help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robinson, C. E.
Right arrow Articles by Gimble, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robinson, C. E.
Right arrow Articles by Gimble, J. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Endocrinology Vol. 140, No. 4 1586-1593
Copyright © 1999 by The Endocrine Society

ARTICLES

A Corepressor and Chicken Ovalbumin Upstream Promoter Transcriptional Factor Proteins Modulate Peroxisome Proliferator-Activated Receptor-{gamma}2/Retinoid X Receptor {alpha}-Activated Transcription from the Murine Lipoprotein Lipase Promoter1

Claudius E. Robinson, Xiying Wu2, Zafar Nawaz, Sergio A. Onãte3 and Jeffrey M. Gimble

Zoology Department, University of Oklahoma (C.E.R., J.M.G.), Norman, Oklahoma 73019; the Departments of Surgery (X.W., J.M.G.) and Pathology (J.M.G.), University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73190; and the Department of Cell Biology, Baylor College of Medicine (Z.N., S.A.O.), Houston, Texas 77030

Address all correspondence and requests for reprints to: Jeffrey M. Gimble, M.D., Ph.D., Department of Surgery, University of Oklahoma Health Sciences Center, P.O. Box 26901, Oklahoma City, Oklahoma 73190. E-mail: jeffrey-gimble{at}ouhsc.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Complex physiological stimuli differentially regulate the tissue-specific transcription of the lipoprotein lipase (LPL) gene. A conserved DNA recognition element (-171 to -149 bp) within the promoter functions as a transcriptional enhancer when bound by the peroxisome proliferator-activated receptor-{gamma}2 (PPAR{gamma}2)/retinoid X receptor {alpha} (RXR{alpha}) heterodimer, but serves as a transcriptional silencer in the presence of unidentified double and single stranded DNA-binding proteins. To address this apparent paradox, the current study examined the effect of two classes of candidate comodulatory proteins, COUP-TF (chicken ovalbumin upstream promoter transcriptional factor) and the corepressor SMRT (silencing mediator of retinoic acid receptor and thyroid receptor). The expression of COUP-TF was detected by Western and Northern blots in a preadipocyte 3T3-L1 cell model during periods corresponding to increased LPL transcription. Cotransfection of COUP-TF expression constructs in the renal epithelial 293T cell line significantly increased transcription from the LPL promoter in synergy with PPAR{gamma}2/RXR{alpha} heterodimers. The COUP-TFII (ARP-1) protein specifically bound the LPL PPAR recognition element in electromobility shift assays and interacted directly with the ligand-binding domain of PPAR{gamma} in pull-down experiments. In contrast, cotransfection of SMRT repressed PPAR{gamma}2/RXR{alpha}-mediated LPL transcription in the absence or presence of COUP-TFII (ARP-1). The interaction between PPAR{gamma}2 and SMRT localized to the receptor-interactive domain 2 (amino acids 1260–1495) of the SMRT protein based on cotransfection and pull-down assays. These in vitro data indicate that COUP-TF proteins and SMRT modulate PPAR{gamma}-mediated LPL transcription in the 293T cell line.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
LIPOPROTEIN lipase (LPL; EC 3.1.1.34) is the enzyme that hydrolyzes triglycerides into FFA (1). It is responsible for the clearance of chylomicrons from the circulation, and its dysregulation contributes to cardiovascular disease (1). A multitude of hormonal and cytokine cues account for the complex physiological expression of LPL in mammary epithelial cells, macrophages, hepatocytes, and adipocytes (1). Nuclear hormone receptor ligands such as thiazolidinediones [peroxisome proliferator-activated receptors (PPARs)] or hydrocortisone (glucocorticoid receptor) induce LPL transcription, whereas proinflammatory cytokines, such as tumor necrosis factor-{alpha}, are inhibitory (1). These actions are mediated through specific DNA recognition elements located within the LPL promoter. Recent studies have determined that the peroxisome proliferator-activated receptor {gamma}2 (PPAR{gamma}2)/retinoid X receptor (RXR) heterodimer binds to the murine and human LPL promoters between -171 to -149 bp relative to the transcriptional start site (2, 3); this identical sequence is conserved in the rat LPL promoter (4). In cotransfection analyses performed in the 293T cell line, PPAR{gamma}2/RXR{alpha} binding to the murine LPL promoter increased reporter gene expression by 13-fold in the absence of exogenous ligand, with a further 2.5-fold induction upon the addition of thiazolidinediones, demonstrating that the PPAR recognition element (PPRE) acts as an enhancer (3). However, independent transfection studies performed in HeLa cells had associated the identical sequence element (-169 to -151 bp) in the human LPL promoter with a silencer function (5). This repressor activity was attributed to unknown double and single stranded DNA-binding proteins (5).

Two classes of proteins could account for this paradoxical association of a single PPRE with both enhancer and silencer activities. One class is the chicken ovalbumin upstream promoter transcription factor (COUP-TF) family, which includes COUP-TFI or erbA-related protein-3 (EAR3), COUP-TFII or apolipoprotein AI regulatory protein-1 (ARP-1), and EAR2 (6, 7, 8). The COUP-TF proteins bind to nuclear receptor recognition elements separated by a single nucleotide (DR1), similar to those recognized by PPAR proteins (7, 9). The COUP-TF proteins have been associated with both repression (reviewed in Ref. 8) and activation (8, 10, 11, 12, 13) of promoters regulated by nuclear hormone receptors. The COUP-TF proteins are expressed in a number of tissues, including preadipocytes (8, 14).

A second class of candidate proteins is the recently described corepressors (15, 16). These proteins interact directly with nuclear hormone receptors in the absence of ligand to repress transcriptional activation from promoters regulated by nuclear hormone receptors (15, 16). The messenger RNAs (mRNAs) of the silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) and the nuclear corepressor (N-CoR) are expressed ubiquitously in all tissues examined as well as in the 293, HeLa, and 3T3 cell lines (17). Although the PPAR{gamma}2/RXR heterodimer has been found to bind strongly to SMRT and N-CoR in solution, their interactions on DNA have been reported as weak (SMRT) or nonexistent (N-CoR) (18). In cotransfection analyses performed in 293T cells, SMRT exhibited less than 2-fold repression of the acyl-coenzyme A oxidase PPRE in the presence of PPAR{gamma}, whereas N-CoR had no significant effect (18). This led to the conclusion that weak binding between PPAR{gamma} and corepressors on DNA resulted in an inability of the protein complex to repress transcription from the acyl-coenzyme A oxidase PPRE; however, "the ability of PPAR{gamma} to interact with corepressor in solution raised the possibility that PPAR{gamma} could repress transcription on other sites or in other cell types" (18).

This study set out to investigate the modulatory effects of COUP-TF family members and SMRT on PPAR{gamma}2/RXR{alpha}-mediated transcriptional activation of the murine LPL promoter. The data demonstrate that COUP-TF proteins potentiated PPAR{gamma}2/RXR{alpha}-mediated transcriptional activation in 293T cells. In contrast, SMRT repressed PPAR{gamma}2/RXR{alpha}-mediated transcription from the LPL promoter, independent of the presence of COUP-TFII (ARP-1).


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
All reagents were obtained from Sigma Chemical Co. (St. Louis, MO) or Fisher Scientific International, Inc. (Dallas, TX) unless noted otherwise.

Plasmids
Constructs containing varying segments of the wild-type murine LPL promoter linked to the luciferase reporter gene were prepared in the p19Luc vector (provided by D. R. Helinski, University of California-San Diego, La Jolla, CA) (19) as previously described (3). The pEF-BOS plasmid (20) was used to prepare eukaryotic expression vectors containing the following complementary DNAs (cDNAs): murine PPAR{gamma}2 (21), murine RXR{alpha} (22) (provided by R. Evans, The Salk Institute, La Jolla, CA), human COUP-TFII (ARP-1) (23), human COUP-TFI (EAR-3), and human EAR-2 (24) (all human cDNAs were provided by J. Ladias, Beth Israel Hospital, Boston, MA). The pAB{Delta}gal vector was used to prepare eukarytoic expression constructs containing cDNAs encoding the following amino acids of the human SMRT protein: full-length construct (1–1495), 29–564, 565-1289, and 565-1495. The pT7 vector was used to prepare bacterial expression constructs encoding the following amino acids of the human SMRT protein: full-length construct (1–1495), 29–564, 565-1289, 565-1495, and 1192–1495 (25). The pBluescript SKII vector was used to prepare a human COUP-TFII (ARP-1) (26) bacterial expression construct; the full-length cDNA was inserted into the EcoRI site of the polylinker under the T7 promoter. The bacterial expression vector pGEX2T containing the glutathione-S-transferase (GST)-PPAR{gamma}1 ligand-binding domain fusion protein (amino acids 174–475; provided by S. Kliewer, Glaxo/Wellcome, Research Triangle Park, NC) (21) was used to prepare a PPAR{gamma} ligand-binding domain-GST fusion protein.

Transient transfections
The human embryonic kidney cell line 293T (27) (provided by K. Oritani, Oklahoma Medical Research Foundation, Oklahoma City, OK), was maintained in DMEM supplemented with 10% FBS (HyClone Laboratories, Inc., Logan, UT), 100 U/ml penicillin, and 100 µg/ml streptomycin. A total of 8 x 104 cells in a 2-ml volume were plated in 35-mm dishes 18 h before transfection. A calcium phosphate/DNA coprecipitate was prepared by mixing 83 µl 1 mM Tris-HCl (pH 8.0) and 0.1 mM EDTA (pH 8.0) containing up to 12 µg DNA with 12.5 µl 2 M CaCl2 and 91.5 µl 2 x HEPES-buffered saline (280 mM NaCl, 10 mM KCl, 1.5 mM Na2PO4, 12 mM dextrose, and 50 mM HEPES, pH 7.05). After 25 min, the entire volume was added to the cells in fresh medium. After overnight incubation, the cell medium was replaced. Cells were harvested 48 h after transfection in a 100-µl volume of 25 mM glycylglycine, 15 mM MgSO4, 1 mM dithiothreitol (DTT), and 1% Triton X-100. Protein concentrations were determined using the bicinchonic acid method (Pierce Chemical Co., Rockford, IL). Luciferase assays were performed over a 20-sec reaction period using aliquots of 87.5 µg protein in a 125-µl volume containing 0.5 mM D-luciferin, 2.5 mM ATP, 7.5 mM MgSO4, and 100 mM KH2PO4. Assays were performed using a Monolight 2010 Luminometer (Analytical Luminescence Laboratory, San Diego, CA). All transfection analyses were performed a minimum of three times and were analyzed by one-way ANOVA and Student-Newman-Keuls multiple comparison test. Minimal criteria for significance were determined by P <= 0.05.

Adipocyte differentiation and tissue culture
The murine preadipocyte cell line 3T3-L1 was plated in 2 ml DMEM supplemented with 10% bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin at a density of 2.5 x 105 cells/35-mm plate. After 4–7 days, when the cells had reached confluence, the medium was replaced with fresh medium containing 10% FBS supplemented with 1 µM dexamethasone, 500 µM methylisobutylxanthine, and 5 µg/ml insulin. Cells were maintained in this induction medium for 3–4 days before returning to the unsupplemented medium. Individual cultures were harvested at varying time intervals (0–8 days) for RNA (in 0.5 ml 4 M guanidine isothiocyanate solution) or for immunoblots [in 100 µl 50 mM Tris (pH 7.4), 150 mM NaCl, 0.025% NaN3, 0.5% Nonidet P-40, 0.25% deoxycholate, 1 mM phenylmethylsulfonylfluoride, 0.5 mM sodium vanadate, 0.1 mM sodium molybdate, and 1 µg/ml leupeptin and aprotinin].

Electromobility shift assays
The DNA electromobility shift assays were performed using a 67-bp HindIII/SspI DNA fragment spanning bp -181 to -113 of the murine LPL promoter (3). DNA labeling was performed using T4 polynucleotide kinase and [{gamma}-32P]deoxy-ATP (ICN, Irvine, CA). Probes were labeled to a specific activity of 105-106 cpm/pmol. Reactions were conducted in a 30-µl volume containing 10 mM Tris (pH 8.0), 0.1 M KCl, 0.05% Nonidet P-40, 1 mM DTT, 6% glycerol, 0.5 ng recombinant COUP-TFII (ARP-1; provided by R. Vega and D. Kelly, Washington University, St. Louis, MO), and 2–10 x 105 cpm probe for a 20-min period at room temperature. Reactions were performed in the absence or presence of competitor DNA fragments spanning bp -181 to +187 of the LPL promoter. In addition to the wild-type sequence, the following mutations (underlined) in the PPAR{gamma} recognition element were used: DNA sequence mutation sites: wild type (-181 bp), gctttccttcctgccctttccccttcttctcgctgg; mutant A (-181 bp), gctttccttaaaaaaatttccccttcttctcgctgg (-172 to -166 bp); mutant B (-181 bp), gctttccttcctgaaaaaaacccttcttctcgctgg (-168 to -162 bp); mutant C (-181 bp), gctttccttcctgccctaaaaaaatcttctcgctgg (-164 to -158 bp); mutant D (-181 bp), gctttccttcctgccctttccaaaaaaactcgctgg (-160 to -154 bp); and mutant E (-181 bp), gctttccttcctgccctttccccttaaaaaaactgg (-156 to -150 bp). Samples were separated on a 5% acrylamide/bis-acrylamide (24:1) gel by electrophoresis at 100 V for 3 h. Gels were dried at 80 C for 90 min and exposed to Kodak XAR film (Eastman Kodak Co., Rochester, NY) for 18 h without an intensifying screen.

In vitro transcription/translation
In vitro transcription was performed using the T7 RNA polymerase and circular plasmids containing varying segments of the human SMRT cDNA in the pT7 vector or containing the full-length coding region of the human COUP-TFII (ARP-1) cDNA in the pBluescript SKII vector. In vitro translation was performed with rabbit reticulocyte lysates (Promega Corp., Madison, WI). Protein products were radiolabeled with [35S]methionine (ICN). Control reactions were performed with a luciferase cDNA provided by the manufacturer, which yielded a 62-kDa product.

In vitro pull-down assays
The pGEX2T vectors containing either no insert or the PPAR{gamma}1 cDNA encoding amino acids 174–475 were transformed into the bacterial strain BL21 (DE3) pLysS, cultured at 20–24 C to an OD592 of 0.6–0.8, induced with a final concentration of 1 mM isopropyl ß-D-thiogalactopyranoside, pelleted by centrifugation at 4 C, and stored at -70 C. Aliquots from 200 ml bacterial culture were suspended in 20 ml lysis buffer [50 mM Tris (pH 8.0), 250 mM KCl, 1 mM dithiothreitol, 1 mM phenylmethylsulfonylfluoride, and 1% Triton X-100], frozen and thawed three times, and centrifuged. Expression of the GST fusion proteins was confirmed by electrophoresis of the lysates on SDS-PAGE gels followed by either Coomassie staining or immunoblotting with polyclonal antibodies directed against either GST or the C-terminal peptide of PPAR{gamma} (28). The cleared lysate was mixed with 300 µl prewashed glutathione-Sepharose 4B beads (Pharmacia Biotech, Alameda, CA) and rocked overnight at 4 C. After four washes in 1.4 ml washing buffer [60 mM NaCl, 20 mM Tris (pH 8.0), 6 mM MgCl2, 1 mM DTT, 1 mM EDTA, 8% glycerol, and 0.05% Nonidet P-40], 200-µl aliquots of beads were mixed with 10-µl volumes of in vitro transcribed and translated proteins and incubated overnight at 4 C. The samples were washed five times in NENT buffer [500 mM NaCl, 20 mM Tris (pH 8.0), 6 mM MgCl2, 1 mM DTT, 1 mM EDTA, 8% glycerol, and 0.5% Nonidet P-40], suspended in 20 µl SDS loading buffer, heated to 95 C for 5 min, and resolved on a 12% acrylamide SDS-PAGE gel. Control lanes contained 10% of the input labeled protein used for binding. The gel was fixed, treated with EN3HANCE (New England Nuclear-DuPont, Boston, MA), dried at 60 C, and exposed to autoradiographic film for 1–7 days with an enhancer screen.

Northern and Western blots
Total RNA harvested from 3T3-L1 cells on days 0–6 was prepared as previously described (28, 29). Northern blots were performed with aliquots of 10 µg total RNA electrophoresed on 1% agarose-0.66% formaldehyde gels, transferred to ZetaProbe membranes (Bio-Rad Laboratories, Inc., Richmond, CA), and hybridized overnight at 55 C in 500 mM sodium phosphate, pH 7.4, and 7% SDS (30) with random primed radiolabeled probes for murine LPL, murine COUP-TFII, or actin (31). Blots were washed in 40 mM sodium phosphate and 1% SDS at a maximum stringency of 55 C and exposed for 1 day with an enhancer screen at -70 C. Western blots were performed with aliquots of 50 µg 3T3-L1 protein lysates electrophoresed on 10% acrylamide SDS-PAGE gels, transferred to nitrocellulose paper, blocked with 5% nonfat dry milk in PBS-0.1% Tween (PBST), and immunoblotted overnight at 4 C with a primary rabbit antibody directed against COUP-TF (32) or C/EBP{alpha} (SC061, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) in 1% nonfat dry milk-PBST. The blots were rinsed in PBST, incubated with goat antirabbit antibody coupled to horseradish peroxidase (1:10,000 dilution in PBST with 0.25% nonfat dry milk; Bio-Rad Laboratories, Inc.), and the protein immunostaining was detected by chemiluminescence (ECL kit, Amersham, Arlington Heights, IL).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effect of adipogenic agonists on expression of COUP-TFII (ARP-1) in 3T3-L1 preadipocytes
Initial studies were performed to document the expression of COUP-TFII (ARP-1) mRNA and protein in response to agents known to induce LPL transcription. Northern blot analysis demonstrated that the preadipocyte cell line 3T3-L1 rapidly increased LPL transcription after exposure to the adipogenic agonists dexamethasone, insulin, and methylisobutylxanthine (Fig. 1AGo) (33, 34). The confluent 3T3-L1 cells expressed COUP-TFII mRNA throughout the induction period; signal remained present from days 0–8 (Fig. 1AGo). Actin served as a control for relative RNA loading between lanes. Western blot analysis performed with protein extracts from similarly treated cells detected COUP-TF protein throughout the induction period (0–48 h). The protein remained at detectable levels for up to 96 h after induction. This coincided with the peak expression of the late appearing adipogenic transcription factor, C/EBP{alpha} (Fig. 1BGo) (35). These studies document the presence of a COUP-TF protein at times corresponding to induction of the LPL transcript in a preadipocyte cell model (33, 34).



View larger version (26K):
[in this window]
[in a new window]
  		Figure 1. Evidence of COUP-TF mRNA and protein expression in preadipocyte and adipocyte 3T3-L1 cells. The 3T3-L1 cells were induced with dexamethasone, insulin, and methylisobutylxanthine for periods of 0–8 days. Cells were harvested at the indicated times for total RNA, examined as 10-µg aliquots per lane on Northern blots (A), and, for protein, examined on Western immunoblots as 50-µg aliquots per lane (B). Equivalent Northern blots were hybridized with probes for LPL, COUP-TFII, and actin. Western blots were examined with polyclonal antibodies directed against COUP-TF or C/EBP{alpha}.

 
Members of the COUP-TF family activate transcription from the murine LPL promoter in synergy with PPAR{gamma}2/RXR{alpha}
In the next series of experiments, cotransfections were designed to determine the effects of COUP-TFI (EAR3), COUP-TFII (ARP-1), and EAR2 on murine LPL transcription in the absence or presence of PPAR{gamma}2/RXR{alpha} (Fig. 2Go). Transfections were performed in 293T cells with the individual nuclear hormone receptor expression constructs alone or in varied combinations. The reporter construct contained -1824 to +187 bp of the LPL promoter linked to luciferase. The COUP-TF family members alone increased expression from the LPL promoter by less than an order of magnitude; the most potent was COUP-TFII (ARP-1; 9.8-fold). This contrasted to a 15.9-fold activation by PPAR{gamma}2 and RXR{alpha} together. Overexpression of any COUP-TF member with either the PPAR{gamma}2 or RXR{alpha} expression construct alone did not increase transcription further. However, simultaneous expression of either COUP-TFII (ARP-1) or COUP-TFI (EAR3) with PPAR{gamma}2 and RXR{alpha} increased luciferase activity by 101- and 45-fold relative to the baseline. Control experiments substituting vitamin D3 expression constructs for COUP-TF did not increase PPAR{gamma}2/RXR{alpha}-mediated activation of the LPL promoter (n = 2; data not shown). The actions of COUP-TFII (ARP-1) were concentration dependent (Fig. 3Go). Transcription rose in a dose-dependent manner as the ratio of the COUP-TFII (ARP-1) expression plasmid was increased relative to the PPAR{gamma}2 and RXR{alpha} plasmids.



View larger version (26K):
[in this window]
[in a new window]
  		Figure 2. Activation of the LPL gene promoter by COUP-TF proteins in conjunction with PPAR{gamma}2 and RXR{alpha}. Cultures of 293T cells were transfected with 0.1 µg of the -1824 to +187 bp LPL promoter/luciferase reporter construct by calcium phosphate coprecipitation in the presence of 10% FBS. Cells were additionally transfected with 2 µg each of pEF-BOS expression vectors containing PPAR{gamma}2, RXR{alpha}, COUP-TFII (ARP-1), COUP-TFI (EAR3), and/or EAR2. All plates were transfected with a total of 12 µg DNA; the empty pEF-BOS vector was used to make up the difference in the total amount when necessary. Fold activation is calculated relative to the luciferase baseline activity in the absence of nuclear hormone receptor expression constructs, defined as 1. Data are normalized relative to a constant protein concentration per assay (87.5 µg) and represent the mean ± SE of three experiments.

 


View larger version (25K):
[in this window]
[in a new window]
  		Figure 3. Dose-dependent activation of the LPL promoter by COUP-TFII (ARP-1) in the presence of PPAR{gamma}2 and RXR{alpha}. Individual plates of 293T cells were cotransfected with 0.1 µg of the -1824 to +187 bp LPL promoter/luciferase reporter construct, 2 µg each of the PPAR{gamma}2 and RXR{alpha} expression constructs, and increasing concentrations (0.2–8 µg) of the COUP-TFII (ARP-1) expression construct. The relative ratio of the COUP-TFII to PPAR{gamma}2 plasmid concentrations is indicated on the x-axis. The total concentration of DNA was held constant by addition of the appropriate amount of the empty pEF-BOS vector. Fold activation is calculated relative to the luciferase baseline in the absence of nuclear hormone receptor expression constructs, defined as 1. Data are normalized relative to a constant protein concentration per assay (87.5 µg) and represent the mean ± SE of three experiments.

 
Additional investigations examined the interaction of COUP-TFII (ARP-1) with the PPRE in the presence of PPAR{gamma}2 and RXR{alpha}. Cotransfection analyses of LPL promoter deletion constructs with the combination of PPAR{gamma}2, RXR{alpha}, and COUP-TFII (ARP-1; Fig. 4AGo) indicated that deletions between bp -181 to -101 significantly reduced the fold activation. Levels decreased by a factor of more than 5, comparable to those observed with the same deletion constructs cotransfected with the PPAR{gamma}2/RXR{alpha} heterodimer alone (3). These data suggested that the PPRE (localized to bp -171 to -149) was critical for COUP-TFII (ARP-1) activation. Recombinant COUP-TFII (ARP-1) protein directly bound to the LPL promoter PPRE in electromobility shift assays, giving rise to two mobility-shifted bands, A and B (Fig. 4BGo). Competition analyses were performed with a panel of equivalent PCR-generated DNA fragments (bp -181 to +187). These included a wild-type control and five mutants (A–E) spanning the PPRE from a 5' (mutant A) to 3' (mutant E) direction. The wild-type control specifically competed for both complexes A and B. In contrast, those DNA fragments containing mutations within the 14 bp at the 5'-end of the PPRE (mutants A–C) did not bind the COUP-TFII (ARP-1) protein. Biochemical studies were performed to determine whether the PPAR{gamma} and COUP-TFII (ARP-1) protein interacted directly. In vitro pull-down assays detected binding between in vitro transcribed and translated COUP-TFII (ARP-1) protein and the ligand-binding domain of PPAR{gamma} fused to the GST protein (Fig. 4CGo). Control studies did not detect binding of the COUP-TFII (ARP-1) protein with the GST protein alone. Together, these data indicate that COUP-TFII (ARP-1) can interact with both the PPRE and the ligand-binding domain of the PPAR{gamma} protein itself.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 4. Evidence for COUP-TFII (ARP-1) interactions with the LPL PPRE and PPAR{gamma}2. A, Activation analysis of LPL promoter deletion constructs by the COUP-TFII (ARP-1) expression construct. The 293T cells were transfected with aliquots of 0.1 µg LPL promoter/luciferase reporter constructs containing -1824, -564, -181, or -101 bp of the 5'-flanking region and all extending to +187 bp. Cells were cotransfected with 6 µg of the empty pEF-BOS vector or 2 µg each of the PPAR{gamma}2, RXR{alpha}, and COUP-TFII (ARP-1) expression constructs. Fold activation is calculated relative to the luciferase baseline in the absence of nuclear hormone receptor expression constructs, defined as 1. Results are normalized to protein concentration (which were maintained at 87.5 µg per reaction) and represent the mean ± SE of three experiments. B, Effect of mutations in the PPAR{gamma}2 recognition element on COUP-TFII (ARP-1) binding. Electromobility shift assays were conducted using a 67-bp wild-type LPL promoter probe spanning bp -181 to -113. Competition experiments were performed using PCR-generated DNA fragments of equivalent size (-181 to +187 bp) containing either the wild-type sequence or individual, overlapping 7-bp mutations (A–E) spanning the region from -172 to -150 bp, as listed inMaterials and Methods. Reactions were conducted with recombinant COUP-TFII (ARP-1) protein. Electromobility-shifted complexes are labeled A and B. C, Evidence for a direct interaction between COUP-TFII (ARP-1) and the PPAR{gamma} ligand-binding domain. In vitro pull-down assays were conducted using [35S]methionine-labeled in vitro transcribed/translated COUP-TFII (ARP-1) protein and bacterially expressed protein from GST vectors without insert or containing the PPAR{gamma}1 ligand-binding domain (amino acids 175–475). Reaction products separated on a 12% SDS-PAGE gel contain 10% of the input COUP-TFII (ARP-1) protein (I), the material bound to the control GST protein (G), and the material bound to the GST-PPAR{gamma} LBD fusion protein. Protein size markers are indicated. Data are representative of two experiments.

 
SMRT represses PPAR{gamma}2/RXR{alpha} activation of transcription from the murine LPL promoter
Previous cotransfection studies by others in 293T cells had demonstrated that the corepressor SMRT bound to the PPAR{gamma}2/RXR{alpha} heterodimer in solution but had a minimal repressive effect on the acyl-coenzyme A oxidase PPRE (18). To determine the effect of SMRT on transcription from the murine LPL promoter, the identical cell line was cotransfected with increasing amounts of the SMRT expression construct in the absence (Fig. 5AGo) or the presence (Fig. 5BGo) of COUP-TFII. As the ratio of full-length SMRT expression construct was increased relative to that of the PPAR{gamma}2 and RXR{alpha} plasmids, the fold activation was reduced to the baseline levels observed in the absence of the PPAR{gamma}2/RXR{alpha} heterodimer (Fig. 5AGo). Likewise, as the ratio of full-length SMRT expression plasmid increased relative to that of the COUP-TFII (ARP1), PPAR{gamma}2, and RXR{alpha} plasmids, the fold activation progressively decreased (Fig. 5BGo). Thus, SMRT repressed transcription from the LPL PPRE independent of the presence of COUP-TFII (ARP-1).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 5. Effect of cotransfected SMRT on LPL promoter function. Cotransfections using the 293T cells were performed using the -1824 to +187 bp LPL promoter/luciferase construct (0.1 µg/plate). All cells were transfected with 2 µg each of PPAR{gamma}2 and RXR{alpha} expression vectors, either alone (A) or together with 2 µg of the COUP-TFII (ARP-1) expression vector (B). Cells were cotransfected with varied concentrations of the full-length SMRT expression construct (0.2–8 µg/plate). The relative ratio of the SMRT to PPAR{gamma}2 (A) or of SMRT to COUP-TFII (B) plasmid concentrations is indicated along the x-axis. The total amount of DNA transfected was held constant by addition of the empty pEF-BOS vector. Fold activation is calculated relative to the luciferase baseline in the absence of nuclear hormone receptor expression constructs, defined as 1. Results are normalized to protein concentration (which were maintained at 87.5 µg per reaction) and represent the mean ± SE of three experiments.

 
To determine the domains of SMRT critical for repression of the LPL PPRE, cotransfection experiments were performed with several SMRT deletion mutants and the wild-type PPAR{gamma}2 and RXR{alpha} (Fig. 6AGo). In the absence of SMRT, the PPAR{gamma}2/RXR{alpha} expression constructs again induced luciferase activity by an order of magnitude relative to baseline. Constructs containing either amino acids 29–564 or 565-1289 of SMRT reduced this fold activation by 40–60%. In contrast, those constructs containing the carboxyl-terminus of the SMRT protein (amino acids 565-1495 or 1–1495) completely abolished this activation. Further studies employed in vitro pull-down assays to determine whether a direct interaction existed between SMRT and PPAR{gamma} (Fig. 6BGo). Strong interactions (indicated by arrows A, B, and C) were observed between the ligand-binding domain of the PPAR{gamma}/GST fusion protein and all in vitro transcribed and translated proteins containing amino acids 1289–1495 of SMRT. Radiolabeled proteins lacking the carboxyl-terminal domain of SMRT did not bind to the PPAR{gamma}-GST fusion protein.



View larger version (42K):
[in this window]
[in a new window]
  		Figure 6. Localization of SMRT domain interacting with PPAR{gamma}2. A, Cotransfection analysis in 293T cells was performed with the empty pAB{Delta}gal expression vector (8 µg/plate) or constructs encoding the full-length (amino acids 1–1495) and deleted versions (amino acids 29–564, 565-1289, and 565-1495) of the SMRT protein together with the -1824 to +187 LPL promoter luciferase construct (0.1 µg/plate) and the PPAR{gamma}2 and RXR{alpha} expression constructs (2 µg/plate). Fold activation is calculated relative to the luciferase baseline in the absence of nuclear hormone receptor expression constructs, defined as 1. Results are normalized to protein concentration (which were maintained at 87.5 µg per reaction) and represent the mean ± SE of three experiments. B, GST pull-down experiments using varied deletions of the SMRT protein. Lanes on a 12% SDS-PAGE gel contained 20% of the input 35S-labeled SMRT proteins (amino acids 1–1495, 29–564, 565-1289, 565-1495, and 1192–1495; I), the labeled protein pulled down by the GST protein-coupled beads (G), and the GST-PPAR{gamma}2 ligand-binding domain-coupled beads (P). Protein size markers are indicated. Data are representative of two experiments. Arrows (labeled A, B, and C) indicate the association of the following 35S-labeled SMRT proteins with the GST protein-coupled beads in pull-down assays (lane P): A, 1–1495; B, 565-1495; and C, 1192–1495.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
PPAR{gamma} interactions with COUP-TF proteins
The COUP-TF proteins increased expression from the LPL promoter synergistically with PPAR{gamma}2/RXR{alpha} in 293T cells, and this was dependent on the presence of an intact PPRE. This contrasts with many studies that have reported antagonistic actions between COUP-TF and PPAR when compared on a common promoter DNA recognition element. In the majority of cases, transcription was increased by PPAR proteins and decreased by COUP-TF proteins; examples include the promoters for apolipoprotein AI (36), medium chain acyl-coenzyme A dehydrogenase (37, 38), hydratase dehydrogenase (39, 40), malic enzyme (41, 42), and mitochondrial hydroxy-methylglutaryl-coenzyme A synthase (43). In contrast, the transferrin promoter is the sole example where expression was decreased by PPAR proteins but increased by COUP-TF proteins (13). Nevertheless, it is likely that the promoters of other hepatic proteins repressed by peroxisome proliferator compounds will exhibit this same profile; candidates include the transthyretin and {alpha}2u-macroglobulin gene promoters (44).

However, the actions of PPAR and COUP-TF proteins are not necessarily antagonistic. There are examples where both PPAR and COUP-TF actions increase transcription from a common DNA recognition element; these include the human immunodeficiency virus long terminal repeat (10) and the phosphoenolpyruvate decarboxylase promoter (11, 12, 45). The murine LPL promoter exhibits this same pattern of regulation in the 293T cell line.

This conflicting pattern of both positive and negative interactions with COUP-TF is not unique to PPAR proteins and PPREs. Similar findings with COUP-TF have been reported for the estrogen receptor and estrogen receptor recognition elements (EREs). In a study examining a consensus ERE, COUP-TF proteins were observed to bind to the DNA element and to repress estrogen ligand activation of a reporter gene (46). In contrast, in studies of the intact estrogen receptor gene promoter containing an ERE, COUP-TF bound to the ERE and increased transcription in synergy with the estrogen receptor (47). Independent of the mechanism accounting for these disparate interactions between COUP-TF and nuclear hormone receptors, the current findings support the conclusion that COUP-TF proteins can positively modulate LPL promoter transcription through the PPAR recognition element in 293T cells.

PPAR{gamma}2 interactions with SMRT
The presence of SMRT repressed PPAR{gamma}2/RXR{alpha}-mediated transcription from the LPL promoter 9-fold. This contrasts with the reported less than 2-fold repression by SMRT of transcription from the isolated acyl-coenyzme A oxidase PPRE (18). As both studies employed 293T cells, this discrepancy cannot be attributed to differences in the cell model (18). Instead, the DNA site itself is a more likely explanation (18). The compositions of the DNA recognition element and its 5'-flanking sequences are known to influence PPAR protein binding affinity and specificity (9, 48, 49, 50). As has been postulated previously (18), alterations in the DNA sequence could result in conformational changes in the DNA recognition element/PPAR{gamma} protein complex. This could lead to subsequent allosteric changes in the accessibility of the bound PPAR protein’s corepressor-interactive domain to the SMRT protein. Thus, the SMRT protein may regulate PPREs differentially depending on their DNA compositions and flanking sequences. The relative stoichiometry of the SMRT protein relative to the nuclear hormone receptor proteins PPAR{gamma}, RXR and COUP-TF may further contribute to the tissue-specific regulation of LPL. Data supporting a role for SMRT as a PPAR corepressor comes from recent microinjection experiments using anti-SMRT and anti-N-CoR antibodies (51). In cells transfected with a PPRE-directed reporter gene, injection of an anti-SMRT antibody (but not an anti-N-CoR antibody) relieved PPAR{gamma}-mediated repression induced by stimulation of the mitogen-activated protein kinase cascade (51).

The current results mapping the PPAR{gamma}2-interactive domain of SMRT to between amino acids 1289–1495 confirm and extend earlier studies (18). This region corresponds to one of the two distinct receptor-interactive domains (RID) delineated in the SMRT carboxyl-terminal (RID2, amino acids 1260–1495) (52). The PPAR{gamma}2-interactive domain of SMRT is similar to that used by the thyroid receptor (52), but differs from those used by the retinoic acid receptor (RID1, corresponding to amino acids 1086–1291) (52) and by COUP-TF1 (the amino-terminal portion of SMRT) (25).

In summary, this work demonstrates that COUP-TFII (ARP-1) and SMRT can modulate transcription from the LPL promoter in the presence of PPAR{gamma}2 and RXR{alpha} in an in vitro system. These observations are consistent with current models suggesting that the relative stochiometry of nuclear receptors and their corepressors regulates promoter function and accounts for cell-specific gene expression (18). Both COUP-TF and SMRT proteins may play an in vivo role in the complex physiological regulation of LPL. However, the current studies were limited to a single cell line. The 293T cells constitutively express the simian virus 40 T antigen (27), and the possibility exists that this has contributed to the current findings. Future studies will extend and test these observations in primary adipose tissues and other sites of LPL expression.


   Acknowledgments
 
The authors thank the following individuals: D. Benbrook, A. J. Cooney, J. Conaway, R. Conaway, M. R. Hill, G. Pighetti, M.-J. Tsai, S. Tsai, and C. Webb for critical comments and review of the manuscript; P. Anderson, S. V. Do, T. Landers, and J. Young for graphic and photographic assistance; and J. Conaway, R. Conaway, R. Evans, D. R. Helinski, T. Kamura, D. Kelly, S. A. Kliewer, and R. Vega for reagents.


   Footnotes
 
1 This work was supported by Grant-in-Aid 9808013S from the American Heart Association, Oklahoma Affiliate, Inc. (to J.M.G.), USPHS Grant CA-50898 from the NCI (to J.M.G.), as well as past support from the Oklahoma Medical Research Foundation. This work has been submitted in partial fulfillment of the Ph.D. thesis requirement for C.E.R. in the Department of Zoology, University of Oklahoma. Back

2 Current address: Eli Lilly & Co., Indianapolis, Indiana 46225. Back

3 Current address: University of Pittsburgh, Pittsburgh, Pennsylvania 15261. Back

Received August 27, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Enerback S, Gimble JM 1993 Lipoprotein lipase gene expression: physiological regulators at the transcriptional and post-transcriptional level. Biochim Biophys Acta 1169:107–125[Medline]
  2. Schoonjans K, Peinado-Onsurbe J, Lefebvre A-M, Heyman RA, Briggs M, Deeb S, Staels B, Auwerx J 1996 PPAR{alpha} and PPAR{gamma} activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J 15:5336–5348[Medline]
  3. Robinson CE, Wu X, Morris DC, Gimble JM 1998 DNA bending is induced by binding of the peroxisome proliferator-activated receptor {gamma}2 heterodimer to its response element in the murine lipoprotein lipase promoter. Biochem Biophys Res Commun 244:671–677[CrossRef][Medline]
  4. Bey L, Etienne J, Tse C, Brault D, Noe L, Raisonnier A, Arnault F, Hamilton MT, Galibert F 1998 Cloning, sequencing and structural analysis of 976 base pairs of the promoter sequence for the rat lipoprotein lipase gene. Comparison with the mouse and human sequences. Gene 209:31–38[CrossRef][Medline]
  5. Tanuma Y, Nakabayashi H, Esumi M, Endo H 1995 A silencer element for the lipoprotein lipase gene promoter and cognate double- and single-stranded DNA-binding proteins. Mol Cell Biol 15:517–523[Abstract]
  6. Qui Y, Tsai SY, Tsai M-J 1994 COUP-TF: an orphan member of the steroid/thyroid hormone receptor superfamily. Trends Endocrinol Metab 5:234–239[CrossRef][Medline]
  7. Tsai M-J, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  8. Tsai SY, Tsai M-J 1997 Chicken ovalbumin upstream promoter-transcription factors (COUP-TF): coming of age. Endocr Rev 18:229–240[Abstract/Free Full Text]
  9. Nakshatri H, Bhat-Nakshatri P 1998 Multiple parameters determine the specificity of transcriptional response by nuclear receptors HNF-4, ARP-1, PPAR, RAR, and RXR through common response elements. Nucleic Acids Res 26:2491–2499[Abstract/Free Full Text]
  10. Ladias JAA 1994 Convergence of multiple nuclear receptor signaling pathways onto the long terminal repeat of human immunodeficiency virus-1. J Biol Chem 269:5944–5951[Abstract/Free Full Text]
  11. Hall RK, Sladek FM, Granner DK 1995 The orphan receptors COUP-TF and HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Proc Natl Acad Sci USA 92:412–416[Abstract/Free Full Text]
  12. Tontonoz P, Hu E, Devine J, Beale EG, Spiegelman BM 1995 PPAR{gamma}2 regulates adipose expression of the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 15:351–357[Abstract]
  13. Hertz R, Seckbach M, Zakin MM, Bar-Tana J 1996 Transcriptional repression of the transferrin gene by hypolipidemic peroxisome proliferators. J Biol Chem 271:218–224[Abstract/Free Full Text]
  14. Brodie AE, Manning VA, Hu CY 1996 Inhibitors of preadipocyte differentiation induce COUP-TF binding to a PPAR/RXR binding sequence. Biochem Biophys Res Commun 228:655–661[CrossRef][Medline]
  15. Horowitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167–1177[Abstract/Free Full Text]
  16. Shibata H, Spencer TE, Onate SA, Jenster G, Tsai SY, Tsai M-J, O’Malley BW 1997 Role of coactivators and corepressors in the mechanisms of steroid/thyroid receptor action. Recent Prog Horm Res 52:141–164
  17. Misiti S, Schomburg L, Yen PM, Chin WW 1998 Expression and hormonal regulation of coactivator and corepressor genes. Endocrinology 139:2493–2500[Abstract/Free Full Text]
  18. Zamir I, Zhang J, Lazar MA 1997 Stoichiometric and steric principles governing repression of nuclear hormone receptors. Genes Dev 11:835–846[Abstract/Free Full Text]
  19. DeWet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725–737[Abstract/Free Full Text]
  20. Mizushima S, Nagata S 1990 pEF-BOS, a powerful mammalian expression vector. Nucleic Acids Res 18:5322[Free Full Text]
  21. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor{gamma} (PPAR{gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  22. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, Kakizuka A, Evans RM 1992 Characterization of three RXR genes that mediate the action of the 9-cis retinoic acid. Genes Dev 6:329–344[Abstract/Free Full Text]
  23. Tran P, Zhang X, Salbert G, Hermann T, Lehann JM, Pfahl M 1992 COUP orphan receptors are negative regulators for retinoic acid response pathways. Mol Cell Biol 12:4666–4676[Abstract/Free Full Text]
  24. Miyajima N, Kadowaki Y, Fukushige S-I, Shimizu S-I, Semba K, Yamanashi Y, Matsubara K-I, Toyoshima K, Yamamoto T 1988 Identification of two novel members of erbA superfamily by molecular cloning: the gene products of the two are highly related to each other. Nucleic Acids Res 16:11057–11074[Abstract/Free Full Text]
  25. Shibata H, Nawaz Z, Tsai SY, O’Malley BW, Tsai M-J 1997 Gene silencing by chicken ovalbumin upstream transcription factor I (COUP-TFI) is mediated by transcriptional corepressors, nuclear receptor-corepressor (N-CoR) and silencing mediator for retinoic acid receptor and thyroid receptor (SMRT). Mol Endocrinol 11:714–724[Abstract/Free Full Text]
  26. Ladias JAA, Karathanasis SK 1991 Regulation of the apolipoprotein AI gene by ARP-1, a novel member of the steroid receptor superfamily. Science 251:561–565[Abstract/Free Full Text]
  27. Graham FL, Smiley J, Russell WC, Nairn R 1977 Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36:59–72[Abstract/Free Full Text]
  28. Gimble JM, Robinson CE, Wu X, Kelly KA, Rodriguez BR, Kliewer SA, Lehmann JM, Morris DC 1996 Peroxisome proliferator-activated receptor {gamma} activation by thiazolidinediones induces adipogenesis in bone marrow stromal cells. Mol Pharmacol 50:1087–1094[Abstract]
  29. Chomczynski P, Sacchi N 1987 Single step method of RNA isolation by acid guanidium isothiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  30. Church G, Gilbert W 1984 Genomic sequencing. Proc Natl Acad Sci USA 81:1991–1995[Abstract/Free Full Text]
  31. Feinberg AP, Vogelstein B 1983 A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6–13[CrossRef][Medline]
  32. Kieback DG, Runnelbaum IB, Moebus VJ, Kreienberg R, McCamant SK, Edwards CL, Jones LA, Tsai M-J, O’Malley BW 1993 Chicken ovalbumin upstream promoter-transcription factor (COUP-TF): an orphan steroid receptor with a specific pattern of differential expression in human ovarian cell lines. Gynecol Oncol 51:167–170[CrossRef][Medline]
  33. Chawla A, Schwartz EJ, Dimaculangan DD, Lazar MA 1994 Peroxisome proliferator-activated receptor (PPAR)-{gamma}: adipose predominant expression and induction early in adipocyte differentiation. Endocrinology 135:798–800[Abstract]
  34. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPPAR{gamma}2:tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–1234[Abstract/Free Full Text]
  35. Cao Z, Umek RM, McKnight SL 1991 Regulated expression of three C/EBP isoforms during adipose conversion of 3T3–L1 cells. Genes Dev 5:1539–1552
  36. Graves RA, Tontonoz P, Spiegelman BM 1992 Analysis of a tissue-specific enhancer: ARF6 regulates adipogenic gene expression. Mol Cell Biol 12:1202–1208[Abstract/Free Full Text]
  37. Disch DL, Rader TA, Cresci S, Leone TC, Barger PM, Vega R, Wood PA, Kelly DP 1996 Transcriptional control of a nuclear gene encoding a mitochondrial fatty acid oxidation enzyme in transgenic mice: role for nuclear receptors in cardiac and brown adipose expression. Mol Cell Biol 16:4043–4051[Abstract]
  38. Gulick T, Cresci S, Caira T, Moore DD, Kelly DP 1994 The peroxisome proliferator activated receptor regulates mitochondrial fatty acid oxidative enzyme gene expression. Proc Natl Acad Sci USA 91:11012–11016[Abstract/Free Full Text]
  39. Miyata KS, Zhang B, Marcus SL, Capone JP, Rachubinski RA 1993 Chicken ovalbumin upstream promoter transcription factor (COUP-TF) binds to a peroxisome proliferator-response element and antagonizes peroxisome proliferator-mediated signaling. J Biol Chem 268:19169–19172[Abstract/Free Full Text]
  40. Marcus SL, Capone JP, Rachubinski RA 1996 Identification of COUP-TFII as a peroxisome proliferator response element binding protein using genetic selection in yeast: COUP-TFII activates transcription in yeast but antagonizes PPAR signaling in mammalian cells. Mol Cell Endocrinol 120:31–39[CrossRef][Medline]
  41. Castelein H, Gulick T, Declercq PE, Mannaerts GP, Moore DD, Baes MI 1994 The peroxisome proliferator activated receptor regulates malic enzyme gene expression. J Biol Chem 269:26754–26758[Abstract/Free Full Text]
  42. Baes M, Castelein H, Desmet L, Declercq PE 1995 Antagonism of COUP-TF and PPAR{alpha}/RXR{alpha} on the activation of the malic enzyme promoter: modulation by 9-cis RA. Biochem Biophys Res Commun 215:338–345[CrossRef][Medline]
  43. Rodriguez JC, Ortiz JA, Hegardt FG, Haro D 1997 Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) could act as a transcriptional activator or repressor of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene. Biochem J 326:587–592
  44. Motojima K, Peters JM, Gonzalez FJ 1997 PPAR{alpha} mediates peroxisome proliferator-induced transcriptional repression of nonperoxisomal gene expression in mouse. Biochem Biophys Res Commun 230:155–158[CrossRef][Medline]
  45. Scott DK, Mitchell JA, Granner DK 1996 The orphan receptor COUP-TF binds to a third glucocorticoid accessory factor element with the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271:31909–31914:1996[Abstract/Free Full Text]
  46. Klinge CM, Silver BF, Driscoll MD, Sathya G, Bambara RA, Hilf R 1997 Chicken ovalbumin upstream promoter-transcription factor interacts with estrogen receptor, binds to estrogen response elements and half-sites, and inhibits estrogen-induced gene expression. J Biol Chem 272:31465–31474[Abstract/Free Full Text]
  47. Lazennec G, Kern L, Valotaire Y, Salbert G 1997 The nuclear orphan receptor COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation. Mol Cell Biol 17:5053–5066[Abstract]
  48. Palmer CNA, Hsu M-H, Griffin KJ, Johnson EF 1995 Novel sequence determinants in peroxisome proliferator signaling. J Biol Chem 270:16114–16121[Abstract/Free Full Text]
  49. Ijpenberg A, Jeannin E, Wahli W, Desvergne B 1997 Polarity and specific sequence requirements of peroxisome proliferator-activated receptor (PPAR)/retinoid X receptor (heterodimer binding to DNA. J Biol Chem 272:20108–201117[Abstract/Free Full Text]
  50. Juge-Aubry C, Pernin A, Favez T, Burger AG, Wahli W, Meier CA, Desvergnes B 1997 DNA binding properties of peroxisome proliferator-activated receptor subtypes on various natural peroxisome proliferator response elements. Importance of 5' flanking region. J Biol Chem 272:25252–25259[Abstract/Free Full Text]
  51. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen T-M, Schiff R, Del-Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci USA 95:2920–2925[Abstract/Free Full Text]
  52. Li H, Leo C, Schroen DJ, Chen JD 1997 Characterization of receptor interaction and transcriptional repression by the corepressor SMRT. Mol Endocrinol 11:2025–2037[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
H. Wang and R. H. Eckel
Lipoprotein lipase: from gene to obesity
Am J Physiol Endocrinol Metab, August 1, 2009; 297(2): E271 - E288.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. J. Calonge, J. Seoane, and J. Massague
Opposite Smad and Chicken Ovalbumin Upstream Promoter Transcription Factor Inputs in the Regulation of the Collagen VII Gene Promoter by Transforming Growth Factor-{beta}
J. Biol. Chem., May 28, 2004; 279(22): 23759 - 23765.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. Coutant, S. Agaugue, L. Perrin-Cocon, P. Andre, and V. Lotteau
Sensing Environmental Lipids by Dendritic Cell Modulates Its Function
J. Immunol., January 1, 2004; 172(1): 54 - 60.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Lin, S. K. Kolluri, G.-q. Chen, and X.-k. Zhang
Regulation of Retinoic Acid-induced Inhibition of AP-1 Activity by Orphan Receptor Chicken Ovalbumin Upstream Promoter-Transcription Factor
J. Biol. Chem., June 7, 2002; 277(24): 21414 - 21422.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. W. Eubank, E. Duplus, S. C. Williams, C. Forest, and E. G. Beale
Peroxisome Proliferator-activated Receptor gamma and Chicken Ovalbumin Upstream Promoter Transcription Factor II Negatively Regulate the Phosphoenolpyruvate Carboxykinase Promoter via a Common Element*
J. Biol. Chem., August 3, 2001; 276(32): 30561 - 30569.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robinson, C. E.
Right arrow Articles by Gimble, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Robinson, C. E.
Right arrow Articles by Gimble, J. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals