| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas 79430.
Address all correspondence and requests for reprints to: Gail A. Cornwall, Ph.D., Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, 3601 4th Street, Lubbock, Texas 79430. E-mail: cbbgc{at}wpoffice.net.ttuhsc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recently, several new cystatin genes have been identified that differ from the family 2 cystatin genes based on their tissue-specific expression, altered consensus sequences, and/or their gene structure (12, 13, 14). These cystatin genes may represent new families in the cystatin superfamily that have evolved to perform tissue-specific functions distinct from the housekeeping cystatin genes described earlier. We have previously reported that CRES gene and protein expression are restricted to the round/elongating spermatids in the testis and to the proximal caput epididymidis, with no detectable expression in 26 other tissues examined, including the reproductive tract of the female (15, 16). Furthermore, castration and hormone replacement studies showed that CRES gene expression within the epididymis required the presence of unknown testicular factors other than androgens (15). Recent genomic cloning and chromosomal localization studies demonstrated that the CRES gene exhibits exon structure similar to that of mouse cystatin C and cosegregates with cystatin C at the same genetic loci (16A ). However, the CRES promoter is distinct from the cystatin C promoter, in that it contains DNA regulatory elements typical of regulated genes. Taken together, these observations suggest that the CRES gene represents a new family of the cystatin superfamily that plays implicit roles in reproduction.
Our previous observations, that the CRES gene and protein are expressed in gonadal tissues, raised the question as to whether the CRES gene was also expressed in the neuroendocrine system, specifically within the pituitary gland, which is directly involved in the regulation of gonadal function via its secretion of gonadotropins. Therefore, the present experiments were designed to determine whether the CRES gene and protein are expressed in the anterior pituitary gland gonadotrope cells, and if so, whether CRES expression is hormonally regulated. In the studies presented here, we demonstrate by RT-PCR and Northern blot analysis that the CRES gene is expressed in the gonadotrope cells in the male and female anterior pituitary gland. Furthermore, Western blot analyses, double-label immunofluorescence, and confocal microscopy show that CRES protein colocalizes with LHß protein in the gonadotropes and is secreted. Finally, our studies suggest that CRES protein levels in the gonadotropes are regulated by hormones.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell and organ culture
Gonadotrope cell lines 
T3–1 and LßT2 were a generous gift
of P. Mellon, University of California, San Diego, whereas the
somatotrope/lactotrope GH3 cell line was from ATCC
(Rockville, MD). The T3–1 and LßT2 cells were cultured in 100-mm
tissue culture dishes and were maintained in DMEM with 4.5 mg/ml
glucose, 5% FCS, 5% calf serum, 100 U/ml penicillin, and 0.1 mg/ml
streptomycin, at 37 C in an atmosphere of 5% CO2. GH3
cells were maintained in DMEM with 10% FCS, 100 U/ml penicillin, and
0.1 mg/ml streptomycin. Media and antibiotics were from Gibco BRL (Grand Island, NY), and serum was from HyClone Laboratories, Inc. (Logan, UT).
Isolation of RNA
Total RNA was isolated from tissues pooled from 5–6 mice using
Trizol reagent (Gibco BRL, Grand Island, NY), following
the manufacturer’s protocol. For the isolation of RNA from cultured
cells, media was aspirated from tissue culture plates, the plates were
rinsed quickly with cold PBS, and 5 ml Trizol was added directly to
each plate. The cells were resuspended by scraping the plate with a
sterile spatula, followed by repeated pipetting and then isolation of
RNA, following the manufacturer’s protocol.
RT-PCR
RT-PCR was performed using 3 µg total RNA from male and female
mouse pituitary glands and 1 µg total RNA from mouse testis. Total
RNA was incubated in RT reaction buffer containing 5 mM
MgCl2, 50 mM KCl, 10 mM Tris (pH
8.3), 0.5 mM deoxynucleotide triphosphates, 20 U RNasin
(RNase inhibitor), and 2.5 µM oligo-dT for 30 min
at 37 C in the presence of 3 U deoxyribonuclease (DNase) I
(Boehringer Mannheim, Indianapolis, IN). After heat
inactivation of the DNase I at 75 C for 5 min (20), 50 U MuLV reverse
transcriptase (Perkin-Elmer Corp., Foster City, CA) was
added, and the reaction mixture was incubated at 42 C for 15 min, then
at 99 C for 5 min to inactivate the enzyme. Eighteen of the 20
microliter RT reaction was used for PCR amplification of the CRES
complementary (cDNA) in the presence of 2 mM
MgCl2, 10 mM Tris (pH 8.3), 50 mM
KCl, 0.2 mM deoxynucleotide triphosphates, 0.5
µM forward and 0.5 µM reverse CRES-specific
primers, 1.5 µCi [-32P]deoxycytidine triphosphate,
and 1.25 U Taq DNA polymerase (Sigma Chemical Co.). After an initial denaturation at 95 C, PCR was
carried out at 94 C for 1 min; 65 C for 1 min for 36 cycles, and 72 C
for 7 min using a minicycler (MJ Research, Inc.,
Watertown, MA). For a constitutive control, 1 µl of a 1:50 dilution
of the same RT reaction was amplified by PCR under the same conditions
described above using primers specific for mouse cystatin C. The RT-PCR
products were analyzed by electrophoresis in a 1.5% agarose/1x Tris
acetate EDTA gel, which was then dried under vacuum onto filter
paper for 1 h at 50 C. The dried gel was exposed to film for
48–72 h at room temperature.
Oligonucleotide primer pairs
Oligonucleotide primers for PCR were designed from the known
sequences for mouse CRES (15) and cystatin C (21) cDNAs. The primers
used for CRES PCR amplification were 5'CAAGGAAAGTGAGGACAAATATGTC3'
(forward) and 5'GTGACAGACTTGAACCACAGGTT3' (reverse), to yield a PCR
product of 340 bp. The primers used for cystatin C PCR amplification
were 5'CCCAAGCTTGGCATTTTTGCAGCTGAA3' (forward) and
5'CGCGGATCCGATGACGATGACAAAGCGACCCCAAAACAAGG3' (reverse), to yield a PCR
product of 354 bp.
Northern blot analysis
Total RNA from mouse tissues and cultured cell lines was
separated on a 1% agarose gel containing borate buffer (pH 8.2) and
0.66 M formaldehyde. The RNA samples were heated at 95 C
for 2 min before loading. To verify equal loading of RNA in each gel
lane, ethidium bromide was included in each RNA sample. The gels were
washed extensively in water to remove formaldehyde before vacuum
transfer (Oncor, Gaithersburg, MD) to nylon membrane (Nytran,
Schleicher & Schuell; Keene, NH). Blots were
prehybridized for 2 h at 42 C in hybridization buffer containing
50% formamide, 5x saline-sodium citrate (SSC), 0.2 mg/ml salmon sperm
DNA, 0.4 mg/ml yeast RNA, 50 µg/ml BSA, 0.1% SDS, and 12.5
mM sodium phosphate buffer, pH 6.6, followed by
hybridization overnight at 42 C in the presence of cDNA probe at a
concentration of 3 x 105 cpm/ml hybridization buffer.
cDNA probes for mouse CRES, rat LHß (a generous gift of P. Mellon),
and mouse 18S RNA were prepared by random priming (Prime-It II,
Stratagene, La Jolla, CA). After hybridization, the blots
were washed in 2x SSC, 1% SDS at 42 C for 30–45 min with several
changes, and then at 65 C, before exposure to film. After hybridization
with the CRES cDNA, blots were stripped by washing twice in 0.1x SSC,
1% SDS at 50 C for 30 min, and then successively probed with the LHß
cDNA and 18S cDNA as a loading control. The Northern blots were
repeated several times, and representative blots are shown.
Sequence analysis
RT-PCR products were cycle sequenced by the Texas Tech
University Biotechnology Core facility under the direction of Susan
SanFrancisco, Ph.D.
Preparation of protein extracts
Mouse testes and epididymides were pooled from four C57Bl6/J or
ICR mice and homogenized in lysis buffer containing 0.02 M
Tris (pH 7.5), 0.05 M NaCl, 1.0 mM EDTA, 0.5%
Triton-X 100, 0.5% deoxycholate, 0.5% SDS, and 0.01 mg/ml aprotinin.
LßT2 cells were grown, as described above, to near confluency. The
day before harvesting, the media was replaced with DMEM minus serum.
The following day, the conditioned media was collected, concentrated to
one fourth the original volume, using Centricon concentrators (Amicon,
Beverly, MA), and an equal volume of 2x lysis buffer was added. LßT2
cells were scraped off the plates and homogenized by 80 strokes with a
Dounce homogenizer on ice in the presence of 0.5 M sucrose,
50 mM Tris (pH 8), 25 mM KCl, 2 mM
MgCl2, 1 mM CaCl2 (TMCK buffer). A
crude secretory granule fraction was prepared, following the protocol
of Conn et al. (22). Briefly, homogenates were centrifuged
at 1,000 x g for 10 min at 4 C to pellet nuclei with
associated organelles and any remaining intact cells. The supernatant
was removed and centrifuged at 12,000 x g for 20 min
at 4 C to pellet secretory granules/organelles (granular fraction). The
nuclear pellet from the first low-speed spin was resuspended in 200
µl PBS containing 0.5% Tween-20 and was kept on ice for 20 min. The
nuclear extract was then layered onto a 0.5 M sucrose
cushion prepared in TMCK buffer and centrifuged at 1,000 x
g for 10 min. The upper layer, containing organelles, was
then combined with the granular fraction. Mouse whole pituitary gland
protein samples were prepared using the Trizol reagent (Gibco BRL, Gaithersburg, MD), following the manufacturer’s protocol.
Proteins present in the phenol/ethanol supernatant, remaining after the
isolation of RNA and DNA, were precipitated by the addition of
isopropanol, followed by centrifugation at 12,000 x g
for 10 min. The protein pellet was washed three times in 0.3
M guanidine hydrochloride in 95% ethanol by incubating the
pellet in the wash solution for 20 min each time, followed by a 5-min
spin at 7,500 x g. The protein pellet was dried and
resuspended in 2.5% SDS, followed by heating until dissolved. The
protein solution was then diluted to 1% SDS with water. Protein
concentrations for all samples were determined using the BCA protein
assay (Pierce Chemical Co., Rockland, IL).
Western blot analysis
One hundred to 150 µg protein were separated by 17.5%
SDS-PAGE, followed by transfer to nitrocellulose (Protran,
Schleicher & Schuell, Inc.) for Western blot
analysis. Blots were incubated in milk buffer containing 5% powdered
milk, 0.2% Tween 20 in PBS (pH 7.4), for 1 h at room temperature,
followed by an overnight incubation at 4 C with an affinity-purified
CRES antibody (2 µg/ml) or preimmune serum (PI, 1:5000 dilution) in
milk buffer containing 1% powdered milk, 0.2% Tween-20 in PBS, pH
7.4. The following day, the blots were washed in PBS-Tween, followed by
incubation with a goat antirabbit horseradish peroxidase-conjugated
secondary antibody (Biosource International, Camarillo,
CA) at 1:40,000 dilution in milk buffer for 1 h at room
temperature. The blots were then washed extensively in 1% milk buffer
before exposure to Super Signal chemiluminescent substrate
(Pierce Chemical Co.) for 5 min, followed by exposure to
film. For some Western blots, 125I-labeled protein A
(ICN Radiochemicals, Irvine, CA) was used in place of the
goat antirabbit horseradish peroxidase-conjugated secondary antibody
and the chemiluminescent substrate.
Carbohydrate analysis
To determine whether the CRES proteins possess N-linked
carbohydrate residues, protein extracts were treated with two different
N-glycosidases and examined by Western blot analysis.
Specifically, 125 µg protein extract, prepared (as described above)
from mouse testis, epididymis, and LßT2 gonadotrope cell culture
media, was denatured by boiling for 10 min in the presence of 0.5% SDS
and 1% ß-mercaptoethanol. The denatured proteins were incubated
overnight at 37 C in the presence of 50 mM sodium phosphate
buffer (pH 7.5) containing 1% NP-40 and 500 U N-glycosidase
F (PNGase F, New England Biolabs, Inc., Beverly, MA) or in
the presence of 50 mM sodium citrate (pH 5.5) and 500 U
endoglycosidase H (New England Biolabs, Inc.). The
following day, the samples were separated by SDS-PAGE, followed by
Western blot analysis, as described above.
Immunofluorescence
Mouse pituitary glands were fixed in 4% paraformaldehyde in
PBS, pH 7.4, for 1 h at 4 C and then washed successively for 30
min each at 4 C in PBS, 0.9% NaCl, 0.45% NaCl/50% ethanol, 70%
ethanol, and stored in 70% ethanol at 4 C overnight. The tissues were
then dehydrated by incubation in 95% ethanol for 30 min at 4 C,
followed by 100% ethanol for 30 min, and then two incubations of 100%
ethanol each for 1 h at 4 C. Tissues were washed in xylenes for 40
min and then 1 h at room temperature, followed by embedding in
paraffin. Four micron paraffin sections were cut and mounted onto glass
slides by the Texas Tech University Health Sciences Center Electron
Microscopy Center. Tissue sections were deparaffinized by incubating at
room temperature twice (for 10 min each) in xylenes, once (for 3 min)
in 100% ethanol, and once (for 3 min) in 95% ethanol. The slides were
allowed to dry, and sections were circled with a Pap pen to allow small
incubation volumes. After a 20-min incubation in PBS, the tissue
sections were covered with 100% normal goat serum and placed in a
humidified chamber at 37 C to block for 90 min. A high percentage of
goat serum was used for blocking, to minimize the background
fluorescence observed in the pituitary glands. The blocked tissue
sections were briefly washed with 5–10 drops of 5% normal goat serum
in PBS and then incubated in a humidified chamber at 37 C for 2 h
with both a rabbit antimouse CRES antiserum (1:400) and a guinea pig
antirat LHß antiserum (1:3000), developed by A. F. Parlow and a
gift from the National Hormone and Pituitary Program, NIDDK. For
controls, pituitary gland tissue sections were incubated with the LHß
antiserum (1:3000) and CRES PI (1:400) or the rabbit antimouse CRES
antiserum, preincubated with recombinant CRES protein (block; 1:400).
The specificity of the guinea pig antirat LHß antiserum has been
demonstrated previously (23). After incubation of the tissue sections
with the primary antibodies, sections were washed three times for 5 min
each at room temperature in PBS and incubated, for 1 h at 37 C in
a dark humidified chamber, with an fluorescein isothiocyanate
(FITC)-conjugated goat antiguinea pig secondary antibody (1:50 in PBS)
(Jackson ImmunoResearch Laboratories, Inc., West Grove,
PA) and a Texas Red-conjugated goat antirabbit secondary antibody (1:50
in PBS) (Jackson ImmunoResearch Laboratories, Inc.).
Sections were washed in PBS three times for 5 min each at room
temperature in the dark and then once in PBS, pH 8.5. Slides were
inverted onto coverslips containing 15–20 µl mounting medium [92
mM Tris (pH 8.5), 18.5% dimethylsulfoxide, 23% methanol,
0.092 mg/ml Mowiol 4–88 (Fisher Scientific, Pittsburgh PA)], to which p-phenyline diamine (1 mg/ml
final; Sigma Chemical Co.) was added immediately before
use, and sections were allowed to cure overnight in the dark. The
sections were examined using an Olympus Corp. BX-60
microscope equipped for epifluorescence and were photographed using
both a wide yellow filter for rhodamine (Texas Red) and a narrow band
filter for FITC. The sections were also examined using an Olympus Corp. LSM-GB200 confocal microscope.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, CRES mRNA
was expressed in the testis as well as in all RNA preparations from the
pituitary glands of both male and female mice. Control experiments,
including RT-PCR of water (to test for the presence of cDNA in the
reaction components) and PCR only, of each RNA sample (to test for DNA
contamination), did not result in a PCR product, indicating that the
CRES signal observed by RT-PCR was attributable to the presence of CRES
mRNA in the pituitary gland RNA preparations. Furthermore, cycle
sequencing confirmed that the 340-bp PCR product was indeed CRES cDNA.
The same reverse transcriptase reactions were also used for PCR
amplification of the mouse cystatin C cDNA. We have previously
determined, by Northern blot analysis, that cystatin C expression does
not vary between RNA samples prepared from different pooled mouse
pituitary glands (data not shown), and therefore, it served as a
constitutive control for the RT-PCR reactions. The differences observed
in the cystatin C levels thus reflect slight differences in the amount
of RNA used in the RT-PCR reactions.
|
T3–1 and LßT2 cell lines and from the rat somatotrope/lactotrope
GH3 cell line, was examined for CRES gene expression in Northern blot
analysis. Total RNA, isolated from the mouse testis and epididymis, was
included in the Northern blot analysis as positive controls. As shown
in Fig. 2, in addition to the expected
expression of the CRES mRNA in the mouse testis and epididymis, the 700
bp CRES mRNA was also expressed in the LßT2 gonadotrope cells but not
in the T3–1 gonadotrope cells or in the GH3 cells. The absence of
CRES mRNA in the rat somatotrope/lactotrope GH3 cells was not caused by
the inability of the mouse cDNA to recognize the rat CRES mRNA, because
we have previously determined (by Northern blot analysis) that the
mouse cDNA was able to recognize the rat CRES mRNA in the epididymis
(data not shown). When the Northern blots were stripped and reprobed
with an LHß cDNA, the LHß mRNA was only detected in the LßT2
cells that represent a differentiated gonadotrope cell line and not in
the T3-1 cells that represent a less differentiated gonadotrope cell
line. The somatotrope/lactotrope GH3 cell line also did not express
LHß mRNA.
|
, although low levels of CRES proteins
were detected in the LßT2 secretory granules, higher levels of CRES
proteins were detected in the conditioned media. Interestingly, in
addition to the 19- and 14-kDa CRES proteins present in the LßT2
secretory granules, two proteins of 17 and 12 kDa were also observed in
the conditioned media, with the 12-kDa CRES protein being the
predominant form. In contrast, in the epididymis, the 19- and 14-kDa
proteins were the predominant forms, with lower levels of the 17- and
12-kDa proteins present. The CRES protein profile in the whole mouse
pituitary gland appeared similar to that observed in the secretory
granules isolated from the LßT2 cultured cells, although little-to-no
14-kDa CRES protein was detected. The 22- and 29-kDa proteins present
in the epididymis, cultured cells, and whole pituitary lysates may
represent proteins with cross-reacting epitopes or CRES protein
complexes resistant to the reducing conditions used. Western blot
analysis, carried out with PI, did not show the presence of the CRES
proteins in the tissue and cell lysates or media, confirming the
specificity of the antibody for CRES protein (Fig. 3B).
|
, incubation of the tissue lysates and
conditioned media in the presence of the N-glycosidase F resulted in a
shift of the higher-molecular-mass CRES proteins (19 and 17 kDa) to the
lower-molecular-mass CRES proteins (14 and 12 kDa), indicating that the
higher-molecular-mass CRES proteins were the result of
N-linked glycosylation. The lower-molecular-mass CRES
proteins (14 and 12 kDa) seemed to be resistant to the
N-glycanase treatment, given that no smaller CRES proteins
were detected. Similarly, tissue lysates and conditioned media
incubated with endoglycosidase H, which cleaves only high mannose
residues and some hybrid oligosaccharides from N-linked
glycoproteins, also caused the higher-molecular-mass CRES proteins to
shift to the lower-molecular-mass CRES proteins (data not shown). Taken
together, the deglycosylation studies suggest that the 5-kDa difference
in molecular mass between the two forms of the CRES proteins is caused
by the presence of high mannose residues.
|
, FITC fluorescence demonstrated that,
in both male and female mice, LHß protein was present in a distinct
population of cells scattered throughout the pituitary gland sections,
indicating that these cells are gonadotropes. Examination of the Texas
Red fluorescence in the same tissue sections showed CRES protein to be
localized to the same population of cells expressing LHß protein.
This was confirmed by a double-exposure photograph, with the FITC and
Texas Red filters, to detect both the LHß and CRES proteins,
respectively (green + red = yellow). No detectable LHß or CRES
protein was present in the posterior region of the pituitary gland
[Fig. 5, (p)]. To control for the specificity of the CRES antiserum,
male and female pituitary gland tissue sections were simultaneously
incubated with the LHß antiserum and the CRES PI, followed by
incubation with the secondary antibodies. As shown in Fig. 5, as
expected, the cells were FITC positive for LHß protein but showed no
specific Texas Red staining for CRES protein with the PI.
Because of the lack of a specific staining for CRES protein when the PI
is used, the double-exposure photograph, with the FITC and Texas Red
filters, therefore detected only the LHß protein (green). In addition
to the PI, controls for nonspecific fluorescence included the
incubation of tissue sections with CRES antiserum preincubated with
CRES protein (block), with secondary antibodies alone, and with both
combinations of mismatched primary and secondary antibodies (CRES
anti-serum + FITC antiguinea pig secondary antibody, LHß antiserum +
Texas Red antirabbit secondary antibody). These experiments resulted in
no specific fluorescence signal in the pituitary gland tissue sections
(data not shown).
|
, nine other male and female mouse pituitary glands were examined by
double-label immunofluorescence. In these studies, the CRES protein
consistently colocalized with LHß protein to the anterior pituitary
gonadotropes. A comparison between the individual male pituitary glands
showed that, in all males, the gonadotropes appeared fairly homogeneous
in size and in the intensity of the LHß and CRES immunofluorescence
(Figs. 5, 6). In contrast, a comparison between individual female
pituitary glands showed heterogeneity in the relative size of the
gonadotropes and in the intensity of the LHß and CRES
immunofluorescence. For example, the gonadotrope cells in the female
pituitary gland, shown in Fig. 5, appeared similar in size and LHß
and CRES immunofluorescence, as in the male gonadotropes. However,
in other female pituitary glands, the gonadotropes were more
heterogeneous; some gonadotropes appeared smaller, with less intense
LHß and CRES immunofluorescence (Fig. 6).
|
). In support
of these observations, confocal microscopy, which examined the
fluorescent intensities for both LHß and CRES proteins in a single
plane of a gonadotrope cell, showed similar patterns in fluorescent
intensities for the two proteins (Fig. 7B). These observations suggest
that CRES protein colocalizes intracellularly with LHß protein in the
gonadotropes.
|
, organ weights of the
androgen-dependent seminal vesicles and the estrogen-dependent uterine
horns reflected the hormonal status of the animal. After gonadectomy,
there was a corresponding decrease in the wet weight of the seminal
vesicles and uterine horns and a subsequent increase in tissue weights
after hormone replacement. Similarly, RIAs showed that circulating
levels of testosterone and estradiol in the male and female mice,
respectively, showed a dramatic decrease after gonadectomy, with a
corresponding increase after the administration of hormone (Fig. 8 legend).
|
|
). After the
administration of testosterone, for 1 week, to castrate male mice
(T-Repl.), the levels of LHß and CRES proteins in the gonadotropes
recovered and seemed equivalent, if not slightly greater, than the
levels of LHß and CRES proteins in the gonadotropes of intact mice
(Fig. 8). Comparable changes in LHß and CRES proteins were observed
in other intact (n = 3), castrate (n = 4), and T-Repl.
(n = 4) male pituitary glands (data not shown). Female mice,
however, seemed to respond differently to gonadectomy than did male
mice. After ovariectomy, the gonadotropes appeared larger and richer in
LHß and CRES proteins than their intact counterpart cells. The
administration of estradiol did not seem to dramatically alter the
levels of LHß and CRES proteins in the gonadotropes, compared with
that observed in ovariectomized mice. However, a decrease in the number
of positive cells was observed. Comparable changes in LHß and CRES
proteins were observed in other intact (n = 3), ovariectomized
(n = 4), and E2-Repl. (n = 4) female mice. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T3–1
gonadotrope cell line, suggesting that the expression of the CRES gene
is associated with a differentiated phenotype. Indeed, though the
T3–1 and LßT2 cell lines are responsive to GnRH and express the
GnRH receptor and thus are characterized as being of the gonadotrope
cell lineage (24, 25), they are distinct from each other. The
T3–1 cell line represents an undifferentiated gonadotrope cell and
expresses the -subunit gene common to several peptide hormones,
including LH, FSH, TSH, and human CG; whereas the LßT2 cell line
represents a differentiated go-nadotrope cell and expresses both
the -subunit gene and the LHß-subunit gene that determines hormone
specificity (24, 25). The expression of the CRES gene exclusively in
the LßT2 cells implies that CRES function is associated with
functionally mature gonadotrope cells. Further analysis of the LßT2 cells, by Western blot analysis, demonstrated that CRES protein was synthesized and secreted by the gonadotrope cells in culture. Interestingly, although the 19- and 14-kDa CRES proteins, present in the epididymal tissue lysate and LßT2 secretory granules, were also present in the conditioned media, the predominant CRES proteins present in the conditioned media were 17 and 12 kDa. Because CRES protein levels were low in the LßT2 secretory granules, it is difficult to determine whether the 17- and 12-kDa CRES proteins present in the media were also present intracellularly. The higher levels of CRES protein present in the conditioned media were most likely caused by the fact that the conditioned medium consisted of proteins secreted over a 18- to 24-h period (and therefore, was an accumulation of CRES protein), whereas the secretory granule fraction represented total CRES protein present in the LßT2 cells at a single point in time. Because the CRES protein profile in the whole pituitary lysate was similar to the LßT2 secretory granule fraction, and smaller CRES proteins were also detected in the epididymal lysates, the 17- and 12-kDa CRES proteins seem to occur in tissues as well as in the cell line.
Deglycosylation studies, in which tissue lysates and the LßT2-conditioned media were pretreated with N-glycosidase F or endoglycosidase H, revealed that the higher-molecular-mass CRES proteins (19 and 17 kDa) were the result of N-linked glycosylation, caused by the presence of high mannose residues. The lower-molecular-mass CRES proteins (14 and 12 kDa) lack N-linked glycosylation, because these proteins seemed resistant to the N-glycanase treatment. The presence of N-linked sugars in the CRES proteins was not surprising, considering that the CRES-derived amino acid sequence possesses two putative N-linked glycosylation consensus sites (Asn-X-Ser/Thr) (15). Furthermore, the N-linked glycosylation of the CRES protein is similar to the mouse and rat cystatin C proteins, which have been shown to be present in glycosylated (20 kDa) and nonglycosylated forms (14 kDa) (26, 27, 28).
Though it seems that N-linked glycosylation of the 14- and 12-kDa CRES proteins resulted in the formation of the 19- and 17-kDa CRES forms, there are several possible reasons for the presence of the smaller 12-kDa CRES protein in addition to the 14-kDa CRES protein. We recently have determined that, in all tissues that express the CRES gene, there is an alternatively spliced CRES mRNA that lacks the initiator methione but that contains a downstream methionine in fairly good context for translational initiation (29). Translational initiation at the second methionine predicts a CRES protein of approximately 12 kDa. Furthermore, preliminary in vitro transcription and translation studies suggest that translation can initiate at the second methionine in the CRES mRNA (Sutton and Cornwall, unpublished observations). A second possibility for the presence of the 12-kDa CRES protein is that the 14-kDa CRES protein is proteolytically processed. Indeed, lower-molecular-mass forms of cystatin C protein have been identified in vivo and have been determined to be the result of specific N-terminal proteolysis (30). Finally, the presence of both 12- and 14-kDa CRES proteins may reflect O-linked glycosylation differences between the two proteins. However, preliminary studies using O-glycanase to remove O-linked carbohydrate residues did not result in changes in the molecular mass of the CRES proteins (data not shown). Studies are currently ongoing to examine further the use of different CRES mRNAs and/or N-terminal proteolysis as a means of regulating CRES protein function.
Double-label immunofluorescence studies of mouse male and female pituitary glands showed that CRES protein colocalized with LHß protein to the gonadotrope cells, thereby confirming the in vitro studies with the LßT2 gonadotrope cell line. Examination of the immunostained pituitary gland sections at a higher magnification showed a similar punctate pattern of localization for the CRES and LHß proteins within the gonadotropes, implying that the two proteins also colocalize intracellularly. These observations were confirmed by confocal microscopy, which showed identical LHß and CRES immunofluorescence patterns through a single plane of a gonadotrope cell. Finally, Western blot analysis of the secretory granule fraction of the LßT2 cells showed the presence of CRES proteins. These observations, taken together with the fact that CRES protein is secreted in vitro, suggest that CRES protein is localized in the gonadotrope secretory granules.
An examination of intact male anterior pituitary glands for CRES and LHß proteins, by double-label immunofluorescence, showed little difference between individual mice in the expression of the two proteins in the gonadotropes. In contrast, qualitative differences were observed between individual female anterior pituitary glands with regard to the relative levels of CRES and LHß proteins and the size of the gonadotrope cells. Though some female anterior pituitary glands exhibited gonadotrope cells that were similar to that in the male, with regard to their size and intensity of the CRES and LHß immunofluorescence, the majority of the females showed a more heterogeneous population of go-nadotropes, with some cells being smaller and exhibiting less intense CRES and LHß immunofluorescence. It is likely that the differences observed in the size of the gonadotropes and the relative amounts of LHß protein reflect mice in different stages of the estrus cycle. It was intriguing that, in the female mice examined, the levels of CRES protein fluctuated in the same direction as those of LHß protein. These observations not only suggest that CRES protein in the gonadotropes may be hormonally regulated but that CRES protein regulation may share some features in common with LHß regulation. Hormonal studies in which gonadectomies were performed in the male and female mice, followed by the administration of testosterone to males and estradiol to females, suggested that CRES protein in the gonadotropes may be regulated, in part, by steroid hormones. Because indirect immunofluorescence was used to examine CRES protein in the anterior pituitary gonadotropes, it is difficult to quantitate the levels of CRES protein before and after hormonal manipulations; and therefore, only qualitative conclusions can be made. However, these studies provide the basis for future experiments to examine, in greater detail, the influence of steroid hormones as well as GnRH on CRES protein in the anterior pituitary gland. Studies are also currently ongoing to develop a CRES enzyme-linked immunosorbent assay for quantitative analyses of CRES protein.
It is of interest to note that our observations of pituitary LHß levels (by immunofluorescence) in male and female mice, after gonadectomy and hormone replacement, were similar to that previously observed (by RIA) in mice (31, 32, 33) but quite different from that reported in rats (34). For example, after orchiectomy, although serum LH is elevated, pituitary LH is persistently reduced in male mice and does not become elevated as occurs in chronically castrate rats (34). This response in male mice has been proposed to be caused by a rate of LH secretion that exceeds the rate of synthesis, leading to a depletion of the pituitary LH content in castrate male mice (35). Interestingly, we observed the exact opposite response in female mice after gonadectomy, in that LHß immunofluorescence seemed elevated. Although other studies have shown by RIA that, within the first 24 h after ovariectomy, there is an immediate decline in pituitary LH content in female mice, there is a subsequent progressive increase, resulting in elevated pituitary LH levels and in serum LH within 7 days (32). In this regard, the pituitary response of ovariectomized mice is similar to that of ovariectomized rats (34). Female mice may respond differently from male mice, in that they typically release large amounts of LH during the preovulatory surge and thus may be more capable of replenishing LH protein in the gonadotropes (35). Our lack of a noticeable effect of estradiol on pituitary LHß levels in ovariectomized female mice was unexpected. However, persistently elevated pituitary LH levels have been observed previously in ovariectomized female mice administered similar doses of estradiol (32), suggesting that higher doses of estradiol are required to elicit a response in mice. Although we had insufficient sample for determining serum LH, the similar response of pituitary LHß immunofluorescence (in our studies) to that previously reported by RIA for male and female mice supports the conclusions (from other studies) that mice are distinct from rats in their pituitary response to hormone withdrawal and replacement.
The colocalization of the CRES protein with LHß protein in the gonadotropes raises intriguing possibilities as to its function in the anterior pituitary gland. Because one proposed role of the cystatin proteins is the regulation of prohormone processing, one possibility is that CRES protein may regulate these processing events in the gonadotrope cells. Alternatively, CRES protein function may be extracellular and, after secretion, CRES may have local effects within the pituitary or more distant endocrine effects.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received October 10, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-trace) and chicken cystatin. FEBS Lett 170:370–374
This article has been cited by other articles:
 |
|
 |
|
  H. G. Sutton-Walsh, S. Whelly, and G. A. Cornwall Differential Effects of GnRH and Androgens on Cres mRNA and Protein in Male Mouse Anterior Pituitary Gonadotropes J Androl, November 1, 2006; 27(6): 802 - 815. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li, C. A. Putnam-Lawson, H. Knapp-Hoch, P. J. Friel, D. Mitchell, R. Hively, and M. D. Griswold Immunolocalization and Regulation of Cystatin 12 in Mouse Testis and Epididymis Biol Reprod, November 1, 2005; 73(5): 872 - 880. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Tohonen, J. Frygelius, M. Mohammadieh, U. Kvist, L. J. Pelliniemi, K. O'Brien, K. Nordqvist, and A. Wedell Normal Sexual Development and Fertility in testatin Knockout Mice Mol. Cell. Biol., June 15, 2005; 25(12): 4892 - 4902. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Hsia, J. P. Brousal, S. R. Hann, and G. A. Cornwall Recapitulation of Germ Cell- and Pituitary-Specific Expression With 1.6 kb of the Cystatin-Related Epididymal Spermatogenic (Cres) Gene Promoter in Transgenic Mice J Androl, March 1, 2005; 26(2): 249 - 257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Kirby, L. Yang, J. C. Labus, R. J. Lye, N. Hsia, R. Day, G. A. Cornwall, and B. T. Hinton Characterization of Epididymal Epithelial Cell-Specific Gene Promoters by In Vivo Electroporation Biol Reprod, August 1, 2004; 71(2): 613 - 619. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, P. J. Friel, D. J. McLean, and M. D. Griswold Cystatin E1 and E2, New Members of Male Reproductive Tract Subgroup Within Cystatin Type 2 Family Biol Reprod, August 1, 2003; 69(2): 489 - 500. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. A. Cornwall, A. Cameron, I. Lindberg, D. M. Hardy, N. Cormier, and N. Hsia The Cystatin-Related Epididymal Spermatogenic Protein Inhibits the Serine Protease Prohormone Convertase 2 Endocrinology, March 1, 2003; 144(3): 901 - 908. [Abstract] [Full Text] [PDF]
|
< |
