| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
/ß Binding Site Involved in the Induction of Oxytocin Receptor Gene Expression in Human Breast Cells. Potentiation by c-Fos/c-Jun1
Department of Obstetrics and Gynecology (S.H., J.A.C., Y.-J.J., M.G.I., M.S.S.), and the Sealy Center for Molecular Science (T.G.W., M.G.I., M.S.S.), University of Texas Medical Branch, Galveston, Texas 77555-1062
Address all correspondence and requests for reprints to: Dr. Melvyn S. Soloff, Department of Obstetrics and Gynecology, University of Texas Medical Branch, 301 University Boulevard, Galveston, Texas 77555-1062. E-mail: msoloff{at}utmb.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ß. Cotransfection of a -85 OTR/luciferase
construct with vectors expressing GABP and GABPß1 had only a
modest effect on expression, but cotransfection with GABP/ß- with
c-Fos/c-Jun-expressing plasmids resulted in an increase of almost
10-fold in luciferase activity. Mutation of either the GABP- or
CRE-like binding sites obliterated the induction. These findings are
consistent with the involvement of protein kinase C activity in serum
induction of the endogenous gene in Hs578T cells. We showed the
requirement for GABP/ß and c-Fos/c-Jun in endogenous OTR gene
expression, using oligonucleotide GABP and AP-1 binding decoys to
inhibit serum-induced increases in 125I-labeled OT
antagonist binding to Hs578T cells. Our work is the first
characterization of the proximal promoter region of the human OTR gene,
and it sets the stage for studying regulation of OTR expression in
breast cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The human OTR gene spans approximately 19 kbp and is divided into four
exons and three introns (Ref. 14 and the present studies). Only a
single OTR gene has been demonstrated in several species (14, 15, 16). We
have shown in the present studies that the human OTR gene contains both
a TATAA-like box and initiator element (Inr). We also have defined an
Ets binding site (EBS) region in the upstream promoter that is
absolutely essential for both basal and serum-induced expression of the
OTR gene, and we have characterized ets gene family proteins
binding to this site as GABP/ß. In addition, AP-1 expression
plasmids synergize with GABP/ß in inducing OTR gene expression.
These studies thus give us the first clues as to how the human OTR gene
is induced in mammary cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
DNA sequence analysis
DNA sequencing was performed using a cycle sequencing protocol
and AmpliTaq DNA polymerase (Perkin-Elmer Corp., Norwalk,
CT). Sequence analysis was done using a model 373A DNA sequence
analyzer (Perkin-Elmer Applied Biosystems, Foster City,
CA).
Extended-length PCR
Extended-length PCR (18) was performed using 50 ng human genomic
DNA and primers derived from the 3' end of exon 3
(5'AGCGTCAAGCTCATCTCCAAGGCC 3') and the 5' end of exon 4 (5'
TCTGCCCTTCAGGTAGCTGGCGG 3'). The amplification reaction (100 µl)
contained 50 pmol of each primer and 1 U of a 50:1 mix of rTth DNA
polymerase (Perkin-Elmer Corp.) and Vent DNA polymerase
(New England Biolabs, Inc., Beverly, MA). The
amplified DNA was cloned using a pCRII vector (Invitrogen,
Carlsbad, CA) and was subjected to restriction and DNA sequence
analysis.
Ribonuclease (RNase) protection assay
The RNA probe used in the RNase protection studies was
synthesized using a plasmid template DNA derived from the human OTR
genomic clone, p8–1. A 491-bp DNA fragment, containing 355 bp of
sequence derived from the 5' end of exon 1 and 124 bp of adjacent 5'
flanking sequence, was PCR-amplified and cloned into pSP73. Purified
plasmid was linearized by digestion with EcoRI (New England Biolabs, Inc.), and antisense transcripts were labeled
in vitro using -32P-cytidine 5'-triphosphate
(800 Ci/mmol) and T7 RNA polymerase (Ambion, Inc., Austin,
TX). Total RNA was isolated (19) from human myometrium obtained
at term for medical reasons and was ethanol-precipitated in
increasing amounts with the OTR antisense probe (1.4 x
105 cpm). DNA samples were analyzed by electrophoresis on
5% acrylamide, 8 M urea gels.
Primer extension analysis
A 26-nucleotide oligomer complementary to the region
between positions +95 to +120 in exon 1 was end-labeled (6 x
108 dpm/µg) using T4 polynucleotide
kinase (New England Biolabs, Inc.) and
[32P]
-ATP (DuPont NEN, Boston, MA)
3000 Ci/mmol. Primer was annealed to human myometrial total RNA (50
µg), extended with murine leukemia virus reverse
transcriptase, and the extended products were analyzed on a 6%
acrylamide, 8 M urea gel in parallel with chain termination
sequencing reactions performed using the above primer and a segment of
human genomic DNA containing the OTR exon 1 and adjacent 5' flanking
region.
Plasmid constructions
Insert DNAs from the 
genomic clones (8–1, 6–1) were
subcloned as SalI DNA fragments into pUC18, creating
plasmids p8–1 and p6–1. A 7.8-kb EcoRI DNA fragment,
containing the first three exons of the human OTR gene and 2.9 kb of 5'
flanking sequence, was isolated from p8–1, subcloned into pUC18, and
designated p1500. A unique HincII site within exon 1 was
used in isolating a 2.2-kbp SstI-HincII DNA
fragment from p1500. This DNA fragment was subcloned into pBluescript
II SK- (SstI-EcoRV). The
HindIII site next to the EcoRV site in the
pBluescript polylinker was used in isolating an
SstI-HindIII DNA fragment. This DNA was cloned
into pGL2-Basic (Promega Corp., Madison, WI) to
create p-1770. A 2.3-kbp SalI-SstI DNA fragment
derived from p8–1 was introduced into p-1770
(XhoI/SstI) to generate p-4225. A unique
NdeI site within the 5' flanking sequence was used to
isolate a 1.3-kbp NdeI-HindIII DNA fragment. This
DNA was cloned into pGL2-Basic (SstI/HindIII)
using a SstI-NdeI linker to generate p-992. The
linker also contained a unique BglII site. Digestion of
p-992 with BglII, followed by treatment with Klenow
polymerase and digestion with EcoRV, resulted in the
deletion of 235 bp and created the 5' flanking sequence for p-757.
Digestion of p-992 with BglII and NsiI, and subsequent
treatment with T4 DNA polymerase, resulted in a deletion of
356 bp and generated the 5' flank sequence for p-636.
SstI-HindIII digests were used in isolating the
5' flank sequences for p-861 and p-118.
BamHI-HindIII digests were used in p-145. PCR was
used to create the other 5'-deletion constructs. Sense primers were
paired with the antisense HindIII primer
5'AAGCTTGATGACTCCCCCCGGGGAAGTTGC 3', which terminates at +350.
Site-specific mutations were created in PCR primers, by the method of
Higuchi et al. (20). To construct vectors containing the
-4225/+1357 sequence, a 2.4-kbp BamHI fragment, containing
exons 1, 2, and 78 bp of the noncoding region of exon 3, was isolated
from p1500. Blunt ends were created using Klenow polymerase,
HindIII linkers were ligated, and the DNA was digested with
HindIII and EcoRV. This DNA and a 3.25-kb
SalI-EcoRV DNA fragment, containing the 5'
sequence of the OTR gene derived from p8–1, were ligated and cloned
into pGL2-Basic that was linearized with
HindIII-XhoI. All plasmid DNAs were purified by
CsCl density gradient centrifugation before use in DNA transfection
assays. Rous sarcoma virus-chloramphenicol acetyltransferase
(RSV-CAT) was identical to the sequence reported by Gorman
et al. (21). The CMV-GABP and CMV-GABPß1 expression
vectors were gifts from Dr. Catherine Thompson (Neuroscience/Kennedy
Krieger Institute, Johns Hopkins University School of Medicine,
Baltimore, MD). GABP and GABPß1 plasmids were gifts from
Drs. Thomas Brown, Pfizer, Inc. (Groton, CT), and
Dr. Steven McKnight (Tularik, Inc., South San Francisco,
CA).
Transfection and cell culture
A human breast ductal carcinoma cell line Hs578T (22) was
obtained from the American type culture collection
(Manassas, VA). Cells were maintained in DMEM supplemented with 5% FBS
and penicillin/streptomycin and were cultured in an atmosphere of 5%
CO2. Transient transfections were done by calcium phosphate
coprecipitation in triplicate 60-mm plates, using 10 µg OTR
promoter-luciferase reporter vector, 0.5 µg RSV-CAT (control for
uniformity of transfection efficiency), and 9.5 µg carrier pGEM7Z
plasmid DNA for each triplicate set of plates. Twenty-four hours after
transfection, cells were rinsed, and fresh medium was added. Cells were
cultured for an additional 24 h and harvested for analysis of
reporter activities. Serum induction studies were carried out with
DCC-treated FBS, 20% (13). The experiments were done with three
different plasmid preparations of each construct.
Reporter assays
Cells were rinsed three times with PBS and lysed in place with
0.3 ml of detergent solution [25 mM Tris-phosphate (pH
7.8), 2 mM dithiothreitol, 2 mM
1,2-diaminocyclohexane-N,N,N,N-tetracetic acid, 10%
glycerol, and 1% Triton X-100]. Luciferase activity was determined
using an AutoLumat luminometer, and the activity of each sample was
normalized relative to CAT activity. CAT activity was determined using
the enzyme-linked immunosorbent assay kit and protocol described by
Boehringer Mannheim (Indianapolis, IN).
Deoxyribonuclease (DNase) I footprinting
Nuclear extracts from Hs578T cells were prepared by a
modification of the method of Shapiro et al. (23), after
purification of the nuclei by sucrose density gradient centrifugation.
The plasmid used for DNase I protection was constructed by inserting a
SmaI (-147)/HaeIII (+56) fragment of the OTR
gene into the SmaI site of pUC18. Inserts in both
orientations were selected. The plasmid was linearized by digestion
with EcoRI, labeled by filling in the 5'-overhangs using
[32P]-deoxy-ATP and the Klenow fragment of DNA
polymerase, and the insert excised by digestion with
HindIII. Labeled DNA was separated from plasmid vector on
5% polyacrylamide gels. Increasing amounts of nuclear protein (see
figure legends) were incubated with 1 µg poly(dI-dC)/poly(dI-dC)
(Pharmacia LKB, Piscataway, NJ) for 20 min on ice
before the addition of approximately 1 ng of labeled DNA. The mixtures
were incubated for 60 min on ice, then digested for 1 min with optimal
amounts of DNase I. DNA from the digested samples was resolved on a 7%
polyacrylamide-urea gel.
Electrophoretic mobility shift assays (EMSA)
Synthetic oligonucleotides corresponding to the regions outlined
in the text were annealed with complementary sequences and end-labeled
with [-32P]ATP and T4 polynucleotide
kinase (Promega Corp.). The EMSA were performed by
incubating 10 µg of nuclear protein, described above, with about 1 ng
of labeled probe. In competition studies, nonradioactive competitor
oligonucleotides were incubated with nuclear protein extract for 10 min
at room temperature before addition of the probe. Samples were loaded
onto a Tris-glycine (pH 8.5), EDTA 4% nondenaturing polyacrylamide gel
(40:1 acrylamide:BIS). Radioactivity on dried gels was visualized by
autoradiography using Kodak XAR-5 film (Eastman Kodak Co., Rochester, NY). The consensus binding site
oligonucleotides for Sp1, CRE, PU.1/GABP, and Ets-1/PEA3 were
purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz,
CA). In antibody supershift assays, antibodies were incubated with
nuclear extracts for 20 min at room temperature before addition of
radiolabeled oligonucleotide. Rabbit polyclonal IgG, directed against
Ets-1/Ets-2, was purchased from Santa Cruz Biotechnology, Inc.. Rabbit polyclonal antibodies, directed against recombinant
GABP and GABPß1, were gifts from Dr. Thomas Brown and Dr. Steven
McKnight.
Oligonucleotide decoy inhibition of serum-induction of
[125I]OTA (OT antagonist) binding sites
Hs578T cells were serum starved for 48 h in 0.5% BSA/DMEM,
containing antibiotics. Double-stranded oligonucleotides were added to
the medium, either during this 48-h period or during the last 24
h, at a concentration of either 25 or 50 µM, according to
the figure legends. DCC-FBS, 20%, was then added, along with 25 or 50
µM of the same oligonucleotide; and the cells were
analyzed 24 h later for [125I]OTA (OTA =
[d(CH2)5,Tyr(Me)2,Thr4,Tyr-NH29]ornithine
vasotocin) binding sites. Specific [125I]OTA
binding assays were carried out in triplicate, using a saturating or
near-saturating concentration of [125I]OTA, as previously
described (13). The oligonucleotides used were OTR25, OTR25M-1, -2, -3,
and oligonucleotides corresponding to the consensus GABP/PU.1 site (GGG
CTG CTT GAG GAA GTA TAA GAA T), mutated (bases underlined)
GABP/PU.1 (GGG CTG CTT GAG AGA GTA TAA GAA T), the
consensus AP-1 site (CGC TTG ATG ACT CAG CCG GAA), and mutated AP-1
(CGC TTG ATG ACT TGG CCG GAA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). The absence of overlapping
homology between the two clones prevented an accurate estimate of the
size of intron 3 and a contiguous alignment of the OTR gene. To
determine the size of intron 3, we performed extended-length PCR using
primers corresponding to coding sequences at the 3' end of exon 3 and
the 5' end of exon 4. A 13.7-kbp fragment of DNA was amplified, cloned,
and characterized by partial nucleotide sequencing and by restriction
mapping. This clone, pXL-3, permitted the contiguous alignment of the
human OTR gene (Fig. 1). The gene is organized into four exons that
span a total of about 19 kbp.
|
). A 535-bp RNA probe representing 101
bp of the proximal 5' end of human OTR cDNA (24) and 378 bp of adjacent
5' sequence was annealed with human myometrial total RNA, digested with
RNase, and analyzed by electrophoresis on a urea-polyacrylamide gel.
The uterine RNA protected one major- and a minor-labeled RNA band (Fig. 2A, lanes 3–5). The size of the major band, about 345 nucleotides, is
consistent with the previously reported transcription start site for
the human OTR (14). Primer extension was performed to identify the
precise nucleotide site for the initiation of transcription. The primer
extension reaction products were analyzed in parallel with chain
termination sequencing reactions using the analogous primer and an OTR
human genomic DNA subclone containing exon 1 and adjacent 5' flanking
sequences. Two start positions, which are in close positional agreement
with those previously reported (14), were identified (Fig. 2B). For
purposes of nomenclature of constructs used in transient transfection
studies, we assigned the major start site (T1 on the template strand,
Fig. 2) as position +1.
|
). To define key regulatory regions in
the OTR gene, luciferase activity of serial deletion mutants of the OTR
5'-flanking region (ranging from -4225 to -65) was determined. In
these preliminary studies, the transfected Hs578T cells were incubated
in the presence 10% FBS so that only serum-induced expression was
determined. Between -4225 and -85, each deletion had only a modest
effect on luciferase expression (Fig. 3). Luciferase activity of the
deletion mutants ranged from 0.66–2.5 times that of the -4225/+350
construct. The level of expression of the -85 construct was about the
same as that of the -4225 mutant. Greater luciferase activities of the
-992, -861, -757, and -636 mutants, relative to the -85 or -4225
constructs, suggest the possibility of weak silencer elements upstream
of -992, but this observation was not explored further in the present
studies. Expression fell to about 20%, when the region between -85
and -73 was deleted, and further reduction (to values comparable with
the activity of the promotorless pGL2-Basic vector) was observed when
the region between -73 and -65 was deleted (Fig. 3). The findings
therefore define a region between -85 and -65 that is critical for
OTR promoter activity. To verify that this region imparts the serum
inducibility seen with endogenous OTRs, transfections were carried out
with -4225, -1770, -85, and -65 constructs in the presence of low
serum concentration (5%). Twenty-four hours after transfection, 20%
DCC-FBS was added for 24 h, and cell lysates were prepared for
reporter analysis. The addition of serum caused an increase of
approximately 3-fold in luciferase activity in the -4225, -1770, and
-85 constructs, but the activity of the -65 construct was unchanged
(Fig. 4A). Basal activity (in 5%
DCC-FBS) was also increased in the -4225, -1770, and -85 constructs
(vs. the -65 construct). Thus, the region between -85 and
-65 is necessary for both basal and serum-induced expression of the
OTR promoter. As shown in our previous studies, serum inducibility of
the endogenous OTR was blocked by the PKC inhibitor GF 109203X (13). GF
109203X, added in increasing concentrations 30 min before addition of
serum, likewise inhibited serum-induced expression from the -85
construct (Fig. 4B).
|
|
): the region containing
the consensus sequence for an Inr around the transcription start site
(depending on the template strand, labeled as 1 or D in Fig. 5); a
TATA-like box (labeled 2 or C in Fig. 5); and an extensive region
between -100 and -44 (labeled 3 and 4 or B in Fig. 5). An area near
the -147 terminus (GAAGAACAT, labeled 5 or A in Fig. 5) that resembles
a partial GRE (25) was also protected. The region between -100 and
-44 is complex, and it includes a potential EBS with the core
consensus sequence of GGA (-77 to -75), a GC box (Sp1 site at -68 to
-62), and the sequence TGACGAGT (-57 to -50), which resembles a CRE
octamer motif 5'-TGACGTCA-3' (25).
|
), interrupts a
Sp1 motif (GC box). In view of the ubiquity of Sp1 and its involvement
in transcription initiated by many different promoters, it was
important to determine whether scission of the GC box accounted for the
sharp reduction in functional activity. An OTR DNA fragment, containing
the putative Sp1 binding site (-95 to -53), did not compete with an
authentic end-labeled Sp1 oligonucleotide for the specific band that
was gel shifted by Hs578T nuclear extracts (data not shown). The
end-labeled OTR oligonucleotide (-95 to -53) also failed to form
Sp1-specific bands with the nuclear extracts. Sp1 binding by the -95
to -53 oligonucleotides was only apparent after addition of purified
recombinant Sp1 protein (Promega Corp.), and binding was
much weaker than that seen with the recombinant protein and the
authentic Sp1 oligonucleotide (data not shown). The data therefore
suggest that the GC-rich site in the OTR promoter is a weak Sp1-binding
site. Furthermore, mutation of the Sp1 site had no effect on OTR
promoter activity (see Fig. 8). Partial protection of the GC-rich area
shown by DNase I footprinting (Fig. 5) might therefore be caused by
proteins binding to adjacent sites.
|
) contains a CRE-like site (TGACG). In view of the fact
that binding of transcription factors to this site might be reduced by
scission of the promoter at -65, we also carried out EMSA of an
oligonucleotide containing this sequence. Addition of the
32P-labeled OTR35 (-73 to -44) to Hs568T nuclear extracts
resulted in the formation of a band that was competed away by both
nonradioactive OTR35 and by an oligonucleotide containing a consensus
CRE (Fig. 6A). Mutation of two bases in
the putative CRE sequence of OTR35, from TGACG to TGTGG,
eliminated competition with [32P]OTR35 (Fig. 6A). An AP-1
consensus oligonucleotide also competed with the labeled probe for
protein binding (Fig. 6B).
|
)
and lying between -85 and -65 contains a purine-rich stretch with a
core 5'-GGA-3' sequence that is characteristic of an Ets family EBS. As
shown by electrophoretic mobility shift analysis, three bands were
shifted using Hs578T nuclear extracts and an end-labeled
oligonucleotide corresponding to the sequence between -87 and -63
(OTR25, Fig. 7A). All three bands were
competitively reduced by addition of an excess of unlabeled OTR25 (Fig. 7A). An oligonucleotide containing an EBS recognized by Ets1 and PEA
(two ets family members) partially competed with labeled
OTR25 (Fig. 7A). In contrast, addition of an oligonucleotide containing
a consensus-binding site for GABP and PU.1 Ets family members
completely displaced the two upper bands. The same two bands were
formed when the nuclear extracts were added to a 5'-end-labeled
consensus GABP/PU.1 oligonucleotide (data not shown). To narrow the
binding region, we created replacement mutants that modified the GGA of
the EBS and sites both immediately up- and down-stream from the EBS in
the OTR promoter. Competition, as studied by EMSA with end-labeled
OTR25 and oligonucleotides that were synthesized by replacing
nucleotides -74 to -71 (M-1), -79 to -75 (M-2), and -83 to -80
(M-3) (Fig. 7B), showed that the binding of nuclear factors by all
three mutants was modified (Fig. 7C). The M-3 mutant failed to
compete with the band having the greatest mobility; but like the
wild-type OTR25, it competed with the upper two bands (Fig. 7C), which
were also displaced by the GABP/PU.1 oligonucleotide (Fig. 7A).
These findings are consistent with the observation that the sequence
between -80 and -83 does not correspond to a consensus GABP/PU.1
binding site. The M-1 and M-2 mutants partially competed for all three
bands, compared with the wild-type oligonucleotide (Fig. 7C). It
therefore seems that two classes of protein complexes exist. The upper
two complexes seem to contain ets family members binding to
the EBS, whereas the faster migrating complex interacts with the region
of the promoter that is covered by all three mutated sites.
|
). Mutation
in the CRE-like site significantly (P < 0.05) reduced
luciferase activity by about 30% (Fig. 8). Mutation of both Sp1 and
CRE-like sites resulted in about the same activity as the CRE mutant
alone (Fig. 8). All three mutations in the purine-rich region
corresponding to M-1, -M-2, and M-3 in the context of the -95OTR/Luc
construct resulted in 4- to 8-fold decreases in luciferase expression
(Fig. 8). These results are consistent with the ability of the three
mutant oligonucleotides to modify the gel shift results (Fig. 7C). From
the functional analysis of the M-1- and M-2-linked luciferase
constructs, it is clear that the EBS is critical for expression of the
OTR promoter. In addition, mutation of the -83 to -80 region (M-3),
which was associated with the lowest gel-shifted band and not
identifiable with GABP/PU.1. (Fig. 7C), also markedly reduced OTR
promoter-driven luciferase activity (Fig. 8).
Identification of protein(s) binding to the EBS
Based on the preceding data, any of the 20 ets family
members could potentially interact with the EBS. An oligonucleotide
containing a specific PU-1 binding site from the SV40 enhancer did not
compete with OTR25 for protein binding (data not shown). Insofar as
PU.1 expression is restricted to cells of hematopoietic lineage (26),
we did not consider this ets family member as a potential
regulatory factor in Hs578T cells. To better define the specific
factors in Hs578T nuclear extracts that bind to the EBS, we carried out
immunoshift analyses using antibodies to Ets proteins. Antibody to
Ets1/Ets2, which cross-reacts with a variety of Ets family members, had
no effect on the EMSA pattern obtained with end-labeled OTR25 and
Hs578T nuclear extracts (Fig. 9A).
Antibodies to both GABP and GABPß1, which (unlike any other
members of the ets family) form a heteromeric complex,
caused a supershift with OTR25 and Hs578T nuclear extracts (Fig. 9B).
These findings indicate that GABP/ß participates in the activation
of OTR gene expression in Hs578T cells.
|
and GABPß1 caused a modest increase in luciferase
expression in the presence of 5% FBS (Fig. 10A). However, expression was markedly
enhanced when the cells were cotransfected with GABP/ß and
c-Fos/c-Jun expression plasmids. Maximal responses to
GABP/ß1, and c-Fos/c-Jun were obtained with 2 µg and 5
µg, respectively (data not shown). Thus, the addition of both caused
a response beyond that elicited by the maximal concentration of
c-Fos/c-Jun alone. The increase in luciferase activity with the
combined plasmids was approximately 8.5-fold (Fig. 10A). These findings
are consistent with the results of studies showing that inhibition of
PKC activity with GF 109203X results in reduced expression of the
endogenous OTR gene (13) and of serum induction of the -85OTR/Luc
construct (Fig. 4B). These findings also indicate that GABP/ß
affects the interaction of c-Fos/c-Jun with its DNA binding sites
either directly or indirectly. Cotransfection of GABP/ß and
c-Fos/c-Jun expression vectors in pGL2 or the -65 construct had
no noticeable effect on luciferase activity (Fig. 10B). As in the case
of the -85 construct, cotransfection with the combined expression
plasmids resulted in elevated luciferase expression from the -1770 and
-4425 constructs (Fig. 10B). Luciferase activity was less in cells
transfected with the -4225 plasmid than with -1770 or -85.
|
). Activity was reduced markedly with M-1 and M-2
mutant -95OTR/Luc constructs, as shown in Fig. 8 (and Fig. 10C), and
cotransfection with GABP/AP-1 expression plasmids resulted in an
increase of only 2-fold (approximately) in luciferase activity (Fig. 10C). Coexpression of -95OTR/Luc with the M-3 mutation and GABP/AP-1
expression plasmids resulted in an increase of approximately 5-fold in
luciferase activity (Fig. 10C).
Coexpression of GABP/AP-1 expression plasmids with the -145OTR/Luc
construct also resulted in an increase of approximately 8-fold in
luciferase activity (Fig. 10D). Mutation of the Sp1 site, in the
context of -145OTR/Luc, still allowed an increase of approximately
6-fold (Fig. 10D). However, mutation of the CRE-like site alone, or the
CRE-like and Sp1 sites, resulted in a reduction of approximately 50%
in basal luciferase activity and the absence of any induction with
GABP/AP-1 expression vectors. These results suggest that both EBS and
CRE-like sites are involved in GABP/AP-1-induced OTR gene
expression.
Reduction in expression of the endogenous OTR by oligonucleotide
decoys
Cells were serum starved in 0.5% BSA/DMEM for 48 h and then
treated with 25 µM OTR25 for 24 h before DCC-FBS
(20%) stimulation. After another 24 h in the presence of
oligonucleotide and serum, the cells were used to measure specific
[125I]OTA binding. The addition of DCC-FBS alone resulted
in a 5.6-fold increase in binding activity (Fig. 11A). The presence of OTR25 (25
µM), however, completely eliminated DCC-FBS-induced
expression of binding activity (Fig. 11A). Incubation of cells with
OTR25M-1, -2, or -3 (25 µM) also resulted in reduction of
specific [125I]OTA binding, but the inhibition was only
39%, 21%, and 57% for OTR25M-1, OTR25M-2, and OTR25M-3, respectively
(Fig. 11A). These findings show that mutation of the EBS (OTR25M-2) has
the greatest effect on attenuating the decoy effects. Further evidence
for the involvement of the EBS in serum induction of OTR gene
expression in Hs578T cells is shown by the inhibition of serum
induction by a GABP/PU.1 consensus oligonucleotide. Incubation of cells
with 50 µM GABP/PU.1 oligonucleotide, for 24 h
before serum induction and for 24 h during induction, resulted in
a reduction of approximately 40% in [125I]OTA binding
(Fig. 11B). Mutation of the consensus sequence resulted in no reduction
at all (Fig. 11B). Incubation of cells with a consensus AP-1
oligonucleotide (50 µM) reduced [125I]OTA
binding by about 45%, and mutation of the oligonucleotide also
eliminated the reduction (Fig. 11B). The combination of GABP/PU.1 and
AP.1 oligonucleotides further reduced [125I]OTA binding
activity by about 70% and 75%, respectively, when either 25
µM or 50 µM of each oligonucleotide was
used (Fig. 11B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The present work has clearly shown that a critical proximal promoter
element is located in the region between -85 and -65 from the major
transcription initiation site. Deletion of the 5'-flanking sequence to
-65 reduced the level of transcriptional activity of the OTR promoter
to that of the promotorless pGL2 vector in Hs578T cells. This region
confers both basal and serum-induced activity of the OTR gene. We have
shown previously that the inducibility of [125I]OTA
binding sites in Hs578T cells by DCC-FBS was blocked by the PKC
inhibitor, GF 109203X (13). In the present studies, we found that GF
109203X also inhibited DCC-FBS-induced luciferase activity of the
-85OTR/Luc construct, establishing a relationship between the
expression of the promoter construct and the endogenous OTR gene. The
-85 to -65 region contains an ets gene family binding site
(EBS), having a core 5'-GGA-3' consensus sequence at -73. The
ets multigene family proteins, composed of approximately 20
homologues in humans, have a common DNA binding domain of approximately
85 amino acid residues near the carboxy-terminus (32, 33). Binding of
nuclear proteins by the EBS was displaced by an oligonucleotide
containing GABP/PU.1 consensus binding sites and, to a much lesser
extent, by an oligonucleotide containing a consensus binding site for
Ets1 and PEA. Antibody to Ets1/Ets2, which cross-reacts with a variety
of ets gene family members, had no effect on the
electrophoretic mobility shift pattern. In contrast, antisera to either
GABP or GABPß1 supershifted complexes between the OTR
oligonucleotide and proteins from Hs578T nuclear extracts. GABP
contains a DNA-binding domain that is a member of the Ets family,
whereas the ß-subunit contains a series of ankyrin repeats and does
not interact with DNA directly (34, 35). GABP alone interacts with
an EBS weakly but establishes stable contacts with DNA when complexed
with GABPß (36, 37, 38, 39). The GABP/ß-DNA complex is 100 times more
stable than a GABP-DNA complex (34, 35). Hence, the ability of
antiserum, against either GABP or GABPß1, to cause the same
supershifted patterns indicates that the EBS is occupied by a stable
GABP/ß-DNA complex. GABP is ubiquitous in mammalian systems (35),
and Scott et al. (40) have shown that immunoreactive GABP is
expressed in several breast cancer cell lines (MDA-453, BT-474,
ZR-75–1, MCF-7).
The DNA binding sites of all Ets proteins include the core
recognition sequence 5'-GGA-3' and at least nine base pairs of
conserved sequence for additional DNA contacts (34). This would explain
why either mutation of bases -79 to -75 or -74 to -71 affected the
mobility gel shift patterns of all three bands. It was surprising that
mutation of bases -83 to -80, leading to a loss in competition for
the lowest band seen in gel shift studies, did not affect GABP/ß
binding, because the mutated site was within nine bases of the
5'-GAA-3' core sequence. Mutation of the DNA between -83 and -80
resulted in a significant reduction in OTR promoter-activated
luciferase expression. Although the identity of protein factor(s)
binding to this site is presently unknown, it is possible that its
binding site overlaps the EBS. Factors binding to this site might also
interact with ets family members.
Additional evidence for the identity of the EBS as a functional GABP
binding site comes from the use of expression plasmids. Transfection of
Hs578T cells with GABP and GABPß1 resulted in only a very modest
effect on luciferase activity. However, cotransfection with plasmids
expressing c-Fos/c-Jun resulted in a very marked enhancement in
OTR promoter activity. Cotransfection of the four expression plasmids
with a reporter construct containing mutated sites in and around the
EBS (M-1, -2, and -3) resulted in a great reduction or disappearance of
inducibility of luciferase expression. The relative inactivity of
GABP and GABPß1, when transfected without AP-1 expression
plasmids, indicates that a primary role of GABP might be to facilitate
AP-1 binding to DNA target sites. Indeed, mutation of the CRE-like site
also resulted in the inability of c-Fos/c-Jun expression plasmids,
in combination with GABP/ß1 expression plasmids, to increase
luciferase expression by an OTR promoter construct. Combinatorial
interactions between distinct classes of sequence-specific
transcription factors play an important role in regulating eukaryotic
gene expression. Our findings are in line with studies that have
suggested that Ets proteins function cooperatively with AP-1
transcription factors to regulate the expression of a number of
different genes (see Ref. 41 for references). AP-1 binding sites have
been identified adjacent to Ets binding sites in many of these genes
and, in some cases, mutations of either the AP-1 or the Ets site
eliminate transcriptional activity mediated by these elements (42, 43, 44).
Cotransfection of Ets and AP-1 expression vectors resulted in
cooperative transactivation of the polyoma virus enhancer-derived PEA3
element containing adjacent Ets and AP-1 sites (44). Bassuk and Leiden
(41) showed that Elf-1, an Ets family member, associates directly with
Jun family members in the absence of DNA. In the presence of target
DNA, Elf1-Jun heteromer further associated with Fos family members to
form trimolecular protein complexes.
At the present time, the mechanisms of cooperative transcriptional
activation of the -85 OTR/Luc construct by GABP/ß and
c-Fos/c-Jun are not understood. Generally, many naturally
occurring AP-1 binding sites that are adjacent to Ets sites are
nonconsensus AP-1 motifs and do not bind AP-1 in the absence of the
appropriate Ets protein (45). It is possible that the half-CRE site
located between -56 and -52 acts as such an AP-1 site. Mutation of
this site significantly reduced OTR promoter-directed luciferase
activity, albeit to a modest extent relative to the effects of mutating
the EBS. Alternatively, AP-1 proteins might be important for the
phosphorylation of both GABP and GABPß. For example, the
GABP-responsive element of the IL-2 enhancer is regulated by
JNK/SAPK-activating pathways in T lymphocytes (45). The role of
phosphorylated GABP has not yet been established, because bacterially
expressed GABP and GABPß are capable of binding to the EBS of the
IL-2 enhancer, as shown by EMSA (45). It can be surmised that
phosphorylation is not required for DNA binding but is required for
transactivation, possibly by allowing the interaction of Ets family
members with other transcription factors.
In addition to AP-1 interactions, Ets family members interact with other factors at composite elements. Ets factors have been shown to interact directly with TFIID to induce assembly of a TBP-dependent complex (46). It has been suggested that promoters with weakly conserved TATA boxes, such as is indicated for the OTR, rely on activating transcription factors to aid in recruitment of TFIID to the promoter (47, 48). Ets family members have also been shown to interact with other nuclear proteins, including NF-IL6ß (49), NF-EM5 (50), ATF-1, and CREM (51). GABP has recently been shown to cooperate with c-Myb and C/EBP to activate the neutrophil elastase promoter (52).
The most compelling evidence for the importance of the region between -85 and -65 for DCC-FBS-induced expression of the OTR gene arises from the oligonucleotide studies and endogenous expression of the gene. Using OTR25 as a decoy, we found that the induction of [125I]OTA binding sites was totally eliminated. This phenomenon was not caused by squelching or other nonspecific interactions, because mutant oligonucleotides (M-1, -2, and -3) were only partially effective in inhibiting DCC-FBS induction of [125I]OTA binding activity. More specifically, use of either GABP/PU.1 or AP-1 consensus oligonucleotides resulted in inhibition of DCC-FBS induction, and the inhibitory effects were lessened when either oligonucleotide was mutated. The combination of both GABP/PU.1 and AP-1 oligonucleotide decoys was further inhibitory, at the same total concentration of plasmid DNA as either oligonucleotide alone.
In conclusion, we have used several independent approaches to
demonstrate that the first 85 bp of 5'-flanking sequence of the human
OTR gene is sufficient to direct more than several hundred fold induced
expression over that of a TATA box-containing promoter. This activity
is imparted by an EBS and an additional site lying immediately
upstream, which binds a protein that remains to be identified. In view
of the inhibitory effects of blocking PKC activity on serum induction,
and the results obtained with AP-1 expression plasmids and
oligonucleotide decoys, we conclude that transcriptional
activation of the human OTR gene results from the interaction of AP-1
and GABP transcription factors. From what is known from other EBS, we
surmise that the binding of GABP/ß to the EBS of the OTR gene
might also result in the interaction of GABP with the basal
transcription complex, leading to increased levels of transcription.
Our studies have provided the first clues toward understanding OTR gene
expression in mammary cells and have established the framework from
which to analyze further the multifactorial, complex mechanisms
involved in its regulated expression. We currently are in the process
of defining the basis of the interaction between GABP and AP-1 proteins
in transcriptional activation of the human OTR gene in breast
cells.
|
Acknowledgments |
|---|
and GABPß1 plasmids and antisera. |
Footnotes |
|---|
Received September 30, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
from ovine endometrium in vitro: correlation with estrous
cycle and oxytocin-receptor binding. Endocrinology 99:1107–1114/ß: an ETS domain
ankyrin repeat heterodimer bound to DNA. Science 279:1037–1041 and two newly
defined ets-related proteins. Genes Dev 6:2502–2512
, CRP3). J Immunol 155:4330–4338[Abstract]
3' enhancer. J
Biol Chem 270:10304–10313This article has been cited by other articles:
 |
|
 |
|
  M. E. Lucas, K. S. Crider, D. R. Powell, P. Kapoor-Vazirani, and P. M. Vertino Methylation-sensitive Regulation of TMS1/ASC by the Ets Factor, GA-binding Protein-{alpha} J. Biol. Chem., May 29, 2009; 284(22): 14698 - 14709. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ball, J. W. Wang, S. Wong, B. Zielnik, J. Mitchell, N. Wang, M. B. Stemerman, and B. F. Mitchell Phorbol ester treatment of human myometrial cells suppresses expression of oxytocin receptor through a mechanism that does not involve activator protein-1 Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E922 - E928. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Soloff, M. G. Izban, D. L. Cook Jr, Y.-J. Jeng, and R. C. Mifflin Interleukin-1-induced NF-{kappa}B recruitment to the oxytocin receptor gene inhibits RNA polymerase II-promoter interactions in cultured human myometrial cells Mol. Hum. Reprod., October 1, 2006; 12(10): 619 - 624. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. G. W. Fleming, T. E. Spencer, S. H. Safe, and F. W. Bazer Estrogen Regulates Transcription of the Ovine Oxytocin Receptor Gene through GC-Rich SP1 Promoter Elements Endocrinology, February 1, 2006; 147(2): 899 - 911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. F. Mitchell, B. Zielnik, S. Wong, C. D. Roberts, and J. M. Mitchell Intraperitoneal infusion of proinflammatory cytokines does not cause activation of the rat uterus during late gestation Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E658 - E664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-J. Jeng, S. L. Soloff, G. D. Anderson, and M. S. Soloff Regulation of Oxytocin Receptor Expression in Cultured Human Myometrial Cells by Fetal Bovine Serum and Lysophospholipids Endocrinology, January 1, 2003; 144(1): 61 - 68. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Copland, M. G. Zlatnik, K. L. Ives, and M. S. Soloff Oxytocin Receptor Regulation and Action in a Human Granulosa-Lutein Cell Line Biol Reprod, May 1, 2002; 66(5): 1230 - 1236. [Abstract] [Full Text]
|
|
|
|
|
|
M. Tanaka, A. Ueda, H. Kanamori, H. Ideguchi, J. Yang, S. Kitajima, and Y. Ishigatsubo Cell-cycle-dependent Regulation of Human aurora A Transcription Is Mediated by Periodic Repression of E4TF1 J. Biol. Chem., March 15, 2002; 277(12): 10719 - 10726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Luzzi, V. Holtschlag, and M. A. Watson Expression Profiling of Ductal Carcinoma in Situ by Laser Capture Microdissection and High-Density Oligonucleotide Arrays Am. J. Pathol., June 1, 2001; 158(6): 2005 - 2010. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. F. Mitchell and B. Schmid Oxytocin and its Receptor in the Process of Parturition Reproductive Sciences, May 1, 2001; 8(3): 122 - 133. [Abstract] [PDF]
|
|
|
|
|
|
B. Schmid, S. Wong, and B. F. Mitchell Transcriptional Regulation of Oxytocin Receptor by Interleukin-1{beta} and Interleukin-6 Endocrinology, April 1, 2001; 142(4): 1380 - 1385. [Abstract] [Full Text]
|
|
|
|
 |
|
 G. Gimpl and F. Fahrenholz The Oxytocin Receptor System: Structure, Function, and Regulation Physiol Rev, April 1, 2001; 81(2): 629 - 683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Copland, Y.-J. Jeng, Z. Strakova, K. L. Ives, M. R. Hellmich, and M. S. Soloff Demonstration of Functional Oxytocin Receptors in Human Breast Hs578T Cells and Their Up-Regulation through a Protein Kinase C-Dependent Pathway Endocrinology, May 1, 1999; 140(5): 2258 - 2267. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
