help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Albarracin, C. T.
Right arrow Articles by Chin, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albarracin, C. T.
Right arrow Articles by Chin, W. W.
Endocrinology Vol. 140, No. 5 2415-2421
Copyright © 1999 by The Endocrine Society


ARTICLES

The Gonadotropin-Releasing Hormone Receptor Gene Promoter Directs Pituitary-Specific Oncogene Expression in Transgenic Mice1

Constance T. Albarracin2, Matthew P. Frosch and William W. Chin

Division of Genetics (C.T.A., W.W.C.), Departments of Medicine and Pathology (M.P.F.), Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts 02115

Address all correspondence and requests for reprints to: Dr. William W. Chin, G. W. Thorn Research Building, Room 1019, Brigham and Women’s Hospital, 20 Shattuck Street, Boston, Massachusetts 02115.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our previous work has shown that 1.2 kb of the 5' flanking region of the mouse GnRH receptor (mGnRH-R) gene is sufficient to direct tissue-specific expression in vitro. In this study, we have used the cell-specific regulatory sequences of the mGnRH-R gene promoter to target the expression of the simian virus 40 virus T antigen (TAg) to the pituitary gland of transgenic mice. A hybrid transgene, GnRH-R/TAg, was prepared using the -1164/+52 region of the mGnRH-R gene and +2533/+5234 sequences encoding the large T antigen of the simian virus 40. Two founders developed tumors of apparent pituitary origin at 44 (M28, female) and 50 (M25, male) days of age. M28 and M25 mice were about 50% underweight, and their gonads were grossly underdeveloped compared with wild-type litter mates. A third male founder, M29, developed a tumor at a later time (109 days). M29 was able to breed successfully and stably transmit the GnRH-R/TAg transgene. Mice of the M29 transgene line developed tumors at 4–5 months of age. Gross examination showed that the tumors extend from the sella and infiltrate into the inferior surface of the brain. In small tumors collected from young transgenic animals, normal pituitary cells as well as transition areas of increasing cellular atypia are evident. Frankly malignant cells are seen in all tumors. The pituitary tumors express the {alpha}-, FSHß-, and LHß-subunits and the GnRH-R messenger RNA, all markers of a gonadotrope but not of other anterior pituitary cell lineages. In summary, our studies indicate that 1.2 kb of the 5'-flanking region of the mGnRH-R gene can be used to target expression specifically to the gonadotropes of the pituitary gland in transgenic mice. The GnRH-R gene promoter-directed expression appears to be cell-specific and results in the formation of tumors that are primarily of gonadotropic origin.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE GnRH receptor (GnRH-R) gene is expressed in a tissue- and cell-specific manner. GnRH-Rs are abundantly expressed in the anterior pituitary and are restricted to the gonadotrope. The presence of GnRH-Rs in pituitary gonadotropes dictates cell-specific responsiveness to GnRH. Although it is well known that the GnRH-R is highly expressed in the pituitary, the regulatory mechanisms determining the pituitary-specific expression of this receptor have not been delineated.

GnRH binding activity and GnRH-R messenger RNA (mRNA) expression have also been identified in other tissues. The expression of extrapituitary GnRH-R is variable among different species. For example, GnRH-Rs have been detected in the hippocampus and Leydig cells of the rat, but not those of the mouse (1). GnRH-R has also been detected in granulosa cells and corpora lutea of the rat (2, 3) and human (4) ovary. However, similar studies in the mouse ovary have garnered conflicting results (5, 6).

We have previously identified and characterized the promoter region of the mouse GnRH-R gene (7). This enabled us to initiate studies on the mechanisms involved in the transcriptional regulation of mGnRH-R gene expression. In particular, we examined the tissue- and cell-specific expression of the mouse GnRH-R gene in vitro using transfection methods. Our studies showed that the mGnRH-R gene promoter is highly expressed in cell lines of pituitary origin, and is transcriptionally more active in a gonadotropic cell line ({alpha}T3–1) than in a somatolactotropic cell line (GH3) (7). The results of these experiments indicate that the regulatory elements for pituitary- and gonadotrope-specific expression are present within a 1.2-kb 5'-flanking region of the mGnRH-R gene.

To extend these in vitro studies, we have generated a transgenic mouse model in which the cell-specific regulatory sequences of the mGnRH-R gene promoter were used to direct the expression of the simian virus 40 (SV40) large T antigen (TAg). Such promoter-specific targeting of oncogene expression has been used extensively to study tissue-specific transcriptional regulation (8, 9). We derived a stable transgenic mouse line from one of the founders that permitted the examination of GnRH-R gene promoter-directed TAg expression. These mice will be used to measure transgene as well as endogenous GnRH-R, gonadotropin and TSH subunits, and PRL and GH gene expression. These experiments were performed to determine whether the 1.2-kb 5'-flanking region of the mGnRH-R gene can direct gene expression to the pituitary, specifically to gonadotropes, in an in vivo system.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Constructs
A genomic clone containing -1164/+52 of the mGnRH-R gene was digested with StyI and filled in with the Klenow fragment of Escherichia coli DNA polymerase I. The 5'-end at -1164 was digested with HindIII to free the mGnRH-R gene promoter fragment. The mGnRH-R gene fragment (-1164/+52) was subcloned into pBluescript KS and then fused with gene sequences coding for the SV40 TAg (+2533/+5234). The SV40 TAg sequences were obtained from a construct provided by Dr. Douglas Hanahan (University of California-San Francisco) (9). The GnRH-R/TAg transgene was separated from the vector pBluescript SK by digestion with BamHI. This 4.1-kb transgene DNA was gel purified using GeneClean (BIO 101, La Jolla CA), phenol-extracted twice, and then precipitated in ethanol (10). The DNA was then diluted in 10 mM Tris-HCl (pH 7.4) and 0.25 mM EDTA and submitted to the Brigham and Women’s Hospital Transgenic Core Facility (Boston, MA). The DNA was injected into the pronuclei of fertilized one-cell embryos from FVB mice. Two-cell stage embryos were then implanted into oviducts of pseudopregnant Swiss-Webster mice (11).

Identification of transgenic mice
Transgenic mice were identified by PCR analysis of tail genomic DNAs that were isolated as previously described (12). The presence of the transgene was screened using a sense primer corresponding to -349/-365 of the mouse GnRH-R (mGnRH-R) gene promoter and an antisense primer corresponding to +4720/+4741 of the SV40 TAg to generate a 900-bp product. One volume of TaqStart antibody (CLONTECH Laboratories, Inc., Palo Alto, CA) to 1 vol Taq DNA polymerase was used in all reactions. PCR was performed by denaturation at 94 C for 1 min and cycling 30 times at 58 C for 2 min and at 72 C for 3 min. PCR analysis of the mGnRH-R gene served as a positive control.

RNA isolation and RT-PCR for TAg mRNA
Individual pituitary and tumor tissues were homogenized in guanidine isothiocyanate, and total RNA was extracted using an RNeasy total RNA extraction (Qiagen, Madison, WI) which simplified the extraction of small amounts of RNA in some tissues. Total RNA was treated with 2 µl ribonuclease-free deoxyribonuclease I (Boehringer Mannheim, Indianapolis, IN) for 1 h to remove genomic DNA contamination. The samples were then extracted with phenol-chloroform and ethanol precipitated. Total RNA was then analyzed for TAg expression by RT-PCR. One microgram of the total RNA was reverse transcribed into complementary DNA (cDNA) using an oligo(deoxythymidine)12–18 primer (Pharmacia Biotech, Piscataway, NJ). Control experiments were performed in which reverse transcriptase was not added. TAg cDNA was then amplified by PCR using primers corresponding to +4620/+5225 of the coding region of TAg, using the conditions described above.

Preparation of cDNAs and oligonucleotide probes
cDNA probes for the {alpha}-subunit were generated by PCR using a sense primer, TCTTCCTGATGGAGACTTTATTATTCAG, and an antisense primer, CGACTTGTGGTAGTAGCAAGTGCTAC, to generate a 288-bp fragment (13). The PCR fragment for TAg corresponded to +4620/+5225 of the coding region of SV40 TAg. The PCR fragments were subcloned into the pGEMT vector (Promega Corp., Madison, WI). The mouse FSHß and LHß cDNAs were obtained from Dr. Malcolm Low (University of Oregon Health Sciences Center, Portland, OR) (14, 15, 16). For the mouse GnRH-R probe, we obtained a PstI-PstI fragment from a full-length cDNA that had been previously cloned by PCR (7). The GnRH-R cDNA fragment was subcloned into pBluescript (Stratagene, La Jolla, CA). Antisense probes were generated from cDNA encoding the {alpha}-subunit, FSHß, LHß, TAg, and GnRH-R. In vitro transcription was performed using either T3 or T7 RNA polymerase following the manufacturer’s instructions (Stratagene, La Jolla, CA). Oligonucleotide probes were synthesized by the Biopolymer Laboratory (Department of Genetics, Harvard Medical School). The oligonucleotide sequences for GH, PRL, POMC, and TSHß have been previously described (17). These probes (0.3 pmol each) were end-labeled with 25 pmol [{alpha}-35S]thiodeoxy-ATP (1300 Ci/mmol; New England Nuclear, Boston, MA) using 50 U terminal deoxynucleotidyl transferase (Boehringer Mannheim, Indianapolis, IN). Each reaction was incubated for 30 min, and the tailing reaction was terminated by adding 2 µl 0.2 M EDTA. Specific hybridization was assessed in control experiments using a 200-fold excess of unlabeled probe.

In situ hybridization
Deparaffinized tissue sections (6–8 µm) were incubated with different probes. The oligonucleotide probes (3000 cpm/µl) were incubated overnight in hybridization solution containing 50% (vol/vol) formamide, 4 x SSC (standard saline citrate), 1 x (vol/vol) Denhardt’s solution, 0.5 mg/ml herring sperm DNA, 10% (wt/vol) dextran, 0.1% (wt/vol) sodium pyrophosphate, and 0.2 mg/ml polyadenylate overnight at 37 C. The sections were then washed four times in 1 x SSC for 15 min for 4 at room temperature, four times in 2 x SSC-50% formamide for 15 min at 37 C, and three times in 1 x SSC for 30 min at room temperature.

Complementary RNA (cRNA) probes (~20,000 cpm) were incubated with tissue sections in hybridization solution containing 50% (vol/vol) formamide, 0.3 M sodium chloride, 10 mM Tris-HCl (pH 7.4), 10 mM NaH2PO4, 5 mM EDTA, 0.2% (wt/vol) Ficoll 400, 0.2% (wt/vol) polyvinylpyrrolidone, 50 µg/ml yeast transfer RNA, 10% (wt/vol) dextran sulfate, and 0.5 mg/ml polyadenylate. Sections were then washed four times at 65 C in 50% formamide, 2 x SSC, and 20 mM ß-mercaptoethanol for 40 min each; three times at 37 C in 4 x SSC, 20 mM Tris-HCl (pH 7.6), and 1 mM EDTA for 10 min each; and once at 37 C in 2 x SSC for 10 min. The slides were then coated with Kodak NTB-2 emulsion and exposed to Kodak Biomax MR or on CRONEX 3 film (Eastman Kodak Co., Rochester, NY). The sections were then developed and counterstained with Hoecsht for 2 min, rinsed in water, and embedded in Canada balsam and methyl salicylate.

Histological approaches
Animals were killed by approved methods, and cranial contents were exposed. In cases of large tumors, the brain with attached tumor mass was removed and fixed in 4% paraformaldehyde. In animals in which tumors were not grossly detected, the brain was removed, and the region of the sella turcica was dissected en bloc along with its contents. These tissues were similarly fixed in 4% paraformaldehyde and subjected to mild decalcification. Tissue was processed according to standard protocols, and 4- to 6-mm sections were cut from paraffin blocks. Sections were stained with hematoxylin and eosin and for reticulin fibers, using standard methods.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of transgenic mice
Transgenic mice were generated using a hybrid transgene containing 1.2 kb of the 5'-flanking region of the mGnRH-R gene and +5234/+2533 of the SV40 genome, which encodes the large TAg (GnRH-R/TAg; Fig. 1Go). Three founders were identified by PCR analysis of tail genomic DNA. Two of the founders, mouse 28 (M28, female) and mouse 25 (M25, male), were stunted in growth and were sterile (Table 1Go). These mice developed grossly enlarged crania with intracranial tumors at 37 and 50 days of age, respectively. In contrast to these two founders, mouse 29 (M29, male) was fertile and attained a normal body size. M29 developed a grossly enlarged cranium, and an apparent pituitary mass was seen at 103 days. All transgenic mice displayed decreased locomotor activity, sluggish responses to external stimuli, and difficulty in maintaining balance, with a tendency to fall or veer to one side. Gross examination of other organs failed to show any other tumor formation.



View larger version (7K):
[in this window]
[in a new window]
 
Figure 1. The mouse GnRH-R gene promoter and SV40 large TAg transgene. A fragment of the mouse GnRH-R gene promoter (-1164/+52) was subcloned into pBluescript KS and then fused with sequences coding for the large TAg of SV40 (+2533/+5234).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of GnRH-R/TAg transgenic mice

 
Derivation and characterization of the M29 transgenic line
Transgenic mice heterozygous for the GnRH-R/TAg transgene were bred from the M29 founder. This transgenic line was denoted the M29 line. Homozygous mice were not obtained because all heterozygote females were infertile in the presence or absence of grossly evident pituitary tumors. The M29 heterozygote females exhibited a grossly normal appearance of the external genitalia and the reproductive tract. However, light microscopy of ovaries from 8-week-old mice showed numerous preovulatory follicles, but no corpus luteum formation (Fig. 2Go), in contrast to corpora lutea and follicles at various stages of development in comparable age-matched nontransgenic animal controls. Superovulatory doses of gonadotropins (PMSG and hCG) induced follicular maturation, ovulation, and corpus luteum formation in M29 mice (data not shown). These studies indicate that the ovaries can respond appropriately to gonadotropin stimulation, and that abnormal ovarian development in M29 females is probably due to abnormal and/or deficient pituitary gonadotropin secretion.



View larger version (74K):
[in this window]
[in a new window]
 
Figure 2. Comparison of M29 ovary with wild-type ovary. Histological examination shows cross-sections from an ovary from an 8-week-old M29 transgenic mouse (A) and an ovary from a littermate wild-type mouse (B). Sections (7 µm) were stained with hematoxylin and eosin.

 
Mating of heterozygote M29 males and wild-type females resulted in 14 litters with 147 offspring, of which 79 mice expressed the transgene. The development of tumors did not appear to be affected by gender (42 males and 37 females). There was no significant fetal or perinatal death, and the affected/unaffected ratio followed the expected Mendelian ratio. All of the transgenic mice developed tumors in the anterior pituitary by 4–5 months of age, with the exception of those animals that were killed at an early age. Tumor size was highly variable in both animals from the same litter and those from different litters. These tumors attained 3- to 5-fold the size of the normal pituitary.

Development of pituitary tumors
The availability of the M29 transgenic line allowed us to obtain tumors at different stages of development. Mice were killed at different ages and examined for the presence of tumors. At early stages of tumor formation in the M29 transgenic line, there was no distortion of the cranium. The tumor was found centered on the sella turcica, with minimal displacement of the optic tract or other structures (Fig. 3Go).



View larger version (137K):
[in this window]
[in a new window]
 
Figure 3. Suprasellar location of the tumors. In A, the cranium is reflected to reveal a small tumor (T) that sits on the sella turcica at the base of the brain with minimal displacement cranial nerve V (arrows) running laterally on either side. In B, the sella (S) is expanded in association with the enlarging tumor mass.

 
Larger tumors were observed in older M29 transgenic mice as well as the three founders. The larger tumors were observed at an earlier age in the founders compared with individual mice of the M29 transgenic line (4–5 months). Upon dissection of the head, reflection of the skin showed an enlarged cranium with attenuated bony structures. Removal of the bone showed normally formed cerebral hemispheres with evidence of a sizable mass effect on the basal surface of the skull. The main tumor mass was nodular and irregular with a variegated surface. The tumors were fairly well circumscribed with the inferior portion of larger lesions having an irregular, infiltrating edge. In contrast, the normal pituitary was ovoid and had a smooth, homogeneous appearance. Despite the size of the tumors and their close proximity to the brain, even the larger tumors could be easily separated from the surrounding brain.

Microscopically, the smaller tumors showed areas of normal pituitary tissue with single tumor cell infiltration as well as transition areas of increasing atypia (Fig. 4Go). The tumor cells were heterogeneous with two main cell populations. There was a predominance of small round cells with scant cytoplasm and large, bizarre giant cells with hyperchromatic vacuolated nuclei, abundant eosinophilic cytoplasm, and prominent nucleoli. The larger cells were more prominent at the infiltrating edge of the tumor. The tumor cells were mostly mononuclear, but nuclear pleomorphism with multilobulation was evident. A fibrous stroma surrounded the cells. Larger tumors presented the same histology, with little if any identifiable normal pituitary tissue.



View larger version (66K):
[in this window]
[in a new window]
 
Figure 4. Histological appearance of a representative pituitary tumor. A coronal section of the entire brain and pituitary tumor from a 5-month-old M29 transgenic mouse is shown. The samples were decalcified, and the tissues were sectioned and then stained with hematoxylin and eosin. A shows a low powered view (x2.5) of a well circumscribed tumor with infiltrating inferior margins. The tumor is in close approximation with the surrounding brain parenchyma. On higher magnification (B; x100), as indicated by the right arrow, one can see normal pituitary tissue with transitional areas of increasing atypia. The left arrow indicates a large giant cell, which is common throughout the tumor.

 
In situ hybridization for pituitary hormones
To characterize tumor expression of genes encoding pituitary hormones as well as GnRH-R and TAg, in situ hybridization was performed using 35S-labeled cRNA and oligonucleotide probes. We were particularly interested in the glycoprotein hormone {alpha}-, FSHß-, and LHß-subunits mRNAs encoding; and the GnRH-R, all of which are markers of a mature pituitary gonadotrope.

In Figure 5Go, in situ hybridization of sagittal sections of the entire brain and tumor from a 5-month-old M29 transgenic mouse was performed. The results demonstrated that the {alpha}-subunit and GnRH-R mRNAs were specifically and abundantly expressed in the tumor. The surrounding brain did not hybridize with any of these probes and provided an internal negative control. The tumor also expressed FSHß, LHß, and TAg mRNAs over the entire tumor, albeit in lesser amounts. The same probes were used to examine hormone and GnRH-R expression in wild-type pituitary (data not shown); the results of these experiments were similar to those previously reported by Japon et al. (17).



View larger version (117K):
[in this window]
[in a new window]
 
Figure 5. In situ hybridization of pituitary tumor and brain. Coronal sections of a pituitary tumor and surrounding brain were hybridized with 35S-labeled cRNA probes corresponding to the {alpha}-, FSHß-, and LHß-subunits; GnRH-R; and TAg. The sections were then washed as described in Materials and Methods. Hybridization signals were visualized by brightfield microscopy. The {alpha}-subunit and GnRH-R antisense cRNA probes strongly hybridize to their respective mRNAs in the tumor. The FSHß and LHß mRNAs have weaker signals, which are evident throughout the tumor.

 
Additional in situ hybridization studies of a larger tumor from another 5-month-old transgenic mouse showed that the different pituitary hormones were expressed in a heterogeneous pattern (Fig. 6Go). This tumor largely expressed {alpha}-, FSHß-, and LHß-subunits and GnRH-R mRNAs. Both FSHß and LHß mRNAs were expressed in all tumors, although the pattern of expression in each tumor varied. In the tumor shown in Fig. 6Go, both gonadotropins were diffusely expressed over the entire tumor. This contrasts with the focal and minimal expression of the other pituitary hormones mRNAs: GH, PRL, POMC, and TSHß. Such discrete areas of expression may represent the presence of remnants of the normal pituitary that are still functional. The prevalence of gonadotrope markers with the virtual absence of GH, PRL, POMC, and TSHß mRNAs indicated that these tumors were of gonadotropic origin.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 6. In situ hybridization of a large pituitary tumor. A large pituitary tumor was obtained from a 5-month-old M29 transgenic mouse. The tumor was hybridized with 35S-labeled cRNA probes for the {alpha}-, FSHß-, and LHß-subunits; GnRH-R; and TAg and with 35S-labeled oligonucleotide probes for TSH ß-subunit, POMC, GH, and PRL. The sections were treated as described above. There is intense hybridization of the {alpha}-subunit and GnRH-R antisense cRNA probes to their respective mRNAs in the tumor. Weak expression of FSHß and LHß is evident throughout the tumor, with discrete but limited areas of hybridization for TSH, ACTH, GH, and PRL mRNAs.

 
Tumor-specific expression of TAg
Tumors and various tissues were obtained from the transgenic mice and analyzed for GnRH-R gene promoter-directed TAg expression by RT-PCR. Deoxyribonuclease treatment of total RNA samples was performed to eliminate contamination with genomic DNA. Normal pituitary from wild-type animals was used as a negative control. mRNA from {alpha}T3 cells was used as a positive control for TAg expression. Both small and large pituitary tumors were assessed. RT-PCR analysis of the different tissues showed that TAg was expressed only in pituitary tumors (Fig. 7Go). TAg was not detected in the male and female gonads or in any of the other tissues obtained from transgenic mice. These results indicate that 1.2 kb of the 5'-flanking region of the mGnRH-R gene promoter direct TAg expression specifically to the pituitary gland.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. Transgene expression in transgenic tissues. Total RNA from various endocrine and nonendocrine tissues of the M29 transgenic mice were prepared. RT-PCR analysis was performed to detect TAg mRNA expression. Control experiments were also performed in which reverse transcriptase was not added (-). TAg cDNA was then amplified by PCR. mRNA for L19, a ribosomal protein, was used as a positive control for all of the samples.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In summary, our studies indicate that 1.2 kb of the 5'-flanking region of the mGnRH-R gene can target oncogene expression specifically to the pituitary in vivo. This was demonstrated by both in situ hybridization and RT-PCR analysis. The GnRH-R gene promoter-directed expression also appears to be cell-specific and results in the formation of pituitary tumors that are primarily of gonadotropic origin. These results correlate with our previous studies, in which the GnRH-R gene promoter dictates pituitary cell-specific transcriptional activation (7).

The promoter-specific targeting of oncogene expression in transgenic mice has been used extensively to study tissue-specific and developmental patterns of transcriptional regulation as well as to generate specific immortalized cell lines. The SV40 TAg is particularly effective in inducing tumor formation in a variety of tissues in conjunction with its own promoter as well as heterogeneous promoters (8, 18). In the pituitary, Mellon and colleagues (19, 20, 21, 22) have obtained targeted oncogenesis to specific cell types using the {alpha} and LHß promoters. Cell lines generated from these studies have been extremely useful in the characterization of gondotrope cell function.

The M29 transgenic mice developed pituitary tumors that were grossly evident at 4–5 months of age. However, the effects of TAg oncogene expression are apparent before this stage, as evidenced by the inability of the mice to reproduce. As the TAg is expressed in the M29 pituitary but not in the ovary, infertility in females is most likely due to a defect in pituitary function. The absence of corpora lutea probably indicates the absence of ovulatory signals. Pituitary secretion of physiological levels of gonadotropins may be altered so that further follicular differentiation and ovulation do not occur. The response of the ovaries in M29 females to large doses of gonadotropin is consistent with this view.

The glycoprotein hormones, {alpha}-, FSHß-, and LHß-subunits, and the GnRH-R are all expressed in gonadotropes. Although the {alpha}-subunit is common to both thyrotropes and gonadotropes, the FSHß- and LHß-subunits are found exclusively in gonadotropes (17). GnRH-Rs are also abundantly and specifically expressed in the gonadotrope. Our in situ hybridization studies show that the tumors express all four gonadotrope-specific markers. The {alpha}-subunit and GnRH-R mRNAs are strongly expressed, which is consistent with their abundant expression in the normal pituitary. Also, the lower levels of expression of the FSHß- and LHß-subunits are consistent with the relatively lower transcriptional activities of these hormone subunits.

In contrast to pituitary tumors generated using the {alpha}- and LHß-subunit promoters (19, 22), the GnRH-R/TAg induces tumors that express both FSHß- and LHß-subunits. In the rodent embryo (17, 23), GnRH-R binding sites in the pituitary have been detected on embryonic day 12, one day after {alpha}-subunit expression and 4 days before the expression of LH and FSHß-subunits. It is possible that the later transcriptional activation of the GnRH-R gene promoter, compared with that of the {alpha}-subunit gene promoter, allows further gonadotrope differentiation. It is also possible that the higher transcriptional activity of the {alpha}-subunit promoter results in the expression of higher levels of TAg and arrests further differentiation of the gonadotrope. Indeed, TAg has been proposed to inhibit differentiation of precursor neuron cells in olfactory neuroepithelium (24). Therefore, the later expression of the GnRH-R gene promoter as well as its weaker promoter activity may allow differentiation of the gonadotrope to one that can express both ß-subunits.

Grossly, the pituitaries of the transgenic mice have a normal appearance in the initial stages. As the pituitaries enlarged and the tumors became grossly evident, changes in pituitary hormone expression occurred. Gonadotropin subunit mRNA expression was diffusely abundant in all tumors examined. Their expression levels persisted, but varied in the different tumors. In contrast, the other pituitary hormones had focal and minimal expression in the same tumors. GH and PRL mRNA expression had similar discrete patterns of expression, which suggested the presence of somatolactotropes. The expression of both of these hormones was low in most tumors. TSHß mRNA expression was minimal, although its pattern of expression was similar to that seen in normal pituitary. POMC mRNA was also usually found focally along the periphery on one edge of the tumor and probably represented rim tissue that had been pushed aside by the central expanding tumor mass. These localized areas of hormone gene expression may represent remnants of normal pituitary tissue. Indeed, transition areas of normal pituitary cells and tumor can be seen in most samples. The persistence of gonadotropin expression and the prevalence of gonadotrope markers as well as the discrete expression of POMC, TSHß, GH, and PRL suggest that the pituitary tumors are of gonadotropic origin.

As the expression of TAg is driven by the GnRH-R gene promoter, the levels of TAg mRNA can therefore be used to evaluate mGnRH-R gene promoter activation and consequently the level of mGnRH-R mRNA expression. As expected, TAg and GnRH-R mRNAs had a similar diffuse pattern of expression throughout the tumor, as shown by in situ hybridization in Figs. 5Go and 6Go. In addition, RT-PCR analysis for TAg mRNA suggests that the GnRH-R gene promoter directed transgene expression solely to the mouse pituitary. TAg mRNA was not detected in any other extrapituitary tissues examined, including ovary and testis. In the rat, extrapituitary GnRH-Rs have been identified in the ovary, testis, and hippocampus (1, 2, 3). However, studies in the mouse failed to establish the presence of receptors in these extrapituitary tissues (1, 5). Thus, the results of these studies are consistent with the presence of GnRH-R in various tissues with patterns of expression that may be distinct for different species.

In this study we have shown that 1.2 kb of the 5'-flanking region of the mGnRH-R gene contains regulatory sequences that direct gene expression specifically to the pituitary in vivo. We have developed a stable transgenic mouse model that consistently develops pituitary tumors. These tumors are capable of expressing the {alpha}-, FSHß-, and LHß-subunits and GnRH-R mRNAs, all of which are markers of a gonadotrope. As such, this transgenic line may provide a useful model for studies of the transcriptional regulation of the genes encoding GnRH-R and the glycoprotein hormone subunits. The pituitary tumors may also be useful for the development of functional gonadotrope cell lines.


    Acknowledgments
 
We thank the members of Dr. Dick Maas’ laboratory for their invaluable technical advice throughout this project; Dr. Lisa Halvorson for initial transfection studies; and Drs. Gumersindo Fernandez-Vasquez, Ursula Kaiser, Akira Sugawara, and Jabeen Jafri for helpful comments. Thanks also to Steve Gisselbrecht for help with the figures.


    Footnotes
 
1 This work was supported in part by NIH Grant HD-19938 (to W.W.C.) from the NICHD and a Lalor Foundation Fellowship Award (to C.T.A.). Back

2 Present address: Department of Pathology, University of Chicago Hospitals, 5812 South Maryland, Chicago, Illinois 60637. Back

Received October 22, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Reubi JC, Palacios JM, Maurer R 1987 Specific luteinizing-hormone-releasing hormone receptor binding sites in hippocampus and pituitary: an autoradiographical study. Neuroscience 21:847–856[CrossRef][Medline]
  2. Bauer-Dantoin AC, Jameson JL 1995 Gonadotropin-releasing hormone receptor messenger ribonucleic acid expression in the ovary during the rat estrous cycle. Endocrinology 136:4432–4438[Abstract]
  3. Jones PB, Conn PM, Marian J, Hsueh AJ 1980 Binding of gonadotropin releasing hormone agonist to rat ovarian granulosa cells. Life Sci 27:2125–2132[CrossRef][Medline]
  4. Peng C, Fan N, Ligier M, Vanaanen J, Leung PCK 1994 Expression and regulation of gonadotropin-releasing hormone (GnRH) and GnRH-R messenger ribonucleic acids in human granulosa-luteal cells. Endocrinology 135:1740–1746[Abstract]
  5. Ackerman RC, Johnson GA, Kirk EAV, Asirvatham AL, Murdoch WJ 1994 Induction of apoptotic or lytic death in an ovarian adenocarcinoma cell line by antibodies against a synthetic N terminal extracellular domain gonadotopin-releasing hormone receptor peptide. Cancer Lett 81:177–184[CrossRef][Medline]
  6. Murdoch WJ 1995 Immunolocalization of a gonadotropin-releasing hormone receptor site in murine endometrium that mediates apoptosis. Cell Tissue Res 282:527–529[Medline]
  7. Albarracin CT, Kaiser UB, Chin WW 1994 Isolation and characterization of the 5'-flanking region of the mouse gonadotropin-releasing hormone receptor gene. Endocrinology 135:2300–2306[Abstract]
  8. Suda Y, Aizawa S, Hirai S, Inoue T, Suzuki M, Hirohashi S, Ikawa Y 1987 Driven by the same Ig enhancer and SV40 T promoter ras induced lung adenomatous tumors, myc induced pre-B cell lymphomas and SV40 large T gene a variety of tumors in transgenic mice. EMBO J 6:4055–4065[Medline]
  9. Hanahan D 1985 Heritable formation of pancreatic ß-cell tumours in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes. Nature 315:115–122[CrossRef][Medline]
  10. DePamphilis ML, Herman SA, Martinez-Salas E, Chalifour LE, Wirak DO, Cupo DY, Miranda M 1988 Microinjecting DNA into mouse ova to study DNA replication and gene expression and to produce transgenic animals. Biotechniques 6:662–680[Medline]
  11. Hogan B, Costantini F, Lacy E 1986 Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor
  12. Laird PW, Zijderveld A, Linders K, Rudnicki MA, Jaenisch R, Berns A 1991 Simplified mammalian DNA isolation procedure. Nucleic Acids Res 19:4293–4295[Free Full Text]
  13. Chin WW, Kronenberg HM, Dee PC, Maloof F, Habener JF 1981 Nucleotide sequence of the mRNA encoding the pre-{alpha}-subunit of mouse thyrotropin. Proc Natl Acad Sci USA 9:5329–5333
  14. Chin WW, Godine JE, Klein DR, Chang AS, Tan LK, Habener JF 1983 Nucleotide sequence of the mRNA encoding the precursor of the ß subunit of rat lutropin. Proc Natl Acad Sci USA 80:4649–4653[Abstract/Free Full Text]
  15. Gharib SD, Roy A, Wierman ME, Chin WW 1989 Isolation and characterization of the gene encoding the ß-subunit of rat follicle-stimulating hormone. DNA 8:339–349[Medline]
  16. Kumar TR, Low MJ 1993 Gonadal steroid hormone regulation of human and mouse follicle-stimulating hormone ß-subunit gene expression in vivo. Mol Endocrinol 7:898–906[Abstract/Free Full Text]
  17. Japon MA, Rubinstein M, Low MJ 1994 In situ hybridization analysis of anterior pituitary hormone gene expression during fetal mouse development. J Histochem Cytochem 42:1117–1125[Abstract]
  18. Hanahan D 1988 Dissecting multistep tumorigenesis in transgenic mice. Annu Rev Genet 22:479–519[CrossRef][Medline]
  19. Windle JJ, Weiner R, Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Mol Endocrinol 4:597–602[Abstract/Free Full Text]
  20. Turgeon JL, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Mol Endocrinol 10:439–450[Abstract/Free Full Text]
  21. Alarid ET, Windle JJ, Whyte DB, Mellon PL 1996 Immortalization of pituitary cells at discrete stages of development by directed oncogenesis in transgenic mice. Development 122:3319–3329[Abstract]
  22. Turgeon J, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Mol Endocrinol 10:439–450
  23. Aubert ML, Begeot M, Winiger BP, Morrel G, Sizonenko PC, Dubois PM 1985 Ontogeny of hypothalamic luteinizing hormone-releasing hormone (GnRH) and pituitary GnRH receptors in fetal and neonatal rats. Endocrinology 116:1565–1576[Abstract/Free Full Text]
  24. Largent BL, Sosnowski RG, Reed RR 1993 Directed expression of an oncogene to the olfactory neuronal lineage in transgenic mice. J Neurosci 13:300–312[Abstract]



This article has been cited by other articles:


Home page
EndocrinologyHome page
K.-H. Jeong, J. C. Gill, V. Nose, A. F. Parlow, R. S. Carroll, and U. B. Kaiser
Expression of a Gonadotropin-Releasing Hormone Receptor-Simian Virus 40 T-Antigen Transgene Has Sex-Specific Effects on the Reproductive Axis
Endocrinology, July 1, 2009; 150(7): 3383 - 3391.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. R. Norwitz, S. Xu, J. Xu, L. B. Spiryda, J. S. Park, K.-H. Jeong, E. A. McGee, and U. B. Kaiser
Direct Binding of AP-1 (Fos/Jun) Proteins to a SMAD Binding Element Facilitates Both Gonadotropin-releasing Hormone (GnRH)- and Activin-mediated Transcriptional Activation of the Mouse GnRH Receptor Gene
J. Biol. Chem., September 27, 2002; 277(40): 37469 - 37478.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. L. Duval, A. R. Farris, C. C. Quirk, T. M. Nett, D. L. Hamernik, and C. M. Clay
Responsiveness of the Ovine Gonadotropin-Releasing Hormone Receptor Gene to Estradiol and Gonadotropin-Releasing Hormone Is Not Detectable in Vitro But Is Revealed in Transgenic Mice
Endocrinology, March 1, 2000; 141(3): 1001 - 1010.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
E. R. Norwitz, K.-H. Jeong, and W. W. Chin
Molecular Mechanisms of Gonadotropin-Releasing Hormone Receptor Gene Regulation
Reproductive Sciences, July 1, 1999; 6(4): 169 - 178.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Albarracin, C. T.
Right arrow Articles by Chin, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albarracin, C. T.
Right arrow Articles by Chin, W. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals