| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Center for Reproductive Biology, Department of Genetics and Cell Biology and Department of Biochemistry and Biophysics, Washington State University, Pullman, Washington 99164-4231
Address all correspondence and requests for reprints to: Michael K. Skinner, Center for Reproductive Biology, Department of Genetics and Cell Biology, Washington State University, Pullman, Washington 99164-4231. E-mail: skinner{at}mail.wsu.edu
| Abstract |
|---|
|
|
|---|
,
RARß, RAR
) were examined. In embryonic day 13 (E13; plug date
= E0) testis organ cultures an RAR-selective agonist and
all-trans retinoic acid completely inhibited
seminiferous cord formation. In contrast, an RAR
-selective
antagonist had no effect. RT-PCR demonstrated that RAR
messenger RNA
(mRNA) was expressed at all developmental time points evaluated, which
included embryonic day 14 (E14) through postnatal day 30 (P30).
Expression of RARß mRNA was present at E15 through P2, whereas RAR
mRNA was expressed at E18 through P2. Cellular localization of
receptors by immunohistochemistry indicated that RAR
was localized
to the interstitium at E18 and to the seminiferous cords by P0. RARß
and RAR
were detected in both interstitium and cords at E16 and by
E18 were mainly expressed in the cords. At P0 RARß and RAR
were
localized to the germ cell populations. To examine retinoid actions,
the growth of P0 testis cultures were investigated. Interestingly,
retinol and retinoic acid did not inhibit growth of P0 testis cultures
but did inhibit the action of growth stimulators. Retinoic acid
inhibited FSH, EGF, and 10% calf serum stimulated growth in P0 testis
cultures. The hypothesis tested was that the inhibitory effects of
retinoids on P0 testis growth may be mediated through the growth
inhibitor, transforming growth factor-ß (TGFß). The action of
retinoids on TGFß mRNA expression was examined in P0 testis cultures.
Retinoic acid stimulated TGFß3 mRNA expression within 24 h and
increased expression of TGFß1 and TGFß2 after 72 h. Retinol
increased expression of TGFß1 and TGFß2 but not TGFß3 after
72 h of treatment. These observations indicate that retinoic acid
can influence seminiferous cord formation and testis growth. The
inhibitory actions of retinoids may in part be mediated through
increased expression of TGFß isoforms. | Introduction |
|---|
|
|
|---|
6 (6)
and lectin (7) have been demonstrated to be involved in the
early steps of cell aggregation leading to cord formation.
Retinoic acid is also a factor that has been determined to effect
seminiferous cord formation during embryonic testis development (8).
Treatment of testis organ cultures with retinoic acid at high
concentrations (9) disrupt formation of the basement membrane and
perturb the formation of seminiferous cords. Cellular localization of
the messenger RNA (mRNA) encoding receptors for retinoic acid have been
investigated in the whole embryo (10). Retinoic acid receptor (RAR)
transcripts were shown to be expressed ubiquitously in the gonads after
cord formation in mice. Expression of RARß transcript was restricted
to the proximal mesenchyme of the genital tubercle, close to the
urogenital sinus (10). The RAR
expression was absent from the
proximal mesenchyme of the genital tubercle and present in the distal
tip. These results suggest a potential role for RARs in embryonic
testis development.
After seminiferous cord formation, a second process occurs that
involves a sex-specific increase in growth of the testis. All
populations of cells within the testis proliferate after seminiferous
cord formation, and by E15, the testis is twice the size of the ovary
from the same age animals (11). This process of embryonic testis growth
is critical because adequate numbers of somatic cells are necessary to
support spermatogenesis in the adult (12). Much of embryonic testis
growth occurs before the acquisition of gonadotropin receptors (13) and
may be attributed to paracrine factors produced locally in the testis.
Recently TGF
has been shown to be important for embryonic testis
growth subsequent to cord formation (14). Other potential regulators of
embryonic testis growth are basic FGF (15), FGF-8 (16), and TGFß (17, 18, 19, 20), which are all produced by cells within the embryonic
testis after cord formation.
Retinoic acid has been reported to interact with TGFß to affect cell proliferation and differentiation in other tissues (21). In the prostate, retinoic acid has been demonstrated to inhibit cell growth and proliferation through the stimulation of TGFß expression (22). Therefore, retinoids have the potential to regulate differentiation of the testis (seminiferous cord formation) as well as embryonic testis growth. The objective of the current study was to investigate the action of retinoids and expression of RARs at two periods during testis development. The first critical period was during testis morphogenesis (cord formation) around E13. The second period was just after birth at P0 when cells are mitotically active. The hypothesis tested was that retinoids are critical for both seminiferous cord formation and subsequent embryonic testis growth.
| Materials and Methods |
|---|
|
|
|---|
Genomic DNA isolation and PCR for SRY
To determine the sex of E13 embryos PCR for SRY was conducted on
each embryo. Embryonic tails were collected to isolate genomic DNA by
standard procedures. Briefly, the tissue was homogenized through a
25-gauge needle in digestion buffer (100 mM NaCl; 10
mM Tris, pH 8; 25 mM EDTA; 0.5% SDS), and
treated with proteinase K (0.15 mg/ml) for at least 4 h at 60 C.
The samples were then extracted twice with an equal volume of phenol:
chloroform: isoamyl alcohol (25:24:1), and once with chloroform:
isoamyl alcohol. The DNA was then precipitated by adding 1/10 volume
7.5 M ammonium acetate and 3 volumes cold ethanol and
collected by centrifugation at 4 C for 30 min after an hour incubation
at -80 C. Pellets were dried and resuspended in 10 µl distilled
H2O. PCR was performed using 1 µl of genomic DNA with
primers to SRY. The sequences of the SRY primers are: 5'
CGGGATCCATGTCAAGCGCCCCATGAATGCATTTATG 3' and 5'
GCGGAATTCACTTTAGCCCTCCGATGAGGCTGATAT-3'. PCR was performed using an
annealing temperature of 55 C for 30 cycles to yield a product of
240 bp (23).
Testicular cell culture and growth assay
To generate a testicular culture from P0 testis, the tunica was
removed and the testis digested with 0.125% trypsin, 0.1% EDTA, and
0.02 mg/ml DNase in HBSS, for 15 min at 37 C. The trypsin was
inactivated with 10% calf serum. The samples were triturated with a
pipette tip and washed twice in 1 ml HBSS. The pellet was resuspended
and either used in growth assays immediately or placed in 100-mm plates
in F12 media supplemented with 10% bovine calf serum until confluent
(approximately 2 days). For growth assays cells were plated at a 25%
confluence in 24-well plates and allowed to settle overnight in DMEM
media without thymidine. Media was replaced the next day and cells were
treated for 24 h with different hormones or growth factors. Media
was removed after the 24-h treatment period and media containing
tritiated thymidine (10 µCi/ml) was placed on cells for 56 h. After
56 h media was discarded and cells were either frozen or processed
using the tritiated thymidine assay. Briefly, solution of 0.5
M NaH2P043 (pH 7.3; 500 µl) was
added to each well and cells were sonicated. Half of the sonicated
cells were placed on DE-81 filters on a manifold and a vacuum was
applied. After three washes with the NaH2P04
buffer the filters were dried, placed in counting vials with 5 ml of
scintillation fluid and counted. The remaining sonicate was used for
DNA assays to normalize number of cells per well (22).
DNA assay
To determine the DNA content of each well of P0 testis cultures,
the remaining sonicate from the growth assay was combined with 100 µl
ethidium bromide buffer (EBB, 20 mM NaCl, 5 mM
EDTA, 10 mM Tris, pH 7.5). DNA content was determined
fluorometrically with ethidium bromide as previously described (22).
Briefly, 0.25 nM ethidium bromide and 100 U/ml heparin in
EBB were added to each sample, vortexed, and incubated for 15 min at
room temperature. Fluorescent emission was measured and quantified by
using a standard curve with calf thymus DNA from 0.5 µg to 6 µg DNA
(22).
RNA isolation and RT-PCR
Total RNA was obtained using Tri Reagent (Sigma Chemical Co.). Briefly, tissue or cells were lysed in Tri Reagent (1
ml/50100 mg tissue or 1 ml/100 mm of culture plate). After adding 0.2
ml chloroform/ml Tri Reagent, the mixture was centrifuged at
12,000 x g for 15 min at 4 C, the colorless upper
aqueous phase was transferred to a fresh tube, and 0.5 ml
isopropanol/ml Tri Reagent was added to pellet the RNA. RT was
performed using MMLV-reverse transcriptase under standard conditions.
RT-PCR was performed at 55 C annealing temperature for 30 cycles. The
primer sequences and procedures were from previously reported
experiments (24). The primer sequences are as follows: RAR
: 5'
CAGATGCACAACGCTGGC 3' and 5 'CCGACTGTCCGCTTAGAG 3'; RARß:
5'ATGCTGGCTTCGGTCCTC 3' and 5' CTGCAGCAGTGGTGACTG 3'; RAR
: 5'
GTGGAGACCGAATGGACC 3' and 5' GACAGGGATGAACACAGG 3'.
Quantitative RT-PCR
Quantitative RT-PCR (QRT-PCR) procedures were performed as
previously published (22). Briefly, total RNA (1 µg) was reverse
transcribed using the specific 3' primers. Plasmid DNAs containing
subclones of interest were used to generate standard curves from 1
ng/µl to 10 pg/µl each containing 10 ng/µl Bluescript carrier
DNA. Identical 10-µl aliquots of each sample or standard were used
for PCR amplification. At least 0.25 µCi of 32P-labeled
dCTP was included in each sample during amplification. Specific PCR
products were quantitated on 45% polyacrylamide gels. The gels were
exposed to a phosphor screen for 824 h, followed by quantification of
specific bands on a PhosphorImager (Molecular Dynamics, Inc.) and analyzed with Image Quant. Equivalent steady-state
mRNA levels for each gene were determined by comparing each sample to
the appropriate standard curve. All gene expression data were
normalized for 1B15 (cyclophilin) mRNA. Optimal cycle number for
amplification was determined for each assay to achieve maximum
sensitivity while maintaining linearity. The sensitivity of each
quantitative PCR assay is below 1 fg with intraassay variabilities of
615%. Primers used for the QRT-PCR were as follows: TGFß1,
5',5'-TCG ATT TTG ACG TCA CTG GAG TTG T-3' and 3',5'-GGG GTG GCC ATG
AGG AGC AGG-3'; TGFß2, 5'-5'-CCG CCC ACT TTC TAC AGA CCC-3' and 3',
5'-GCG CTG GGT GGG AGA TGT TAA-3'; TGFß3, 5 prime 5' TGC CCA ACC CGA
GCT CTA AGC G-3', 3',5'-CCT TTG AAT TTG ATC TCC A-3'; cyclophilin,
5',5'-ACA CGC CAT AAT GGC ACT GG-3' and 3',5'-ATT TGC CAT GGA CAA GAT
GCC-3' (22).
Embedding, histology, and immunohistochemistry
Tissues were fixed in Histochoice (Amresco, Solon, OH) and
embedded in paraffin according to standard procedures (22). The tissue
sections (3 µm) were deparaffinized, rehydrated, microwaved, and
blocked in 10% goat serum for 15 min at room temperature.
Immunohistochemistry was performed as described previously (25, 26).
The RAR
antibody was an anti-RAR
peptide antibody (Santa Cruz Biotechnology, Inc. (SCB), Santa Cruz, CA) raised against
amino acids 443462 (CSPSLSPSSNRSSPATHSP) of human RAR
(which is
100% homologous to rat RAR
, unpublished data). The RARß antibody
was an anti-RARß peptide antibody (SCB) raised against amino acids
430447 (SISPSSVENSGVSQSPLVQ) of human RARß. The RAR
antibody was
an anti-RAR
peptide antibody (SCB) raised against amino acids
436454 (CSSEDEVPGGQGKGGLKSPA) of human RAR
. The RAR
antibody
was diluted 1:200 in 10% goat serum, and he RARß and
primary
antibodies were diluted 1:50 in 10% goat serum. As a negative control,
serial sections were put through the same procedure without any primary
antibody. Additional negative control sections were incubated with
50x100x excess of synthetic immunizing peptide and the anti-RAR
,
anti-RARß, or anti-RAR
antibody. The biotinylated goat antirabbit
secondary antibody (Vector Laboratories, Inc.,
Burlingame, CA) was diluted 1:300. The secondary antibody was
detected by using the histo stain-SP kit (Zymed Laboratories, Inc., South San Francisco, CA) and immunohistochemical images
were digitized with a slide scanner (Sprint Scan, Polaroid, Cambridge,
MA).
Immunoblotting
Soluble proteins from six P0 testes were prepared as previously
described (26). The testes were homogenized and lysed in 1 ml of lysis
buffer (50 mM Tris-HCI, [pH 7.5], 250 mM
NaCl, 0.1% Triton X-100, 50 mM NaF, 5 mM EDTA)
containing a cocktail of proteinase inhibitors (100 µg/ml
phenylmethylsulfonyl fluoride, 10 µg/ml Aprotinin, 10 µg/ml
leupeptin). Protein concentration was determined by the method of
Bradford (27) with BSA as the standard.
Fifty (RAR
) or one hundred (RARß and
) micrograms of protein
were loaded on 8.5% SDS-polyacrylamide gels and subjected to
electrophoresis. This was repeated three times. The proteins were
transferred to an Immobilon-P membrane (Millipore Corp.)
to perform Western blot analysis. The membranes were blocked with 5%
blotto (Carnation, Los Angeles, CA) in PBS for 1 h at room
temperature and then incubated with the appropriate primary antibody at
a dilution of 1:200 in PBS/Tween-20 for 1 h. This was followed by
incubation with horseradish peroxidase-conjugated antirabbit IgG
secondary antibody at a dilution of 1:2500 in PBS/Tween-20 for 30 min.
The proteins were detected by the Enhanced Chemiluminescence (ECL)
Western blotting system (Amersham Corp., Arlington
Heights, IL) (27).
Statistical analysis
All data were analyzed by a JMP 3.1 statistical analysis program
(SAS Institute, Inc., Cary, NC). All values are expressed
as the mean ± SEM. Statistical analysis was performed
using one-way ANOVA. Significant differences were determined using the
Dunnetts test for comparison to controls and using the Tukey-Kramer
honesty difference test for multiple comparisons. Statistical
difference was confirmed at P < 0.05.
| Results |
|---|
|
|
|---|
|
|
|
antagonist (28) were used to treat E13 testis
organ cultures. The RAR specific agonist when treated at 0.1
µM perturbed cord formation (Fig. 3D
did not have any effect on
seminiferous cord formation in E13 testis organ cultures (data not
shown). These novel results demonstrate that the RAR may be important
for early testis differentiation and excessive amounts of retinoic acid
are disruptive to testis morphogenesis.
Expression of mRNA for RARs during testis development
To determine expression of mRNAs for RARs during
testis development, RT-PCR for RAR
, RARß, and RAR
was conducted
in E14 through P30 testis sections. Expression of mRNA for RAR
(Fig. 4A
) was present in the testis during
developmental periods between E14 and P30. Expression of mRNA for
RARß (Fig. 4B
) and RAR
(Fig. 4C
) appeared to be more transiently
expressed during testis development. Expression of mRNA for RARß
(Fig. 4B
) was detected in testis from rats at E15, E18-P2, and then at
P10. The expression of mRNA for RAR
(Fig. 4C
) was present in testis
from E18 through P2 (similar to RARß) and then at P5 and P30. These
observations suggest that the mRNAs for receptors of retinoic acid are
present during embryonic development and that expression of mRNAs for
RARß and RAR
appear to be developmentally regulated during testis
development.
|
, RARß, and RAR
were
determined on proteins isolated from P0 testis by Western blot
analysis. Two bands (54 and 50 kDa) were detected for RAR
(Fig. 5
. RARß and RAR
also had a minor band
detected at approximately 45 kDa (data not shown). These results are
consistent with previously published results for the receptors in mouse
and human (29, 30, 31).
|
, RARß, and RAR
using testis
sections from E14, E16, E18, and P0 testis (Fig. 6
protein in
E16 testis was variable (Fig. 6B
including cells surrounding the seminiferous cords
that are presumed to be peritubular cells (Fig. 6C
(Fig. 6D
|
was similar to that of RARß at E16, E18, and P0
(Fig. 6
, whereas at E18 only the cells within the
seminiferous cords stained positive for RAR
. At P0, the
highest level of expression for RAR
was detected in the germ
cells. Therefore, by P0 of testis development expression of RAR
,
RARß, and RAR
was present within the germ cell population.
Effect of retinoids on early testis growth
The effect of retinoic acid and retinol on whole P0 testis growth
was examined with testicular cultures from P0 rats. FSH, EGF, and 10%
calf serum were used as positive controls because all of these reagents
stimulate growth of P0 testis cultures (Fig. 7
). Interestingly, retinol or retinoic
acid treatment alone had no effect on growth of whole P0 testis
cultures (Fig. 7
, A and B). Retinol and retinoic acid inhibited EGF
(Fig. 7A
) and 10% calf serum stimulated growth (Fig. 7B
). In addition,
retinoic acid inhibited FSH stimulated growth (Fig. 7A
).
Thus, the current study demonstrates that retinoids influence the
ability of FSH, EGF, and 10% calf serum to stimulate whole P0 testis
growth.
|
|
|
| Discussion |
|---|
|
|
|---|
,
RARß, and RAR
have been localized to the gonad around the time of
cord formation (10). The current study was designed to determine the cellular expression of the retinoic acid receptors and action of retinoids during embryonic testis development. While 1 µM RA has been demonstrated to inhibit seminiferous cord formation, the actions of retinol, lower doses of RA, and specific RAR selective agonist on seminiferous cord formation have not been evaluated. Observations confirm previous research as well as demonstrate novel data on the dose dependent effects of retinol, all-trans retinoic acid and a RAR-selective agonist on seminiferous cord formation. All-trans retinol is a circulating form of retinoid in the bloodstream and can be converted to either all-trans retinoic acid or to 9-cis retinoic acid in the tissue (36). All-trans retinoic acid binds preferentially to the RARs. In contrast, 9-cis retinoic acid binds to and activates both RAR and RXR (36). In the present study, all forms of retinoids caused disruption or disorganization of seminiferous cord formation. All-trans retinoic acid at concentrations of 1 µM and 0.1 µM RAR-selective agonist had the greatest effect on inhibition of cord formation. This information is important because the RAR selective agonist demonstrates that seminiferous cord formation disruption may be through the RAR and not RXR. It is not surprising that retinol did not have as dramatic effect on cord formation because conversion of retinol is necessary to produce retinoic acid. Therefore, it was necessary to increase the amount of retinol added to the organ cultures to elicit a similar effects as either all-trans retinoic acid or the RAR-selective agonist.
The current study used RT-PCR and immunohistochemistry to determine the
expression patterns and localization of RARs. RT-PCR demonstrated that
expression of RAR
mRNA was present during all developmental periods
evaluated (E14-P30). RAR
mRNA was the only RAR mRNA present around
the time of seminiferous cord formation. Therefore, any action of
retinoids may be elicited through RAR
at this developmental period.
However, RAR
protein was not expressed in E14 testis and did not
appear until E16. This may be due to a translational control that has
been reported previously in adult testis (26). This suggests that RARs
may not participate in the normal process of seminiferous cord
formation. Previous observations have also demonstrated that retinoids
are capable of up regulating the expression of RAR
(37, 38). This
may provide a potential explanation of how treatment of retinoic acid
could inhibit seminiferous cord formation in E13 testis organ cultures.
Further investigation is necessary to determine whether RAR
expression can be up-regulated in E13 organ cultures. Cellular
localization of RAR
protein in the testis was demonstrated to be in
the interstitium at E16 and E18. By P0 of testis development, RAR
protein was in the germ cells. Therefore, RAR
may be important after
E16 to regulate the growth and differentiation of the interstitial and
germ cells. The phosphorylation state and expression of the protein are
both important to determine if RAR
is capable of binding retinoic
acid in the embryonic and postnatal testis. Previous reports have
demonstrated that posttranslational modification can influence the
activity of RAR
in several different tissues (37).
In contrast to RAR
, the mRNA for both RARß and RAR
were
transiently expressed during testis development. This suggests that
there is potential regulation of these two receptors during testis
development. RARß mRNA is present at E15 while both RARß and
are present in the embryonic testis from E18 through P2. This is a time
during testis development when germ cell populations have undergone
mitotic arrest and have stopped cell division (39). The expression of
mRNA for RARß present at E15 occurs before protein expression at or
around E16 of testis development. There is a discrepancy in the first
appearance of mRNA for RAR
(E18) and the appearance of RAR
protein at E16. One possible explanation is that mRNA expression for
RAR
occurs before E14. By P0 of testis development, all receptors
for retinoic acid are localized to the germ cell population. This
cellular localization of the RARs suggests a potential regulation of
germ cell differentiation and proliferation within the perinatal
developing testis.
The effects of retinoids on cell growth was examined in the current study with a mixed population of testicular cells from P0 rats. Retinoids alone did not influence cell growth. However, retinol and all-trans retinoic acid inhibited thymidine incorporation in EGF and 10% calf serum stimulated cells. In addition, retinoic acid inhibited FSH stimulated growth. It is interesting that retinoid treatment alone did not inhibit growth. At P0, germ cells in vivo are the only cell population within the testis that is not actively proliferating. Because receptors for RARs are present in germ cells at P0, retinoids may contribute to the growth arrest of germ cells. Further treatment of P0 testis cultures with retinoids may not have inhibitory effects on this cell population. However, stimulation of P0 testis cells by FSH, EGF, and 10% calf serum may allow for progression of the cell cycle in germ cells when in culture. These growth stimulators may cause the germ cells to resume mitosis and allow for subsequent inhibition of germ cell proliferation by retinoid treatment.
The inhibition of cell growth by retinoids is not novel to the testis. Retinoic acid has been observed to prevent cell growth in several other tissues. In the prostate, retinoic acid inhibits cellular growth and proliferation by stimulating expression of mRNA and protein for all three isoforms of TGFß (21). In addition, a monoclonal neutralizing antibody to all isoforms of TGFß blocked the ability of retinoic acid to inhibit growth (21). Therefore, it was proposed that retinoic acid caused the inhibition of growth through increased or altered expression of TGFß isoforms in P0 testis.
Retinoic acid increased expression of mRNA for TGFß3 within 24 h. After 72 h, TGFß1, TGFß2, and TGFß3 mRNA expression was also elevated in retinoic acid treated cultures. These results are similar to those demonstrated previously in the prostate (21). In the prostate, up-regulation of mRNA for TGFß2 and TGFß3 was greater and earlier than subsequent increases in mRNA for TGFß1 by retinoic acid (20). In the testis TGFß1 inhibits testis growth in embryonic and P0 testis cultures (20). Therefore, regulation of cellular proliferation by retinoic acid is potentially mediated through the expression of specific TGFß isoforms which in turn cause inhibition of cellular proliferation.
Interestingly, retinol did not have similar effects on expression of TGFß isoforms as retinoic acid. Retinol did not increase expression of any TGFß isoforms after 24 h. However, after 72 h of treatment retinol increased expression of TGFß1 and TGFß2, but did not effect mRNA expression of TGFß3. These differences are presumably do to conversion of retinol into both all-trans and 9-cis retinoic acid which act at both RAR (all-trans and 9-cis) and RXR (9-cis).
FSH did not stimulate expression of mRNA for any TGFß isoform. This supports previous reports that FSH stimulation of P0 testis does not influence expression of TGFß isoforms (20). FSH treatment in combination with retinoic acid appeared to inhibit the ability of retinoic acid to stimulate TGFß1 and TGFß3 isoform expression. After 72 h, expression of TGFß1 was suppressed in a retinoic acid and FSH combined treatment when compared with retinoic acid treatment alone. In addition, the expression of TGFß3 was also altered when retinoic acid was given in combination with FSH. Therefore, FSH may alter the ability of retinoic acid to stimulate expression of TGFß isoforms in P0 testis cultures.
Knockout mice lacking RARs demonstrate that retinoids are important for
testis development. RAR
knockout mice are sterile due to defective
spermatogenesis (40). RAR
knockouts have problems associated with
secondary sex glands, which is not associated with testis development
but may alter viability of sperm (41). However, no problems have been
detected in embryonic testis development in these knockouts. The
redundant nature of the RARs may allow for compensation to occur in
mice lacking one of the RAR genes or retinoic acid may only be
important in later testis development.
In conclusion, the novel results of the current study demonstrate that retinoic acid or an RAR-specific agonist can influence the process of seminiferous cord formation. The potential absence of RAR isoforms at E14 and the presence of RAR isoforms after E16 in testis development suggests that retinoic acid is not necessary for seminiferous cord formation. Because seminiferous cord formation is disrupted by high doses of retinoic acid and RAR specific agonists the lack of RARs may be a protective mechanism to ensure successful testis development. The primary function of retinoic acid may be to allow for cell differentiation and growth in the interstitium and germ cells after E16. The localization of the RARs in P0 testis is interesting because all receptors are present within the germ cell population. This suggests that retinoic acid may be critical to germ cell development. At P0, the germ cells in the testis are in mitotic arrest, and retinoic acid may be involved in initiating this process to allow for germ cell differentiation. The current study also presents novel information on potential mechanisms for retinoid regulation of testis cell growth. The mechanism for retinoid regulation of cell growth is proposed to be through increased expression of TGFß isoforms. Therefore, retinoids appear to be important during perinatal testis development to regulate cellular growth and differentiation.
Received October 7, 1998.
| References |
|---|
|
|
|---|
related ligands and the epidermal growth
factor receptor in embryonic testis development. Endocrinology, in
press
,
25-dihydroxyvitamint D3 in NRP-152 rat prostatic epithelial cells.
J Cell Physiol 166:321329
expression in the rat
epididymus. Biol Reprod 54:11111119[Abstract]
dependent signaling pathway in the induction of tissue transglutaminase
and apoptosis by retinoids. J Biol Chem 270:60226029
: evidence for phosphorylation. Exp Cell Res 201:335346[CrossRef][Medline]
: specific
immunodetection and phosphorylation. J Cell Biol 115:535545
mutant mice. Proc Natl Acad
Sci USA 90:72257229This article has been cited by other articles:
![]() |
K. Han, H. Song, I. Moon, R. Augustin, K. Moley, M. Rogers, and H. Lim Utilization of DR1 as true RARE in regulating the Ssm, a novel retinoic acid-target gene in the mouse testis J. Endocrinol., March 1, 2007; 192(3): 539 - 551. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Ricci, A Catizone, and M Galdieri Expression and functional role of hepatocyte growth factor and its receptor (c-met) during fetal mouse testis development J. Endocrinol., December 1, 2006; 191(3): 559 - 570. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Bott, R. M. McFee, D. T. Clopton, C. Toombs, and A. S. Cupp Vascular Endothelial Growth Factor and Kinase Domain Region Receptor Are Involved in Both Seminiferous Cord Formation and Vascular Development During Testis Morphogenesis in the Rat Biol Reprod, July 1, 2006; 75(1): 56 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Koubova, D. B. Menke, Q. Zhou, B. Capel, M. D. Griswold, and D. C. Page Inaugural Articles: Retinoic acid regulates sex-specific timing of meiotic initiation in mice PNAS, February 21, 2006; 103(8): 2474 - 2479. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Dufour, M. Hamilton, R. V. Rajotte, and G. S. Korbutt Neonatal Porcine Sertoli Cells Inhibit Human Natural Antibody-Mediated Lysis Biol Reprod, May 1, 2005; 72(5): 1224 - 1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li and K. H. Kim Retinoic Acid Inhibits Rat XY Gonad Development by Blocking Mesonephric Cell Migration and Decreasing the Number of Gonocytes Biol Reprod, March 1, 2004; 70(3): 687 - 693. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li and K. H. Kim Effects of Mono-(2-Ethylhexyl) Phthalate on Fetal and Neonatal Rat Testis Organ Cultures Biol Reprod, December 1, 2003; 69(6): 1964 - 1972. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li and K. H. Kim Effects of Ethanol on Embryonic and Neonatal Rat Testes in Organ Cultures J Androl, September 1, 2003; 24(5): 653 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Buzzard, N. G. Wreford, and J. R. Morrison Thyroid Hormone, Retinoic Acid, and Testosterone Suppress Proliferation and Induce Markers of Differentiation in Cultured Rat Sertoli Cells Endocrinology, September 1, 2003; 144(9): 3722 - 3731. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Glozak, Y. Li, R. Reuille, K. H. Kim, M.-N. Vo, and M. B. Rogers Trapping and Characterization of Novel Retinoid Response Elements Mol. Endocrinol., January 1, 2003; 17(1): 27 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Dufour, R. V. Rajotte, and G. S. Korbutt Development of an In Vivo Model to Study Testicular Morphogenesis J Androl, September 1, 2002; 23(5): 635 - 644. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Livera, V. Rouiller-Fabre, and R. Habert Retinoid Receptors Involved in the Effects of Retinoic Acid on Rat Testis Development Biol Reprod, May 1, 2001; 64(5): 1307 - 1314. [Abstract] [Full Text] |