Endocrinology Vol. 140, No. 5 2268-2279
Copyright © 1999 by The Endocrine Society
Identification of a GABP
/ß Binding Site Involved in the Induction of Oxytocin Receptor Gene Expression in Human Breast Cells. Potentiation by c-Fos/c-Jun1
Sarasija Hoare,
John A. Copland,
Thomas G. Wood,
Yow-Jiun Jeng,
Michael G. Izban and
Melvyn S. Soloff
Department of Obstetrics and Gynecology (S.H., J.A.C., Y.-J.J.,
M.G.I., M.S.S.), and the Sealy Center for Molecular Science (T.G.W.,
M.G.I., M.S.S.), University of Texas Medical Branch, Galveston,
Texas 77555-1062
Address all correspondence and requests for reprints to: Dr. Melvyn S. Soloff, Department of Obstetrics and Gynecology, University of Texas Medical Branch, 301 University Boulevard, Galveston, Texas 77555-1062. E-mail: msoloff{at}utmb.edu
 |
Abstract
|
|---|
Oxytocin (OT) receptors (OTRs) mediate reproductive functions,
including the initiation of labor and milk ejection. OTR messenger
RNA levels are highly regulated, reaching the greatest
concentration in the uterus at the end of gestation, and in the mammary
gland during lactation. Factors directly effecting changes in OTR gene
expression in the mammary gland are not known, so the present studies
were done to elucidate possible regulators by characterizing the human
OTR gene promoter and 5'-flanking sequence. By analyzing expression of
promoter-luciferase constructs, we localized a region between
-85 and -65 that was required for both basal and serum-induced
expression in a mammary tumor cell line (Hs578T) that expresses
inducible, endogenous OTRs. This DNA region contains an
ets family target sequence (5'-GGA-3'), and a
CRE/AP-1-like motif. The specific Ets factor binding to the OTR
promoter was identified, by electrophoretic mobility immunoshift
assays, to be GABP
/ß. Cotransfection of a -85 OTR/luciferase
construct with vectors expressing GABP
and GABPß1 had only a
modest effect on expression, but cotransfection with GABP
/ß- with
c-Fos/c-Jun-expressing plasmids resulted in an increase of almost
10-fold in luciferase activity. Mutation of either the GABP- or
CRE-like binding sites obliterated the induction. These findings are
consistent with the involvement of protein kinase C activity in serum
induction of the endogenous gene in Hs578T cells. We showed the
requirement for GABP
/ß and c-Fos/c-Jun in endogenous OTR gene
expression, using oligonucleotide GABP and AP-1 binding decoys to
inhibit serum-induced increases in 125I-labeled OT
antagonist binding to Hs578T cells. Our work is the first
characterization of the proximal promoter region of the human OTR gene,
and it sets the stage for studying regulation of OTR expression in
breast cells.
 |
Introduction
|
|---|
THE OXYTOCIN (OT) receptor (OTR) is a G
protein-coupled receptor, located on the plasma membrane of myometrial
and endometrial/decidual cells of the uterus and of myoepithelial cells
of the mammary gland. The binding of OT to its receptor leads to
activation of signal pathways that stimulate contraction of uterine
smooth muscle and mammary myoepithelial cells and PG release from
endometrial/decidual cells of the uterus. Up-regulation of OTR
concentrations occurs in all three tissues and is vital for the
initiation of labor (1) milk ejection from the mammary gland (2, 3) and
regulation of the length of the estrous cycle (4), respectively. The
concentration of OTR binding sites in the human uterus increases about
150-fold by the end of pregnancy (5), and these changes are a
reflection of increased OTR messenger RNA (mRNA) levels (6). Although
steady-state mRNA levels have been shown to increase in several OT
target tissues, it has been shown only recently that up-regulation of
OTR in rabbit amnion cells in primary culture is the result of
transcriptional activation (7). There have been extensive studies on
factors regulating OTR concentrations in uterine smooth muscle and
amnion in laboratory species (8, 9, 10), but very little is known about
the regulation of OTR mRNA levels in the mammary gland. Uterine OTR
concentrations are up-regulated by estrogen (10, 11), and progesterone
treatment inhibits the estrogen effect in rats (11). In contrast, OTR
concentrations in rabbit amnion cells are up-regulated by agents that
elevate intracellular cAMP concentrations and by glucocorticoids (7).
The concentrations of OTR in the mammary gland are relatively low at
the end of parturition, when uterine and amnion receptor concentrations
are greatest, but increase to maximal levels during lactation in the
rat (12). Because the temporal pattern of OTR expression differs
between the mammary gland and uterus or amnion, it would seem that the
mammary receptors are regulated differently than uterine/amnion
receptors. We recently demonstrated that a human carcinosarcoma cell
line (Hs578T) expresses OTRs that are up-regulated by dextran-coated
charcoal-treated FBS (DCC-FBS) (13). Up-regulation was inhibited by
pretreatment with the protein kinase C (PKC) inhibitor, GF 109203X
(13), indicating the possible involvement of AP-1 proteins. Because
OTRs are not universally expressed and are regulated according to
reproductive stage, it would seem that the OTR gene has important
regulatory and/or enhancer elements. To better understand OTR
regulation in breast cells, we cloned the human OTR gene and expressed
constructs containing the promoter region fused to luciferase in Hs578T
cells.
The human OTR gene spans approximately 19 kbp and is divided into four
exons and three introns (Ref. 14 and the present studies). Only a
single OTR gene has been demonstrated in several species (14, 15, 16). We
have shown in the present studies that the human OTR gene contains both
a TATAA-like box and initiator element (Inr). We also have defined an
Ets binding site (EBS) region in the upstream promoter that is
absolutely essential for both basal and serum-induced expression of the
OTR gene, and we have characterized ets gene family proteins
binding to this site as GABP
/ß. In addition, AP-1 expression
plasmids synergize with GABP
/ß in inducing OTR gene expression.
These studies thus give us the first clues as to how the human OTR gene
is induced in mammary cells.
 |
Materials and Methods
|
|---|
Library construction and screening
Construction of the human genomic library used in isolating the
OTR gene was previously described (17). The library was screened using
a PCR-generated complementary DNA (cDNA) probe containing the terminal
320 bp of the OTR open reading frame and 70 bp of the adjacent 3'
nontranslated sequence.
DNA sequence analysis
DNA sequencing was performed using a cycle sequencing protocol
and AmpliTaq DNA polymerase (Perkin-Elmer Corp., Norwalk,
CT). Sequence analysis was done using a model 373A DNA sequence
analyzer (Perkin-Elmer Applied Biosystems, Foster City,
CA).
Extended-length PCR
Extended-length PCR (18) was performed using 50 ng human genomic
DNA and primers derived from the 3' end of exon 3
(5'AGCGTCAAGCTCATCTCCAAGGCC 3') and the 5' end of exon 4 (5'
TCTGCCCTTCAGGTAGCTGGCGG 3'). The amplification reaction (100 µl)
contained 50 pmol of each primer and 1 U of a 50:1 mix of rTth DNA
polymerase (Perkin-Elmer Corp.) and Vent DNA polymerase
(New England Biolabs, Inc., Beverly, MA). The
amplified DNA was cloned using a pCRII vector (Invitrogen,
Carlsbad, CA) and was subjected to restriction and DNA sequence
analysis.
Ribonuclease (RNase) protection assay
The RNA probe used in the RNase protection studies was
synthesized using a plasmid template DNA derived from the human OTR
genomic clone, p81. A 491-bp DNA fragment, containing 355 bp of
sequence derived from the 5' end of exon 1 and 124 bp of adjacent 5'
flanking sequence, was PCR-amplified and cloned into pSP73. Purified
plasmid was linearized by digestion with EcoRI (New England Biolabs, Inc.), and antisense transcripts were labeled
in vitro using
-32P-cytidine 5'-triphosphate
(800 Ci/mmol) and T7 RNA polymerase (Ambion, Inc., Austin,
TX). Total RNA was isolated (19) from human myometrium obtained
at term for medical reasons and was ethanol-precipitated in
increasing amounts with the OTR antisense probe (1.4 x
105 cpm). DNA samples were analyzed by electrophoresis on
5% acrylamide, 8 M urea gels.
Primer extension analysis
A 26-nucleotide oligomer complementary to the region
between positions +95 to +120 in exon 1 was end-labeled (6 x
108 dpm/µg) using T4 polynucleotide
kinase (New England Biolabs, Inc.) and
[32P]
-ATP (DuPont NEN, Boston, MA)
3000 Ci/mmol. Primer was annealed to human myometrial total RNA (50
µg), extended with murine leukemia virus reverse
transcriptase, and the extended products were analyzed on a 6%
acrylamide, 8 M urea gel in parallel with chain termination
sequencing reactions performed using the above primer and a segment of
human genomic DNA containing the OTR exon 1 and adjacent 5' flanking
region.
Plasmid constructions
Insert DNAs from the
genomic clones (
81,
61) were
subcloned as SalI DNA fragments into pUC18, creating
plasmids p81 and p61. A 7.8-kb EcoRI DNA fragment,
containing the first three exons of the human OTR gene and 2.9 kb of 5'
flanking sequence, was isolated from p81, subcloned into pUC18, and
designated p1500. A unique HincII site within exon 1 was
used in isolating a 2.2-kbp SstI-HincII DNA
fragment from p1500. This DNA fragment was subcloned into pBluescript
II SK- (SstI-EcoRV). The
HindIII site next to the EcoRV site in the
pBluescript polylinker was used in isolating an
SstI-HindIII DNA fragment. This DNA was cloned
into pGL2-Basic (Promega Corp., Madison, WI) to
create p-1770. A 2.3-kbp SalI-SstI DNA fragment
derived from p81 was introduced into p-1770
(XhoI/SstI) to generate p-4225. A unique
NdeI site within the 5' flanking sequence was used to
isolate a 1.3-kbp NdeI-HindIII DNA fragment. This
DNA was cloned into pGL2-Basic (SstI/HindIII)
using a SstI-NdeI linker to generate p-992. The
linker also contained a unique BglII site. Digestion of
p-992 with BglII, followed by treatment with Klenow
polymerase and digestion with EcoRV, resulted in the
deletion of 235 bp and created the 5' flanking sequence for p-757.
Digestion of p-992 with BglII and NsiI, and subsequent
treatment with T4 DNA polymerase, resulted in a deletion of
356 bp and generated the 5' flank sequence for p-636.
SstI-HindIII digests were used in isolating the
5' flank sequences for p-861 and p-118.
BamHI-HindIII digests were used in p-145. PCR was
used to create the other 5'-deletion constructs. Sense primers were
paired with the antisense HindIII primer
5'AAGCTTGATGACTCCCCCCGGGGAAGTTGC 3', which terminates at +350.
Site-specific mutations were created in PCR primers, by the method of
Higuchi et al. (20). To construct vectors containing the
-4225/+1357 sequence, a 2.4-kbp BamHI fragment, containing
exons 1, 2, and 78 bp of the noncoding region of exon 3, was isolated
from p1500. Blunt ends were created using Klenow polymerase,
HindIII linkers were ligated, and the DNA was digested with
HindIII and EcoRV. This DNA and a 3.25-kb
SalI-EcoRV DNA fragment, containing the 5'
sequence of the OTR gene derived from p81, were ligated and cloned
into pGL2-Basic that was linearized with
HindIII-XhoI. All plasmid DNAs were purified by
CsCl density gradient centrifugation before use in DNA transfection
assays. Rous sarcoma virus-chloramphenicol acetyltransferase
(RSV-CAT) was identical to the sequence reported by Gorman
et al. (21). The CMV-GABP
and CMV-GABPß1 expression
vectors were gifts from Dr. Catherine Thompson (Neuroscience/Kennedy
Krieger Institute, Johns Hopkins University School of Medicine,
Baltimore, MD). GABP
and GABPß1 plasmids were gifts from
Drs. Thomas Brown, Pfizer, Inc. (Groton, CT), and
Dr. Steven McKnight (Tularik, Inc., South San Francisco,
CA).
Transfection and cell culture
A human breast ductal carcinoma cell line Hs578T (22) was
obtained from the American type culture collection
(Manassas, VA). Cells were maintained in DMEM supplemented with 5% FBS
and penicillin/streptomycin and were cultured in an atmosphere of 5%
CO2. Transient transfections were done by calcium phosphate
coprecipitation in triplicate 60-mm plates, using 10 µg OTR
promoter-luciferase reporter vector, 0.5 µg RSV-CAT (control for
uniformity of transfection efficiency), and 9.5 µg carrier pGEM7Z
plasmid DNA for each triplicate set of plates. Twenty-four hours after
transfection, cells were rinsed, and fresh medium was added. Cells were
cultured for an additional 24 h and harvested for analysis of
reporter activities. Serum induction studies were carried out with
DCC-treated FBS, 20% (13). The experiments were done with three
different plasmid preparations of each construct.
Reporter assays
Cells were rinsed three times with PBS and lysed in place with
0.3 ml of detergent solution [25 mM Tris-phosphate (pH
7.8), 2 mM dithiothreitol, 2 mM
1,2-diaminocyclohexane-N,N,N,N-tetracetic acid, 10%
glycerol, and 1% Triton X-100]. Luciferase activity was determined
using an AutoLumat luminometer, and the activity of each sample was
normalized relative to CAT activity. CAT activity was determined using
the enzyme-linked immunosorbent assay kit and protocol described by
Boehringer Mannheim (Indianapolis, IN).
Deoxyribonuclease (DNase) I footprinting
Nuclear extracts from Hs578T cells were prepared by a
modification of the method of Shapiro et al. (23), after
purification of the nuclei by sucrose density gradient centrifugation.
The plasmid used for DNase I protection was constructed by inserting a
SmaI (-147)/HaeIII (+56) fragment of the OTR
gene into the SmaI site of pUC18. Inserts in both
orientations were selected. The plasmid was linearized by digestion
with EcoRI, labeled by filling in the 5'-overhangs using
[32P]
-deoxy-ATP and the Klenow fragment of DNA
polymerase, and the insert excised by digestion with
HindIII. Labeled DNA was separated from plasmid vector on
5% polyacrylamide gels. Increasing amounts of nuclear protein (see
figure legends) were incubated with 1 µg poly(dI-dC)/poly(dI-dC)
(Pharmacia LKB, Piscataway, NJ) for 20 min on ice
before the addition of approximately 1 ng of labeled DNA. The mixtures
were incubated for 60 min on ice, then digested for 1 min with optimal
amounts of DNase I. DNA from the digested samples was resolved on a 7%
polyacrylamide-urea gel.
Electrophoretic mobility shift assays (EMSA)
Synthetic oligonucleotides corresponding to the regions outlined
in the text were annealed with complementary sequences and end-labeled
with [
-32P]ATP and T4 polynucleotide
kinase (Promega Corp.). The EMSA were performed by
incubating 10 µg of nuclear protein, described above, with about 1 ng
of labeled probe. In competition studies, nonradioactive competitor
oligonucleotides were incubated with nuclear protein extract for 10 min
at room temperature before addition of the probe. Samples were loaded
onto a Tris-glycine (pH 8.5), EDTA 4% nondenaturing polyacrylamide gel
(40:1 acrylamide:BIS). Radioactivity on dried gels was visualized by
autoradiography using Kodak XAR-5 film (Eastman Kodak Co., Rochester, NY). The consensus binding site
oligonucleotides for Sp1, CRE, PU.1/GABP
, and Ets-1/PEA3 were
purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz,
CA). In antibody supershift assays, antibodies were incubated with
nuclear extracts for 20 min at room temperature before addition of
radiolabeled oligonucleotide. Rabbit polyclonal IgG, directed against
Ets-1/Ets-2, was purchased from Santa Cruz Biotechnology, Inc.. Rabbit polyclonal antibodies, directed against recombinant
GABP
and GABPß1, were gifts from Dr. Thomas Brown and Dr. Steven
McKnight.
Oligonucleotide decoy inhibition of serum-induction of
[125I]OTA (OT antagonist) binding sites
Hs578T cells were serum starved for 48 h in 0.5% BSA/DMEM,
containing antibiotics. Double-stranded oligonucleotides were added to
the medium, either during this 48-h period or during the last 24
h, at a concentration of either 25 or 50 µM, according to
the figure legends. DCC-FBS, 20%, was then added, along with 25 or 50
µM of the same oligonucleotide; and the cells were
analyzed 24 h later for [125I]OTA (OTA =
[d(CH2)5,Tyr(Me)2,Thr4,Tyr-NH29]ornithine
vasotocin) binding sites. Specific [125I]OTA
binding assays were carried out in triplicate, using a saturating or
near-saturating concentration of [125I]OTA, as previously
described (13). The oligonucleotides used were OTR25, OTR25M-1, -2, -3,
and oligonucleotides corresponding to the consensus GABP/PU.1 site (GGG
CTG CTT GAG GAA GTA TAA GAA T), mutated (bases underlined)
GABP/PU.1 (GGG CTG CTT GAG AGA GTA TAA GAA T), the
consensus AP-1 site (CGC TTG ATG ACT CAG CCG GAA), and mutated AP-1
(CGC TTG ATG ACT TGG CCG GAA).
 |
Results
|
|---|
OTR gene structure
To isolate the OTR gene, we screened a human genomic library
(7.8 x 105 phage) using a cDNA probe representing the
terminal 320 bp of the OTR open reading frame and 70 bp of adjacent 3'
untranslated sequence. Ten clones were isolated, and a preliminary
characterization using EcoRI and BamHI
restriction analysis indicated that each clone belonged to either one
of two groups. A representative clone from each group (p81, p61)
was selected for detailed restriction mapping and DNA sequence analysis
(Fig. 1
). The absence of overlapping
homology between the two clones prevented an accurate estimate of the
size of intron 3 and a contiguous alignment of the OTR gene. To
determine the size of intron 3, we performed extended-length PCR using
primers corresponding to coding sequences at the 3' end of exon 3 and
the 5' end of exon 4. A 13.7-kbp fragment of DNA was amplified, cloned,
and characterized by partial nucleotide sequencing and by restriction
mapping. This clone, pXL-3, permitted the contiguous alignment of the
human OTR gene (Fig. 1
). The gene is organized into four exons that
span a total of about 19 kbp.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 1. Physical map of the human OTR gene. Exons are
represented as solid boxes for untranslated sequences
and open boxes for translated sequences. A complete
restriction map is presented for the following restriction
endonucleases: BamHI, B; BglII, Bg;
HindIII, H; KpnI, K;
EcoRI, R; SmaI, S; XhoI,
X. Plasmids used in determining the gene structure are shown
below the genomic map.
|
|
Transcription start site
The location of the 5' end of exon 1 was determined by both RNase
protection and primer extension analyses (Fig. 2
). A 535-bp RNA probe representing 101
bp of the proximal 5' end of human OTR cDNA (24) and 378 bp of adjacent
5' sequence was annealed with human myometrial total RNA, digested with
RNase, and analyzed by electrophoresis on a urea-polyacrylamide gel.
The uterine RNA protected one major- and a minor-labeled RNA band (Fig. 2A
, lanes 35). The size of the major band, about 345 nucleotides, is
consistent with the previously reported transcription start site for
the human OTR (14). Primer extension was performed to identify the
precise nucleotide site for the initiation of transcription. The primer
extension reaction products were analyzed in parallel with chain
termination sequencing reactions using the analogous primer and an OTR
human genomic DNA subclone containing exon 1 and adjacent 5' flanking
sequences. Two start positions, which are in close positional agreement
with those previously reported (14), were identified (Fig. 2B
). For
purposes of nomenclature of constructs used in transient transfection
studies, we assigned the major start site (T1 on the template strand,
Fig. 2
) as position +1.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 2. Determination of the human OTR transcription start
site. A, RNase protection analysis. A 535-nucleotide probe (lane 1) was
hybridized with either 50 µg yeast RNA (lane 2), or human uterine
total RNA: 50 µg (lane 3), 25 µg (lane 4), or 10 µg (lane 5)
before nuclease digestion (lanes 25). Samples were analyzed by
electrophoresis on a urea-5% acrylamide gel and by autoradiography.
Labeled RNA markers (lane 6) were run in parallel. B, Primer extension
analysis. Products from the primer extension reaction (lane 1) were
analyzed on a 6% acrylamide-urea gel. Chain termination sequencing
reactions were run in parallel. Nucleotides corresponding to the sizes
of the major and minor reverse transcripts are indicated by
asterisks.
|
|
5'-Deletion analysis
Computer-assisted analysis of 1770 bp of 5'-flanking sequence of
the OTR gene, which delimits the extent that was sequenced, indicated a
number of potential transcriptional regulatory sites (Fig. 3
). To define key regulatory regions in
the OTR gene, luciferase activity of serial deletion mutants of the OTR
5'-flanking region (ranging from -4225 to -65) was determined. In
these preliminary studies, the transfected Hs578T cells were incubated
in the presence 10% FBS so that only serum-induced expression was
determined. Between -4225 and -85, each deletion had only a modest
effect on luciferase expression (Fig. 3
). Luciferase activity of the
deletion mutants ranged from 0.662.5 times that of the -4225/+350
construct. The level of expression of the -85 construct was about the
same as that of the -4225 mutant. Greater luciferase activities of the
-992, -861, -757, and -636 mutants, relative to the -85 or -4225
constructs, suggest the possibility of weak silencer elements upstream
of -992, but this observation was not explored further in the present
studies. Expression fell to about 20%, when the region between -85
and -73 was deleted, and further reduction (to values comparable with
the activity of the promotorless pGL2-Basic vector) was observed when
the region between -73 and -65 was deleted (Fig. 3
). The findings
therefore define a region between -85 and -65 that is critical for
OTR promoter activity. To verify that this region imparts the serum
inducibility seen with endogenous OTRs, transfections were carried out
with -4225, -1770, -85, and -65 constructs in the presence of low
serum concentration (5%). Twenty-four hours after transfection, 20%
DCC-FBS was added for 24 h, and cell lysates were prepared for
reporter analysis. The addition of serum caused an increase of
approximately 3-fold in luciferase activity in the -4225, -1770, and
-85 constructs, but the activity of the -65 construct was unchanged
(Fig. 4A
). Basal activity (in 5%
DCC-FBS) was also increased in the -4225, -1770, and -85 constructs
(vs. the -65 construct). Thus, the region between -85 and
-65 is necessary for both basal and serum-induced expression of the
OTR promoter. As shown in our previous studies, serum inducibility of
the endogenous OTR was blocked by the PKC inhibitor GF 109203X (13). GF
109203X, added in increasing concentrations 30 min before addition of
serum, likewise inhibited serum-induced expression from the -85
construct (Fig. 4B
).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 3. Effects of deletion of 5'-flanking sequence on OTR
promoter activity. Sequentially deleted 5'-flanking regions of the
human OTR gene were fused to a luciferase reporter and transfected into
Hs578T cells. Potential regulatory elements, and deletion sites used,
are indicated across the top of the figure. Luciferase
values were normalized to CAT activity from a cotransfected RSV-CAT
plasmid and expressed as the percent stimulation (± SE) of
three replicate determinations, relative to the -4225/+350 construct.
The experiment was repeated at least three times with three different
plasmid preparations, with comparable results.
|
|

View larger version (8K):
[in this window]
[in a new window]
|
Figure 4. A, Serum induction of OTR/Luc constructs. Hs578T
cells in 5% FBS were transfected with 10 µg/3 dishes (60-mm each) of
the appropriate reporter construct, and with 0.5 µg/3 dishes of RSV
CAT for normalization of the luciferase results. DCC-FBS, 20%, was
added 24 h after transfection, and cell lysates for luciferase
determination were prepared 24 h later. B, Inhibition of serum
induction of luciferase expression by the -85OTR/Luc construct with
increasing concentrations of PKC inhibitor, GF 109203X, added 30 min
before serum induction.
|
|
Footprint analysis of the proximal promoter region
To further define the critical region of the human OTR promoter
capable of interacting with transcription factors, we carried out DNase
I footprint analysis of OTR DNA between -147 and +56 using nuclear
extracts from Hs578T cells. Three sites were clearly protected on both
strands (Fig. 5
): the region containing
the consensus sequence for an Inr around the transcription start site
(depending on the template strand, labeled as 1 or D in Fig. 5
); a
TATA-like box (labeled 2 or C in Fig. 5
); and an extensive region
between -100 and -44 (labeled 3 and 4 or B in Fig. 5
). An area near
the -147 terminus (GAAGAACAT, labeled 5 or A in Fig. 5
) that resembles
a partial GRE (25) was also protected. The region between -100 and
-44 is complex, and it includes a potential EBS with the core
consensus sequence of GGA (-77 to -75), a GC box (Sp1 site at -68 to
-62), and the sequence TGACGAGT (-57 to -50), which resembles a CRE
octamer motif 5'-TGACGTCA-3' (25).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 5. DNase I footprinting of the region of the human
OTR gene between -147 and +56. Both labeled template and nontemplate
strands are shown (A). The outer lanes of each panel
contained DNA to which no nuclear extract was added. Either 15, 30, or
50 µg of nuclear protein was incubated with DNA before DNase I
treatment, as indicated. Protected areas on the template and
nontemplate strands are identified by letter or number, respectively,
and by the boxed regions in the diagram (B). Putative
transcription factor recognition sites are indicated in bold
letters. The transcription start site is indicated by +1.
|
|
Characterization of potential binding sites for transcription
factors within the -85 to -65 region
The -65 deletion, which caused the sharp reduction in luciferase
activity (to that of a promotorless construct) (Fig. 3
), interrupts a
Sp1 motif (GC box). In view of the ubiquity of Sp1 and its involvement
in transcription initiated by many different promoters, it was
important to determine whether scission of the GC box accounted for the
sharp reduction in functional activity. An OTR DNA fragment, containing
the putative Sp1 binding site (-95 to -53), did not compete with an
authentic end-labeled Sp1 oligonucleotide for the specific band that
was gel shifted by Hs578T nuclear extracts (data not shown). The
end-labeled OTR oligonucleotide (-95 to -53) also failed to form
Sp1-specific bands with the nuclear extracts. Sp1 binding by the -95
to -53 oligonucleotides was only apparent after addition of purified
recombinant Sp1 protein (Promega Corp.), and binding was
much weaker than that seen with the recombinant protein and the
authentic Sp1 oligonucleotide (data not shown). The data therefore
suggest that the GC-rich site in the OTR promoter is a weak Sp1-binding
site. Furthermore, mutation of the Sp1 site had no effect on OTR
promoter activity (see Fig. 8
). Partial protection of the GC-rich area
shown by DNase I footprinting (Fig. 5
) might therefore be caused by
proteins binding to adjacent sites.

View larger version (10K):
[in this window]
[in a new window]
|
Figure 8. Effects of mutation of the Sp1, CRE-like, and Ets
sites in the proximal promoter region of the human OTR gene on
promoter-driven luciferase activity in Hs578T cells. Sp1 and CRE site
mutations were constructed in the context of the -145/+351 vector.
M-1, M-2, and M-3 mutations were constructed in the context of the
-95/+351 vector. The data represent the mean of triplicate (±
SE) determinations. The experiments were repeated at least
three times.
|
|
Site 3 (Fig. 5
) contains a CRE-like site (TGACG). In view of the fact
that binding of transcription factors to this site might be reduced by
scission of the promoter at -65, we also carried out EMSA of an
oligonucleotide containing this sequence. Addition of the
32P-labeled OTR35 (-73 to -44) to Hs568T nuclear extracts
resulted in the formation of a band that was competed away by both
nonradioactive OTR35 and by an oligonucleotide containing a consensus
CRE (Fig. 6A
). Mutation of two bases in
the putative CRE sequence of OTR35, from TGACG to TGTGG,
eliminated competition with [32P]OTR35 (Fig. 6A
). An AP-1
consensus oligonucleotide also competed with the labeled probe for
protein binding (Fig. 6B
).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 6. EMSA of 5'-flanking sequence between -73 and -44
of the human OTR gene and nuclear proteins from Hs578T cells. A,
Competition for protein binding by the 32P-end-labeled
oligonucleotide and nonradioactive oligonucleotides corresponding to
self, a CRE consensus sequence, and a mutated CRE sequence; B,
competition by an AP-1 consensus sequence. Competition was carried out
with 50-, 100-, and 150-fold excesses of nonradioactive
oligonucleotide.
|
|
The area corresponding to region 4 in the DNase I footprint (Fig. 5
)
and lying between -85 and -65 contains a purine-rich stretch with a
core 5'-GGA-3' sequence that is characteristic of an Ets family EBS. As
shown by electrophoretic mobility shift analysis, three bands were
shifted using Hs578T nuclear extracts and an end-labeled
oligonucleotide corresponding to the sequence between -87 and -63
(OTR25, Fig. 7A
). All three bands were
competitively reduced by addition of an excess of unlabeled OTR25 (Fig. 7A
). An oligonucleotide containing an EBS recognized by Ets1 and PEA
(two ets family members) partially competed with labeled
OTR25 (Fig. 7A
). In contrast, addition of an oligonucleotide containing
a consensus-binding site for GABP
and PU.1 Ets family members
completely displaced the two upper bands. The same two bands were
formed when the nuclear extracts were added to a 5'-end-labeled
consensus GABP
/PU.1 oligonucleotide (data not shown). To narrow the
binding region, we created replacement mutants that modified the GGA of
the EBS and sites both immediately up- and down-stream from the EBS in
the OTR promoter. Competition, as studied by EMSA with end-labeled
OTR25 and oligonucleotides that were synthesized by replacing
nucleotides -74 to -71 (M-1), -79 to -75 (M-2), and -83 to -80
(M-3) (Fig. 7B
), showed that the binding of nuclear factors by all
three mutants was modified (Fig. 7C
). The M-3 mutant failed to
compete with the band having the greatest mobility; but like the
wild-type OTR25, it competed with the upper two bands (Fig. 7C
), which
were also displaced by the GABP
/PU.1 oligonucleotide (Fig. 7A
).
These findings are consistent with the observation that the sequence
between -80 and -83 does not correspond to a consensus GABP
/PU.1
binding site. The M-1 and M-2 mutants partially competed for all three
bands, compared with the wild-type oligonucleotide (Fig. 7C
). It
therefore seems that two classes of protein complexes exist. The upper
two complexes seem to contain ets family members binding to
the EBS, whereas the faster migrating complex interacts with the region
of the promoter that is covered by all three mutated sites.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 7. EMSA of 5'-flanking sequence between -87 and -63
of the human OTR gene and nuclear proteins from Hs578T cells. A,
Competition for protein binding by the 32P-end-labeled
oligonucleotide and nonradioactive oligonucleotides corresponding to
self, and consensus sequences to Ets/PEA and GABP /PU.1, using
nuclear extract from Hs578T cells. Competition was carried out with
100- and 150-fold excesses of nonradioactive oligonucleotide. B,
Oligonucleotides containing mutated bases in the -87 to -63 region.
The EBS consensus sequence in the wild-type, 5'-GGA-3' is
indicated by the boxed area. Mutated bases are
underlined. C, EMSA of the mutant oligonucleotides shown
in B. Competition between the mutant oligonucleotides and
32P-end-labeled wild-type oligonucleotide was carried out
with nuclear extract from Hs578T cell nuclear extracts.
|
|
Effects of Sp1, CRE, and Ets site mutations on functional activity
of the OTR promoter
A three-base substitution in the Sp1 site (GGGCGGG to
ACCCGGG) in the -145 promoter construct had no effect on
luciferase expression (Fig. 8
). Mutation
in the CRE-like site significantly (P < 0.05) reduced
luciferase activity by about 30% (Fig. 8
). Mutation of both Sp1 and
CRE-like sites resulted in about the same activity as the CRE mutant
alone (Fig. 8
). All three mutations in the purine-rich region
corresponding to M-1, -M-2, and M-3 in the context of the -95OTR/Luc
construct resulted in 4- to 8-fold decreases in luciferase expression
(Fig. 8
). These results are consistent with the ability of the three
mutant oligonucleotides to modify the gel shift results (Fig. 7C
). From
the functional analysis of the M-1- and M-2-linked luciferase
constructs, it is clear that the EBS is critical for expression of the
OTR promoter. In addition, mutation of the -83 to -80 region (M-3),
which was associated with the lowest gel-shifted band and not
identifiable with GABP
/PU.1. (Fig. 7C
), also markedly reduced OTR
promoter-driven luciferase activity (Fig. 8
).
Identification of protein(s) binding to the EBS
Based on the preceding data, any of the 20 ets family
members could potentially interact with the EBS. An oligonucleotide
containing a specific PU-1 binding site from the SV40 enhancer did not
compete with OTR25 for protein binding (data not shown). Insofar as
PU.1 expression is restricted to cells of hematopoietic lineage (26),
we did not consider this ets family member as a potential
regulatory factor in Hs578T cells. To better define the specific
factors in Hs578T nuclear extracts that bind to the EBS, we carried out
immunoshift analyses using antibodies to Ets proteins. Antibody to
Ets1/Ets2, which cross-reacts with a variety of Ets family members, had
no effect on the EMSA pattern obtained with end-labeled OTR25 and
Hs578T nuclear extracts (Fig. 9A
).
Antibodies to both GABP
and GABPß1, which (unlike any other
members of the ets family) form a heteromeric complex,
caused a supershift with OTR25 and Hs578T nuclear extracts (Fig. 9B
).
These findings indicate that GABP
/ß participates in the activation
of OTR gene expression in Hs578T cells.

View larger version (5K):
[in this window]
[in a new window]
|
Figure 9. Identification of protein(s) binding to the EBS,
using antibodies to A: Ets-1/Ets-2 (A), GABP or GABPß1 (B).
32P-end-labeled oligonucleotide (-87 to -63) was
incubated with nuclear extracts from Hs578T cells, followed by
incubation with each antibody. S shows the position of the
immunoshifted complexes.
|
|
The effect of GABP and AP-1 overexpression on OTR promoter
activity
Cotransfection of -85 OTR/Luc with CMV-driven expression vectors
for GABP
and GABPß1 caused a modest increase in luciferase
expression in the presence of 5% FBS (Fig. 10A
). However, expression was markedly
enhanced when the cells were cotransfected with GABP
/ß and
c-Fos/c-Jun expression plasmids. Maximal responses to
GABP
/ß1, and c-Fos/c-Jun were obtained with 2 µg and 5
µg, respectively (data not shown). Thus, the addition of both caused
a response beyond that elicited by the maximal concentration of
c-Fos/c-Jun alone. The increase in luciferase activity with the
combined plasmids was approximately 8.5-fold (Fig. 10A
). These findings
are consistent with the results of studies showing that inhibition of
PKC activity with GF 109203X results in reduced expression of the
endogenous OTR gene (13) and of serum induction of the -85OTR/Luc
construct (Fig. 4B
). These findings also indicate that GABP
/ß
affects the interaction of c-Fos/c-Jun with its DNA binding sites
either directly or indirectly. Cotransfection of GABP
/ß and
c-Fos/c-Jun expression vectors in pGL2 or the -65 construct had
no noticeable effect on luciferase activity (Fig. 10B
). As in the case
of the -85 construct, cotransfection with the combined expression
plasmids resulted in elevated luciferase expression from the -1770 and
-4425 constructs (Fig. 10B
). Luciferase activity was less in cells
transfected with the -4225 plasmid than with -1770 or -85.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 10. A, Effects of GABP , GABPß1, c-Fos, and c-Jun
expression on OTR promoter activity. GABP and GABPß1, c-Fos and
c-Jun, and a combination of the four were transfected into Hs578T cells
along with -85OTR/Luc and RSV CAT. The amounts of each expression
plasmid transfected refer to the micrograms of DNA added to the total
of three 60-mm plates. B, Induction of luciferase expression in -85,
-1770, and -4225 OTR/Luc constructs (10 µg/3 plates) by
cotransfection with GABP /ß and c-Fos/c-Jun (+). Sham-transfected
cells (-) were used as a control. The amount of DNA per total of three
60-mm plates is indicated. C, Cotransfection of GABP /ß and
c-Fos/c-Jun expression plasmids (+) with 10 µg/3 plates of
-95OTR/Luc or -95OTR/Luc constructs containing mutated sites (M-1,
-2, or -3). D, Cotransfection of GABP /ß and c-Fos/c-Jun expression
plasmids (+) with 10 µg/3 plates of -145OTR/Luc or -145OTR/Luc
constructs containing mutated Sp1, CRE-like, or both Sp1 and CRE-like
sites. The data in all experiments represent the mean of triplicate (±
SE) determinations. The experiments were repeated at least
three times.
|
|
These studies further show that the GABP/AP-1 regulated region lies
between -85 and -65 of the OTR 5'-flanking sequence. This conclusion
is supported by the results obtained with M-1, -2, and -3 constructs.
Cotransfection of wild-type -95OTR/Luc with GABP/AP-1 expression
plasmids resulted in an increase of approximately 8-fold in luciferase
activity (Fig. 10C
). Activity was reduced markedly with M-1 and M-2
mutant -95OTR/Luc constructs, as shown in Fig. 8
(and Fig. 10C
), and
cotransfection with GABP/AP-1 expression plasmids resulted in an
increase of only 2-fold (approximately) in luciferase activity (Fig. 10C
). Coexpression of -95OTR/Luc with the M-3 mutation and GABP/AP-1
expression plasmids resulted in an increase of approximately 5-fold in
luciferase activity (Fig. 10C
).
Coexpression of GABP/AP-1 expression plasmids with the -145OTR/Luc
construct also resulted in an increase of approximately 8-fold in
luciferase activity (Fig. 10D
). Mutation of the Sp1 site, in the
context of -145OTR/Luc, still allowed an increase of approximately
6-fold (Fig. 10D
). However, mutation of the CRE-like site alone, or the
CRE-like and Sp1 sites, resulted in a reduction of approximately 50%
in basal luciferase activity and the absence of any induction with
GABP/AP-1 expression vectors. These results suggest that both EBS and
CRE-like sites are involved in GABP/AP-1-induced OTR gene
expression.
Reduction in expression of the endogenous OTR by oligonucleotide
decoys
Cells were serum starved in 0.5% BSA/DMEM for 48 h and then
treated with 25 µM OTR25 for 24 h before DCC-FBS
(20%) stimulation. After another 24 h in the presence of
oligonucleotide and serum, the cells were used to measure specific
[125I]OTA binding. The addition of DCC-FBS alone resulted
in a 5.6-fold increase in binding activity (Fig. 11A
). The presence of OTR25 (25
µM), however, completely eliminated DCC-FBS-induced
expression of binding activity (Fig. 11A
). Incubation of cells with
OTR25M-1, -2, or -3 (25 µM) also resulted in reduction of
specific [125I]OTA binding, but the inhibition was only
39%, 21%, and 57% for OTR25M-1, OTR25M-2, and OTR25M-3, respectively
(Fig. 11A
). These findings show that mutation of the EBS (OTR25M-2) has
the greatest effect on attenuating the decoy effects. Further evidence
for the involvement of the EBS in serum induction of OTR gene
expression in Hs578T cells is shown by the inhibition of serum
induction by a GABP/PU.1 consensus oligonucleotide. Incubation of cells
with 50 µM GABP/PU.1 oligonucleotide, for 24 h
before serum induction and for 24 h during induction, resulted in
a reduction of approximately 40% in [125I]OTA binding
(Fig. 11B
). Mutation of the consensus sequence resulted in no reduction
at all (Fig. 11B
). Incubation of cells with a consensus AP-1
oligonucleotide (50 µM) reduced [125I]OTA
binding by about 45%, and mutation of the oligonucleotide also
eliminated the reduction (Fig. 11B
). The combination of GABP/PU.1 and
AP.1 oligonucleotides further reduced [125I]OTA binding
activity by about 70% and 75%, respectively, when either 25
µM or 50 µM of each oligonucleotide was
used (Fig. 11B
).

View larger version (8K):
[in this window]
[in a new window]
|
Figure 11. Effect of oligonucleotide decoys on
[125I]OTA binding by Hs578T cells. Cells were
serum-starved for 48 h in 0.5% BSA/DMEM to reduce endogenous OTR
levels. Oligonucleotide decoy (25 µM) was added after the
first 24 h and again at 48 h upon addition of 20% DCC-FBS.
The cells were then analyzed for specific [125I]OTA
binding, and the results are expressed per microgram of cell DNA. Each
value is the mean ± SE. A, Decoy oligonucleotides
used were OTR25, OTR25M-1, M-2, and M-3; B, decoy nucleotides were
GABP/PU.1, AP-1, and mutated sequences in both oligonucleotides. The
cells were treated with 50 µM decoy for 48 h,
followed by another 24 h during DCC-FBS induction.
|
|
 |
Discussion
|
|---|
We have cloned the human OTR gene and identified the promoter and
upstream regulatory elements essential for transcriptional activation
of the gene. The sequence organization of the OTR agrees almost
entirely with that described earlier (14), except that we have been
able to more accurately define the length of intron 3. An A+T-rich
sequence, located about 30 bp upstream from the major transcription
start site, was protected from DNase I digestion. TFIID can bind and
stimulate transcription from a variety of A+T-rich sequences (27, 28),
and in view of its position (relative to the start site), it is likely
that the TTTTAAA sequence functions as a TATA box. An identical
sequence is found about 25 bp upstream from the transcription start
site in the rat connexin 43 gene, which (like the OTR gene) is
selectively expressed in the uterus at term (29). Initiator proteins,
which bind at the transcriptional start site, have been suggested to
augment transcriptional activity of TATA box-containing promoters (30).
The region surrounding the transcription start sites of the OTR
promoter was protected from DNase I digestion, and the 5'-CCATTTG-3'
resembles the consensus sequence of an Inr (31). The OTR gene promoter
thus seems to be of the type that contains both a TATA box, albeit not
a canonical one, and an Inr.
The present work has clearly shown that a critical proximal promoter
element is located in the region between -85 and -65 from the major
transcription initiation site. Deletion of the 5'-flanking sequence to
-65 reduced the level of transcriptional activity of the OTR promoter
to that of the promotorless pGL2 vector in Hs578T cells. This region
confers both basal and serum-induced activity of the OTR gene. We have
shown previously that the inducibility of [125I]OTA
binding sites in Hs578T cells by DCC-FBS was blocked by the PKC
inhibitor, GF 109203X (13). In the present studies, we found that GF
109203X also inhibited DCC-FBS-induced luciferase activity of the
-85OTR/Luc construct, establishing a relationship between the
expression of the promoter construct and the endogenous OTR gene. The
-85 to -65 region contains an ets gene family binding site
(EBS), having a core 5'-GGA-3' consensus sequence at -73. The
ets multigene family proteins, composed of approximately 20
homologues in humans, have a common DNA binding domain of approximately
85 amino acid residues near the carboxy-terminus (32, 33). Binding of
nuclear proteins by the EBS was displaced by an oligonucleotide
containing GABP
/PU.1 consensus binding sites and, to a much lesser
extent, by an oligonucleotide containing a consensus binding site for
Ets1 and PEA. Antibody to Ets1/Ets2, which cross-reacts with a variety
of ets gene family members, had no effect on the
electrophoretic mobility shift pattern. In contrast, antisera to either
GABP
or GABPß1 supershifted complexes between the OTR
oligonucleotide and proteins from Hs578T nuclear extracts. GABP
contains a DNA-binding domain that is a member of the Ets family,
whereas the ß-subunit contains a series of ankyrin repeats and does
not interact with DNA directly (34, 35). GABP
alone interacts with
an EBS weakly but establishes stable contacts with DNA when complexed
with GABPß (36, 37, 38, 39). The GABP
/ß-DNA complex is 100 times more
stable than a GABP
-DNA complex (34, 35). Hence, the ability of
antiserum, against either GABP
or GABPß1, to cause the same
supershifted patterns indicates that the EBS is occupied by a stable
GABP
/ß-DNA complex. GABP is ubiquitous in mammalian systems (35),
and Scott et al. (40) have shown that immunoreactive GABP is
expressed in several breast cancer cell lines (MDA-453, BT-474,
ZR-751, MCF-7).
The DNA binding sites of all Ets proteins include the core
recognition sequence 5'-GGA-3' and at least nine base pairs of
conserved sequence for additional DNA contacts (34). This would explain
why either mutation of bases -79 to -75 or -74 to -71 affected the
mobility gel shift patterns of all three bands. It was surprising that
mutation of bases -83 to -80, leading to a loss in competition for
the lowest band seen in gel shift studies, did not affect GABP
/ß
binding, because the mutated site was within nine bases of the
5'-GAA-3' core sequence. Mutation of the DNA between -83 and -80
resulted in a significant reduction in OTR promoter-activated
luciferase expression. Although the identity of protein factor(s)
binding to this site is presently unknown, it is possible that its
binding site overlaps the EBS. Factors binding to this site might also
interact with ets family members.
Additional evidence for the identity of the EBS as a functional GABP
binding site comes from the use of expression plasmids. Transfection of
Hs578T cells with GABP
and GABPß1 resulted in only a very modest
effect on luciferase activity. However, cotransfection with plasmids
expressing c-Fos/c-Jun resulted in a very marked enhancement in
OTR promoter activity. Cotransfection of the four expression plasmids
with a reporter construct containing mutated sites in and around the
EBS (M-1, -2, and -3) resulted in a great reduction or disappearance of
inducibility of luciferase expression. The relative inactivity of
GABP
and GABPß1, when transfected without AP-1 expression
plasmids, indicates that a primary role of GABP might be to facilitate
AP-1 binding to DNA target sites. Indeed, mutation of the CRE-like site
also resulted in the inability of c-Fos/c-Jun expression plasmids,
in combination with GABP
/ß1 expression plasmids, to increase
luciferase expression by an OTR promoter construct. Combinatorial
interactions between distinct classes of sequence-specific
transcription factors play an important role in regulating eukaryotic
gene expression. Our findings are in line with studies that have
suggested that Ets proteins function cooperatively with AP-1
transcription factors to regulate the expression of a number of
different genes (see Ref. 41 for references). AP-1 binding sites have
been identified adjacent to Ets binding sites in many of these genes
and, in some cases, mutations of either the AP-1 or the Ets site
eliminate transcriptional activity mediated by these elements (42, 43, 44).
Cotransfection of Ets and AP-1 expression vectors resulted in
cooperative transactivation of the polyoma virus enhancer-derived PEA3
element containing adjacent Ets and AP-1 sites (44). Bassuk and Leiden
(41) showed that Elf-1, an Ets family member, associates directly with
Jun family members in the absence of DNA. In the presence of target
DNA, Elf1-Jun heteromer further associated with Fos family members to
form trimolecular protein complexes.
At the present time, the mechanisms of cooperative transcriptional
activation of the -85 OTR/Luc construct by GABP
/ß and
c-Fos/c-Jun are not understood. Generally, many naturally
occurring AP-1 binding sites that are adjacent to Ets sites are
nonconsensus AP-1 motifs and do not bind AP-1 in the absence of the
appropriate Ets protein (45). It is possible that the half-CRE site
located between -56 and -52 acts as such an AP-1 site. Mutation of
this site significantly reduced OTR promoter-directed luciferase
activity, albeit to a modest extent relative to the effects of mutating
the EBS. Alternatively, AP-1 proteins might be important for the
phosphorylation of both GABP
and GABPß. For example, the
GABP-responsive element of the IL-2 enhancer is regulated by
JNK/SAPK-activating pathways in T lymphocytes (45). The role of
phosphorylated GABP has not yet been established, because bacterially
expressed GABP
and GABPß are capable of binding to the EBS of the
IL-2 enhancer, as shown by EMSA (45). It can be surmised that
phosphorylation is not required for DNA binding but is required for
transactivation, possibly by allowing the interaction of Ets family
members with other transcription factors.
In addition to AP-1 interactions, Ets family members interact with
other factors at composite elements. Ets factors have been shown to
interact directly with TFIID to induce assembly of a TBP-dependent
complex (46). It has been suggested that promoters with weakly
conserved TATA boxes, such as is indicated for the OTR, rely on
activating transcription factors to aid in recruitment of TFIID to the
promoter (47, 48). Ets family members have also been shown to interact
with other nuclear proteins, including NF-IL6ß (49), NF-EM5 (50),
ATF-1, and CREM (51). GABP has recently been shown to cooperate with
c-Myb and C/EBP to activate the neutrophil elastase promoter (52).
The most compelling evidence for the importance of the region between
-85 and -65 for DCC-FBS-induced expression of the OTR gene arises
from the oligonucleotide studies and endogenous expression of the gene.
Using OTR25 as a decoy, we found that the induction of
[125I]OTA binding sites was totally eliminated. This
phenomenon was not caused by squelching or other nonspecific
interactions, because mutant oligonucleotides (M-1, -2, and -3) were
only partially effective in inhibiting DCC-FBS induction of
[125I]OTA binding activity. More specifically, use of
either GABP/PU.1 or AP-1 consensus oligonucleotides resulted in
inhibition of DCC-FBS induction, and the inhibitory effects were
lessened when either oligonucleotide was mutated. The combination of
both GABP/PU.1 and AP-1 oligonucleotide decoys was further inhibitory,
at the same total concentration of plasmid DNA as either
oligonucleotide alone.
In conclusion, we have used several independent approaches to
demonstrate that the first 85 bp of 5'-flanking sequence of the human
OTR gene is sufficient to direct more than several hundred fold induced
expression over that of a TATA box-containing promoter. This activity
is imparted by an EBS and an additional site lying immediately
upstream, which binds a protein that remains to be identified. In view
of the inhibitory effects of blocking PKC activity on serum induction,
and the results obtained with AP-1 expression plasmids and
oligonucleotide decoys, we conclude that transcriptional
activation of the human OTR gene results from the interaction of AP-1
and GABP transcription factors. From what is known from other EBS, we
surmise that the binding of GABP
/ß to the EBS of the OTR gene
might also result in the interaction of GABP with the basal
transcription complex, leading to increased levels of transcription.
Our studies have provided the first clues toward understanding OTR gene
expression in mammary cells and have established the framework from
which to analyze further the multifactorial, complex mechanisms
involved in its regulated expression. We currently are in the process
of defining the basis of the interaction between GABP and AP-1 proteins
in transcriptional activation of the human OTR gene in breast
cells.
 |
Acknowledgments
|
|---|
We thank Dr. Ben Van Houton for carrying out the extended-length
PCR; Solweig Soloff, Maribel Acosta, and Chinnapa Kodira for technical
assistance; Dr. Allan Brasier for use of the luminometer; Mariam Ali
for the human myometrial sample; Dr. Steve Widen for helpful comments;
Dr. David Konkel for reviewing the manuscript; and Drs. Steven
McKnight, Tom Brown, and Catherine Thompson for gifts of GABP
and GABPß1 plasmids and antisera.
 |
Footnotes
|
|---|
1 This work was supported, in part, by NIH Grant HD-08406 (to
M.S.S.). 
Received September 30, 1998.
 |
References
|
|---|
-
Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y,
Nishimura T, Oida H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K,
Murata T, Hirata M, Ushikubi F, Negishi M, Ichikawa A, Narumiya S 1997 Failure of parturition in mice lacking the prostaglandin F
receptor. Science 277:681683[Abstract/Free Full Text]
-
Nishimori K, Young LJ, Guo Q, Wang Z, Insel TR, Matzuk
MM 1996 Oxytocin is required for nursing but is not essential for
parturition or reproductive behavior. Proc Natl Acad Sci USA 93:1169911704[Abstract/Free Full Text]
-
Young WS, Shepard E, Amico J, Hennighausen L, Wagner
KU, Lamarca ME, Mckinney C, Ginns EI 1996 Deficiency in mouse
oxytocin prevents milk ejection, but not fertility or parturition.
J Neuroendocrinol 8:847853[CrossRef][Medline]
-
Roberts JS, McCracken JA, Gavagan JE, Soloff MS 1976 Oxytocin-stimulated release of prostaglandin F2
from ovine endometrium in vitro: correlation with estrous
cycle and oxytocin-receptor binding. Endocrinology 99:11071114[Abstract]
-
Fuchs AR, Fuchs F, Husslein P, Soloff MS, Fernstrom
MJ 1982 Oxytocin receptors and human parturition: a dual role for
oxytocin in the initiation of labor. Science 215:13961398[Abstract/Free Full Text]
-
Kimura T, Takemura M, Nomura S, Nobunaga T, Kubota Y,
Inoue T, Hashimoto K, Kumazawa I, Ito Y, Ohashi K, Koyama
M, Azuma C, Kitamura Y, Saji F 1996 Expression of oxytocin
receptor in human pregnant myometrium. Endocrinology 137:780785[Abstract]
-
Jeng Y-J, Lolait SJ, Soloff MS 1998 Induction of
oxytocin receptor gene expression in rabbit amnion cells. Endocrinology 139:34493455[Abstract/Free Full Text]
-
Soloff MS, Alexandrova M, Fernstrom MJ 1979 Oxytocin receptors: triggers for parturition and lactation? Science 204:13131315[Abstract/Free Full Text]
-
Hinko A, Soloff MS 1992 Characterization of
oxytocin receptors in rabbit amnion involved in the production of
prostaglandin E2. Endocrinology 130:35473553[Abstract]
-
Larcher A, Neculcea J, Breton C, Arslan A, Rozen F,
Russo C, Zingg HH 1995 Oxytocin receptor gene expression in the
rat uterus during pregnancy and the estrous cycle and in response to
gonadal steroid treatment. Endocrinology 136:53505356[Abstract]
-
Fuchs AR, Periyasamy S, Alexandrova M, Soloff MS 1983 Correlation between oxytocin receptor concentration and
responsiveness to oxytocin in pregnant rat myometrium: effects of
ovarian steroids. Endocrinology 113:742749[Abstract]
-
Soloff MS, Wieder MH 1983 Oxytocin receptors in rat
involuting mammary gland. Can J Biochem Cell Biol 61:631635[Medline]
-
Copland JA, Jeng Y-J, Strakova Z, Ives KL, Hellmich MR,
Soloff MS 1999 Demonstration of functional oxytocin receptors in
human breast Hs578T cells and their up-regulation through a protein
kinase C-dependent pathway. Endocrinology 140:22582267[Abstract/Free Full Text]
-
Inoue T, Kimura T, Azuma C, Inazawa J, Takemura M,
Kikuchi T, Kubota Y, Ogita K, Saji F 1994 Structural organization
of the human oxytocin receptor gene. J Biol Chem 269:3245132456[Abstract/Free Full Text]
-
Rozen F, Russo C, Banville D, Zingg HH 1995 Structure, characterization, and expression of the rat oxytocin
receptor gene. Proc Natl Acad Sci USA 92:200204[Abstract/Free Full Text]
-
Bathgate R, Rust W, Balvers M, Hartung S, Morley S,
Ivell R 1995 Structure and expression of the bovine oxytocin
receptor gene. DNA Cell Biol 14:10371048[Medline]
-
Chyan YJ, Ackerman S, Shepherd NS, McBride OW, Widen SG,
Wilson SH, Wood TG 1994 The human DNA polymerase ß gene
structure. Evidence of alternative splicing in gene expression. Nucleic
Acids Res 22:27192725[Abstract/Free Full Text]
-
Cheng S, Fockler C, Barnes WM, Higuchi R 1994 Effective amplification of long targets from cloned inserts and human
genomic DNA. Proc Natl Acad Sci USA 91:56955699[Abstract/Free Full Text]
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162:156159[Medline]
-
Higuchi R, Krummel B, Saiki RK 1988 A general
method of in vitro preparation and specific mutagenesis of
DNA fragments: study of protein and DNA interactions. Nucleic Acids Res 16:73517367[Abstract/Free Full Text]
-
Gorman CM, Merlino GT, Willingham MC, Pastan I, Howard
BH 1982 The Rous sarcoma virus long terminal repeat is a strong
promoter when introduced into a variety of eukaryotic cells by
DNA-mediated transfection. Proc Natl Acad Sci USA 79:67776781[Abstract/Free Full Text]
-
Hackett AJ, Smith HS, Springer EL, Owens RB, Nelson-Rees
WA, Riggs JL, Gardner MB 1977 Two syngeneic cell lines from human
breast tissue: the aneuploid mammary epithelial (Hs578T) and the
diploid myoepithelial (Hs578Bst) cell lines. J Natl Cancer Inst 58:17951806
-
Shapiro DJ, Sharp PA, Wahli WW, Keller MJ 1988 A
high-efficiency HeLa cell nuclear transcription extract. DNA 7:4755[Medline]
-
Kimura T, Tanizawa O, Mori K, Brownstein MJ, Okayama
H 1992 Structure and expression of a human oxytocin receptor
[published erratum appears in Nature 1992; 357:176]. Nature356
:526529[CrossRef][Medline]
-
Roesler WJ, Vandenbark GR, Hanson RW, Miksicek R, Heber
A, Schmid W, Danesch U, Posseckert G, Beato M, Schutz G 1988 Cyclic AMP and the induction of eukaryotic gene transcription.
Glucocorticoid responsiveness of the transcriptional enhancer of
Moloney murine sarcoma virus. J Biol Chem 263:90639066[Free Full Text]
-
Fisher RC, Scott EW 1998 Role of PU.1 in
hematopoiesis. Stem Cells 16:2537[Abstract/Free Full Text]
-
Hahn S, Buratowski S, Sharp PA, Guarente L 1989 Yeast TATA-binding protein TFIID binds to TATA elements with both
consensus and nonconsensus DNA sequences. Proc Natl Acad Sci USA 86:57185722[Abstract/Free Full Text]
-
Singer VL, Wobbe CR, Struhl K 1990 A wide variety
of DNA sequences can functionally replace a yeast TATA element for
transcriptional activation. Genes Dev 4:636645[Abstract/Free Full Text]
-
Yu W, Dahl G, Werner R 1994 The connexin43 gene is
responsive to oestrogen. Proc R Soc Lond [Biol] 255:125132[Medline]
-
Colgan J, Manley JL 1995 Cooperation between core
promoter elements influences transcriptional activity in
vivo. Proc Natl Acad Sci USA 92:19551959[Abstract/Free Full Text]
-
Javahery R, Khachi A, Lo K, Zenzie-Gregory B, Smale
ST 1994 DNA sequence requirements for transcriptional initiator
activity in mammalian cells. Mol Cell Biol 14:116127[Abstract/Free Full Text]
-
Wasylyk B, Hahn SL, Giovane A 1993 The Ets family
of transcription factors [published erratum appears in Eur J
Biochem 1993; 215:907]. Eur J Biochem 211:718[Medline]
-
Seth A, Ascione R, Fisher RJ, Mavrothalassitis GJ, Bhat
NK, Papas TS 1992 The ets gene family. Cell Growth
Differ 3:327334[Medline]
-
Graves BJ 1998 Inner workings of a transcription
factor partnership. Science 279:10001002[Free Full Text]
-
Batchelor AH, Piper DE, de la Brousse FC, McKnight SL,
Wolberger C 1998 The structure of GABP
/ß: an ETS domain
ankyrin repeat heterodimer bound to DNA. Science 279:10371041[Abstract/Free Full Text]
-
Gugneja S, Virbasius JV, Scarpulla RC 1995 Four
structurally distinct, non-DNA-binding subunits of human nuclear
respiratory factor 2 share a conserved transcriptional activation
domain. Mol Cell Biol 15:102111[Abstract]
-
Brown TA, McKnight SL 1992 Specificities of
protein-protein and protein-DNA interaction of GABP
and two newly
defined ets-related proteins. Genes Dev 6:25022512[Abstract/Free Full Text]
-
LaMarco K, Thompson CC, Byers BP, Walton EM, McKnight
SL 1991 Identification of Ets- and notch-related subunits in GA
binding protein. Science 253:789792[Abstract/Free Full Text]
-
Watanabe H, Sawada J, Yano K, Yamaguchi K, Goto M, Handa
H 1993 cDNA cloning of transcription factor E4TF1 subunits with
Ets and notch motifs. Mol Cell Biol 13:13851391[Abstract/Free Full Text]
-
Scott GK, Daniel JC, Xiong X, Maki RA, Kabat D, Benz
CC 1994 Binding of an ETS-related protein within the DNase I
hypersensitive site of the HER2/neu promoter in human breast cancer
cells. J Biol Chem 269:1984819858[Abstract/Free Full Text]
-
Bassuk AG, Leiden JM 1995 A direct physical
association between ETS and AP-1 transcription factors in normal human
T cells. Immunity 3:223237[CrossRef][Medline]
-
Gottschalk LR, Giannola DM, Emerson SG 1993 Molecular regulation of the human IL-3 gene: inducible T
cell-restricted expression requires intact AP-1 and Elf-1 nuclear
protein binding sites. J Exp Med 178:16811692[Abstract/Free Full Text]
-
Wang CY, Bassuk AG, Boise LH, Thompson CB, Bravo R,
Leiden JM 1994 Activation of the granulocyte-macrophage
colony-stimulating factor promoter in T cells requires cooperative
binding of Elf-1 and AP-1 transcription factors. Mol Cell Biol 14:11531159[Abstract/Free Full Text]
-
Wasylyk B, Wasylyk C, Flores P, Begue A, Leprince D,
Stehelin D 1990 The c-ets proto-oncogenes encode
transcription factors that cooperate with c-Fos and c-Jun for
transcriptional activation. Nature 346:191193[CrossRef][Medline]
-
Hoffmeyer A, Avots A, Flory E, Weber CK, Serfling E,
Rapp UR 1998 The GABP-responsive element of the interleukin-2
enhancer is regulated by JNK/SAPK-activating pathways in T lymphocytes.
J Biol Chem 273:1011210119[Abstract/Free Full Text]
-
Hagemeier C, Bannister AJ, Cook A, Kouzarides T 1993 The activation domain of transcription factor PU.1 binds the
retinoblastoma (RB) protein and the transcription factor TFIID in
vitro: RB shows sequence similarity to TFIID and TFIIB. Proc Natl
Acad Sci USA 90:15801584[Abstract/Free Full Text]
-
Weinzierl RO, Ruppert S, Dynlacht BD, Tanese N, Tjian
R 1993 Cloning and expression of Drosophila TAFII60 and human
TAFII70 reveal conserved interactions with other subunits of TFIID.
EMBO J 12:53035309[Medline]
-
Rigby PW 1993 Three in one and one in three: it all
depends on TBP. Cell 72:710[CrossRef][Medline]
-
Nagulapalli S, Pongubala JM, Atchison ML 1995 Multiple proteins physically interact with PU.1. Trans