help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoare, S.
Right arrow Articles by Soloff, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoare, S.
Right arrow Articles by Soloff, M. S.
Endocrinology Vol. 140, No. 5 2268-2279
Copyright © 1999 by The Endocrine Society


ARTICLES

Identification of a GABP{alpha}/ß Binding Site Involved in the Induction of Oxytocin Receptor Gene Expression in Human Breast Cells. Potentiation by c-Fos/c-Jun1

Sarasija Hoare, John A. Copland, Thomas G. Wood, Yow-Jiun Jeng, Michael G. Izban and Melvyn S. Soloff

Department of Obstetrics and Gynecology (S.H., J.A.C., Y.-J.J., M.G.I., M.S.S.), and the Sealy Center for Molecular Science (T.G.W., M.G.I., M.S.S.), University of Texas Medical Branch, Galveston, Texas 77555-1062

Address all correspondence and requests for reprints to: Dr. Melvyn S. Soloff, Department of Obstetrics and Gynecology, University of Texas Medical Branch, 301 University Boulevard, Galveston, Texas 77555-1062. E-mail: msoloff{at}utmb.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oxytocin (OT) receptors (OTRs) mediate reproductive functions, including the initiation of labor and milk ejection. OTR messenger RNA levels are highly regulated, reaching the greatest concentration in the uterus at the end of gestation, and in the mammary gland during lactation. Factors directly effecting changes in OTR gene expression in the mammary gland are not known, so the present studies were done to elucidate possible regulators by characterizing the human OTR gene promoter and 5'-flanking sequence. By analyzing expression of promoter-luciferase constructs, we localized a region between -85 and -65 that was required for both basal and serum-induced expression in a mammary tumor cell line (Hs578T) that expresses inducible, endogenous OTRs. This DNA region contains an ets family target sequence (5'-GGA-3'), and a CRE/AP-1-like motif. The specific Ets factor binding to the OTR promoter was identified, by electrophoretic mobility immunoshift assays, to be GABP{alpha}/ß. Cotransfection of a -85 OTR/luciferase construct with vectors expressing GABP{alpha} and GABPß1 had only a modest effect on expression, but cotransfection with GABP{alpha}/ß- with c-Fos/c-Jun-expressing plasmids resulted in an increase of almost 10-fold in luciferase activity. Mutation of either the GABP- or CRE-like binding sites obliterated the induction. These findings are consistent with the involvement of protein kinase C activity in serum induction of the endogenous gene in Hs578T cells. We showed the requirement for GABP{alpha} and c-Fos/c-Jun in endogenous OTR gene expression, using oligonucleotide GABP and AP-1 binding decoys to inhibit serum-induced increases in 125I-labeled OT antagonist binding to Hs578T cells. Our work is the first characterization of the proximal promoter region of the human OTR gene, and it sets the stage for studying regulation of OTR expression in breast cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE OXYTOCIN (OT) receptor (OTR) is a G protein-coupled receptor, located on the plasma membrane of myometrial and endometrial/decidual cells of the uterus and of myoepithelial cells of the mammary gland. The binding of OT to its receptor leads to activation of signal pathways that stimulate contraction of uterine smooth muscle and mammary myoepithelial cells and PG release from endometrial/decidual cells of the uterus. Up-regulation of OTR concentrations occurs in all three tissues and is vital for the initiation of labor (1) milk ejection from the mammary gland (2, 3) and regulation of the length of the estrous cycle (4), respectively. The concentration of OTR binding sites in the human uterus increases about 150-fold by the end of pregnancy (5), and these changes are a reflection of increased OTR messenger RNA (mRNA) levels (6). Although steady-state mRNA levels have been shown to increase in several OT target tissues, it has been shown only recently that up-regulation of OTR in rabbit amnion cells in primary culture is the result of transcriptional activation (7). There have been extensive studies on factors regulating OTR concentrations in uterine smooth muscle and amnion in laboratory species (8, 9, 10), but very little is known about the regulation of OTR mRNA levels in the mammary gland. Uterine OTR concentrations are up-regulated by estrogen (10, 11), and progesterone treatment inhibits the estrogen effect in rats (11). In contrast, OTR concentrations in rabbit amnion cells are up-regulated by agents that elevate intracellular cAMP concentrations and by glucocorticoids (7). The concentrations of OTR in the mammary gland are relatively low at the end of parturition, when uterine and amnion receptor concentrations are greatest, but increase to maximal levels during lactation in the rat (12). Because the temporal pattern of OTR expression differs between the mammary gland and uterus or amnion, it would seem that the mammary receptors are regulated differently than uterine/amnion receptors. We recently demonstrated that a human carcinosarcoma cell line (Hs578T) expresses OTRs that are up-regulated by dextran-coated charcoal-treated FBS (DCC-FBS) (13). Up-regulation was inhibited by pretreatment with the protein kinase C (PKC) inhibitor, GF 109203X (13), indicating the possible involvement of AP-1 proteins. Because OTRs are not universally expressed and are regulated according to reproductive stage, it would seem that the OTR gene has important regulatory and/or enhancer elements. To better understand OTR regulation in breast cells, we cloned the human OTR gene and expressed constructs containing the promoter region fused to luciferase in Hs578T cells.

The human OTR gene spans approximately 19 kbp and is divided into four exons and three introns (Ref. 14 and the present studies). Only a single OTR gene has been demonstrated in several species (14, 15, 16). We have shown in the present studies that the human OTR gene contains both a TATAA-like box and initiator element (Inr). We also have defined an Ets binding site (EBS) region in the upstream promoter that is absolutely essential for both basal and serum-induced expression of the OTR gene, and we have characterized ets gene family proteins binding to this site as GABP{alpha}/ß. In addition, AP-1 expression plasmids synergize with GABP{alpha}/ß in inducing OTR gene expression. These studies thus give us the first clues as to how the human OTR gene is induced in mammary cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Library construction and screening
Construction of the human genomic library used in isolating the OTR gene was previously described (17). The library was screened using a PCR-generated complementary DNA (cDNA) probe containing the terminal 320 bp of the OTR open reading frame and 70 bp of the adjacent 3' nontranslated sequence.

DNA sequence analysis
DNA sequencing was performed using a cycle sequencing protocol and AmpliTaq DNA polymerase (Perkin-Elmer Corp., Norwalk, CT). Sequence analysis was done using a model 373A DNA sequence analyzer (Perkin-Elmer Applied Biosystems, Foster City, CA).

Extended-length PCR
Extended-length PCR (18) was performed using 50 ng human genomic DNA and primers derived from the 3' end of exon 3 (5'AGCGTCAAGCTCATCTCCAAGGCC 3') and the 5' end of exon 4 (5' TCTGCCCTTCAGGTAGCTGGCGG 3'). The amplification reaction (100 µl) contained 50 pmol of each primer and 1 U of a 50:1 mix of rTth DNA polymerase (Perkin-Elmer Corp.) and Vent DNA polymerase (New England Biolabs, Inc., Beverly, MA). The amplified DNA was cloned using a pCRII vector (Invitrogen, Carlsbad, CA) and was subjected to restriction and DNA sequence analysis.

Ribonuclease (RNase) protection assay
The RNA probe used in the RNase protection studies was synthesized using a plasmid template DNA derived from the human OTR genomic clone, p8–1. A 491-bp DNA fragment, containing 355 bp of sequence derived from the 5' end of exon 1 and 124 bp of adjacent 5' flanking sequence, was PCR-amplified and cloned into pSP73. Purified plasmid was linearized by digestion with EcoRI (New England Biolabs, Inc.), and antisense transcripts were labeled in vitro using {alpha}-32P-cytidine 5'-triphosphate (800 Ci/mmol) and T7 RNA polymerase (Ambion, Inc., Austin, TX). Total RNA was isolated (19) from human myometrium obtained at term for medical reasons and was ethanol-precipitated in increasing amounts with the OTR antisense probe (1.4 x 105 cpm). DNA samples were analyzed by electrophoresis on 5% acrylamide, 8 M urea gels.

Primer extension analysis
A 26-nucleotide oligomer complementary to the region between positions +95 to +120 in exon 1 was end-labeled (6 x 108 dpm/µg) using T4 polynucleotide kinase (New England Biolabs, Inc.) and [32P]{gamma}-ATP (DuPont NEN, Boston, MA) 3000 Ci/mmol. Primer was annealed to human myometrial total RNA (50 µg), extended with murine leukemia virus reverse transcriptase, and the extended products were analyzed on a 6% acrylamide, 8 M urea gel in parallel with chain termination sequencing reactions performed using the above primer and a segment of human genomic DNA containing the OTR exon 1 and adjacent 5' flanking region.

Plasmid constructions
Insert DNAs from the {lambda} genomic clones ({lambda}8–1, {lambda}6–1) were subcloned as SalI DNA fragments into pUC18, creating plasmids p8–1 and p6–1. A 7.8-kb EcoRI DNA fragment, containing the first three exons of the human OTR gene and 2.9 kb of 5' flanking sequence, was isolated from p8–1, subcloned into pUC18, and designated p1500. A unique HincII site within exon 1 was used in isolating a 2.2-kbp SstI-HincII DNA fragment from p1500. This DNA fragment was subcloned into pBluescript II SK- (SstI-EcoRV). The HindIII site next to the EcoRV site in the pBluescript polylinker was used in isolating an SstI-HindIII DNA fragment. This DNA was cloned into pGL2-Basic (Promega Corp., Madison, WI) to create p-1770. A 2.3-kbp SalI-SstI DNA fragment derived from p8–1 was introduced into p-1770 (XhoI/SstI) to generate p-4225. A unique NdeI site within the 5' flanking sequence was used to isolate a 1.3-kbp NdeI-HindIII DNA fragment. This DNA was cloned into pGL2-Basic (SstI/HindIII) using a SstI-NdeI linker to generate p-992. The linker also contained a unique BglII site. Digestion of p-992 with BglII, followed by treatment with Klenow polymerase and digestion with EcoRV, resulted in the deletion of 235 bp and created the 5' flanking sequence for p-757. Digestion of p-992 with BglII and NsiI, and subsequent treatment with T4 DNA polymerase, resulted in a deletion of 356 bp and generated the 5' flank sequence for p-636. SstI-HindIII digests were used in isolating the 5' flank sequences for p-861 and p-118. BamHI-HindIII digests were used in p-145. PCR was used to create the other 5'-deletion constructs. Sense primers were paired with the antisense HindIII primer 5'AAGCTTGATGACTCCCCCCGGGGAAGTTGC 3', which terminates at +350.

Site-specific mutations were created in PCR primers, by the method of Higuchi et al. (20). To construct vectors containing the -4225/+1357 sequence, a 2.4-kbp BamHI fragment, containing exons 1, 2, and 78 bp of the noncoding region of exon 3, was isolated from p1500. Blunt ends were created using Klenow polymerase, HindIII linkers were ligated, and the DNA was digested with HindIII and EcoRV. This DNA and a 3.25-kb SalI-EcoRV DNA fragment, containing the 5' sequence of the OTR gene derived from p8–1, were ligated and cloned into pGL2-Basic that was linearized with HindIII-XhoI. All plasmid DNAs were purified by CsCl density gradient centrifugation before use in DNA transfection assays. Rous sarcoma virus-chloramphenicol acetyltransferase (RSV-CAT) was identical to the sequence reported by Gorman et al. (21). The CMV-GABP{alpha} and CMV-GABPß1 expression vectors were gifts from Dr. Catherine Thompson (Neuroscience/Kennedy Krieger Institute, Johns Hopkins University School of Medicine, Baltimore, MD). GABP{alpha} and GABPß1 plasmids were gifts from Drs. Thomas Brown, Pfizer, Inc. (Groton, CT), and Dr. Steven McKnight (Tularik, Inc., South San Francisco, CA).

Transfection and cell culture
A human breast ductal carcinoma cell line Hs578T (22) was obtained from the American type culture collection (Manassas, VA). Cells were maintained in DMEM supplemented with 5% FBS and penicillin/streptomycin and were cultured in an atmosphere of 5% CO2. Transient transfections were done by calcium phosphate coprecipitation in triplicate 60-mm plates, using 10 µg OTR promoter-luciferase reporter vector, 0.5 µg RSV-CAT (control for uniformity of transfection efficiency), and 9.5 µg carrier pGEM7Z plasmid DNA for each triplicate set of plates. Twenty-four hours after transfection, cells were rinsed, and fresh medium was added. Cells were cultured for an additional 24 h and harvested for analysis of reporter activities. Serum induction studies were carried out with DCC-treated FBS, 20% (13). The experiments were done with three different plasmid preparations of each construct.

Reporter assays
Cells were rinsed three times with PBS and lysed in place with 0.3 ml of detergent solution [25 mM Tris-phosphate (pH 7.8), 2 mM dithiothreitol, 2 mM 1,2-diaminocyclohexane-N,N,N,N-tetracetic acid, 10% glycerol, and 1% Triton X-100]. Luciferase activity was determined using an AutoLumat luminometer, and the activity of each sample was normalized relative to CAT activity. CAT activity was determined using the enzyme-linked immunosorbent assay kit and protocol described by Boehringer Mannheim (Indianapolis, IN).

Deoxyribonuclease (DNase) I footprinting
Nuclear extracts from Hs578T cells were prepared by a modification of the method of Shapiro et al. (23), after purification of the nuclei by sucrose density gradient centrifugation. The plasmid used for DNase I protection was constructed by inserting a SmaI (-147)/HaeIII (+56) fragment of the OTR gene into the SmaI site of pUC18. Inserts in both orientations were selected. The plasmid was linearized by digestion with EcoRI, labeled by filling in the 5'-overhangs using [32P]{alpha}-deoxy-ATP and the Klenow fragment of DNA polymerase, and the insert excised by digestion with HindIII. Labeled DNA was separated from plasmid vector on 5% polyacrylamide gels. Increasing amounts of nuclear protein (see figure legends) were incubated with 1 µg poly(dI-dC)/poly(dI-dC) (Pharmacia LKB, Piscataway, NJ) for 20 min on ice before the addition of approximately 1 ng of labeled DNA. The mixtures were incubated for 60 min on ice, then digested for 1 min with optimal amounts of DNase I. DNA from the digested samples was resolved on a 7% polyacrylamide-urea gel.

Electrophoretic mobility shift assays (EMSA)
Synthetic oligonucleotides corresponding to the regions outlined in the text were annealed with complementary sequences and end-labeled with [{gamma}-32P]ATP and T4 polynucleotide kinase (Promega Corp.). The EMSA were performed by incubating 10 µg of nuclear protein, described above, with about 1 ng of labeled probe. In competition studies, nonradioactive competitor oligonucleotides were incubated with nuclear protein extract for 10 min at room temperature before addition of the probe. Samples were loaded onto a Tris-glycine (pH 8.5), EDTA 4% nondenaturing polyacrylamide gel (40:1 acrylamide:BIS). Radioactivity on dried gels was visualized by autoradiography using Kodak XAR-5 film (Eastman Kodak Co., Rochester, NY). The consensus binding site oligonucleotides for Sp1, CRE, PU.1/GABP{alpha}, and Ets-1/PEA3 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). In antibody supershift assays, antibodies were incubated with nuclear extracts for 20 min at room temperature before addition of radiolabeled oligonucleotide. Rabbit polyclonal IgG, directed against Ets-1/Ets-2, was purchased from Santa Cruz Biotechnology, Inc.. Rabbit polyclonal antibodies, directed against recombinant GABP{alpha} and GABPß1, were gifts from Dr. Thomas Brown and Dr. Steven McKnight.

Oligonucleotide decoy inhibition of serum-induction of [125I]OTA (OT antagonist) binding sites
Hs578T cells were serum starved for 48 h in 0.5% BSA/DMEM, containing antibiotics. Double-stranded oligonucleotides were added to the medium, either during this 48-h period or during the last 24 h, at a concentration of either 25 or 50 µM, according to the figure legends. DCC-FBS, 20%, was then added, along with 25 or 50 µM of the same oligonucleotide; and the cells were analyzed 24 h later for [125I]OTA (OTA = [d(CH2)5,Tyr(Me)2,Thr4,Tyr-NH29]ornithine vasotocin) binding sites. Specific [125I]OTA binding assays were carried out in triplicate, using a saturating or near-saturating concentration of [125I]OTA, as previously described (13). The oligonucleotides used were OTR25, OTR25M-1, -2, -3, and oligonucleotides corresponding to the consensus GABP/PU.1 site (GGG CTG CTT GAG GAA GTA TAA GAA T), mutated (bases underlined) GABP/PU.1 (GGG CTG CTT GAG AGA GTA TAA GAA T), the consensus AP-1 site (CGC TTG ATG ACT CAG CCG GAA), and mutated AP-1 (CGC TTG ATG ACT TGG CCG GAA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
OTR gene structure
To isolate the OTR gene, we screened a human genomic library (7.8 x 105 phage) using a cDNA probe representing the terminal 320 bp of the OTR open reading frame and 70 bp of adjacent 3' untranslated sequence. Ten clones were isolated, and a preliminary characterization using EcoRI and BamHI restriction analysis indicated that each clone belonged to either one of two groups. A representative clone from each group (p8–1, p6–1) was selected for detailed restriction mapping and DNA sequence analysis (Fig. 1Go). The absence of overlapping homology between the two clones prevented an accurate estimate of the size of intron 3 and a contiguous alignment of the OTR gene. To determine the size of intron 3, we performed extended-length PCR using primers corresponding to coding sequences at the 3' end of exon 3 and the 5' end of exon 4. A 13.7-kbp fragment of DNA was amplified, cloned, and characterized by partial nucleotide sequencing and by restriction mapping. This clone, pXL-3, permitted the contiguous alignment of the human OTR gene (Fig. 1Go). The gene is organized into four exons that span a total of about 19 kbp.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Physical map of the human OTR gene. Exons are represented as solid boxes for untranslated sequences and open boxes for translated sequences. A complete restriction map is presented for the following restriction endonucleases: BamHI, B; BglII, Bg; HindIII, H; KpnI, K; EcoRI, R; SmaI, S; XhoI, X. Plasmids used in determining the gene structure are shown below the genomic map.

 
Transcription start site
The location of the 5' end of exon 1 was determined by both RNase protection and primer extension analyses (Fig. 2Go). A 535-bp RNA probe representing 101 bp of the proximal 5' end of human OTR cDNA (24) and 378 bp of adjacent 5' sequence was annealed with human myometrial total RNA, digested with RNase, and analyzed by electrophoresis on a urea-polyacrylamide gel. The uterine RNA protected one major- and a minor-labeled RNA band (Fig. 2AGo, lanes 3–5). The size of the major band, about 345 nucleotides, is consistent with the previously reported transcription start site for the human OTR (14). Primer extension was performed to identify the precise nucleotide site for the initiation of transcription. The primer extension reaction products were analyzed in parallel with chain termination sequencing reactions using the analogous primer and an OTR human genomic DNA subclone containing exon 1 and adjacent 5' flanking sequences. Two start positions, which are in close positional agreement with those previously reported (14), were identified (Fig. 2BGo). For purposes of nomenclature of constructs used in transient transfection studies, we assigned the major start site (T1 on the template strand, Fig. 2Go) as position +1.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Determination of the human OTR transcription start site. A, RNase protection analysis. A 535-nucleotide probe (lane 1) was hybridized with either 50 µg yeast RNA (lane 2), or human uterine total RNA: 50 µg (lane 3), 25 µg (lane 4), or 10 µg (lane 5) before nuclease digestion (lanes 2–5). Samples were analyzed by electrophoresis on a urea-5% acrylamide gel and by autoradiography. Labeled RNA markers (lane 6) were run in parallel. B, Primer extension analysis. Products from the primer extension reaction (lane 1) were analyzed on a 6% acrylamide-urea gel. Chain termination sequencing reactions were run in parallel. Nucleotides corresponding to the sizes of the major and minor reverse transcripts are indicated by asterisks.

 
5'-Deletion analysis
Computer-assisted analysis of 1770 bp of 5'-flanking sequence of the OTR gene, which delimits the extent that was sequenced, indicated a number of potential transcriptional regulatory sites (Fig. 3Go). To define key regulatory regions in the OTR gene, luciferase activity of serial deletion mutants of the OTR 5'-flanking region (ranging from -4225 to -65) was determined. In these preliminary studies, the transfected Hs578T cells were incubated in the presence 10% FBS so that only serum-induced expression was determined. Between -4225 and -85, each deletion had only a modest effect on luciferase expression (Fig. 3Go). Luciferase activity of the deletion mutants ranged from 0.66–2.5 times that of the -4225/+350 construct. The level of expression of the -85 construct was about the same as that of the -4225 mutant. Greater luciferase activities of the -992, -861, -757, and -636 mutants, relative to the -85 or -4225 constructs, suggest the possibility of weak silencer elements upstream of -992, but this observation was not explored further in the present studies. Expression fell to about 20%, when the region between -85 and -73 was deleted, and further reduction (to values comparable with the activity of the promotorless pGL2-Basic vector) was observed when the region between -73 and -65 was deleted (Fig. 3Go). The findings therefore define a region between -85 and -65 that is critical for OTR promoter activity. To verify that this region imparts the serum inducibility seen with endogenous OTRs, transfections were carried out with -4225, -1770, -85, and -65 constructs in the presence of low serum concentration (5%). Twenty-four hours after transfection, 20% DCC-FBS was added for 24 h, and cell lysates were prepared for reporter analysis. The addition of serum caused an increase of approximately 3-fold in luciferase activity in the -4225, -1770, and -85 constructs, but the activity of the -65 construct was unchanged (Fig. 4AGo). Basal activity (in 5% DCC-FBS) was also increased in the -4225, -1770, and -85 constructs (vs. the -65 construct). Thus, the region between -85 and -65 is necessary for both basal and serum-induced expression of the OTR promoter. As shown in our previous studies, serum inducibility of the endogenous OTR was blocked by the PKC inhibitor GF 109203X (13). GF 109203X, added in increasing concentrations 30 min before addition of serum, likewise inhibited serum-induced expression from the -85 construct (Fig. 4BGo).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Effects of deletion of 5'-flanking sequence on OTR promoter activity. Sequentially deleted 5'-flanking regions of the human OTR gene were fused to a luciferase reporter and transfected into Hs578T cells. Potential regulatory elements, and deletion sites used, are indicated across the top of the figure. Luciferase values were normalized to CAT activity from a cotransfected RSV-CAT plasmid and expressed as the percent stimulation (± SE) of three replicate determinations, relative to the -4225/+350 construct. The experiment was repeated at least three times with three different plasmid preparations, with comparable results.

 


View larger version (8K):
[in this window]
[in a new window]
 
Figure 4. A, Serum induction of OTR/Luc constructs. Hs578T cells in 5% FBS were transfected with 10 µg/3 dishes (60-mm each) of the appropriate reporter construct, and with 0.5 µg/3 dishes of RSV CAT for normalization of the luciferase results. DCC-FBS, 20%, was added 24 h after transfection, and cell lysates for luciferase determination were prepared 24 h later. B, Inhibition of serum induction of luciferase expression by the -85OTR/Luc construct with increasing concentrations of PKC inhibitor, GF 109203X, added 30 min before serum induction.

 
Footprint analysis of the proximal promoter region
To further define the critical region of the human OTR promoter capable of interacting with transcription factors, we carried out DNase I footprint analysis of OTR DNA between -147 and +56 using nuclear extracts from Hs578T cells. Three sites were clearly protected on both strands (Fig. 5Go): the region containing the consensus sequence for an Inr around the transcription start site (depending on the template strand, labeled as 1 or D in Fig. 5Go); a TATA-like box (labeled 2 or C in Fig. 5Go); and an extensive region between -100 and -44 (labeled 3 and 4 or B in Fig. 5Go). An area near the -147 terminus (GAAGAACAT, labeled 5 or A in Fig. 5Go) that resembles a partial GRE (25) was also protected. The region between -100 and -44 is complex, and it includes a potential EBS with the core consensus sequence of GGA (-77 to -75), a GC box (Sp1 site at -68 to -62), and the sequence TGACGAGT (-57 to -50), which resembles a CRE octamer motif 5'-TGACGTCA-3' (25).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 5. DNase I footprinting of the region of the human OTR gene between -147 and +56. Both labeled template and nontemplate strands are shown (A). The outer lanes of each panel contained DNA to which no nuclear extract was added. Either 15, 30, or 50 µg of nuclear protein was incubated with DNA before DNase I treatment, as indicated. Protected areas on the template and nontemplate strands are identified by letter or number, respectively, and by the boxed regions in the diagram (B). Putative transcription factor recognition sites are indicated in bold letters. The transcription start site is indicated by +1.

 
Characterization of potential binding sites for transcription factors within the -85 to -65 region
The -65 deletion, which caused the sharp reduction in luciferase activity (to that of a promotorless construct) (Fig. 3Go), interrupts a Sp1 motif (GC box). In view of the ubiquity of Sp1 and its involvement in transcription initiated by many different promoters, it was important to determine whether scission of the GC box accounted for the sharp reduction in functional activity. An OTR DNA fragment, containing the putative Sp1 binding site (-95 to -53), did not compete with an authentic end-labeled Sp1 oligonucleotide for the specific band that was gel shifted by Hs578T nuclear extracts (data not shown). The end-labeled OTR oligonucleotide (-95 to -53) also failed to form Sp1-specific bands with the nuclear extracts. Sp1 binding by the -95 to -53 oligonucleotides was only apparent after addition of purified recombinant Sp1 protein (Promega Corp.), and binding was much weaker than that seen with the recombinant protein and the authentic Sp1 oligonucleotide (data not shown). The data therefore suggest that the GC-rich site in the OTR promoter is a weak Sp1-binding site. Furthermore, mutation of the Sp1 site had no effect on OTR promoter activity (see Fig. 8Go). Partial protection of the GC-rich area shown by DNase I footprinting (Fig. 5Go) might therefore be caused by proteins binding to adjacent sites.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 8. Effects of mutation of the Sp1, CRE-like, and Ets sites in the proximal promoter region of the human OTR gene on promoter-driven luciferase activity in Hs578T cells. Sp1 and CRE site mutations were constructed in the context of the -145/+351 vector. M-1, M-2, and M-3 mutations were constructed in the context of the -95/+351 vector. The data represent the mean of triplicate (± SE) determinations. The experiments were repeated at least three times.

 
Site 3 (Fig. 5Go) contains a CRE-like site (TGACG). In view of the fact that binding of transcription factors to this site might be reduced by scission of the promoter at -65, we also carried out EMSA of an oligonucleotide containing this sequence. Addition of the 32P-labeled OTR35 (-73 to -44) to Hs568T nuclear extracts resulted in the formation of a band that was competed away by both nonradioactive OTR35 and by an oligonucleotide containing a consensus CRE (Fig. 6AGo). Mutation of two bases in the putative CRE sequence of OTR35, from TGACG to TGTGG, eliminated competition with [32P]OTR35 (Fig. 6AGo). An AP-1 consensus oligonucleotide also competed with the labeled probe for protein binding (Fig. 6BGo).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. EMSA of 5'-flanking sequence between -73 and -44 of the human OTR gene and nuclear proteins from Hs578T cells. A, Competition for protein binding by the 32P-end-labeled oligonucleotide and nonradioactive oligonucleotides corresponding to self, a CRE consensus sequence, and a mutated CRE sequence; B, competition by an AP-1 consensus sequence. Competition was carried out with 50-, 100-, and 150-fold excesses of nonradioactive oligonucleotide.

 
The area corresponding to region 4 in the DNase I footprint (Fig. 5Go) and lying between -85 and -65 contains a purine-rich stretch with a core 5'-GGA-3' sequence that is characteristic of an Ets family EBS. As shown by electrophoretic mobility shift analysis, three bands were shifted using Hs578T nuclear extracts and an end-labeled oligonucleotide corresponding to the sequence between -87 and -63 (OTR25, Fig. 7AGo). All three bands were competitively reduced by addition of an excess of unlabeled OTR25 (Fig. 7AGo). An oligonucleotide containing an EBS recognized by Ets1 and PEA (two ets family members) partially competed with labeled OTR25 (Fig. 7AGo). In contrast, addition of an oligonucleotide containing a consensus-binding site for GABP{alpha} and PU.1 Ets family members completely displaced the two upper bands. The same two bands were formed when the nuclear extracts were added to a 5'-end-labeled consensus GABP{alpha}/PU.1 oligonucleotide (data not shown). To narrow the binding region, we created replacement mutants that modified the GGA of the EBS and sites both immediately up- and down-stream from the EBS in the OTR promoter. Competition, as studied by EMSA with end-labeled OTR25 and oligonucleotides that were synthesized by replacing nucleotides -74 to -71 (M-1), -79 to -75 (M-2), and -83 to -80 (M-3) (Fig. 7BGo), showed that the binding of nuclear factors by all three mutants was modified (Fig. 7CGo). The M-3 mutant failed to compete with the band having the greatest mobility; but like the wild-type OTR25, it competed with the upper two bands (Fig. 7CGo), which were also displaced by the GABP{alpha}/PU.1 oligonucleotide (Fig. 7AGo). These findings are consistent with the observation that the sequence between -80 and -83 does not correspond to a consensus GABP{alpha}/PU.1 binding site. The M-1 and M-2 mutants partially competed for all three bands, compared with the wild-type oligonucleotide (Fig. 7CGo). It therefore seems that two classes of protein complexes exist. The upper two complexes seem to contain ets family members binding to the EBS, whereas the faster migrating complex interacts with the region of the promoter that is covered by all three mutated sites.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 7. EMSA of 5'-flanking sequence between -87 and -63 of the human OTR gene and nuclear proteins from Hs578T cells. A, Competition for protein binding by the 32P-end-labeled oligonucleotide and nonradioactive oligonucleotides corresponding to self, and consensus sequences to Ets/PEA and GABP{alpha}/PU.1, using nuclear extract from Hs578T cells. Competition was carried out with 100- and 150-fold excesses of nonradioactive oligonucleotide. B, Oligonucleotides containing mutated bases in the -87 to -63 region. The EBS consensus sequence in the wild-type, 5'-GGA-3' is indicated by the boxed area. Mutated bases are underlined. C, EMSA of the mutant oligonucleotides shown in B. Competition between the mutant oligonucleotides and 32P-end-labeled wild-type oligonucleotide was carried out with nuclear extract from Hs578T cell nuclear extracts.

 
Effects of Sp1, CRE, and Ets site mutations on functional activity of the OTR promoter
A three-base substitution in the Sp1 site (GGGCGGG to ACCCGGG) in the -145 promoter construct had no effect on luciferase expression (Fig. 8Go). Mutation in the CRE-like site significantly (P < 0.05) reduced luciferase activity by about 30% (Fig. 8Go). Mutation of both Sp1 and CRE-like sites resulted in about the same activity as the CRE mutant alone (Fig. 8Go). All three mutations in the purine-rich region corresponding to M-1, -M-2, and M-3 in the context of the -95OTR/Luc construct resulted in 4- to 8-fold decreases in luciferase expression (Fig. 8Go). These results are consistent with the ability of the three mutant oligonucleotides to modify the gel shift results (Fig. 7CGo). From the functional analysis of the M-1- and M-2-linked luciferase constructs, it is clear that the EBS is critical for expression of the OTR promoter. In addition, mutation of the -83 to -80 region (M-3), which was associated with the lowest gel-shifted band and not identifiable with GABP{alpha}/PU.1. (Fig. 7CGo), also markedly reduced OTR promoter-driven luciferase activity (Fig. 8Go).

Identification of protein(s) binding to the EBS
Based on the preceding data, any of the 20 ets family members could potentially interact with the EBS. An oligonucleotide containing a specific PU-1 binding site from the SV40 enhancer did not compete with OTR25 for protein binding (data not shown). Insofar as PU.1 expression is restricted to cells of hematopoietic lineage (26), we did not consider this ets family member as a potential regulatory factor in Hs578T cells. To better define the specific factors in Hs578T nuclear extracts that bind to the EBS, we carried out immunoshift analyses using antibodies to Ets proteins. Antibody to Ets1/Ets2, which cross-reacts with a variety of Ets family members, had no effect on the EMSA pattern obtained with end-labeled OTR25 and Hs578T nuclear extracts (Fig. 9AGo). Antibodies to both GABP{alpha} and GABPß1, which (unlike any other members of the ets family) form a heteromeric complex, caused a supershift with OTR25 and Hs578T nuclear extracts (Fig. 9BGo). These findings indicate that GABP{alpha}/ß participates in the activation of OTR gene expression in Hs578T cells.



View larger version (5K):
[in this window]
[in a new window]
 
Figure 9. Identification of protein(s) binding to the EBS, using antibodies to A: Ets-1/Ets-2 (A), GABP{alpha} or GABPß1 (B). 32P-end-labeled oligonucleotide (-87 to -63) was incubated with nuclear extracts from Hs578T cells, followed by incubation with each antibody. S shows the position of the immunoshifted complexes.

 
The effect of GABP and AP-1 overexpression on OTR promoter activity
Cotransfection of -85 OTR/Luc with CMV-driven expression vectors for GABP{alpha} and GABPß1 caused a modest increase in luciferase expression in the presence of 5% FBS (Fig. 10AGo). However, expression was markedly enhanced when the cells were cotransfected with GABP{alpha} and c-Fos/c-Jun expression plasmids. Maximal responses to GABP{alpha}/ß1, and c-Fos/c-Jun were obtained with 2 µg and 5 µg, respectively (data not shown). Thus, the addition of both caused a response beyond that elicited by the maximal concentration of c-Fos/c-Jun alone. The increase in luciferase activity with the combined plasmids was approximately 8.5-fold (Fig. 10AGo). These findings are consistent with the results of studies showing that inhibition of PKC activity with GF 109203X results in reduced expression of the endogenous OTR gene (13) and of serum induction of the -85OTR/Luc construct (Fig. 4BGo). These findings also indicate that GABP{alpha}/ß affects the interaction of c-Fos/c-Jun with its DNA binding sites either directly or indirectly. Cotransfection of GABP{alpha}/ß and c-Fos/c-Jun expression vectors in pGL2 or the -65 construct had no noticeable effect on luciferase activity (Fig. 10BGo). As in the case of the -85 construct, cotransfection with the combined expression plasmids resulted in elevated luciferase expression from the -1770 and -4425 constructs (Fig. 10BGo). Luciferase activity was less in cells transfected with the -4225 plasmid than with -1770 or -85.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 10. A, Effects of GABP{alpha}, GABPß1, c-Fos, and c-Jun expression on OTR promoter activity. GABP{alpha} and GABPß1, c-Fos and c-Jun, and a combination of the four were transfected into Hs578T cells along with -85OTR/Luc and RSV CAT. The amounts of each expression plasmid transfected refer to the micrograms of DNA added to the total of three 60-mm plates. B, Induction of luciferase expression in -85, -1770, and -4225 OTR/Luc constructs (10 µg/3 plates) by cotransfection with GABP{alpha}/ß and c-Fos/c-Jun (+). Sham-transfected cells (-) were used as a control. The amount of DNA per total of three 60-mm plates is indicated. C, Cotransfection of GABP{alpha}/ß and c-Fos/c-Jun expression plasmids (+) with 10 µg/3 plates of -95OTR/Luc or -95OTR/Luc constructs containing mutated sites (M-1, -2, or -3). D, Cotransfection of GABP{alpha}/ß and c-Fos/c-Jun expression plasmids (+) with 10 µg/3 plates of -145OTR/Luc or -145OTR/Luc constructs containing mutated Sp1, CRE-like, or both Sp1 and CRE-like sites. The data in all experiments represent the mean of triplicate (± SE) determinations. The experiments were repeated at least three times.

 
These studies further show that the GABP/AP-1 regulated region lies between -85 and -65 of the OTR 5'-flanking sequence. This conclusion is supported by the results obtained with M-1, -2, and -3 constructs. Cotransfection of wild-type -95OTR/Luc with GABP/AP-1 expression plasmids resulted in an increase of approximately 8-fold in luciferase activity (Fig. 10CGo). Activity was reduced markedly with M-1 and M-2 mutant -95OTR/Luc constructs, as shown in Fig. 8Go (and Fig. 10CGo), and cotransfection with GABP/AP-1 expression plasmids resulted in an increase of only 2-fold (approximately) in luciferase activity (Fig. 10CGo). Coexpression of -95OTR/Luc with the M-3 mutation and GABP/AP-1 expression plasmids resulted in an increase of approximately 5-fold in luciferase activity (Fig. 10CGo).

Coexpression of GABP/AP-1 expression plasmids with the -145OTR/Luc construct also resulted in an increase of approximately 8-fold in luciferase activity (Fig. 10DGo). Mutation of the Sp1 site, in the context of -145OTR/Luc, still allowed an increase of approximately 6-fold (Fig. 10DGo). However, mutation of the CRE-like site alone, or the CRE-like and Sp1 sites, resulted in a reduction of approximately 50% in basal luciferase activity and the absence of any induction with GABP/AP-1 expression vectors. These results suggest that both EBS and CRE-like sites are involved in GABP/AP-1-induced OTR gene expression.

Reduction in expression of the endogenous OTR by oligonucleotide decoys
Cells were serum starved in 0.5% BSA/DMEM for 48 h and then treated with 25 µM OTR25 for 24 h before DCC-FBS (20%) stimulation. After another 24 h in the presence of oligonucleotide and serum, the cells were used to measure specific [125I]OTA binding. The addition of DCC-FBS alone resulted in a 5.6-fold increase in binding activity (Fig. 11AGo). The presence of OTR25 (25 µM), however, completely eliminated DCC-FBS-induced expression of binding activity (Fig. 11AGo). Incubation of cells with OTR25M-1, -2, or -3 (25 µM) also resulted in reduction of specific [125I]OTA binding, but the inhibition was only 39%, 21%, and 57% for OTR25M-1, OTR25M-2, and OTR25M-3, respectively (Fig. 11AGo). These findings show that mutation of the EBS (OTR25M-2) has the greatest effect on attenuating the decoy effects. Further evidence for the involvement of the EBS in serum induction of OTR gene expression in Hs578T cells is shown by the inhibition of serum induction by a GABP/PU.1 consensus oligonucleotide. Incubation of cells with 50 µM GABP/PU.1 oligonucleotide, for 24 h before serum induction and for 24 h during induction, resulted in a reduction of approximately 40% in [125I]OTA binding (Fig. 11BGo). Mutation of the consensus sequence resulted in no reduction at all (Fig. 11BGo). Incubation of cells with a consensus AP-1 oligonucleotide (50 µM) reduced [125I]OTA binding by about 45%, and mutation of the oligonucleotide also eliminated the reduction (Fig. 11BGo). The combination of GABP/PU.1 and AP.1 oligonucleotides further reduced [125I]OTA binding activity by about 70% and 75%, respectively, when either 25 µM or 50 µM of each oligonucleotide was used (Fig. 11BGo).



View larger version (8K):
[in this window]
[in a new window]
 
Figure 11. Effect of oligonucleotide decoys on [125I]OTA binding by Hs578T cells. Cells were serum-starved for 48 h in 0.5% BSA/DMEM to reduce endogenous OTR levels. Oligonucleotide decoy (25 µM) was added after the first 24 h and again at 48 h upon addition of 20% DCC-FBS. The cells were then analyzed for specific [125I]OTA binding, and the results are expressed per microgram of cell DNA. Each value is the mean ± SE. A, Decoy oligonucleotides used were OTR25, OTR25M-1, M-2, and M-3; B, decoy nucleotides were GABP/PU.1, AP-1, and mutated sequences in both oligonucleotides. The cells were treated with 50 µM decoy for 48 h, followed by another 24 h during DCC-FBS induction.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have cloned the human OTR gene and identified the promoter and upstream regulatory elements essential for transcriptional activation of the gene. The sequence organization of the OTR agrees almost entirely with that described earlier (14), except that we have been able to more accurately define the length of intron 3. An A+T-rich sequence, located about 30 bp upstream from the major transcription start site, was protected from DNase I digestion. TFIID can bind and stimulate transcription from a variety of A+T-rich sequences (27, 28), and in view of its position (relative to the start site), it is likely that the TTTTAAA sequence functions as a TATA box. An identical sequence is found about 25 bp upstream from the transcription start site in the rat connexin 43 gene, which (like the OTR gene) is selectively expressed in the uterus at term (29). Initiator proteins, which bind at the transcriptional start site, have been suggested to augment transcriptional activity of TATA box-containing promoters (30). The region surrounding the transcription start sites of the OTR promoter was protected from DNase I digestion, and the 5'-CCATTTG-3' resembles the consensus sequence of an Inr (31). The OTR gene promoter thus seems to be of the type that contains both a TATA box, albeit not a canonical one, and an Inr.

The present work has clearly shown that a critical proximal promoter element is located in the region between -85 and -65 from the major transcription initiation site. Deletion of the 5'-flanking sequence to -65 reduced the level of transcriptional activity of the OTR promoter to that of the promotorless pGL2 vector in Hs578T cells. This region confers both basal and serum-induced activity of the OTR gene. We have shown previously that the inducibility of [125I]OTA binding sites in Hs578T cells by DCC-FBS was blocked by the PKC inhibitor, GF 109203X (13). In the present studies, we found that GF 109203X also inhibited DCC-FBS-induced luciferase activity of the -85OTR/Luc construct, establishing a relationship between the expression of the promoter construct and the endogenous OTR gene. The -85 to -65 region contains an ets gene family binding site (EBS), having a core 5'-GGA-3' consensus sequence at -73. The ets multigene family proteins, composed of approximately 20 homologues in humans, have a common DNA binding domain of approximately 85 amino acid residues near the carboxy-terminus (32, 33). Binding of nuclear proteins by the EBS was displaced by an oligonucleotide containing GABP{alpha}/PU.1 consensus binding sites and, to a much lesser extent, by an oligonucleotide containing a consensus binding site for Ets1 and PEA. Antibody to Ets1/Ets2, which cross-reacts with a variety of ets gene family members, had no effect on the electrophoretic mobility shift pattern. In contrast, antisera to either GABP{alpha} or GABPß1 supershifted complexes between the OTR oligonucleotide and proteins from Hs578T nuclear extracts. GABP{alpha} contains a DNA-binding domain that is a member of the Ets family, whereas the ß-subunit contains a series of ankyrin repeats and does not interact with DNA directly (34, 35). GABP{alpha} alone interacts with an EBS weakly but establishes stable contacts with DNA when complexed with GABPß (36, 37, 38, 39). The GABP{alpha}/ß-DNA complex is 100 times more stable than a GABP{alpha}-DNA complex (34, 35). Hence, the ability of antiserum, against either GABP{alpha} or GABPß1, to cause the same supershifted patterns indicates that the EBS is occupied by a stable GABP{alpha}/ß-DNA complex. GABP is ubiquitous in mammalian systems (35), and Scott et al. (40) have shown that immunoreactive GABP is expressed in several breast cancer cell lines (MDA-453, BT-474, ZR-75–1, MCF-7).

The DNA binding sites of all Ets proteins include the core recognition sequence 5'-GGA-3' and at least nine base pairs of conserved sequence for additional DNA contacts (34). This would explain why either mutation of bases -79 to -75 or -74 to -71 affected the mobility gel shift patterns of all three bands. It was surprising that mutation of bases -83 to -80, leading to a loss in competition for the lowest band seen in gel shift studies, did not affect GABP{alpha}/ß binding, because the mutated site was within nine bases of the 5'-GAA-3' core sequence. Mutation of the DNA between -83 and -80 resulted in a significant reduction in OTR promoter-activated luciferase expression. Although the identity of protein factor(s) binding to this site is presently unknown, it is possible that its binding site overlaps the EBS. Factors binding to this site might also interact with ets family members.

Additional evidence for the identity of the EBS as a functional GABP binding site comes from the use of expression plasmids. Transfection of Hs578T cells with GABP{alpha} and GABPß1 resulted in only a very modest effect on luciferase activity. However, cotransfection with plasmids expressing c-Fos/c-Jun resulted in a very marked enhancement in OTR promoter activity. Cotransfection of the four expression plasmids with a reporter construct containing mutated sites in and around the EBS (M-1, -2, and -3) resulted in a great reduction or disappearance of inducibility of luciferase expression. The relative inactivity of GABP{alpha} and GABPß1, when transfected without AP-1 expression plasmids, indicates that a primary role of GABP might be to facilitate AP-1 binding to DNA target sites. Indeed, mutation of the CRE-like site also resulted in the inability of c-Fos/c-Jun expression plasmids, in combination with GABP{alpha}/ß1 expression plasmids, to increase luciferase expression by an OTR promoter construct. Combinatorial interactions between distinct classes of sequence-specific transcription factors play an important role in regulating eukaryotic gene expression. Our findings are in line with studies that have suggested that Ets proteins function cooperatively with AP-1 transcription factors to regulate the expression of a number of different genes (see Ref. 41 for references). AP-1 binding sites have been identified adjacent to Ets binding sites in many of these genes and, in some cases, mutations of either the AP-1 or the Ets site eliminate transcriptional activity mediated by these elements (42, 43, 44). Cotransfection of Ets and AP-1 expression vectors resulted in cooperative transactivation of the polyoma virus enhancer-derived PEA3 element containing adjacent Ets and AP-1 sites (44). Bassuk and Leiden (41) showed that Elf-1, an Ets family member, associates directly with Jun family members in the absence of DNA. In the presence of target DNA, Elf1-Jun heteromer further associated with Fos family members to form trimolecular protein complexes.

At the present time, the mechanisms of cooperative transcriptional activation of the -85 OTR/Luc construct by GABP{alpha}/ß and c-Fos/c-Jun are not understood. Generally, many naturally occurring AP-1 binding sites that are adjacent to Ets sites are nonconsensus AP-1 motifs and do not bind AP-1 in the absence of the appropriate Ets protein (45). It is possible that the half-CRE site located between -56 and -52 acts as such an AP-1 site. Mutation of this site significantly reduced OTR promoter-directed luciferase activity, albeit to a modest extent relative to the effects of mutating the EBS. Alternatively, AP-1 proteins might be important for the phosphorylation of both GABP{alpha} and GABPß. For example, the GABP-responsive element of the IL-2 enhancer is regulated by JNK/SAPK-activating pathways in T lymphocytes (45). The role of phosphorylated GABP has not yet been established, because bacterially expressed GABP{alpha} and GABPß are capable of binding to the EBS of the IL-2 enhancer, as shown by EMSA (45). It can be surmised that phosphorylation is not required for DNA binding but is required for transactivation, possibly by allowing the interaction of Ets family members with other transcription factors.

In addition to AP-1 interactions, Ets family members interact with other factors at composite elements. Ets factors have been shown to interact directly with TFIID to induce assembly of a TBP-dependent complex (46). It has been suggested that promoters with weakly conserved TATA boxes, such as is indicated for the OTR, rely on activating transcription factors to aid in recruitment of TFIID to the promoter (47, 48). Ets family members have also been shown to interact with other nuclear proteins, including NF-IL6ß (49), NF-EM5 (50), ATF-1, and CREM (51). GABP has recently been shown to cooperate with c-Myb and C/EBP to activate the neutrophil elastase promoter (52).

The most compelling evidence for the importance of the region between -85 and -65 for DCC-FBS-induced expression of the OTR gene arises from the oligonucleotide studies and endogenous expression of the gene. Using OTR25 as a decoy, we found that the induction of [125I]OTA binding sites was totally eliminated. This phenomenon was not caused by squelching or other nonspecific interactions, because mutant oligonucleotides (M-1, -2, and -3) were only partially effective in inhibiting DCC-FBS induction of [125I]OTA binding activity. More specifically, use of either GABP/PU.1 or AP-1 consensus oligonucleotides resulted in inhibition of DCC-FBS induction, and the inhibitory effects were lessened when either oligonucleotide was mutated. The combination of both GABP/PU.1 and AP-1 oligonucleotide decoys was further inhibitory, at the same total concentration of plasmid DNA as either oligonucleotide alone.

In conclusion, we have used several independent approaches to demonstrate that the first 85 bp of 5'-flanking sequence of the human OTR gene is sufficient to direct more than several hundred fold induced expression over that of a TATA box-containing promoter. This activity is imparted by an EBS and an additional site lying immediately upstream, which binds a protein that remains to be identified. In view of the inhibitory effects of blocking PKC activity on serum induction, and the results obtained with AP-1 expression plasmids and oligonucleotide decoys, we conclude that transcriptional activation of the human OTR gene results from the interaction of AP-1 and GABP transcription factors. From what is known from other EBS, we surmise that the binding of GABP{alpha}/ß to the EBS of the OTR gene might also result in the interaction of GABP with the basal transcription complex, leading to increased levels of transcription. Our studies have provided the first clues toward understanding OTR gene expression in mammary cells and have established the framework from which to analyze further the multifactorial, complex mechanisms involved in its regulated expression. We currently are in the process of defining the basis of the interaction between GABP and AP-1 proteins in transcriptional activation of the human OTR gene in breast cells.


    Acknowledgments
 
We thank Dr. Ben Van Houton for carrying out the extended-length PCR; Solweig Soloff, Maribel Acosta, and Chinnapa Kodira for technical assistance; Dr. Allan Brasier for use of the luminometer; Mariam Ali for the human myometrial sample; Dr. Steve Widen for helpful comments; Dr. David Konkel for reviewing the manuscript; and Drs. Steven McKnight, Tom Brown, and Catherine Thompson for gifts of GABP{alpha} and GABPß1 plasmids and antisera.


    Footnotes
 
1 This work was supported, in part, by NIH Grant HD-08406 (to M.S.S.). Back

Received September 30, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y, Nishimura T, Oida H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K, Murata T, Hirata M, Ushikubi F, Negishi M, Ichikawa A, Narumiya S 1997 Failure of parturition in mice lacking the prostaglandin F receptor. Science 277:681–683[Abstract/Free Full Text]
  2. Nishimori K, Young LJ, Guo Q, Wang Z, Insel TR, Matzuk MM 1996 Oxytocin is required for nursing but is not essential for parturition or reproductive behavior. Proc Natl Acad Sci USA 93:11699–11704[Abstract/Free Full Text]
  3. Young WS, Shepard E, Amico J, Hennighausen L, Wagner KU, Lamarca ME, Mckinney C, Ginns EI 1996 Deficiency in mouse oxytocin prevents milk ejection, but not fertility or parturition. J Neuroendocrinol 8:847–853[CrossRef][Medline]
  4. Roberts JS, McCracken JA, Gavagan JE, Soloff MS 1976 Oxytocin-stimulated release of prostaglandin F2{alpha} from ovine endometrium in vitro: correlation with estrous cycle and oxytocin-receptor binding. Endocrinology 99:1107–1114[Abstract/Free Full Text]
  5. Fuchs AR, Fuchs F, Husslein P, Soloff MS, Fernstrom MJ 1982 Oxytocin receptors and human parturition: a dual role for oxytocin in the initiation of labor. Science 215:1396–1398[Abstract/Free Full Text]
  6. Kimura T, Takemura M, Nomura S, Nobunaga T, Kubota Y, Inoue T, Hashimoto K, Kumazawa I, Ito Y, Ohashi K, Koyama M, Azuma C, Kitamura Y, Saji F 1996 Expression of oxytocin receptor in human pregnant myometrium. Endocrinology 137:780–785[Abstract]
  7. Jeng Y-J, Lolait SJ, Soloff MS 1998 Induction of oxytocin receptor gene expression in rabbit amnion cells. Endocrinology 139:3449–3455[Abstract/Free Full Text]
  8. Soloff MS, Alexandrova M, Fernstrom MJ 1979 Oxytocin receptors: triggers for parturition and lactation? Science 204:1313–1315[Abstract/Free Full Text]
  9. Hinko A, Soloff MS 1992 Characterization of oxytocin receptors in rabbit amnion involved in the production of prostaglandin E2. Endocrinology 130:3547–3553[Abstract/Free Full Text]
  10. Larcher A, Neculcea J, Breton C, Arslan A, Rozen F, Russo C, Zingg HH 1995 Oxytocin receptor gene expression in the rat uterus during pregnancy and the estrous cycle and in response to gonadal steroid treatment. Endocrinology 136:5350–5356[Abstract]
  11. Fuchs AR, Periyasamy S, Alexandrova M, Soloff MS 1983 Correlation between oxytocin receptor concentration and responsiveness to oxytocin in pregnant rat myometrium: effects of ovarian steroids. Endocrinology 113:742–749[Abstract/Free Full Text]
  12. Soloff MS, Wieder MH 1983 Oxytocin receptors in rat involuting mammary gland. Can J Biochem Cell Biol 61:631–635[Medline]
  13. Copland JA, Jeng Y-J, Strakova Z, Ives KL, Hellmich MR, Soloff MS 1999 Demonstration of functional oxytocin receptors in human breast Hs578T cells and their up-regulation through a protein kinase C-dependent pathway. Endocrinology 140:2258–2267[Abstract/Free Full Text]
  14. Inoue T, Kimura T, Azuma C, Inazawa J, Takemura M, Kikuchi T, Kubota Y, Ogita K, Saji F 1994 Structural organization of the human oxytocin receptor gene. J Biol Chem 269:32451–32456[Abstract/Free Full Text]
  15. Rozen F, Russo C, Banville D, Zingg HH 1995 Structure, characterization, and expression of the rat oxytocin receptor gene. Proc Natl Acad Sci USA 92:200–204[Abstract/Free Full Text]
  16. Bathgate R, Rust W, Balvers M, Hartung S, Morley S, Ivell R 1995 Structure and expression of the bovine oxytocin receptor gene. DNA Cell Biol 14:1037–1048[Medline]
  17. Chyan YJ, Ackerman S, Shepherd NS, McBride OW, Widen SG, Wilson SH, Wood TG 1994 The human DNA polymerase ß gene structure. Evidence of alternative splicing in gene expression. Nucleic Acids Res 22:2719–2725[Abstract/Free Full Text]
  18. Cheng S, Fockler C, Barnes WM, Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA. Proc Natl Acad Sci USA 91:5695–5699[Abstract/Free Full Text]
  19. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  20. Higuchi R, Krummel B, Saiki RK 1988 A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res 16:7351–7367[Abstract/Free Full Text]
  21. Gorman CM, Merlino GT, Willingham MC, Pastan I, Howard BH 1982 The Rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by DNA-mediated transfection. Proc Natl Acad Sci USA 79:6777–6781[Abstract/Free Full Text]
  22. Hackett AJ, Smith HS, Springer EL, Owens RB, Nelson-Rees WA, Riggs JL, Gardner MB 1977 Two syngeneic cell lines from human breast tissue: the aneuploid mammary epithelial (Hs578T) and the diploid myoepithelial (Hs578Bst) cell lines. J Natl Cancer Inst 58:1795–1806
  23. Shapiro DJ, Sharp PA, Wahli WW, Keller MJ 1988 A high-efficiency HeLa cell nuclear transcription extract. DNA 7:47–55[Medline]
  24. Kimura T, Tanizawa O, Mori K, Brownstein MJ, Okayama H 1992 Structure and expression of a human oxytocin receptor [published erratum appears in Nature 1992; 357:176]. Nature356 :526–529[CrossRef][Medline]
  25. Roesler WJ, Vandenbark GR, Hanson RW, Miksicek R, Heber A, Schmid W, Danesch U, Posseckert G, Beato M, Schutz G 1988 Cyclic AMP and the induction of eukaryotic gene transcription. Glucocorticoid responsiveness of the transcriptional enhancer of Moloney murine sarcoma virus. J Biol Chem 263:9063–9066[Free Full Text]
  26. Fisher RC, Scott EW 1998 Role of PU.1 in hematopoiesis. Stem Cells 16:25–37[Medline]
  27. Hahn S, Buratowski S, Sharp PA, Guarente L 1989 Yeast TATA-binding protein TFIID binds to TATA elements with both consensus and nonconsensus DNA sequences. Proc Natl Acad Sci USA 86:5718–5722[Abstract/Free Full Text]
  28. Singer VL, Wobbe CR, Struhl K 1990 A wide variety of DNA sequences can functionally replace a yeast TATA element for transcriptional activation. Genes Dev 4:636–645[Abstract/Free Full Text]
  29. Yu W, Dahl G, Werner R 1994 The connexin43 gene is responsive to oestrogen. Proc R Soc Lond [Biol] 255:125–132[Medline]
  30. Colgan J, Manley JL 1995 Cooperation between core promoter elements influences transcriptional activity in vivo. Proc Natl Acad Sci USA 92:1955–1959[Abstract/Free Full Text]
  31. Javahery R, Khachi A, Lo K, Zenzie-Gregory B, Smale ST 1994 DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol Cell Biol 14:116–127[Abstract/Free Full Text]
  32. Wasylyk B, Hahn SL, Giovane A 1993 The Ets family of transcription factors [published erratum appears in Eur J Biochem 1993; 215:907]. Eur J Biochem 211:7–18[Medline]
  33. Seth A, Ascione R, Fisher RJ, Mavrothalassitis GJ, Bhat NK, Papas TS 1992 The ets gene family. Cell Growth Differ 3:327–334[Medline]
  34. Graves BJ 1998 Inner workings of a transcription factor partnership. Science 279:1000–1002[Free Full Text]
  35. Batchelor AH, Piper DE, de la Brousse FC, McKnight SL, Wolberger C 1998 The structure of GABP{alpha}/ß: an ETS domain ankyrin repeat heterodimer bound to DNA. Science 279:1037–1041[Abstract/Free Full Text]
  36. Gugneja S, Virbasius JV, Scarpulla RC 1995 Four structurally distinct, non-DNA-binding subunits of human nuclear respiratory factor 2 share a conserved transcriptional activation domain. Mol Cell Biol 15:102–111[Abstract]
  37. Brown TA, McKnight SL 1992 Specificities of protein-protein and protein-DNA interaction of GABP{alpha} and two newly defined ets-related proteins. Genes Dev 6:2502–2512[Abstract/Free Full Text]
  38. LaMarco K, Thompson CC, Byers BP, Walton EM, McKnight SL 1991 Identification of Ets- and notch-related subunits in GA binding protein. Science 253:789–792[Abstract/Free Full Text]
  39. Watanabe H, Sawada J, Yano K, Yamaguchi K, Goto M, Handa H 1993 cDNA cloning of transcription factor E4TF1 subunits with Ets and notch motifs. Mol Cell Biol 13:1385–1391[Abstract/Free Full Text]
  40. Scott GK, Daniel JC, Xiong X, Maki RA, Kabat D, Benz CC 1994 Binding of an ETS-related protein within the DNase I hypersensitive site of the HER2/neu promoter in human breast cancer cells. J Biol Chem 269:19848–19858[Abstract/Free Full Text]
  41. Bassuk AG, Leiden JM 1995 A direct physical association between ETS and AP-1 transcription factors in normal human T cells. Immunity 3:223–237[CrossRef][Medline]
  42. Gottschalk LR, Giannola DM, Emerson SG 1993 Molecular regulation of the human IL-3 gene: inducible T cell-restricted expression requires intact AP-1 and Elf-1 nuclear protein binding sites. J Exp Med 178:1681–1692[Abstract/Free Full Text]
  43. Wang CY, Bassuk AG, Boise LH, Thompson CB, Bravo R, Leiden JM 1994 Activation of the granulocyte-macrophage colony-stimulating factor promoter in T cells requires cooperative binding of Elf-1 and AP-1 transcription factors. Mol Cell Biol 14:1153–1159[Abstract/Free Full Text]
  44. Wasylyk B, Wasylyk C, Flores P, Begue A, Leprince D, Stehelin D 1990 The c-ets proto-oncogenes encode transcription factors that cooperate with c-Fos and c-Jun for transcriptional activation. Nature 346:191–193[CrossRef][Medline]
  45. Hoffmeyer A, Avots A, Flory E, Weber CK, Serfling E, Rapp UR 1998 The GABP-responsive element of the interleukin-2 enhancer is regulated by JNK/SAPK-activating pathways in T lymphocytes. J Biol Chem 273:10112–10119[Abstract/Free Full Text]
  46. Hagemeier C, Bannister AJ, Cook A, Kouzarides T 1993 The activation domain of transcription factor PU.1 binds the retinoblastoma (RB) protein and the transcription factor TFIID in vitro: RB shows sequence similarity to TFIID and TFIIB. Proc Natl Acad Sci USA 90:1580–1584[Abstract/Free Full Text]
  47. Weinzierl RO, Ruppert S, Dynlacht BD, Tanese N, Tjian R 1993 Cloning and expression of Drosophila TAFII60 and human TAFII70 reveal conserved interactions with other subunits of TFIID. EMBO J 12:5303–5309[Medline]
  48. Rigby PW 1993 Three in one and one in three: it all depends on TBP. Cell 72:7–10[CrossRef][Medline]
  49. Nagulapalli S, Pongubala JM, Atchison ML 1995 Multiple proteins physically interact with PU.1. Transcriptional synergy with NF-IL6ß (C/EBP{delta}, CRP3). J Immunol 155:4330–4338[Abstract]
  50. Pongubala JM, Van BC, Nagulapalli S, Klemsz MJ, McKercher SR, Maki RA, Atchison ML 1993 Effect of PU.1 phosphorylation on interaction with NF-EM5 and transcriptional activation. Science 259:1622–1625[Abstract/Free Full Text]
  51. Pongubala JM, Atchison ML 1995 Activating transcription factor 1 and cyclic AMP response element modulator can modulate the activity of the immunoglobulin {kappa} 3' enhancer. J Biol Chem 270:10304–10313[Abstract/Free Full Text]
  52. Nuchprayoon I, Simkevich CP, Luo M, Friedman AD, Rosmarin AG 1997 GABP cooperates with c-Myb and C/EBP to activate the neutrophil elastase promoter. Blood 89:4546–4554[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
Y.-J. Jeng and M. S. Soloff
Characterization of the Cyclic Adenosine Monophosphate Target Site in the Oxytocin Receptor Gene in Rabbit Amnion
Biol Reprod, September 1, 2009; 81(3): 473 - 479.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. E. Lucas, K. S. Crider, D. R. Powell, P. Kapoor-Vazirani, and P. M. Vertino
Methylation-sensitive Regulation of TMS1/ASC by the Ets Factor, GA-binding Protein-{alpha}
J. Biol. Chem., May 29, 2009; 284(22): 14698 - 14709.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Ball, J. W. Wang, S. Wong, B. Zielnik, J. Mitchell, N. Wang, M. B. Stemerman, and B. F. Mitchell
Phorbol ester treatment of human myometrial cells suppresses expression of oxytocin receptor through a mechanism that does not involve activator protein-1
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E922 - E928.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. S. Soloff, M. G. Izban, D. L. Cook Jr, Y.-J. Jeng, and R. C. Mifflin
Interleukin-1-induced NF-{kappa}B recruitment to the oxytocin receptor gene inhibits RNA polymerase II-promoter interactions in cultured human myometrial cells
Mol. Hum. Reprod., October 1, 2006; 12(10): 619 - 624.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. G. W. Fleming, T. E. Spencer, S. H. Safe, and F. W. Bazer
Estrogen Regulates Transcription of the Ovine Oxytocin Receptor Gene through GC-Rich SP1 Promoter Elements
Endocrinology, February 1, 2006; 147(2): 899 - 911.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. F. Mitchell, B. Zielnik, S. Wong, C. D. Roberts, and J. M. Mitchell
Intraperitoneal infusion of proinflammatory cytokines does not cause activation of the rat uterus during late gestation
Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E658 - E664.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y.-J. Jeng, S. L. Soloff, G. D. Anderson, and M. S. Soloff
Regulation of Oxytocin Receptor Expression in Cultured Human Myometrial Cells by Fetal Bovine Serum and Lysophospholipids
Endocrinology, January 1, 2003; 144(1): 61 - 68.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A. Copland, M. G. Zlatnik, K. L. Ives, and M. S. Soloff
Oxytocin Receptor Regulation and Action in a Human Granulosa-Lutein Cell Line
Biol Reprod, May 1, 2002; 66(5): 1230 - 1236.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. Tanaka, A. Ueda, H. Kanamori, H. Ideguchi, J. Yang, S. Kitajima, and Y. Ishigatsubo
Cell-cycle-dependent Regulation of Human aurora A Transcription Is Mediated by Periodic Repression of E4TF1
J. Biol. Chem., March 15, 2002; 277(12): 10719 - 10726.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
V. Luzzi, V. Holtschlag, and M. A. Watson
Expression Profiling of Ductal Carcinoma in Situ by Laser Capture Microdissection and High-Density Oligonucleotide Arrays
Am. J. Pathol., June 1, 2001; 158(6): 2005 - 2010.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
B. F. Mitchell and B. Schmid
Oxytocin and its Receptor in the Process of Parturition
Reproductive Sciences, May 1, 2001; 8(3): 122 - 133.
[Abstract] [PDF]


Home page
EndocrinologyHome page
B. Schmid, S. Wong, and B. F. Mitchell
Transcriptional Regulation of Oxytocin Receptor by Interleukin-1{beta} and Interleukin-6
Endocrinology, April 1, 2001; 142(4): 1380 - 1385.
[Abstract] [Full Text]


Home page
Physiol. Rev.Home page
G. Gimpl and F. Fahrenholz
The Oxytocin Receptor System: Structure, Function, and Regulation
Physiol Rev, April 1, 2001; 81(2): 629 - 683.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. A. Copland, Y.-J. Jeng, Z. Strakova, K. L. Ives, M. R. Hellmich, and M. S. Soloff
Demonstration of Functional Oxytocin Receptors in Human Breast Hs578T Cells and Their Up-Regulation through a Protein Kinase C-Dependent Pathway
Endocrinology, May 1, 1999; 140(5): 2258 - 2267.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoare, S.
Right arrow Articles by Soloff, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoare, S.
Right arrow Articles by Soloff, M. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals