| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Division of Genetics (C.T.A., W.W.C.), Departments of Medicine and Pathology (M.P.F.), Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts 02115
Address all correspondence and requests for reprints to: Dr. William W. Chin, G. W. Thorn Research Building, Room 1019, Brigham and Women’s Hospital, 20 Shattuck Street, Boston, Massachusetts 02115.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-, FSHß-, and LHß-subunits and the GnRH-R messenger
RNA, all markers of a gonadotrope but not of other anterior pituitary
cell lineages. In summary, our studies indicate that 1.2 kb of the
5'-flanking region of the mGnRH-R gene can be used to target expression
specifically to the gonadotropes of the pituitary gland in transgenic
mice. The GnRH-R gene promoter-directed expression appears to be
cell-specific and results in the formation of tumors that are primarily
of gonadotropic origin. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
GnRH binding activity and GnRH-R messenger RNA (mRNA) expression have also been identified in other tissues. The expression of extrapituitary GnRH-R is variable among different species. For example, GnRH-Rs have been detected in the hippocampus and Leydig cells of the rat, but not those of the mouse (1). GnRH-R has also been detected in granulosa cells and corpora lutea of the rat (2, 3) and human (4) ovary. However, similar studies in the mouse ovary have garnered conflicting results (5, 6).
We have previously identified and characterized the promoter region of
the mouse GnRH-R gene (7). This enabled us to initiate studies on the
mechanisms involved in the transcriptional regulation of mGnRH-R gene
expression. In particular, we examined the tissue- and cell-specific
expression of the mouse GnRH-R gene in vitro using
transfection methods. Our studies showed that the mGnRH-R gene promoter
is highly expressed in cell lines of pituitary origin, and is
transcriptionally more active in a gonadotropic cell line (T3–1)
than in a somatolactotropic cell line (GH3) (7). The
results of these experiments indicate that the regulatory elements for
pituitary- and gonadotrope-specific expression are present within a
1.2-kb 5'-flanking region of the mGnRH-R gene.
To extend these in vitro studies, we have generated a transgenic mouse model in which the cell-specific regulatory sequences of the mGnRH-R gene promoter were used to direct the expression of the simian virus 40 (SV40) large T antigen (TAg). Such promoter-specific targeting of oncogene expression has been used extensively to study tissue-specific transcriptional regulation (8, 9). We derived a stable transgenic mouse line from one of the founders that permitted the examination of GnRH-R gene promoter-directed TAg expression. These mice will be used to measure transgene as well as endogenous GnRH-R, gonadotropin and TSH subunits, and PRL and GH gene expression. These experiments were performed to determine whether the 1.2-kb 5'-flanking region of the mGnRH-R gene can direct gene expression to the pituitary, specifically to gonadotropes, in an in vivo system.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Identification of transgenic mice
Transgenic mice were identified by PCR analysis of tail genomic
DNAs that were isolated as previously described (12). The presence of
the transgene was screened using a sense primer corresponding to
-349/-365 of the mouse GnRH-R (mGnRH-R) gene promoter and an
antisense primer corresponding to +4720/+4741 of the SV40 TAg to
generate a 900-bp product. One volume of TaqStart antibody
(CLONTECH Laboratories, Inc., Palo Alto, CA) to 1 vol
Taq DNA polymerase was used in all reactions. PCR was
performed by denaturation at 94 C for 1 min and cycling 30 times at 58
C for 2 min and at 72 C for 3 min. PCR analysis of the mGnRH-R gene
served as a positive control.
RNA isolation and RT-PCR for TAg mRNA
Individual pituitary and tumor tissues were homogenized in
guanidine isothiocyanate, and total RNA was extracted using an RNeasy
total RNA extraction (Qiagen, Madison, WI) which
simplified the extraction of small amounts of RNA in some tissues.
Total RNA was treated with 2 µl ribonuclease-free deoxyribonuclease I
(Boehringer Mannheim, Indianapolis, IN) for 1 h to
remove genomic DNA contamination. The samples were then extracted with
phenol-chloroform and ethanol precipitated. Total RNA was then analyzed
for TAg expression by RT-PCR. One microgram of the total RNA was
reverse transcribed into complementary DNA (cDNA) using an
oligo(deoxythymidine)12–18 primer (Pharmacia Biotech, Piscataway, NJ). Control experiments were performed in
which reverse transcriptase was not added. TAg cDNA was then amplified
by PCR using primers corresponding to +4620/+5225 of the coding region
of TAg, using the conditions described above.
Preparation of cDNAs and oligonucleotide probes
cDNA probes for the -subunit were generated by PCR using a
sense primer, TCTTCCTGATGGAGACTTTATTATTCAG, and an antisense primer,
CGACTTGTGGTAGTAGCAAGTGCTAC, to generate a 288-bp fragment (13). The PCR
fragment for TAg corresponded to +4620/+5225 of the coding region of
SV40 TAg. The PCR fragments were subcloned into the pGEMT vector
(Promega Corp., Madison, WI). The mouse FSHß and LHß
cDNAs were obtained from Dr. Malcolm Low (University of Oregon Health
Sciences Center, Portland, OR) (14, 15, 16). For the mouse GnRH-R
probe, we obtained a PstI-PstI fragment from a
full-length cDNA that had been previously cloned by PCR (7). The GnRH-R
cDNA fragment was subcloned into pBluescript (Stratagene,
La Jolla, CA). Antisense probes were generated from cDNA encoding the
-subunit, FSHß, LHß, TAg, and GnRH-R. In vitro
transcription was performed using either T3 or T7 RNA polymerase
following the manufacturer’s instructions (Stratagene, La
Jolla, CA). Oligonucleotide probes were synthesized by the Biopolymer
Laboratory (Department of Genetics, Harvard Medical School). The
oligonucleotide sequences for GH, PRL, POMC, and TSHß have been
previously described (17). These probes (0.3 pmol each) were
end-labeled with 25 pmol [-35S]thiodeoxy-ATP (1300
Ci/mmol; New England Nuclear, Boston, MA) using 50 U
terminal deoxynucleotidyl transferase (Boehringer Mannheim, Indianapolis, IN). Each reaction was incubated for 30
min, and the tailing reaction was terminated by adding 2 µl 0.2
M EDTA. Specific hybridization was assessed in control
experiments using a 200-fold excess of unlabeled probe.
In situ hybridization
Deparaffinized tissue sections (6–8 µm) were incubated with
different probes. The oligonucleotide probes (3000 cpm/µl) were
incubated overnight in hybridization solution containing 50% (vol/vol)
formamide, 4 x SSC (standard saline citrate), 1 x (vol/vol)
Denhardt’s solution, 0.5 mg/ml herring sperm DNA, 10% (wt/vol)
dextran, 0.1% (wt/vol) sodium pyrophosphate, and 0.2 mg/ml
polyadenylate overnight at 37 C. The sections were then washed four
times in 1 x SSC for 15 min for 4 at room temperature, four times
in 2 x SSC-50% formamide for 15 min at 37 C, and three times in
1 x SSC for 30 min at room temperature.
Complementary RNA (cRNA) probes (
20,000 cpm) were incubated with
tissue sections in hybridization solution containing 50% (vol/vol)
formamide, 0.3 M sodium chloride, 10 mM
Tris-HCl (pH 7.4), 10 mM NaH2PO4, 5
mM EDTA, 0.2% (wt/vol) Ficoll 400, 0.2% (wt/vol)
polyvinylpyrrolidone, 50 µg/ml yeast transfer RNA, 10% (wt/vol)
dextran sulfate, and 0.5 mg/ml polyadenylate. Sections were then washed
four times at 65 C in 50% formamide, 2 x SSC, and 20
mM ß-mercaptoethanol for 40 min each; three times at 37 C
in 4 x SSC, 20 mM Tris-HCl (pH 7.6), and 1
mM EDTA for 10 min each; and once at 37 C in 2 x SSC
for 10 min. The slides were then coated with Kodak NTB-2 emulsion and
exposed to Kodak Biomax MR or on CRONEX 3 film (Eastman Kodak Co., Rochester, NY). The sections were then developed and
counterstained with Hoecsht for 2 min, rinsed in water, and embedded in
Canada balsam and methyl salicylate.
Histological approaches
Animals were killed by approved methods, and cranial contents
were exposed. In cases of large tumors, the brain with attached tumor
mass was removed and fixed in 4% paraformaldehyde. In animals in which
tumors were not grossly detected, the brain was removed, and the region
of the sella turcica was dissected en bloc along with its
contents. These tissues were similarly fixed in 4% paraformaldehyde
and subjected to mild decalcification. Tissue was processed according
to standard protocols, and 4- to 6-mm sections were cut from paraffin
blocks. Sections were stained with hematoxylin and eosin and for
reticulin fibers, using standard methods.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Three founders were identified by PCR
analysis of tail genomic DNA. Two of the founders, mouse 28 (M28,
female) and mouse 25 (M25, male), were stunted in growth and were
sterile (Table 1). These mice developed
grossly enlarged crania with intracranial tumors at 37 and 50 days of
age, respectively. In contrast to these two founders, mouse 29 (M29,
male) was fertile and attained a normal body size. M29 developed a
grossly enlarged cranium, and an apparent pituitary mass was seen at
103 days. All transgenic mice displayed decreased locomotor activity,
sluggish responses to external stimuli, and difficulty in maintaining
balance, with a tendency to fall or veer to one side. Gross examination
of other organs failed to show any other tumor formation.
|
|
), in contrast to corpora lutea and
follicles at various stages of development in comparable age-matched
nontransgenic animal controls. Superovulatory doses of gonadotropins
(PMSG and hCG) induced follicular maturation, ovulation, and corpus
luteum formation in M29 mice (data not shown). These studies indicate
that the ovaries can respond appropriately to gonadotropin stimulation,
and that abnormal ovarian development in M29 females is probably due to
abnormal and/or deficient pituitary gonadotropin secretion.
|
Development of pituitary tumors
The availability of the M29 transgenic line allowed us to obtain
tumors at different stages of development. Mice were killed at
different ages and examined for the presence of tumors. At early stages
of tumor formation in the M29 transgenic line, there was no distortion
of the cranium. The tumor was found centered on the sella turcica, with
minimal displacement of the optic tract or other structures (Fig. 3).
|
Microscopically, the smaller tumors showed areas of normal pituitary
tissue with single tumor cell infiltration as well as transition areas
of increasing atypia (Fig. 4). The tumor
cells were heterogeneous with two main cell populations. There was a
predominance of small round cells with scant cytoplasm and large,
bizarre giant cells with hyperchromatic vacuolated nuclei, abundant
eosinophilic cytoplasm, and prominent nucleoli. The larger cells were
more prominent at the infiltrating edge of the tumor. The tumor cells
were mostly mononuclear, but nuclear pleomorphism with multilobulation
was evident. A fibrous stroma surrounded the cells. Larger tumors
presented the same histology, with little if any identifiable normal
pituitary tissue.
|
-, FSHß-, and LHß-subunits mRNAs encoding; and the GnRH-R,
all of which are markers of a mature pituitary gonadotrope.
In Figure 5, in situ
hybridization of sagittal sections of the entire brain and tumor from a
5-month-old M29 transgenic mouse was performed. The results
demonstrated that the -subunit and GnRH-R mRNAs were specifically
and abundantly expressed in the tumor. The surrounding brain did not
hybridize with any of these probes and provided an internal negative
control. The tumor also expressed FSHß, LHß, and TAg mRNAs over the
entire tumor, albeit in lesser amounts. The same probes were used to
examine hormone and GnRH-R expression in wild-type pituitary (data not
shown); the results of these experiments were similar to those
previously reported by Japon et al. (17).
|
). This tumor largely expressed -,
FSHß-, and LHß-subunits and GnRH-R mRNAs. Both FSHß and
LHß mRNAs were expressed in all tumors, although the pattern of
expression in each tumor varied. In the tumor shown in Fig. 6, both
gonadotropins were diffusely expressed over the entire tumor. This
contrasts with the focal and minimal expression of the other pituitary
hormones mRNAs: GH, PRL, POMC, and TSHß. Such discrete areas of
expression may represent the presence of remnants of the normal
pituitary that are still functional. The prevalence of gonadotrope
markers with the virtual absence of GH, PRL, POMC, and TSHß mRNAs
indicated that these tumors were of gonadotropic origin.
|
T3 cells
was used as a positive control for TAg expression. Both small and large
pituitary tumors were assessed. RT-PCR analysis of the different
tissues showed that TAg was expressed only in pituitary tumors (Fig. 7). TAg was not detected in the male and
female gonads or in any of the other tissues obtained from transgenic
mice. These results indicate that 1.2 kb of the 5'-flanking region of
the mGnRH-R gene promoter direct TAg expression specifically to the
pituitary gland.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The promoter-specific targeting of oncogene expression in transgenic
mice has been used extensively to study tissue-specific and
developmental patterns of transcriptional regulation as well as to
generate specific immortalized cell lines. The SV40 TAg is particularly
effective in inducing tumor formation in a variety of tissues in
conjunction with its own promoter as well as heterogeneous promoters
(8, 18). In the pituitary, Mellon and colleagues (19, 20, 21, 22) have obtained
targeted oncogenesis to specific cell types using the and LHß
promoters. Cell lines generated from these studies have been extremely
useful in the characterization of gondotrope cell function.
The M29 transgenic mice developed pituitary tumors that were grossly evident at 4–5 months of age. However, the effects of TAg oncogene expression are apparent before this stage, as evidenced by the inability of the mice to reproduce. As the TAg is expressed in the M29 pituitary but not in the ovary, infertility in females is most likely due to a defect in pituitary function. The absence of corpora lutea probably indicates the absence of ovulatory signals. Pituitary secretion of physiological levels of gonadotropins may be altered so that further follicular differentiation and ovulation do not occur. The response of the ovaries in M29 females to large doses of gonadotropin is consistent with this view.
The glycoprotein hormones, -, FSHß-, and LHß-subunits, and the
GnRH-R are all expressed in gonadotropes. Although the -subunit is
common to both thyrotropes and gonadotropes, the FSHß- and
LHß-subunits are found exclusively in gonadotropes (17). GnRH-Rs are
also abundantly and specifically expressed in the gonadotrope. Our
in situ hybridization studies show that the tumors express
all four gonadotrope-specific markers. The -subunit and GnRH-R mRNAs
are strongly expressed, which is consistent with their abundant
expression in the normal pituitary. Also, the lower levels of
expression of the FSHß- and LHß-subunits are consistent with the
relatively lower transcriptional activities of these hormone
subunits.
In contrast to pituitary tumors generated using the - and
LHß-subunit promoters (19, 22), the GnRH-R/TAg induces tumors that
express both FSHß- and LHß-subunits. In the rodent embryo (17, 23),
GnRH-R binding sites in the pituitary have been detected on embryonic
day 12, one day after -subunit expression and 4 days before the
expression of LH and FSHß-subunits. It is possible that the later
transcriptional activation of the GnRH-R gene promoter, compared with
that of the -subunit gene promoter, allows further gonadotrope
differentiation. It is also possible that the higher transcriptional
activity of the -subunit promoter results in the expression of
higher levels of TAg and arrests further differentiation of the
gonadotrope. Indeed, TAg has been proposed to inhibit differentiation
of precursor neuron cells in olfactory neuroepithelium (24). Therefore,
the later expression of the GnRH-R gene promoter as well as its weaker
promoter activity may allow differentiation of the gonadotrope to one
that can express both ß-subunits.
Grossly, the pituitaries of the transgenic mice have a normal appearance in the initial stages. As the pituitaries enlarged and the tumors became grossly evident, changes in pituitary hormone expression occurred. Gonadotropin subunit mRNA expression was diffusely abundant in all tumors examined. Their expression levels persisted, but varied in the different tumors. In contrast, the other pituitary hormones had focal and minimal expression in the same tumors. GH and PRL mRNA expression had similar discrete patterns of expression, which suggested the presence of somatolactotropes. The expression of both of these hormones was low in most tumors. TSHß mRNA expression was minimal, although its pattern of expression was similar to that seen in normal pituitary. POMC mRNA was also usually found focally along the periphery on one edge of the tumor and probably represented rim tissue that had been pushed aside by the central expanding tumor mass. These localized areas of hormone gene expression may represent remnants of normal pituitary tissue. Indeed, transition areas of normal pituitary cells and tumor can be seen in most samples. The persistence of gonadotropin expression and the prevalence of gonadotrope markers as well as the discrete expression of POMC, TSHß, GH, and PRL suggest that the pituitary tumors are of gonadotropic origin.
As the expression of TAg is driven by the GnRH-R gene promoter, the
levels of TAg mRNA can therefore be used to evaluate mGnRH-R gene
promoter activation and consequently the level of mGnRH-R mRNA
expression. As expected, TAg and GnRH-R mRNAs had a similar diffuse
pattern of expression throughout the tumor, as shown by in
situ hybridization in Figs. 5
and 6. In addition, RT-PCR analysis
for TAg mRNA suggests that the GnRH-R gene promoter directed transgene
expression solely to the mouse pituitary. TAg mRNA was not detected in
any other extrapituitary tissues examined, including ovary and testis.
In the rat, extrapituitary GnRH-Rs have been identified in the ovary,
testis, and hippocampus (1, 2, 3). However, studies in the mouse failed
to establish the presence of receptors in these extrapituitary tissues
(1, 5). Thus, the results of these studies are consistent with the
presence of GnRH-R in various tissues with patterns of expression that
may be distinct for different species.
In this study we have shown that 1.2 kb of the 5'-flanking region of
the mGnRH-R gene contains regulatory sequences that direct gene
expression specifically to the pituitary in vivo. We have
developed a stable transgenic mouse model that consistently develops
pituitary tumors. These tumors are capable of expressing the -,
FSHß-, and LHß-subunits and GnRH-R mRNAs, all of which are markers
of a gonadotrope. As such, this transgenic line may provide a useful
model for studies of the transcriptional regulation of the genes
encoding GnRH-R and the glycoprotein hormone subunits. The pituitary
tumors may also be useful for the development of functional gonadotrope
cell lines.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Present address: Department of Pathology, University of Chicago
Hospitals, 5812 South Maryland, Chicago, Illinois 60637.
Received October 22, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-subunit of mouse thyrotropin. Proc Natl Acad Sci USA 9:5329–5333
This article has been cited by other articles:
 |
|
 |
|
  K.-H. Jeong, J. C. Gill, V. Nose, A. F. Parlow, R. S. Carroll, and U. B. Kaiser Expression of a Gonadotropin-Releasing Hormone Receptor-Simian Virus 40 T-Antigen Transgene Has Sex-Specific Effects on the Reproductive Axis Endocrinology, July 1, 2009; 150(7): 3383 - 3391. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. R. Norwitz, S. Xu, J. Xu, L. B. Spiryda, J. S. Park, K.-H. Jeong, E. A. McGee, and U. B. Kaiser Direct Binding of AP-1 (Fos/Jun) Proteins to a SMAD Binding Element Facilitates Both Gonadotropin-releasing Hormone (GnRH)- and Activin-mediated Transcriptional Activation of the Mouse GnRH Receptor Gene J. Biol. Chem., September 27, 2002; 277(40): 37469 - 37478. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Duval, A. R. Farris, C. C. Quirk, T. M. Nett, D. L. Hamernik, and C. M. Clay Responsiveness of the Ovine Gonadotropin-Releasing Hormone Receptor Gene to Estradiol and Gonadotropin-Releasing Hormone Is Not Detectable in Vitro But Is Revealed in Transgenic Mice Endocrinology, March 1, 2000; 141(3): 1001 - 1010. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. R. Norwitz, K.-H. Jeong, and W. W. Chin Molecular Mechanisms of Gonadotropin-Releasing Hormone Receptor Gene Regulation Reproductive Sciences, July 1, 1999; 6(4): 169 - 178. [Abstract] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
