help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, X.
Right arrow Articles by Peter, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, X.
Right arrow Articles by Peter, R. E.
Right arrowPubmed/NCBI databases
*Protein
*Compound via MeSH
*Substance via MeSH
Endocrinology Vol. 140, No. 5 2089-2099
Copyright © 1999 by The Endocrine Society


ARTICLES

Expression of Three Distinct Somatostatin Messenger Ribonucleic Acids (mRNAs) in Goldfish Brain: Characterization of the Complementary Deoxyribonucleic Acids, Distribution and Seasonal Variation of the mRNAs, and Action of a Somatostatin-14 Variant1

Xinwei Lin, Carla J. Otto and Richard E. Peter

Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada

Address all correspondence and requests for reprints to: Dr. R. E. Peter, Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada. E-mail: dick.peter{at}ualberta.ca


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, three somatostatin (SRIF) complementary DNAs (cDNAs) were characterized from goldfish brain. The cDNAs encode three distinct preprosomatostatins (PSS), designated as PSS-I, PSS-II, and PSS-III. The goldfish PSS-I, PSS-II, and PSS-III contain enzymatic cleavage recognition sites, potentially yielding SRIF-14 with sequence identical to mammalian SRIF-14, SRIF-28 with [Glu1, Tyr7, Gly10]SRIF-14 at its C-terminus, and [Pro2]SRIF-14, respectively. The brain distribution of the three SRIF messenger RNAs (mRNAs) were differential but overlapping in the telencephalon, hypothalamus and optic tectum-thalamus regions. Seasonal variations in the levels of the three mRNAs were observed, with differential patterns between the three mRNAs and differences between the sexes. However, only the seasonal alteration in the levels of the mRNA encoding PSS-I showed close association with the seasonal variation in brain contents of immunoreactive SRIF-14 and inversely correlated with the seasonal variation in serum GH levels described in the previous studies, suggesting that SRIF-14 is involved in the control of the seasonal variation in serum GH levels. The putative SRIF-14 variant, [Pro2]SRIF-14, inhibited basal GH secretion from in vitro perifused goldfish pituitary fragments, with similar potency to SRIF-14; [Pro2]SRIF-14 also inhibited stimulated GH release from the pituitary fragments, supporting that [Pro2]SRIF-14 is a biologically active form of SRIF in goldfish.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SOMATOSTATIN (SRIF or SS) is a polypeptide that was originally isolated from mammalian hypothalamus and characterized as a physiological inhibitor of GH secretion (1). In mammals, SRIF is now known to be a multifunctional peptide widely distributed throughout the central nervous system and peripheral tissues (2, 3). Mammalian SRIF exists as two predominant biologically active forms, SRIF-14 and its NH2-terminal extension of 14 amino acids, SRIF-28. Both SRIF-14 and SRIF-28 are encoded by a common gene and processed from a single precursor (2, 3, 4).

SRIF is also a phylogenetically ancient and multigene family of peptides in vertebrates. SRIF-14 has been identified, with the same amino acid sequence, in representative species of all classes of vertebrate (5, 6). In addition, four molecular variants of SRIF-14, [Ser12]SRIF-14, [Ser5]SRIF-14, [Pro2, Met13]SRIF-14 and [Pro2]SRIF-14, have been isolated in nonmammalian vertebrates (7, 8, 9, 10). To date, cDNAs for preprosomatostatin-I (PSS-I), which contains SRIF-14 at its C-terminus, have been cloned in several mammalian species (11, 12, 13, 14), chicken (15), frog (16), and two teleost species (17, 18, 19). The gene for PSS-I has also been characterized in mouse, rat, and human (20, 21, 22).

In addition to having PSS-I, teleost fish possess a second SRIF precursor, PSS-II, a molecule that is thought to be processed to a large form of SRIF (SRIF-28 or SRIF-25) with [Tyr7, Gly10]SRIF-14 sequence at its C-terminus. The cDNA sequence for PSS-II has been identified in anglerfish (18) and rainbow trout (23), providing evidence that somatostatins arose from a multigene family. Amino acid sequences for processing products of PSS-II obtained directly from isolates of islet extracts are also known for several teleost species (24, 25, 26, 27). Recently, a second SRIF messenger RNA (mRNA) encoding a SRIF-14 variant, [Pro2, Met13]SRIF-14, was identified in frog brain (9). In addition, a SRIF-related gene termed as cortistatin (CST) has been described in human, rat and mouse, which gives rise to a precursor that contains a tetradecapeptide at its C-terminus with an 11 amino acid homology with SRIF-14 (28, 29, 30). This suggests the existence of a multigene family for SRIF in tetrapods.

In teleosts, most of the physiological studies of SRIF have been focused on the regulation of pancreatic hormone and metabolism in salmonids (31, 32) and the regulation of GH secretion and growth in goldfish (33). In goldfish, immunoreactive SRIF-14 has been observed in the brain, with fiber tracts that terminate at the proximal pars distalis of pituitary (34, 35). SRIF-14 is a potent inhibitor of basal and stimulated GH release in goldfish (33). In addition, the concentrations of immunoreactive SRIF-14 in various brain regions vary on a seasonal basis inverse to the seasonal variation in serum GH levels (36). The inhibitory actions of SRIF-14 on GH secretion in vitro or in vivo have also been reported in tilapia, rainbow trout, and several other teleost species (33).

In the present study, three distinct SRIF cDNAs were cloned from goldfish brain RNA or cDNA library. The differential brain distribution and seasonal variation of the three SRIF mRNAs were also examined. In addition, the actions of a cDNA-deduced SRIF-14 variant on pituitary GH secretion were investigated using an in vitro perifusion system.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Goldfish (Carasius auratus) of the common or comet variety with body weight ranging from 30–40 g were purchased from Grassyfork Fisheries (Martinsville, IN) and maintained in 300-liter flow-through aquaria at 17 C under a simulated natural photoperiod of Edmonton, Alberta, Canada. The fish were fed with commercially prepared Unifeed Nu-Way trout ration (United Feeds, Calgary, Canada). Sexually regressed fish (mixed sexes) were used for extraction of RNA and DNA for molecular cloning and tissue distribution studies. For seasonal studies, tissue samples were collected in April [sexually mature fish, with gonadosomatic index (GSI) of 6.5% ± 0.68 for female and 3.5% ± 0.31 for male], July (sexually regressed fish, with GSI of 0.11% ± 0.07 for female and 0.21% ± 0.06 for male) and December (sexually recrudescent fish, with GSI of 4.06% ± 0.91 for female and 2.6% ± 0.33 for male) of the same year. Goldfish were anesthetized with 0.05% tricaine methanesulfonate (Syndel, Vancouver, BC) before tissue collection.

Reagents and test substances
SRIF-14 (Ala-Gly-Cys-Lys-Asn-Phe-Phe-Trp-Lys-Thr-Phe-Thr-Ser-Cys) was obtained from Sigma Chemical Co. (St. Louis, MO). [Pro2]SRIF-14 was a gift from Professor H. Kawauchi (Kitasato University, Sanriku, Japan). SRIF peptides were dissolved in HBSS immediately before use. sGnRH ([Trp7, Leu8]GnRH) was purchased from Peninsula Laboratories, Inc. (Belmont, CA). sGnRH was dissolved in 0.1 M acetic acid. Subsequent dilution of all peptides to appropriate concentrations with culture medium was performed immediately before drug treatment. Dopamine (DA) D1 receptor agonist, SKF 38393 (1-phenyl-2,3,4,5-tetrahydro-(1H)-3-benzazepine-7,8-diol hydrochloride), was purchased from Research Biochemicals International, Inc. (Wayland, MA). SKF 38393 was first dissolved in dimethyl sulfoxide (DMSO), and then diluted to appropriate concentration with culture medium. Final levels of DMSO was less than 0.1%, and did not alter basal GH release from goldfish pituitary fragments (unpublished results). Trizol Reagent, Taq DNA polymerase and SuperScript Preamplification System were purchased from Life Technologies (Gaithersburg, MD). T7QuickPrime Kit was obtained from Pharmacia Biotech (Baie d’Urfe, Québec, Canada). Nybond Nylon membranes and discs, ECL direct nucleic acid labeling and detection system, [{alpha}-32P]deoxy-CTP (dCTP) were obtained from Amersham Life Science (Buckinghamshire, UK). JM109 competent cells and pGEM-T vector system were purchased from Promega Corp. (Madison, WI). Other reagents were of the highest degree of purity available from commercial sources.

Preparation of total RNA and genomic DNA
Total RNA was extracted from goldfish forebrain (telencephalon, including optic nerve and preoptic region, and hypothalamus) using Trizol Reagent, based on the acid guanidinium thiocyanate-phenol-chloroform extraction method (37). The integrity of the RNA was verified by ethidium bromide staining of 28s and 18s ribosomal bands on a denaturing agarose gel. Genomic DNA was isolated from liver tissue of single fish using Trizol Reagent according to the manufacturer’s instruction.

Cloning of three goldfish SRIF cDNAs
For cloning of goldfish PSS-I cDNA, RT-PCR was used to prepare a DNA probe for screening the goldfish brain cDNA library. cDNA was synthesized from 4 µg of total RNA from goldfish forebrain using the SuperScript Preamplification System. For PCR, forward primer SS1-F1 (5'CGGATCCAGTGCGCCCTGGC3') and reverse primer SS1-R1 (5'GTGAAAGTTTTCCAGAAGAA3') were designed on the basis of the coding region of the catfish PSS-I cDNA sequence (19). Thirty cycles of PCR amplification were performed with denaturation for 1 min at 94 C, annealing for 1 min at 50 C, extension for 1.5 min at 73 C, and final extension for 10 min at 73 C after the last cycle. Amplification products were separated by agarose gel, and the band of desired size was excised and purified using a Geneclean II kit (Bio 101, La Jolla, CA). The purified DNA fragment (323 bp) was subcloned into pGEM-T vector. The nucleotide sequence analysis indicated that the cloned PCR product (323 bp) contained a partial coding region for a precursor with a partial SRIF-14 sequence at its C-terminus. This DNA fragment was then used as a probe to screen the cDNA library.

A goldfish brain cDNA library (kindly provided by Dr. H. R. Habibi, University of Calgary, Calgary, Alberta, Canada) was constructed using the ZAP-cDNA synthesis kit, including Gigapack II Gold packaging extract (Stratagene, La Jolla, CA). The library was amplified once to a titer of 6 x 109 pfu/ml before being transferred to Nybond-N+ discs at a density of 2 x 104 plaques/filter according to the manufacturer’s protocol. The filters were probed with the 323 bp DNA probe prepared by PCR as described above. The probe labeling, hybridization, and signal detection were performed using ECL direct nucleic acid labeling and detection systems based on enhanced chemiluminescence (38). A total of 2.5 x 105 clones were screened, out of which six positives were picked and subjected to secondary screening. Three positive clones were obtained from the secondary screening and subjected to in vivo excision according to the instruction of the ZAP-cDNA synthesis kit. The three clones with cDNA inserts of desired size (approximately 750 bp) were sequenced on an PE Applied Biosystems automated sequencer (373A) according to the manufacturer’s protocol. Sequencing was carried out on both strands using T7 and T3 sequencing primers that flank the insert cDNA.

For cloning of goldfish PSS-II cDNA, RT and rapid amplification of cDNA ends (RACE, 39) were applied. To isolate the 3' end of cDNA for PSS-II, two degenerate primers, DP1 (5'GCIGGITG(CT)AAGAACTTCTA3'] and DP2 (5'AAGAACTTCTA(CT)TGGAAGGG3'], were designed on the basis of the [Tyr7, Gly10]SRIF-14 amino acid sequence of anglerfish and rainbow trout PSS-II (18, 23). RT and RACE were carried out as described previously (40, 41). Briefly, total RNA was reverse transcribed to cDNA with dT-adapter primer [dT-AP, 5'GGCCACGCGTCGACTAGTAC(T)173'] using SuperScript II reverse transcriptase. Two rounds of PCR amplifications were then performed to amplify the 3' end of cDNA with adapter primer (AP, 5'GGCCACGCGTCGACTAGTAC3') and DP1, and AP and internal DP2, respectively. After determining the nucleotide sequence of the cDNA 3' end, new cDNA was synthesized by RT of total RNA with gene specific primer 1 (GSP1, 5'TTAACTTACATTGAGTCAGTTGA3'). After 3'-end tailing of the cDNA with poly(A) using TdT (Life Technologies), the second strand cDNA was synthesized using dT-AP. Two rounds of PCR amplifications were then carried out to amplify the 5' end of cDNA with AP and GSP1, and AP and internal gene specific primer 2 (GSP2, 5'CAAGCGAGGGCCTCAGCAGG3'), respectively. PCR products were fractionated and the desired bands were purified and subcloned using pGEM-T vector system. DNA sequence analyses were carried out as described above.

To confirm the PSS-II cDNA sequence obtained from RT and RACE, PCR of goldfish genomic DNA was carried out to obtain a partial gene sequence that contained the full coding region for PSS-II. PCR amplification was performed using 100 ng of genomic DNA as template and primers SS2-F1 (5'CGAATCACAGCTACAAAGAGTC3') and SS2-R1 (5'CAAGCGAGGGCCTCAGCAGG3') designed from the 5' and 3' ends of the isolated PSS-II cDNA sequence. PCR products were purified and subcloned into the pGEM-T vector. DNA sequence analyses were carried out as described above using T7 and M13 reverse sequencing primers and gene specific primers.

For cloning of the third SRIF cDNA, the goldfish brain cDNA library was screened using partial goldfish PSS-II cDNA as probe. A 426-bp DNA probe was prepared by PCR with primer set, SS2-F1, and SS2-R1 specific for the cloned cDNA sequence for PSS-II, and PSS-II cDNA as template. The probe was then used to screen the cDNA library as described above. The probe labeling, hybridization, and signal detection were performed using ECL direct nucleic acid labeling and detection systems. A total of 2 x 105 clones were screened, out of which three positives were picked and subjected to the secondary screening. Two positive clones were obtained from the secondary screening and subjected to in vivo excision and sequence analysis as described above.

Brain distribution of three goldfish somotostatin mRNAs
Tissues of five discrete goldfish brain areas, olfactory bulbs and tracts, telencephalon (including optic nerve and preoptic region), hypothalamus, optic tectum-thalamus, and posterior brain (including cerebellum, medulla and spinal cord), and pituitary were freshly excised and homogenized for extraction of total RNA using Trizol Reagent as described above. About 10 µg of total RNA from individual tissues were fractionated by electrophoresis in a denaturing agarose gel (1.5%) with formaldehyde and blotted onto Nybond nylon membrane by capillary transfer. The cDNAs for goldfish PSS-I, PSS-II, and PSS-III were labeled with [{alpha}-32P]dCTP using T7QuickPrime Kit. Hybridization was performed using methods described by Church and Gilbert (42). In brief, the membranes were prehybridized in hybridization solution (0.5 M NaHPO4, 7% SDS, 1 mM EDTA, and 1% BSA) for at least 1 h. The hybridization solution was then changed, and the labeled probe was added. After hybridization overnight at 65 C, the membranes were washed three times with washing solution (0.04 M NaHPO4, 1 mM EDTA, and 1% SDS) and exposed to a phosphoimaging screen for 72 h. To serve as an internal control, the membrane was stripped and reprobed with a [{alpha}-32P]dCTP-labeled partial cDNA for goldfish {alpha}-tubulin (kind gift from Dr. H. R. Habibi, University of Calgary, Calgary, Alberta, Canada).

The brain distribution of the three goldfish somatostatin mRNAs was further confirmed by RT-PCR followed by Southern blot analysis. First strand cDNA was prepared from total RNA using the SuperScript Preamplification System and used as templates for PCR using specific primers for the three goldfish SRIF mRNAs. The primer sets are: SS1-F2 (5'GCGTATCCAGTGCGCACTGGC3') and SS1-R2 (5'GTGAAAGTTTTCCAGAAGAA3') for PSS-I mRNA, SS2-F1 (5'CGAATCACAGCTACAAAGAGTC3') and SS2-R1 (5'CAAGCGAGGGCCTGAGCAGG3') for PSS-II, and SS3-F1 (5'GGAGCTACAAGACTTCAAC3') and SS3-R1 (5'CTGTGTCAGAGTAAGTCCACG3') for PSS-III. PCR condition was denaturation 1 min at 94 C, annealing 1 min at 51-55 C and extension 1 min at 73 C for a total of 30 cycles, and a final extension of 10 min at 73 C. For internal control, RT-PCR was performed at the same time using a primer set (Actin-F: CTACTGGTATTGTGATGGACTCCG; Actin-R: TCCAGACAGAGTATTTGCGCTCAG) for goldfish ß-actin. Twenty microliters of each PCR reaction were fractionated on 1.5% agarose gel and transferred onto a Nybond nylon membrane by capillary transfer. The membranes were then hybridized with cDNA probes for one of the three goldfish SRIF mRNAs, using ECL direct nucleic acid labeling and detection systems.

Seasonal variation of three goldfish somatostatin mRNAs
Tissue samples of forebrain regions of 20 goldfish were collected on April 3, July 31, and December 21 of the same year, respectively, and stored at -80 C until total RNA was extracted. The mRNA levels for each PSS form in the total RNA samples were analyzed using Northern blot as described in the previous section. The hybridization signals were scanned using phosphorimaging (Molecular Dynamics, Inc., Sunnyvale, CA) and quantitated by ImageQuant software (Molecular Dynamics, Inc.). The mRNA levels for each PSS form were expressed as a ratio of PSS mRNA to {alpha}-tubulin mRNA. These ratios were then normalized as a percentage of mRNA levels from male fish collected in April.

Column perifusion of goldfish pituitary fragments
To examine the actions of the deduced SRIF-14 variant, [Pro2]SRIF, on pituitary GH secretion, an in vitro column perifusion system for goldfish pituitary fragments was used (43). In brief, goldfish (sexually recrudescent) pituitary fragments (0.2 mm3) from 30 pituitaries were divided over 8 columns. The pituitary fragments were perifused overnight (15–18 h) with M199 (Life Technologies) containing 56 U/ml Nystatin (Sigma Chemical Co.), at a flow rate of 5 ml/h. Two hours before the experiment, the perifusion medium was switched to HBSS containing 25 mM HEPES and 0.1% BSA (Sigma Chemical Co.), and the flow rate increased to 15 ml/h. After this period of continuous perifusion, GH release from the pituitary fragments remained relatively stable in the absence of stimulation. Test substances were then applied from a drug reservior to the perifusion column through a three-way stopcock. Perifusate samples were collected in 5-min fractions and stored frozen at -25 C. GH contents in these samples were assayed using a RIA previously validated for goldfish GH (43).

For the dose-response study, goldfish pituitary fragments were administered with 2 min pulses of increasing doses of [Pro2]SRIF-14 or SRIF-14 from 0.01 nM to 100 nM at intervals of 30 min. To examine the actions of [Pro2]SRIF-14 on stimulated GH release from pituitary fragments, the pituitary fragments were first exposed to a 2-min pulse of 1 µM SKF 38393 or a 5-min pulse of 100 nM sGnRH. Sixty min after the pulse of sGnRH or SKF 38393, the fragments were exposed to 100 nM [Pro2]SRIF-14 or medium (control) for 60 min. During the exposure to SRIF or medium, the fragments were also exposed to the second pulse of 100 nM sGnRH (5 min) or 1 µM SKF 38393 (2 min). A third pulse of 100 nM sGnRH (5 min) or 1 µM SKF 38393 (2 min) was administered to the fragments 60 min after exposure to SRIF or medium. The interval between each of the three pulses of 100 nM sGnRH (5 min) or 1 µM SKF 38393 (2 min) was 90 min.

Data transformation and statistics
GH data from each column were expressed as a percentage of the mean GH contents of the first six fractions (30 min) collected at the beginning of perifusion before any drug treatment commenced (referred to as % pretreatment) (43, 44). This data transformation allows pooling of GH data from separate columns of the same experiment. GH responses were quantified by calculating the accumulated net change in GH release during the 30-min period (6 fractions) after a pulse of drug treatment (i.e. a net change in the area under the curve). Dose-response curves for [Pro2]SRIF-14 and SRIF-14 were analyzed with the ALLFIT computer program to obtain the respective ED50 values (45). Data for GH release quantitated by RIA and SRIF mRNA levels quantitated by Northern blot analysis were subjected to statistical analyses using ANOVA followed by Fisher’s least significant difference (LSD) test. Differences were considered significant at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Three goldfish SRIF cDNAs
Screening of a goldfish brain cDNA library with a probe for the coding region of partial PSS-I cDNA obtained six positive clones. After secondary screening, three clones were characterized by nucleotide sequence analysis. Sequence analysis confirmed their identity as PSS-I cDNA clones because the deduced protein sequence contains SRIF-14 at its C-terminus. All three clones contained the identical nucleotide sequence of PSS-I cDNA, only differing in the length of poly(A) tails at their 3'-end. The 749-nucleotide sequence of goldfish PSS-I cDNA is shown in Fig. 1AGo (GenBank accession number U40754), along with the deduced amino acid sequence of the PSS-I. The cDNA comprises 79 bases of 5'-untranslated region, 345 bases of open reading frame, and a long 325 base 3'-untranslated region, which contains a polyadenylation signal (AATAAA) and a poly(A) tail. The nucleotide sequence of the open reading frame predicts a goldfish PSS-I of 114 amino acid residues. The PSS-I consists of a putative signal peptide sequence of 24 amino acids from position +1 to 24. The signal peptide has features common to other signal peptides, notably a region of hydrophobic residues preceded by a positively charged residue (Arg at +5) near the N terminus (46). The precursor also contains a number of putative enzyme cleavage recognition sites (47). These include an Arg monobasic site at position +88, potentially yielding a 26-amino acid large form of SRIF (SRIF-26), and an Arg-Lys dibasic site at position +99 to 100, potentially yielding SRIF-14 with sequence identical to mammalian SRIF-14 (1).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. The cDNA and deduced amino acid sequences of the three goldfish preprosomatostatins (PSS), PSS-I (A), PSS-II (B), and PSS-III (C). The DNA sequences of the 5'- and 3'-untranslated region are shown as lower case letters, while coding regions are shown as upper case letters. The putative signal peptide sequences are shown as bold upper case letters. Potential monobasic and dibasic enzymatic cleavage recognition sites are indicated in boxes. The amino acid sequences for somatostatin-14 (SRIF-14) or its potential variants are underlined at the C-terminus of each precursor. The polyadenylation signals (AATAAA or ATTAAA) in the 3'-untranslated regions are shown as upper case letters.

 
RT and RACE were performed to clone goldfish PSS-II cDNA. 3'-RACE produced a distinct band of approximately 200 bp size. Sequence analysis of this product indicates that this partial cDNA contained the 3'-untranslated region and coding region for the C-terminal portion of the [Tyr7, Gly10]SRIF-14 sequence. Analysis of the 5'-RACE products revealed a distinct band of about 450 bp. Subcloning and sequence analysis showed that this 5'-RACE product contained nucleotide sequences for the 5'-untranslated region and an open reading frame for the second goldfish SRIF precursor (PSS-II), which contains [Glu1, Tyr7, Gly10]SRIF-14 at its C-terminus. The nucleotide sequences of the overlapping portions were identical between the partial cDNAs obtained by 3'-RACE and 5'-RACE. The same PCR amplification and sequence analyses for 3'-RACE and 5'-RACE were repeated to confirm that the sequences did not include any errors caused by misincorporation. Additional confirmation of the complete nucleotide sequence of the goldfish PSS-II cDNA was achieved by performing PCR amplification using specific primers positioned at the most 5' and 3' end of the cDNA and sequence analysis of the cDNA. The complete nucleotide sequences and the deduced amino acid sequence of the PSS-II cDNA, size 589 bp, is shown in Fig. 1BGo (GenBank accession number U60262). The cDNA comprises 57 bp 5'-untranslated region, an open reading frame (363 bp), and a 169 bp 3'-untranslated region, including two polyadenylation signals (AATAAA) and a poly(A) tail. The open reading frame encodes a 120-amino acid precursor, which contains a putative 26-amino acid signal peptide sequence from position +1 to 26. The precursor contains an Arg monobasic site at position +92, potentially yielding a large form of SRIF (SRIF-28) with 28 amino acids, and an Arg-Lys dibasic site at position +105 to +106, potentially yielding [Glu1, Tyr7, Gly10]SRIF-14. The [Glu1, Tyr7, Gly10]SRIF-14 is likely a variant of [Tyr7, Gly10]SRIF-14, which was identified at the C-terminus of PSS-II in anglerfish (18) and rainbow trout (23). To confirm the PSS-II cDNA sequence derived from RT and RACE, PCR of genomic DNA was performed to obtain a partial gene sequence for PSS-II. Sequence analysis of the PCR product confirmed the cDNA sequence. This 1269-bp partial gene sequence contains an internal intron of 841 bp and two partial exons for a reading frame of 363 bp encoding the full-length of PSS-II (Data not shown, GenBank accession number AF025686).

Screening of the goldfish brain cDNA library using partial PSS-II cDNA as probe identified two positive clones. After secondary screening, two positive clones were characterized by nucleotide sequence analysis. The identity of the sequence indicates a novel cDNA, as the deduced peptide sequence contains a SRIF-14 variant with a proline substitution at position 2 of SRIF-14. The 694 bp of goldfish PSS-III cDNA (GenBank accession number U72656) is shown in Fig. 1CGo, along with the deduced amino acid sequence of the precursor (PSS-III). The cDNA is comprised of a 104 bp 5'-untranslated region, 336 bp of open reading frame, and a 254 bp 3'-untranslated region, which contains a modified polyadenylation signal (ATTAAA) and a poly (A) tail. The deduced 111-amino acid precursor consists of a putative signal peptide sequence of 19 amino acids from position +1 to 19. The precursor contains an Arg-Lys dibasic site at position +96 and +97, potentially processing into [Pro2]SRIF-14. In addition, the precursor contains two Arg monobasic sites at +87 and +82, potentially generating a 24-amino acid peptide and a 29-amino acid peptide, respectively.

The nucleotide sequence similarity of the precursor coding regions of the three goldfish SRIF cDNAs are 53%, 22%, and 15% between PSS-I and PSS-II cDNA, PSS-I and PSS-III cDNA, and PSS-II, and PSS-III cDNA, respectively. The amino acid sequence similarity between three goldfish PSSs are 38%, 32%, and 18% between PSS-I and PSS-II, PSS-I and PSS-III, and PSS-II and PSS-III, respectively. Table 1Go summarizes the percentage amino acid sequence similarity of the known PSS between goldfish and other veterbrate species. The multiple sequence alignment was performed using Clustal W program at the online service website of European Bioinformatics Institute.


View this table:
[in this window]
[in a new window]
 
Table 1. Percentage amino acid sequence similarity of the known preprosomatostatins (PSS) between goldfish and other vertebrate species

 
Differential brain distribution of three golfish SRIF mRNAs
To examine the brain distribution of the three goldfish SRIF mRNAs, total RNA prepared from pituitary and five different brain areas, including olfactory bulbs and tracts, telencephalon, hypothalamus, optic tectum-thalamus, and posterior brain region, was subjected to Northern blot analysis (Fig. 2AGo). Hybridization signals to [{alpha}-32P]-labeled probe for PSS-I mRNA were found in the pituitary and in all brain areas except the olfactory bulbs. Hybridization signals to the probe for PSS-II mRNA were only found in the hypothalamus and optic tectum-thalamus. Hybridization signals to the probe for PSS-III mRNA were detected in the olfactory bulbs, telencephalon, hypothalamus and optic tectum-thalamus. The {alpha}-tubulin transcript as an internal control was observed in all of the tissues examined (Fig. 2AGo).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Brain distribution of the three goldfish somatostatin mRNAs as revealed by Northern blot analysis (A) and RT-PCR followed by Southern blot analysis (B). Total RNA was prepared from five brain regions, including olfactory bulb and tract (1 ), telencephalon (2 ), hypothalamus (3 ), optic tectum-thalamus (4 ) and posterior brain region (5 ), and pituitary (6 ). The RNA (10 µg) was fractionated on denaturing agarose gel and transblotted onto Hybond nylon membranes. The membrane was hybridized with one of the goldfish somatostatin cDNA probes labeled with [{alpha}-32P]dCTP and exposed to phosphoimaging screen. Northern blot of goldfish {alpha}-tubulin was also performed as internal control. For RT-PCR, cDNA was prepared from the total RNA samples from the five brain regions as described above. PCR was performed using the specific primer sets for each of the three goldfish somatostatin mRNAs. RT-PCR for goldfish ß-actin was also performed as internal control. PCR reaction was fractionated and transblotted onto nylon membrane. The membrane was hybridized with cDNA probe and detected using ECL nucleic acid labeling and detection system.

 
The differential brain distribution of the three goldfish SRIF mRNAs was confirmed using RT-PCR followed by Southern blot analysis (Fig. 2BGo). The primer set specific for goldfish PSS-I mRNA amplified a PCR product of 323 bp and was detected with Southern blot in the telencephalon, hypothalamus, optic tectum-thalamus and posterior brain. The primer set specific for goldfish PSS-II mRNA amplified a PCR product of 426 bp and was detected with Southern blot in the hypothalamus and optic tectum-thalamus as well as in telencephalon, where PSS-I mRNA was not detected by Northern blot analysis. The primer set specific for goldfish PSS-III mRNA amplified a PCR product of 531 bp and was detected with Southern blot in the olfactory bulbs, telencephalon, hypothalamus, optic tectum-thalamus area as well as in posterior brain, where PSS-III mRNA was not detected by Northern blot analysis. The primer set specific for ß-actin mRNA amplified a PCR product of 600 bp in all of the tissues examined, verifying the quality and integrity of the cDNA samples. There was no PCR product detected in the negative control (PCR without DNA template). No cross hybridization was seen for each of the three probes in Northern blot and Southern blot analyses.

Seasonal variation of three goldfish SRIF mRNAs
To examine the seasonal variation of the three SRIF mRNAs, total RNA prepared from forebrain tissue of male or female goldfish collected in April (sexually mature), July (sexually regressed) or December (sexually recrudescent) was used to quantitate mRNA levels for each SRIF mRNA using Northern blot analysis.

Seasonal changes in PSS-I mRNA levels were observed for female but not male fish (Fig. 3AGo). Females in December and April exhibited significantly higher levels of PSS-I mRNA than that in July, but there were no significant differences in PSS-I mRNA levels between female fish collected in April and in December. Male fish showed no significant differences in PSS-I mRNA levels between April, July, and December. No sexual differences in mRNA levels for PSS-I were seen in July or December (Fig. 3AGo). In April, however, female fish had significantly higher levels of PSS-I mRNA levels than males.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 3. Seasonal variation of the three goldfish somatostatin mRNAs. Total RNA was prepared from the goldfish forebrain tissues collected in April, July, and December, respectively, and subjected to Northern blot analysis as described in Fig. 2Go. Hybridization signals were detected using phosphoimaging and quantitated using ImageQuant program. The somatostatin mRNA levels were expressed as a ratio between somatostatin mRNA and {alpha}-tubulin mRNA (internal control) and then normalized as a percentage of somatostatin mRNA levels from male fish collected in April. Data are mean ± SEM (n = 6). Statistical analysis was performed using ANOVA followed by Fisher’s LSD test. Significant differences at P < 0.05 between groups are designated by different lower case letters above the bars.

 
The pattern of seasonal alteration in PSS-II mRNA levels was similar for both female and male fish, with significantly higher levels occurring in July compared with April and December (Fig. 3BGo). No significant differences in PSS-II mRNA levels were found in both sexes between April and December. Significant sexual differences in PSS-II mRNA levels were observed in April, with higher expression of PSS-II in females (Fig. 3BGo).

Seasonal alterations in PSS-III mRNA levels were observed in both females and males (Fig. 3CGo). Both female and male fish in July had the highest levels of PSS-III mRNA. In addition, female fish had significantly higher levels of PSS-III mRNA in April compared with that in December. In contrast, male fish in December had significantly higher PSS-III expression compared with that in April, but there was no difference in PSS-III mRNA levels between males in July and in December (Fig. 3CGo). Significant sexual differences in mRNA levels for PSS-III were observed in both April and December (Fig. 3CGo). In December, males expressed significantly higher PSS-III than females. In contrast, in April females expressed higher PSS-III than males.

Actions of [Pro2]SRIF-14 on goldfish pituitary GH secretion
Direct actions of [Pro2]SRIF-14 on GH release were examined in goldfish pituitary fragments under column perifusion. Both SRIF-14 and [Pro2]SRIF-14 (0.01–100 nM) inhibited basal GH secretion from goldfish pituitary fragments in a dose-dependent manner, with similar potency between the GH release response to SRIF-14 and to [Pro2]SRIF-14 (Fig. 4Go). The ED50 values of [Pro2]SRIF-14 and SRIF-14 were 2.33 ± 2.17 nM and 3.56 ± 2.43 nM, respectively. GH secretion after each pulse rapidly returned to baseline levels, with increasing duration of the inhibition with increasing concentrations of SRIF peptides.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 4. Dose-dependent inhibiting effect of SRIF-14 and [Pro2]SRIF-14 on GH secretion from perifused goldfish pituitary fragments. Two-min pulses of increasing concentrations of SRIF-14 or [Pro2]SRIF-14 were administered at 30-min intervals. GH responses were quantitated as the accumulated net change in GH release after each pulse of SRIF peptide treatment. Data showed mean ± SEM (n = 4). ED50 values analyzed using the ALLFIT program for the GH-inhibiting effect of SRIF-14 and [Pro2]SRIF-14 were 2.33 ± 2.17 nM and 3.56 ± 2.43 nM, respectively.

 
[Pro2]SRIF-14 also inhibited DA D1 receptor agonist-stimulated GH release from perifused goldfish pituitary fragments (Fig. 5AGo). Two min pulses of SKF 38393, adminstered at 90-min intervals, significantly stimulated GH release. Exposure of the fragments to [Pro2]SRIF-14 decreased basal GH secretion and completely blocked SKF 38393-induced (the second pulse) GH secretion. After removal of [Pro2]SRIF-14, GH levels returned to near the initial baseline levels. However, subsequent exposure of the fragments to the third SKF 38393 pulse did not stimulate GH secretion from the fragments.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Effects of [Pro2]SRIF-14 on dopamine D1 receptor agonist SKF 38393-stimulated (A) and sGnRH-stimulated (B) GH secretion from perifused goldfish pituitary fragments. Three 2-min pulses of 100 nM sGnRH or 5-min pulses of 1 µM SKF 38393 were administered at 90-min intervals. The pituitary fragments were exposed to [Pro2]SRIF-14 or medium (control) for 1 h when the second pulse of drug treatment was supplied in the middle of this exposure. The upper panels of (A) and (B) show the GH release profile expressed as percentage of basal levels in columns treated with [Pro2]SRIF-14. The lower panels of (A) and (B) show the GH release responses to the three pulses of the drug treatment in the control columns and in the columns treated with [Pro2]SRIF-14. GH responses were quantitated as the accumulated net change in GH release after each pulse of drug treatment. Data showed mean ± SEM (n = 4–6). Statistical analysis was performed using ANOVA followed by Fisher’s LSD test. Significant differences at P < 0.05 between groups are designated by different lower case letters above the bars.

 
The actions of [Pro2]SRIF-14 on sGnRH-stimulated GH secretion was also examined (Fig. 5BGo). Five-minute pulses of sGnRH, given at 90-min intervals, resulted in stimulation of GH release from the pituitary fragments. Exposure of the fragments to [Pro2]SRIF-14 decreased basal GH secretion and completely blocked sGnRH-induced (the second pulse) GH secretion. Subsequent exposure of the fragments to the third sGnRH pulse resulted in the stimulation of GH secretion, which was not significantly different from the GH response to the third sGnRH pulse in the control columns (without exposure to [Pro2]SRIF-14).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, three distinct SRIF cDNAs were cloned from goldfish brain. The three cDNAs encode three goldfish SRIF precursors designated as PSS-I, PSS-II, and PSS-III, respectively. The deduced amino acid sequence similarities between three goldfish PSSs are from 18–38%, indicating high divergence between three goldfish SRIF precursors. Notably, goldfish PSS-III showed 32% and 27% similarity to frog [Pro2, Met13]SRIF-14 precursor (9) and mammalian CST precursor (28, 29, 30), respectively. A phylogenetic tree was produced by the amino acid sequence alignment of all known PSSs and CST precursors using Clustal W program (data not shown). This phylogenetic tree showed that goldfish PSS-I was grouped with mammalian, chicken, frog and catfish PSS-I in a separate clade, and that goldfish PSS-II was grouped with rainbow trout and anglerfish PSS-II in a clade. However, goldfish PSS-III was grouped with frog [Pro2, Met13]SRIF-14 precursor and mammalian CST precursors in a branch, along with catfish SRIF-22 precursor. Goldfish [Pro2]SRIF-14 precursor (PSS-III) shows little structural similarity with either PSS-I or PSS-II outside the C-terminal region. Similar results were observed between frog [Pro2, Met13]SRIF-14 precursor and frog PSS-I and the known fish PSS-IIs (16). Together, this suggests that goldfish PSS-III represents a third gene for SRIF in goldfish and is phylogenetically associated with the frog [Pro2, Met13]SRIF-14 and mammalian CST genes.

Posttranslational processing of PSS-I has been well studied in mammals and some fish species (6). In mammals, processing of PSS-I by converting enzymes is tissue specific. In brain, pancreas, and stomach, PSS-I is primarily hydrolyzed to yield SRIF-14 by cleavage at Arg-Lys dibasic sites, whereas in the intestine, PSS-I is mostly processed to SRIF-28 by cleavage at an upstream Arg monobasic site (48, 49). In nonmammalian vertebrates, SRIF-14 is the only PSS-I product identified in extracts of the pancreas of all species of birds, reptiles, and amphibias studied to date (6) and in islet tissue from some fish species (24, 25, 26, 50, 51). Therefore, according to the processing of PSS-I in other species, goldfish PSS-I is likely processed at the Arg-Lys dibasic site to generate SRIF-14, identical to the mammalian SRIF-14 (1). However, it is also possible that goldfish PSS-I can be processed at monobasic Arg site to yield SRIF-26, which has only three residue substitutions compared with bowfin SRIF-26 (52). The SRIF-26 is the most abundant SRIF component in extracts of the islet organ in bowfin, and SRIF-14 is present as a minor component in this species (52). Similarly, catfish PSS-I contains a monobasic Arg site, which could generate a SRIF-26 with an identical sequence to the proposed goldfish SRIF-26 (19).

Processing of PSS-II into SRIF-25 or SRIF-28 has been demonstrated indirectly by isolates of islet or intestine extracts from several fish species (24, 25, 26, 27). In anglerfish, both PSS-I and PSS-II contain dibasic and monobasic cleavage sites that could be cleaved respectively to generate SRIF-14 and SRIF-28 (17, 18). However, it has been shown that anglerfish SRIF-14 and SRIF-28 are two separate and independent products of anglerfish PSS-I and II, respectively, although both precursors are also cleaved at corresponding mono- and dibasic sites to some minor extent (50, 53, 54, 55), and both PSSs are expressed in different cells of the Brockmann body (56, 57). On this basis, it is suggested that goldfish PSS-II is likely processed at the monobasic Arg site to yield SRIF-28, which contains [Glu1, Tyr7, Gly10]SRIF-14 at its C-terminus. The goldfish SRIF-28 deduced from the cloned cDNA has 7 amino acids different from anglerfish SRIF-28 (18). Recently, a SRIF-28 peptide was isolated from goldfish intestine (27), with 5 amino acids different from the goldfish SRIF-28 deduced from cDNA in this study. These results suggest that there are at least two forms of SRIF-28 in goldfish, which may be differentially expressed in specific tissues.

Goldfish PSS-III deduced from the third cDNA sequence contains dibasic Arg-Lys site to generate [Pro2]SRIF-14 at its C-terminus. [Pro2]SRIF-14 has been identified in Russian sturgeon, a modern representative of the primitive bony fish (10). Sturgeons are one of the extant representatives of chondrosteans that gave rise to holosteans and teleosts. In addition, sturgeons exhibit dramatic similarities with amphibians; in particular they possess a functional hypothalamic-hypophysial blood portal system similar to the tetrapods, a system that is vestigial or absent in teleosts (58). A SRIF-14 variant [Pro2, Met13]SRIF-14 was identified and subsequently its cDNA was cloned from an amphibian species (9, 16). Recently, cDNA encoding a SRIF-related peptide, CST, has been characterized in several mammalian species (28, 29, 30). Preprocortistatin contains 112 amino acids with the sequence of a lysine-extended SRIF-14-related peptide at its C-terminus. CST-14 binds to mammalian SRIF receptors (sst) and inhibits stimulated-cAMP production likely through sst (28, 30). In addition, [Pro2]SRIF-14, [Pro2, Met13]SRIF-14 and rat CST-14 all contain Gly-Pro substitution at position 2 (position 1 for CST), although the functional implication of this substitution is unclear. Given the presence of [Pro2]SRIF-14 in both sturgeon and goldfish and the close phylogenetic relationship between goldfish [Pro2]SRIF-14 precursor (PSS-III) and [Pro2, Met13]SRIF-14 and CST precursors, the [Pro2]SRIF-14 gene may be the origin for the [Pro2, Met13]SRIF-14 and CST genes and represent an evolutionary branch of the SRIF family.

In the present study, [Pro2]SRIF-14 peptide inhibited basal GH release from goldfish pituitary fragments in a dose-dependent manner, with similar potency to SRIF-14. In addition, [Pro2]SRIF-14 inhibited sGnRH- or DA D1 receptor agonist-stimulated GH release from goldfish pituitary fragments; sGnRH and dopamine are two major stimulators of pituitary GH secretion in goldfish (43, 44). These results suggest that [Pro2]SRIF-14 is a biologically active form of SRIF in goldfish. In frogs, [Pro2, Met13]SRIF-14 is more potent than SRIF-14 in competing with the radioligand in receptor binding studies, and both [Pro2, Met13]SRIF-14 and SRIF-14 inhibit GH secretion from the frog pituitary (59).

In goldfish, immunoreactive SRIF (SRIF-ir) has been demonstrated in the brain using antiserum recognizing equally well mammalian SRIF-14 and SRIF-28 (34, 35). SRIF-ir neurons were widely distributed in the telencephalon, diencephalon, including the preoptic region, ventrobasal hypothalamus, epithalamus, midbrain, reticular formation and spinal cord (35). In the present study, distribution of the three SRIF mRNAs were consistently observed in the telencephalon, hypothalamus, and optic tectum-thalamus. However, the distribution of the three SRIF mRNAs were differential in the other brain regions. PSS-I mRNA was also detected in the posterior brain area by both RT-PCR and Northern blot analysis, consistent with the previous observation of SRIF peptide localization using immunocytochemistry. PSS-II mRNA was restricted in the forebrain and midbrain areas. PSS-III mRNA was also detected in posterior brain by RT-PCR but not by Northern blot analysis, suggesting lower expression levels of PSS-III mRNA in this brain area. In addition, PSS-III mRNA was detected in the olfactory bulbs by both RT-PCR and Northern blot analysis, whereas mRNAs for PSS-I and PSS-II were not detected in this brain area. Interestingly, goldfish PSS-I mRNA, which encodes SRIF-14, was also detected in the pituitary using Northern blot analysis. The presence of SRIF mRNA in the pituitary suggests a paracrine function of SRIF-14.

In a previous study, seasonal variations in circulating levels of GH in the goldfish have been observed with highest mean daily serum GH levels in June and the lowest levels in November (60). The seasonal variation in body growth rates correlates in part with the seasonal cycle in serum GH levels (60). The brain and pituitary content of immunoreactive SRIF-14 measured by RIA using antiserum against SRIF-14 was shown to vary on a seasonal basis inverse to the seasonal variation in the levels of serum GH in goldfish (36), with highest levels of immunoreactive SRIF-14 in telencephalon, hypothalamus, and thalamus-midbrain at November and the lowest levels of immunoreactive SRIF in the same brain regions at June and July. These results suggest that the seasonal variations in GH reflect changes in the intensity of the SRIF inhibitory tone. In the present study, seasonal variations of the levels of three SRIF mRNAs were observed, with differential patterns and sexual differences. Goldfish PSS-II and PSS-III mRNAs levels are highest for both males and females in late July in sexually regressed fish, and lower in April in sexually mature fish. Therefore, the seasonal variations in PSS-II and PSS-III mRNA levels are not closely correlated with the seasonal variations in GH levels and immunoreactive SRIF-14 levels from the previous studies (36, 60). However, the seasonal variations in PSS-I mRNA in female fish were closely correlated with the seasonal variations in GH levels and immunoreactive SRIF levels from the previous studies (36, 60), with higher PSS-I mRNA levels in sexually mature fish in April and in sexually recrudescent fish in December and lower levels in sexually regressed fish in July. These results suggest that PSS-I mRNA, which encodes SRIF-14, is potentially involved in the control of seasonal variations in serum GH levels. On the other hand, the present results do not demonstrate a significant seasonal variation in PSS-I mRNA in the forebrain of male fish, suggesting that SRIF-14 is not involved directly in controlling the seasonal GH cycle in male fish. These differences between males and females in brain PSS-I mRNA expression patterns implicate sex steroids in the modulation of PSS-I mRNA expression in goldfish. Indeed, our recent studies (unpublished observations) have shown that brain PSS-I mRNA levels are affected by estradiol but not by testosterone.

In summary, three SRIF cDNAs were characterized from goldfish brain. The cDNAs encode three distinct PSSs, which potentially yield SRIF-14, SRIF-28 with [Glu1, Tyr7, Gly10]SRIF-14 at its C-terminus, and [Pro2]SRIF-14, respectively. The brain distribution of the three SRIF mRNAs were differential but overlapping in the telencephalon, hypothalamus and optic tectum-thalamus regions. Seasonal variations in the levels of the three mRNAs were observed, with differential patterns between the three mRNAs and differences between sexes. The putative SRIF-14 variant, [Pro2]SRIF-14, inhibited basal goldfish pituitary GH secretion, with similar potency to SRIF-14; [Pro2]SRIF-14 also inhibited stimulated GH release, supporting that [Pro2]SRIF-14 is a biologically active form of SRIF in goldfish.


    Acknowledgments
 
We acknowledge Dr. H. R. Habibi for providing goldfish brain cDNA library and goldfish {alpha}-tubulin clone. We thank Carol Nahorniak, Gary Ritzel, Eugene Chomey, and Pierre Peyon for their assistance.


    Footnotes
 
1 This research was supported by Grant A-6371 from the Natural Sciences and Engineering Research Council of Canada (NSERC) to R. E. Peter. Back

Received October 28, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Brazeau P, Vale WW, Burgus R, Ling N, Butcher M, Rivier J, Guillemin R 1973 Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone. Science 179:77–79[Abstract/Free Full Text]
  2. Reisine T, Bell GI 1995 Molecular biology of somatostatin receptors. Endocr Rev 16:427–442[Abstract/Free Full Text]
  3. Reisine T 1995 Somatostatin. Cell Mol Neurobiol 15:597–614[CrossRef][Medline]
  4. Patel YC, Srikant CB 1998 Somatostatin receptors. Trends Endocrinol Metab 8:398–405
  5. Conlon JM, Tostivint H, Vaudry H 1997 Somatostatin- and urotensin II-related peptides: molecular diversity and evolutionary perspectives. Regul Pept 69:95–103[CrossRef][Medline]
  6. Conlon JM 1990 Somatostatin: aspects of molecular evolution. In: Epple A, Scanes CG, Stetson MH (eds) Progress in Comparative Endocrinology. Wiley-Liss, New York, pp 10–15
  7. Andrews PC, Pollock HG, Elliott WM, Youson JH, Plisetskaya EM 1988 Isolation and characterization of a variant somatostatin-14 and two related somatostatins of 34 and 37 residues from lamprey (Petromyzon marinus). J Biol Chem 263:15809–15814[Abstract/Free Full Text]
  8. Conlon JM 1990 [Ser5]-somatostatin-14: isolation from the pancreas of a holocephalan fish, the Pacific ratfish (Hydrolagus colliei). Gen Comp Endocrinol 80: 314–320
  9. Vaudry H, Chartrel N, Conlon JM 1992 Isolation of [Pro2, Met13] somatostatin-14 and somatostatin-14 from the frog brain reveals the existence of a somatostatin gene family in a tetrapod. Biochem Biophys Res Commun 188:477–482[CrossRef][Medline]
  10. Nishii M, Moverus B, Bukovskaya OS, Takahashi A, Kawauchi H 1995 Isolation and characterization of [Pro2]somatostatin-14 and melanotropins from Russian sturgeon, Acipenser gueldenstaedti Brandt. Gen Comp Endocrinol 99:6–12[CrossRef][Medline]
  11. Shen L-P, Pictet RL, Rutter WJ 1982 Human somatostatin. I. Sequence of the cDNA. Proc Natl Acad Sci USA 79:4575–4579[Abstract/Free Full Text]
  12. Funckes CL, Minth CD, Deschenes R, Magazin M, Tavianini MA, Sheets M, Collier K, Weith HL, Aron DL, Roos BA, Dixon JE 1983 Cloning and characterization of a mRNA encoding rat preprosomatostatin. J Biol Chem 258:8781–8787[Abstract/Free Full Text]
  13. Su C-J, White JW, Li W-H, Luo C-C, Frazier ML, Saunders GF, Chan L 1988 Structure and evolution of somatostatin genes. Mol Endocrinol 2:109–216
  14. Travis GH, Sutcliffe JG 1988 Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs. Proc Natl Acad Sci USA 85:1696–1700[Abstract/Free Full Text]
  15. Nat K, Kobayashi T, Karahashi K, Kato S, Yamamoto H, Yonekura H, Okamoto H 1991 Nucleotide sequence determination of chicken somatostatin precursor cDNA. DDJB, EMBL and GenBank Nucleotide Sequence Databases, accession number X60191
  16. Tostivint H, Lihrmann I, Bucharles C, Vieau D, Coulouarn Y, Fournier A, Conlon JM, Vaudry H 1996 Occurrence of two somatostatin variants in the frog brain: characterization of the cDNAs, distribution of the mRNAs, and receptor-binding affinities of the peptides. Proc Natl Acad Sci USA 93:12605–12610[Abstract/Free Full Text]
  17. Goodman RH, Jacobs JW, Chin WW, Lund PK, Dee PC, Habener JF 1980 Nucleotide sequence of a cloned structural gene coding for a precursor of pancreatic somatostatin. Proc Natl Acad Sci USA 77:5869–5873[Abstract/Free Full Text]
  18. Hobart P, Crawford R, Shen LP, Pictet R, Rutte WJ 1980 Cloning and sequence analysis of cDNAs encoding two distinct somatostatin precursors found in the endocrine pancreas of anglerfish. Nature 288:137–141[CrossRef][Medline]
  19. Minth CD, Taylor WL, Magazin M, Tavianin MA, Collier K, Weith HL, Dixon JE 1982 The structure of cloned DNA complementary to catfish pancreatic somatostatin-14 messenger RNA. J Biol Chem 257:10372–10377[Abstract/Free Full Text]
  20. Montminy MR, Goodman RH, Horovitch SJ, Habener JF 1984 Primary structure of the gene encoding rat preprosomatostatin. Proc Natl Acad Sci USA 81:3337–3340[Abstract/Free Full Text]
  21. Shen L, Rutter WJ 1984 Sequence of the human somatostatin I gene. Science 224:168–171[Abstract/Free Full Text]
  22. Fuhrmann G, Heilig R, Kempf J, Ebel A 1990 Nucleotide sequence of the mouse preprosomatostatin gene. Nucleic Acids Res 18:5
  23. Moore CA, Kittilson JD, Dahl SK, Sheridan MA 1995 Isolation and characterization of a cDNA encoding for preprosomatostatin containing [Tyr7 Gly10]-somatostatin-14 from the endocrine pancreas of rainbow trout, Oncorhynchus mykiss. Gen Comp Endocrinol 98:253–261[CrossRef][Medline]
  24. Conlon JM, Davis MS, Falkmer S, Thim L 1987 Structural characterization of peptides derived from prosomatostatins I and II from the pancreatic islets of two species of teleostean fish: the daddy sculpin and the flounder. Eur J Biochem 168:647–652[Medline]
  25. Conlon JM, Deacon CF, Hazon N, Henderson IW, Thim L 1988 Somatostatin-related and glucagon-related peptides with unusual structural features from the European eel (Anguilla anguilla). Gen Comp Endocrinol 72:181–189[CrossRef][Medline]
  26. Plisetskaya EM, Pollock HG, Roose JB, Hamilton JW, Kimmel JR, Andrews PC, Gorbman A 1986 Characterization of coho salmon (Oncorhynchus kisutch) islet somatostatins. Gen Comp Endocrinol 63:252–263[CrossRef][Medline]
  27. Uesaka T, Yano K, Yamasaki M, Ando M 1995 Somatostatin-, vasoactive intestinal peptide-, and granulin-like peptides isolated from intestinal extracts of goldfish, Carassius auratus. Gen Comp Endocrinol 99:187–306
  28. de Lecea L, Criado JR, Prospero O, Gautvik KM, Schweitzer P, Danielson PE, Dunlop CM, Siggins GR, Henriksen SJ, Sutcliffe JG 1996 A cortical neuropeptide with neuronal depressant and sleep-modulating properties. Nature 381:242–245[CrossRef][Medline]
  29. de Lecea L, Ruiz-Lozano P, Danielson PE, Peelle-Kirley J, Foye PE, Frankel WN, Sutcliffe JG 1997 Cloning, mRNA expression, and chromosomal mapping of mouse and human preprocortistatin. Genomics 42:499–506[CrossRef][Medline]
  30. Fukusumi S, Kitada C, Takekawa S, Kizawa H, Sakamoto J, Miyamoto M, Hinuma S, Kitano K, Fujino M 1997 Identification and characterization of a novel human cortistatin-like peptide. Biochem Biophys Res Commun 232:157–163[CrossRef][Medline]
  31. Plisetskaya EM, Duguay SJ 1993 Pancreatic hormones and metabolism in ectotherm vertebrates: current views. In: Schreibman MP, Scanes CG, Pang PKT (eds) The Endocrinology of Growth, Development, and Metabolism in Vertebrates. Academic Press, New York, pp 265–287
  32. Sheridan MA 1994 Regulation of lipid metabolism in poikilothermic vertebrates. Comp Biochem Physiol B107:495–508
  33. Peng C, Peter RE 1997 Neuroendocrine regulation of growth hormone secretion and growth in fish. Zool Stud 36:79–89
  34. de Olivier K, Chambolle P, Dubourg P, Dubois MP 1982 Immunocytochemical distribution of somatostatin in the forebrain of two teleosts, the goldfish (Carassius auratus) and Gambusia sp. C R Acad Sci III 294:519–524
  35. Pickavance LC, Staines WA, Fryer JN 1992 Distributions and colocalization of neuropeptide Y and somatostatin in the goldfish brain. J Chem Neuroanat 5:221–233[CrossRef][Medline]
  36. Marchant TA, Dulka JG, Peter RE 1989 Relationship between serum growth hormone levels and the brain and pituitary content of immunoreactive somatostatin in the goldfish, Carasius auratus L. Gen Comp Endocrinol 73:458–468[CrossRef][Medline]
  37. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidunium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:1556–1559
  38. Whitehead TP, Thorpe GHG, Carter TJN, Groucutt C, Kricka LJ 1983 Enhanced luminescence procedure for sensitive determination of peroxidase-labelled conjugates in immunoassay. Nature 305:185–186
  39. Frohman MA, Dush MK, Martin GR 1988 Rapid production of full-length cDNA from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA 85:8998–9002[Abstract/Free Full Text]
  40. Lin XW, Peter RE 1996 Expression of salmon gonadotropin-releasing hormone (GnRH) and chicken GnRH-II precursor messenger ribonucleic acids in the brain and ovary of goldfish. Gen Comp Endocrinol 101:282–296[CrossRef][Medline]
  41. Lin XW, Peter RE 1997 Goldfish {gamma}-preprotachykinin mRNA encodes the neruopeptides substance P, carassin, and neurokinin A. Peptides 18:817–824[CrossRef][Medline]
  42. Church GM, Gilbert W 1984 Genomic sequencing. Proc Natl Acad Sci USA 81:1991–1995[Abstract/Free Full Text]
  43. Marchant TA, Chang JP, Nahorniak CS, Peter RE 1989 Evidence that gonadotropin-releasing hormone also functions as a growth hormone-releasing factor in the goldfish. Endocrinology 124:2509–2218[Abstract/Free Full Text]
  44. Wong AL, Chang JP, Peter RE 1992 Dopamine stimulates growth hormone release from the pituitary of goldfish, Carassius auratus, through the dopamine D1 receptors. Endocrinology 130:1201–1210[Abstract/Free Full Text]
  45. De Lean A, Munson PJ, Rodbard D 1978 Simultaneous analysis of families of sigmoidal curves: application to bioassay, radioligand assay and physiological dose-response curves. Am J Physiol 235:E97–E102
  46. Perlman D, Halvorson HO 1983 A putative signal peptidase recognition site and sequence in eukaryotic and prokaryotic signal peptides. J Mol Biol 167:391–409[CrossRef][Medline]
  47. Douglass J, Civelli O, Herbert E 1984 Polyprotein gene expression: generation of diversity of neuroendocrine peptides. Annu Rev Biochem 53:665–715[CrossRef][Medline]
  48. Benoit R, Bohlen P, Ling N, Briskin A, Esch F, Brazeau P, Ying S-Y, Guillemin R 1982 Presence of somatostatin-28-(1–12) in hypothalamus and pancreas. Proc Natl Acad Sci USA 79:917–921[Abstract/Free Full Text]
  49. Conlon JM, McCarthy DM 1984 Fragments of prosomatostatin isolated from a human pancreatic tumour. Mol Cell Endocrinol 38:87–86[CrossRef][Medline]
  50. Noe BC, Andrews PC, Dixon JE, Spiess J 1986 Cotranslational and posttranslational proteolytic processing of different (pre)prosomatostatins in intact islet tissue. J Cell Biol 103:1205–1211[Abstract/Free Full Text]
  51. Andrews PC, Dixon JE 1981 Isolation and structure of a peptide hormone predicted from a mRNA sequence: a second somatostatin from the catfish pancreas. J Biol Chem 256:8267–8270[Abstract/Free Full Text]
  52. Wang Y, Youson JH, Conlon JM 1993 Prosomatostatin-I is processed to somatostatin-26 and somatostatin-14 in the pancreas of the bowfin, Amia calva. Regul Pept 47:33–39[CrossRef][Medline]
  53. Andrews PC, Dixon JE 1987 Isolation of products and intermediates of pancreatic prosomatostatin processing: using of fast atom bombardment mass spectrometry as an aid in analysis of prohormone processing. Biochemistry 26:4853–4861[CrossRef][Medline]
  54. Andrews PC, Nicholas R, Dixon JE 1987 Post-translational processing of preprosomatostatin-II examined using fast atom bombardment mass spectrometry. J Biol Chem 262:12692–12699[Abstract/Free Full Text]
  55. Morel A, Chang JY, Cohen P 1984 The complete amino acid sequence of anglerfish somatostatin-28. II. A new octacosapeptide containing the (Tyr7, Gly10) derivative of somatostatin-14I. FEBS Lett 175:21–24[CrossRef][Medline]
  56. McDonald JK, Greiner F, Bauer GE, Elde RP, Noe BD 1987 Separate cell types that express two different forms of somatostatin in anglerfish islets can be immunohistochemically differentiated. J Histochem Cytochem 35:155–162[Abstract]
  57. Sevarino KA, Stork P, Ventimeglia R, Mandel G, Goodman RH 1989 Processing and intracellular sorting of anglerfish and rat preprosomatostatins in mammalian endocrine cells. Cell 57:11–19[CrossRef][Medline]
  58. Peter RE, Fryer JN 1983 Endocrine functions of the hypothalamus of Actinopterygians. In: Davis RE, Northcutt RG (eds) Fish Neurobiology. The University of Michigan Press, Ann Arbor, vol 2:165–201
  59. Jeandel L, Okuno A, Kobayashi T, Kikuyama S, Tostivint H, Lihrmann I, Chartrel N, Conlon JM, Fournier A, Tonon MC, Vaudry H 1998 Effects of the two somatostatin variants somatostatin-14 and [Pro2, Met13]somatostatin-14 on receptor binding, adenylyl cyclase activity and growth hormone release from the frog pituitary. J Neuroendocrinol 10:187–192[CrossRef][Medline]
  60. Marchant TA, Peter RE 1986 Seasonal variations in body growth rates and circulating levels of growth hormone in the goldfish, Carassius auratus. J Exp Zool 237:231–239[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. F. Canosa, N. Stacey, and R. E. Peter
Changes in brain mRNA levels of gonadotropin-releasing hormone, pituitary adenylate cyclase activating polypeptide, and somatostatin during ovulatory luteinizing hormone and growth hormone surges in goldfish
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1815 - R1821.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Tostivint, L. Joly, I. Lihrmann, C. Parmentier, A. Lebon, M. Morisson, A. Calas, M. Ekker, and H. Vaudry
Comparative genomics provides evidence for close evolutionary relationships between the urotensin II and somatostatin gene families
PNAS, February 14, 2006; 103(7): 2237 - 2242.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. F. Canosa, S. Unniappan, and R. E. Peter
Periprandial changes in growth hormone release in goldfish: role of somatostatin, ghrelin, and gastrin-releasing peptide
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2005; 289(1): R125 - R133.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
H. Tostivint, L. Joly, I. Lihrmann, M. Ekker, and H. Vaudry
Chromosomal localization of three somatostatin genes in zebrafish. Evidence that the [Pro2]-somatostatin-14 isoform and cortistatin are encoded by orthologous genes
J. Mol. Endocrinol., December 1, 2004; 33(3): R1 - R8.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. K. Yunker, S. Smith, C. Graves, P. J. Davis, S. Unniappan, J. E. Rivier, R. E. Peter, and J. P. Chang
Endogenous Hypothalamic Somatostatins Differentially Regulate Growth Hormone Secretion from Goldfish Pituitary Somatotropes in Vitro
Endocrinology, September 1, 2003; 144(9): 4031 - 4041.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Tostivint, D. Vieau, N. Chartrel, I. Boutelet, L. Galas, A. Fournier, I. Lihrmann, and H. Vaudry
Expression and Processing of the [Pro2,Met13]Somatostatin-14 Precursor in the Intermediate Lobe of the Frog Pituitary
Endocrinology, September 1, 2002; 143(9): 3472 - 3481.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. C. Holloway, G. T. Melroe, M. M. Ehrman, P. K. Reddy, J. F. Leatherland, and M. A. Sheridan
Effect of 17beta -estradiol on the expression of somatostatin genes in rainbow trout (Oncorhynchus mykiss)
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2000; 279(2): R389 - R393.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
M. A. Sheridan, J. D. Kittilson, and B. J. Slagter
Structure-Function Relationships of the Signaling System for the Somatostatin Peptide Hormone Family
Integr. Comp. Biol., April 1, 2000; 40(2): 269 - 286.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. A. Moore, J. D. Kittilson, M. M. Ehrman, and M. A. Sheridan
Rainbow trout (Oncorhynchus mykiss) possess two somatostatin mRNAs that are differentially expressed
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 1999; 277(6): R1553 - R1561.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Lin, J. A. Janovick, S. Brothers, P. M. Conn, and R. E. Peter
Molecular Cloning and Expression of Two Type One Somatostatin Receptors in Goldfish Brain
Endocrinology, November 1, 1999; 140(11): 5211 - 5219.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, X.
Right arrow Articles by Peter, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, X.
Right arrow Articles by Peter, R. E.
Right arrowPubmed/NCBI databases
*Protein
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals