolic genes in skeletal muscle Am J Physiol Endocrinol Metab, June 1, 2000; 278(6): E1078 - E1086. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Du, D. A. Higginbotham, and B. D. White Food Intake, Energy Balance and Serum Leptin Concentrations in Rats Fed Low-Protein Diets J. Nutr., March 1, 2000; 130(3): 514 - 521. [Abstract] [Full Text]
|
|
|
|
|
|
C. Pecqueur, M.-C. Alves-Guerra, C. Gelly, C. Levi-Meyrueis, E. Couplan, S. Collins, D. Ricquier, F. Bouillaud, and B. Miroux Uncoupling Protein 2, in Vivo Distribution, Induction upon Oxidative Stress, and Evidence for Translational Regulation J. Biol. Chem., March 16, 2001; 276(12): 8705 - 8712. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Jucker, J. Ren, S. Dufour, X. Cao, S. F. Previs, K. S. Cadman, and G. I. Shulman 13C/31P NMR Assessment of Mitochondrial Energy Coupling in Skeletal Muscle of Awake Fed and Fasted Rats. RELATIONSHIP WITH UNCOUPLING PROTEIN 3 EXPRESSION J. Biol. Chem., December 8, 2000; 275(50): 39279 - 39286. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
