help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sutton, H. G.
Right arrow Articles by Cornwall, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sutton, H. G.
Right arrow Articles by Cornwall, G. A.
Endocrinology Vol. 140, No. 6 2721-2732
Copyright © 1999 by The Endocrine Society


ARTICLES

Cystatin-Related Epididymal Spermatogenic Protein Colocalizes with Luteinizing Hormone-ß Protein in Mouse Anterior Pituitary Gonadotropes1

H. Gayle Sutton, Angelina Fusco and Gail A. Cornwall

Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas 79430.

Address all correspondence and requests for reprints to: Gail A. Cornwall, Ph.D., Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, 3601 4th Street, Lubbock, Texas 79430. E-mail: cbbgc{at}wpoffice.net.ttuhsc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CRES (cystatin-related epididymal spermatogenic) protein, a member of the cystatin superfamily of cysteine protease inhibitors, exhibits highly restricted expression in the mouse testis and epididymis, suggesting roles in reproduction. Considering the well-established relationship that exists between the gonads and the neuroendocrine system, the present studies were undertaken to determine whether the CRES messenger RNA and protein are expressed in the anterior pituitary gland and, if so, whether the expression is regulated by hormones. RT-PCR analysis of whole pituitary gland RNA preparations, and Northern blot analyses of pituitary gland cell lines, demonstrated that the CRES gene is expressed in the male and female anterior pituitary gland gonadotropes. Furthermore, Western blot analysis demonstrated that CRES protein was present in whole mouse pituitary glands and was synthesized and secreted by the LßT2 gonadotrope cell line. Interestingly, whereas the predominant CRES proteins present in epididymal lysates, LßT2 secretory granules, and whole pituitary gland lysates were 19 and 14 kDa, the predominant CRES proteins present in the cell culture conditioned media were 17 and 12 kDa. Deglycosylation studies revealed that the higher-molecular-mass CRES proteins (19 and 17 kDa) were the result of N-linked glycosylation, caused by the presence of high mannose residues. Double-label immunofluorescence and confocal microscopic analysis of male and female mouse pituitary gland tissue confirmed the RNA studies and showed that CRES protein colocalized with LHß protein in the gonadotropes. Finally, gonadectomy and hormone replacement studies suggest that CRES protein in the gonadotropes is hormonally regulated. These studies suggest that CRES protein may perform a role in the gonadotrope-mediated control of reproduction.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE CRES (cystatin-related epididymal spermatogenic) gene is a highly conserved gene, which is a member of the cystatin superfamily of cysteine protease inhibitors. The cystatin superfamily consists of three well-characterized families, including the intracellular stefins, and the secreted cystatins and kininogens (1). The cystatins (family 2 cystatins), with which the CRES gene shows the highest sequence similarity, are characterized by their 3-exon structure, a broad tissue distribution, and promoters with features of housekeeping genes (2). The family 2 cystatin genes, including cystatins C, D, S, SA, and SN, encode secreted proteins of 12–13 kDa, which are present in most body fluids (1). The proteins possess four highly conserved cysteine residues necessary for protein folding (3) and three consensus motifs thought to be involved in the inhibition of cysteine proteases (4, 5). Although in vitro studies have clearly established that the cystatins are cysteine protease inhibitors with specificities against the papain-like cysteine proteases [such as cathepsin B, S, H, and L (6)], the in vivo function of the cystatins is not well understood. However, roles in tumor invasion, inflammation, and prohormone processing have been suggested (7, 8, 9). The critical role these proteins play is further emphasized by the association of several neurological diseases with mutations in specific cystatin genes (10, 11).

Recently, several new cystatin genes have been identified that differ from the family 2 cystatin genes based on their tissue-specific expression, altered consensus sequences, and/or their gene structure (12, 13, 14). These cystatin genes may represent new families in the cystatin superfamily that have evolved to perform tissue-specific functions distinct from the housekeeping cystatin genes described earlier. We have previously reported that CRES gene and protein expression are restricted to the round/elongating spermatids in the testis and to the proximal caput epididymidis, with no detectable expression in 26 other tissues examined, including the reproductive tract of the female (15, 16). Furthermore, castration and hormone replacement studies showed that CRES gene expression within the epididymis required the presence of unknown testicular factors other than androgens (15). Recent genomic cloning and chromosomal localization studies demonstrated that the CRES gene exhibits exon structure similar to that of mouse cystatin C and cosegregates with cystatin C at the same genetic loci (16A ). However, the CRES promoter is distinct from the cystatin C promoter, in that it contains DNA regulatory elements typical of regulated genes. Taken together, these observations suggest that the CRES gene represents a new family of the cystatin superfamily that plays implicit roles in reproduction.

Our previous observations, that the CRES gene and protein are expressed in gonadal tissues, raised the question as to whether the CRES gene was also expressed in the neuroendocrine system, specifically within the pituitary gland, which is directly involved in the regulation of gonadal function via its secretion of gonadotropins. Therefore, the present experiments were designed to determine whether the CRES gene and protein are expressed in the anterior pituitary gland gonadotrope cells, and if so, whether CRES expression is hormonally regulated. In the studies presented here, we demonstrate by RT-PCR and Northern blot analysis that the CRES gene is expressed in the gonadotrope cells in the male and female anterior pituitary gland. Furthermore, Western blot analyses, double-label immunofluorescence, and confocal microscopy show that CRES protein colocalizes with LHß protein in the gonadotropes and is secreted. Finally, our studies suggest that CRES protein levels in the gonadotropes are regulated by hormones.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental animals
Intact mature male and female ICR and C57Bl6/J mice and bilaterally castrate ICR male and bilaterally ovariectomized ICR female mice were purchased from Harlan Sprague Dawley, Inc. (Indianapolis, IN) and were maintained under a constant 12-h light, 12-h dark cycle, with food and water ad libitum. Testosterone replacement was by the implantation of a 5-mg testosterone pellet (Innovative Research of America, Sarasota, FL) directly under the skin on the back of each mouse. Estrogen replacement was by a daily sc injection of 300 ng 17ß estradiol in 0.1 ml corn oil/mouse (Sigma Chemical Co. St. Louis, MO), as previously described (17). At the time mice were killed, the remainder of the testosterone pellet was isolated from each implanted mouse to ensure that it had not been lost during the replacement period. Also, the seminal vesicles and uteri were removed and weighed, and blood was collected for RIA determination of circulating testosterone and estrogen levels in the male and female mice, respectively. RIAs were performed by the Endocrine Services Laboratory at the Oregon Regional Primate Research Center (Beaverton, OR) under the direction of David Hess, using the assays previously reported (18, 19). All animal studies were conducted in accordance with the NIH guidelines for the Care and Use of Experimental Animals.

Cell and organ culture
Gonadotrope cell lines {alpha}T3–1 and LßT2 were a generous gift of P. Mellon, University of California, San Diego, whereas the somatotrope/lactotrope GH3 cell line was from ATCC (Rockville, MD). The {alpha}T3–1 and LßT2 cells were cultured in 100-mm tissue culture dishes and were maintained in DMEM with 4.5 mg/ml glucose, 5% FCS, 5% calf serum, 100 U/ml penicillin, and 0.1 mg/ml streptomycin, at 37 C in an atmosphere of 5% CO2. GH3 cells were maintained in DMEM with 10% FCS, 100 U/ml penicillin, and 0.1 mg/ml streptomycin. Media and antibiotics were from Gibco BRL (Grand Island, NY), and serum was from HyClone Laboratories, Inc. (Logan, UT).

Isolation of RNA
Total RNA was isolated from tissues pooled from 5–6 mice using Trizol reagent (Gibco BRL, Grand Island, NY), following the manufacturer’s protocol. For the isolation of RNA from cultured cells, media was aspirated from tissue culture plates, the plates were rinsed quickly with cold PBS, and 5 ml Trizol was added directly to each plate. The cells were resuspended by scraping the plate with a sterile spatula, followed by repeated pipetting and then isolation of RNA, following the manufacturer’s protocol.

RT-PCR
RT-PCR was performed using 3 µg total RNA from male and female mouse pituitary glands and 1 µg total RNA from mouse testis. Total RNA was incubated in RT reaction buffer containing 5 mM MgCl2, 50 mM KCl, 10 mM Tris (pH 8.3), 0.5 mM deoxynucleotide triphosphates, 20 U RNasin (RNase inhibitor), and 2.5 µM oligo-dT for 30 min at 37 C in the presence of 3 U deoxyribonuclease (DNase) I (Boehringer Mannheim, Indianapolis, IN). After heat inactivation of the DNase I at 75 C for 5 min (20), 50 U MuLV reverse transcriptase (Perkin-Elmer Corp., Foster City, CA) was added, and the reaction mixture was incubated at 42 C for 15 min, then at 99 C for 5 min to inactivate the enzyme. Eighteen of the 20 microliter RT reaction was used for PCR amplification of the CRES complementary (cDNA) in the presence of 2 mM MgCl2, 10 mM Tris (pH 8.3), 50 mM KCl, 0.2 mM deoxynucleotide triphosphates, 0.5 µM forward and 0.5 µM reverse CRES-specific primers, 1.5 µCi [{alpha}-32P]deoxycytidine triphosphate, and 1.25 U Taq DNA polymerase (Sigma Chemical Co.). After an initial denaturation at 95 C, PCR was carried out at 94 C for 1 min; 65 C for 1 min for 36 cycles, and 72 C for 7 min using a minicycler (MJ Research, Inc., Watertown, MA). For a constitutive control, 1 µl of a 1:50 dilution of the same RT reaction was amplified by PCR under the same conditions described above using primers specific for mouse cystatin C. The RT-PCR products were analyzed by electrophoresis in a 1.5% agarose/1x Tris acetate EDTA gel, which was then dried under vacuum onto filter paper for 1 h at 50 C. The dried gel was exposed to film for 48–72 h at room temperature.

Oligonucleotide primer pairs
Oligonucleotide primers for PCR were designed from the known sequences for mouse CRES (15) and cystatin C (21) cDNAs. The primers used for CRES PCR amplification were 5'CAAGGAAAGTGAGGACAAATATGTC3' (forward) and 5'GTGACAGACTTGAACCACAGGTT3' (reverse), to yield a PCR product of 340 bp. The primers used for cystatin C PCR amplification were 5'CCCAAGCTTGGCATTTTTGCAGCTGAA3' (forward) and 5'CGCGGATCCGATGACGATGACAAAGCGACCCCAAAACAAGG3' (reverse), to yield a PCR product of 354 bp.

Northern blot analysis
Total RNA from mouse tissues and cultured cell lines was separated on a 1% agarose gel containing borate buffer (pH 8.2) and 0.66 M formaldehyde. The RNA samples were heated at 95 C for 2 min before loading. To verify equal loading of RNA in each gel lane, ethidium bromide was included in each RNA sample. The gels were washed extensively in water to remove formaldehyde before vacuum transfer (Oncor, Gaithersburg, MD) to nylon membrane (Nytran, Schleicher & Schuell; Keene, NH). Blots were prehybridized for 2 h at 42 C in hybridization buffer containing 50% formamide, 5x saline-sodium citrate (SSC), 0.2 mg/ml salmon sperm DNA, 0.4 mg/ml yeast RNA, 50 µg/ml BSA, 0.1% SDS, and 12.5 mM sodium phosphate buffer, pH 6.6, followed by hybridization overnight at 42 C in the presence of cDNA probe at a concentration of 3 x 105 cpm/ml hybridization buffer. cDNA probes for mouse CRES, rat LHß (a generous gift of P. Mellon), and mouse 18S RNA were prepared by random priming (Prime-It II, Stratagene, La Jolla, CA). After hybridization, the blots were washed in 2x SSC, 1% SDS at 42 C for 30–45 min with several changes, and then at 65 C, before exposure to film. After hybridization with the CRES cDNA, blots were stripped by washing twice in 0.1x SSC, 1% SDS at 50 C for 30 min, and then successively probed with the LHß cDNA and 18S cDNA as a loading control. The Northern blots were repeated several times, and representative blots are shown.

Sequence analysis
RT-PCR products were cycle sequenced by the Texas Tech University Biotechnology Core facility under the direction of Susan SanFrancisco, Ph.D.

Preparation of protein extracts
Mouse testes and epididymides were pooled from four C57Bl6/J or ICR mice and homogenized in lysis buffer containing 0.02 M Tris (pH 7.5), 0.05 M NaCl, 1.0 mM EDTA, 0.5% Triton-X 100, 0.5% deoxycholate, 0.5% SDS, and 0.01 mg/ml aprotinin. LßT2 cells were grown, as described above, to near confluency. The day before harvesting, the media was replaced with DMEM minus serum. The following day, the conditioned media was collected, concentrated to one fourth the original volume, using Centricon concentrators (Amicon, Beverly, MA), and an equal volume of 2x lysis buffer was added. LßT2 cells were scraped off the plates and homogenized by 80 strokes with a Dounce homogenizer on ice in the presence of 0.5 M sucrose, 50 mM Tris (pH 8), 25 mM KCl, 2 mM MgCl2, 1 mM CaCl2 (TMCK buffer). A crude secretory granule fraction was prepared, following the protocol of Conn et al. (22). Briefly, homogenates were centrifuged at 1,000 x g for 10 min at 4 C to pellet nuclei with associated organelles and any remaining intact cells. The supernatant was removed and centrifuged at 12,000 x g for 20 min at 4 C to pellet secretory granules/organelles (granular fraction). The nuclear pellet from the first low-speed spin was resuspended in 200 µl PBS containing 0.5% Tween-20 and was kept on ice for 20 min. The nuclear extract was then layered onto a 0.5 M sucrose cushion prepared in TMCK buffer and centrifuged at 1,000 x g for 10 min. The upper layer, containing organelles, was then combined with the granular fraction. Mouse whole pituitary gland protein samples were prepared using the Trizol reagent (Gibco BRL, Gaithersburg, MD), following the manufacturer’s protocol. Proteins present in the phenol/ethanol supernatant, remaining after the isolation of RNA and DNA, were precipitated by the addition of isopropanol, followed by centrifugation at 12,000 x g for 10 min. The protein pellet was washed three times in 0.3 M guanidine hydrochloride in 95% ethanol by incubating the pellet in the wash solution for 20 min each time, followed by a 5-min spin at 7,500 x g. The protein pellet was dried and resuspended in 2.5% SDS, followed by heating until dissolved. The protein solution was then diluted to 1% SDS with water. Protein concentrations for all samples were determined using the BCA protein assay (Pierce Chemical Co., Rockland, IL).

Western blot analysis
One hundred to 150 µg protein were separated by 17.5% SDS-PAGE, followed by transfer to nitrocellulose (Protran, Schleicher & Schuell, Inc.) for Western blot analysis. Blots were incubated in milk buffer containing 5% powdered milk, 0.2% Tween 20 in PBS (pH 7.4), for 1 h at room temperature, followed by an overnight incubation at 4 C with an affinity-purified CRES antibody (2 µg/ml) or preimmune serum (PI, 1:5000 dilution) in milk buffer containing 1% powdered milk, 0.2% Tween-20 in PBS, pH 7.4. The following day, the blots were washed in PBS-Tween, followed by incubation with a goat antirabbit horseradish peroxidase-conjugated secondary antibody (Biosource International, Camarillo, CA) at 1:40,000 dilution in milk buffer for 1 h at room temperature. The blots were then washed extensively in 1% milk buffer before exposure to Super Signal chemiluminescent substrate (Pierce Chemical Co.) for 5 min, followed by exposure to film. For some Western blots, 125I-labeled protein A (ICN Radiochemicals, Irvine, CA) was used in place of the goat antirabbit horseradish peroxidase-conjugated secondary antibody and the chemiluminescent substrate.

Carbohydrate analysis
To determine whether the CRES proteins possess N-linked carbohydrate residues, protein extracts were treated with two different N-glycosidases and examined by Western blot analysis. Specifically, 125 µg protein extract, prepared (as described above) from mouse testis, epididymis, and LßT2 gonadotrope cell culture media, was denatured by boiling for 10 min in the presence of 0.5% SDS and 1% ß-mercaptoethanol. The denatured proteins were incubated overnight at 37 C in the presence of 50 mM sodium phosphate buffer (pH 7.5) containing 1% NP-40 and 500 U N-glycosidase F (PNGase F, New England Biolabs, Inc., Beverly, MA) or in the presence of 50 mM sodium citrate (pH 5.5) and 500 U endoglycosidase H (New England Biolabs, Inc.). The following day, the samples were separated by SDS-PAGE, followed by Western blot analysis, as described above.

Immunofluorescence
Mouse pituitary glands were fixed in 4% paraformaldehyde in PBS, pH 7.4, for 1 h at 4 C and then washed successively for 30 min each at 4 C in PBS, 0.9% NaCl, 0.45% NaCl/50% ethanol, 70% ethanol, and stored in 70% ethanol at 4 C overnight. The tissues were then dehydrated by incubation in 95% ethanol for 30 min at 4 C, followed by 100% ethanol for 30 min, and then two incubations of 100% ethanol each for 1 h at 4 C. Tissues were washed in xylenes for 40 min and then 1 h at room temperature, followed by embedding in paraffin. Four micron paraffin sections were cut and mounted onto glass slides by the Texas Tech University Health Sciences Center Electron Microscopy Center. Tissue sections were deparaffinized by incubating at room temperature twice (for 10 min each) in xylenes, once (for 3 min) in 100% ethanol, and once (for 3 min) in 95% ethanol. The slides were allowed to dry, and sections were circled with a Pap pen to allow small incubation volumes. After a 20-min incubation in PBS, the tissue sections were covered with 100% normal goat serum and placed in a humidified chamber at 37 C to block for 90 min. A high percentage of goat serum was used for blocking, to minimize the background fluorescence observed in the pituitary glands. The blocked tissue sections were briefly washed with 5–10 drops of 5% normal goat serum in PBS and then incubated in a humidified chamber at 37 C for 2 h with both a rabbit antimouse CRES antiserum (1:400) and a guinea pig antirat LHß antiserum (1:3000), developed by A. F. Parlow and a gift from the National Hormone and Pituitary Program, NIDDK. For controls, pituitary gland tissue sections were incubated with the LHß antiserum (1:3000) and CRES PI (1:400) or the rabbit antimouse CRES antiserum, preincubated with recombinant CRES protein (block; 1:400). The specificity of the guinea pig antirat LHß antiserum has been demonstrated previously (23). After incubation of the tissue sections with the primary antibodies, sections were washed three times for 5 min each at room temperature in PBS and incubated, for 1 h at 37 C in a dark humidified chamber, with an fluorescein isothiocyanate (FITC)-conjugated goat antiguinea pig secondary antibody (1:50 in PBS) (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) and a Texas Red-conjugated goat antirabbit secondary antibody (1:50 in PBS) (Jackson ImmunoResearch Laboratories, Inc.). Sections were washed in PBS three times for 5 min each at room temperature in the dark and then once in PBS, pH 8.5. Slides were inverted onto coverslips containing 15–20 µl mounting medium [92 mM Tris (pH 8.5), 18.5% dimethylsulfoxide, 23% methanol, 0.092 mg/ml Mowiol 4–88 (Fisher Scientific, Pittsburgh PA)], to which p-phenyline diamine (1 mg/ml final; Sigma Chemical Co.) was added immediately before use, and sections were allowed to cure overnight in the dark. The sections were examined using an Olympus Corp. BX-60 microscope equipped for epifluorescence and were photographed using both a wide yellow filter for rhodamine (Texas Red) and a narrow band filter for FITC. The sections were also examined using an Olympus Corp. LSM-GB200 confocal microscope.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CRES gene expression in the pituitary gland
We have previously shown that, of the 26 mouse tissues examined, the CRES gene exhibits highly restricted expression in the testis and epididymis (15). A recent examination of additional tissues, by Northern blot analysis, suggested that the CRES gene was expressed also in the pituitary gland (data not shown). However, because of the low levels of the CRES messenger RNA (mRNA), which resulted in lengthy exposure times for the Northern blots, we used the more sensitive approach of RT-PCR to examine CRES gene expression in the mouse pituitary gland. Pituitary glands were pooled from 4–6 male and cycling female ICR strain mice, and RNA was isolated and used for RT-PCR. For comparison, whole testicular RNA was used as a positive control. As shown in Fig. 1Go, CRES mRNA was expressed in the testis as well as in all RNA preparations from the pituitary glands of both male and female mice. Control experiments, including RT-PCR of water (to test for the presence of cDNA in the reaction components) and PCR only, of each RNA sample (to test for DNA contamination), did not result in a PCR product, indicating that the CRES signal observed by RT-PCR was attributable to the presence of CRES mRNA in the pituitary gland RNA preparations. Furthermore, cycle sequencing confirmed that the 340-bp PCR product was indeed CRES cDNA. The same reverse transcriptase reactions were also used for PCR amplification of the mouse cystatin C cDNA. We have previously determined, by Northern blot analysis, that cystatin C expression does not vary between RNA samples prepared from different pooled mouse pituitary glands (data not shown), and therefore, it served as a constitutive control for the RT-PCR reactions. The differences observed in the cystatin C levels thus reflect slight differences in the amount of RNA used in the RT-PCR reactions.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. Expression of the CRES gene in the male and female mouse pituitary gland. RT-PCR (+) was performed using approximately 1 µg total RNA from the mouse testis (TE) and 3 µg total RNA from pooled pituitary glands from male and cycling female mice. The pooled pituitaries from five to six mice were used for each RNA preparation, and five separate RNA preparations were examined for male mice, and three separate RNA preparations were examined for female mice. After RT, using oligo-dT to prime cDNA synthesis, the same RT reaction was used for the PCR amplification of CRES and cystatin C (cyst C) cDNA, which served as an internal control. PCR was carried out in the presence of 1.5 µCi [{alpha}-32P]deoxycytidine triphosphate, and RT-PCR reactions were analyzed by agarose gel electrophoresis, followed by exposure of the dried gel to film. Control experiments included RT-PCR of water (+) and PCR only (-) of each RNA sample to test for the presence of contaminating cDNA in the reagents and RNA preparations.

 
The anterior pituitary gland is composed of multiple cell populations, including gonadotropes that express LH and FSH, somatotropes that express GH, and lactotropes that express PRL. Available pituitary cell lines were therefore examined to determine the cell type(s) that express the CRES gene. Total RNA, isolated from the mouse gonadotrope {alpha}T3–1 and LßT2 cell lines and from the rat somatotrope/lactotrope GH3 cell line, was examined for CRES gene expression in Northern blot analysis. Total RNA, isolated from the mouse testis and epididymis, was included in the Northern blot analysis as positive controls. As shown in Fig. 2Go, in addition to the expected expression of the CRES mRNA in the mouse testis and epididymis, the 700 bp CRES mRNA was also expressed in the LßT2 gonadotrope cells but not in the {alpha}T3–1 gonadotrope cells or in the GH3 cells. The absence of CRES mRNA in the rat somatotrope/lactotrope GH3 cells was not caused by the inability of the mouse cDNA to recognize the rat CRES mRNA, because we have previously determined (by Northern blot analysis) that the mouse cDNA was able to recognize the rat CRES mRNA in the epididymis (data not shown). When the Northern blots were stripped and reprobed with an LHß cDNA, the LHß mRNA was only detected in the LßT2 cells that represent a differentiated gonadotrope cell line and not in the {alpha}T3-1 cells that represent a less differentiated gonadotrope cell line. The somatotrope/lactotrope GH3 cell line also did not express LHß mRNA.



View larger version (81K):
[in this window]
[in a new window]
 
Figure 2. Cell-type specific expression of the CRES mRNA in the pituitary gland. Northern blot analysis of 10 µg total RNA isolated from the mouse TE, epididymis (EPI), {alpha}T3–1 and LßT2 gonadotrope cell lines, and the GH3 somatotrope/lactotrope cell line, probed with the mouse CRES cDNA insert. The CRES cDNA insert recognized the 0.7-kb CRES mRNA in the testis, epididymis, and LßT2 gonadotrope cell line. The blot was then stripped and reprobed with an LHß cDNA, followed by 18S cDNA, to confirm equal loading of RNA in each lane. A representative Northern blot is shown.

 
CRES protein expression in the pituitary gland
Because RT-PCR and Northern blot analysis showed the presence of CRES mRNA in the mouse pituitary gland gonadotropes, studies were next undertaken to examine CRES protein. The gonadotrope LßT2 cells were grown to near confluency, and secretory granules and conditioned media from the cultured cells and whole mouse pituitary glands were examined for CRES protein using an affinity-purified rabbit antimouse CRES antibody in Western blot analysis. We previously have identified two CRES proteins, of 19 and 14 kDa, in the mouse testis and epididymis (16); therefore, epididymal extracts were also examined by Western blot analysis as a positive control. As shown in Fig. 3AGo, although low levels of CRES proteins were detected in the LßT2 secretory granules, higher levels of CRES proteins were detected in the conditioned media. Interestingly, in addition to the 19- and 14-kDa CRES proteins present in the LßT2 secretory granules, two proteins of 17 and 12 kDa were also observed in the conditioned media, with the 12-kDa CRES protein being the predominant form. In contrast, in the epididymis, the 19- and 14-kDa proteins were the predominant forms, with lower levels of the 17- and 12-kDa proteins present. The CRES protein profile in the whole mouse pituitary gland appeared similar to that observed in the secretory granules isolated from the LßT2 cultured cells, although little-to-no 14-kDa CRES protein was detected. The 22- and 29-kDa proteins present in the epididymis, cultured cells, and whole pituitary lysates may represent proteins with cross-reacting epitopes or CRES protein complexes resistant to the reducing conditions used. Western blot analysis, carried out with PI, did not show the presence of the CRES proteins in the tissue and cell lysates or media, confirming the specificity of the antibody for CRES protein (Fig. 3BGo).



View larger version (71K):
[in this window]
[in a new window]
 
Figure 3. CRES protein expression in the gonadotrope cells. Western blot analysis of 100 µg epididymal lysate EPI, LßT2 secretory granules (SG) and conditioned media (M), and whole male mouse pituitary gland lysate (PIT) were separated by 17.5% SDS-PAGE, followed by transfer to nitrocellulose and incubation with (A) an affinity purified mouse CRES antibody (2 µg/ml) or (B) PI (1:5000). The blots were then incubated with a goat antirabbit horseradish peroxidase-conjugated secondary antibody, followed by Pierce Chemical Co. Super Signal substrate and exposure to film. Arrows indicate the 19-, 17-, 14-, and 12-kDa CRES proteins. A representative Western blot is shown.

 
The predicted amino acid sequence of the mouse CRES protein possesses two putative N-linked glycosylation sites (Asn-X-Ser/Thr). Also, Western blots revealed the presence of two predominant CRES proteins: 19- and-14 kDa in the epididymis, whole mouse pituitary glands, and LßT2-cultured cells; and 17- and 12-kDa in the LßT2-conditioned media. Therefore, studies were next carried out to determine whether the higher-molecular-mass CRES proteins were the result of N-linked glycosylation. Mouse testicular and epididymal tissue lysates and the LßT2 gonadotrope cell conditioned media were incubated in the presence or absence of N-glycosidase F, which hydrolyzes most types of N-glycan chains from glycoproteins, and then examined by Western blot analysis. As shown in Fig. 4Go, incubation of the tissue lysates and conditioned media in the presence of the N-glycosidase F resulted in a shift of the higher-molecular-mass CRES proteins (19 and 17 kDa) to the lower-molecular-mass CRES proteins (14 and 12 kDa), indicating that the higher-molecular-mass CRES proteins were the result of N-linked glycosylation. The lower-molecular-mass CRES proteins (14 and 12 kDa) seemed to be resistant to the N-glycanase treatment, given that no smaller CRES proteins were detected. Similarly, tissue lysates and conditioned media incubated with endoglycosidase H, which cleaves only high mannose residues and some hybrid oligosaccharides from N-linked glycoproteins, also caused the higher-molecular-mass CRES proteins to shift to the lower-molecular-mass CRES proteins (data not shown). Taken together, the deglycosylation studies suggest that the 5-kDa difference in molecular mass between the two forms of the CRES proteins is caused by the presence of high mannose residues.



View larger version (82K):
[in this window]
[in a new window]
 
Figure 4. Carbohydrate analysis of the CRES protein in the testis, epididymis, and LßT2 gonadotrope cells. Western blot analysis of 125 µg of testis TE, epididymal tissue lysate EPI, and LßT2 cell conditioned media incubated overnight in the presence (+) or absence (-) of N-glycosidase F. The samples were then separated by 17.5% SDS-PAGE, followed by transfer to nitrocellulose and incubation with an affinity-purified mouse CRES antibody (2 µg/ml). The blots were then incubated with 125I protein A, followed by exposure to film.

 
Colocalization of CRES and LHß proteins in the anterior pituitary gonadotropes
To confirm that CRES protein was expressed by the anterior pituitary gonadotropes in vivo, double-label immunofluorescence analysis was performed. Male and female mouse pituitary gland tissue sections were simultaneously incubated with a rabbit antimouse CRES antiserum and a guinea pig antirat LHß antiserum, followed by incubation with a Texas Red-conjugated goat antirabbit antiserum and an FITC-conjugated goat antiguinea pig antiserum, respectively. The tissue sections were viewed using a fluorescent microscope and the appropriate filters to detect the Texas Red (red) or FITC (green) fluorescence. As shown in Fig. 5Go, FITC fluorescence demonstrated that, in both male and female mice, LHß protein was present in a distinct population of cells scattered throughout the pituitary gland sections, indicating that these cells are gonadotropes. Examination of the Texas Red fluorescence in the same tissue sections showed CRES protein to be localized to the same population of cells expressing LHß protein. This was confirmed by a double-exposure photograph, with the FITC and Texas Red filters, to detect both the LHß and CRES proteins, respectively (green + red = yellow). No detectable LHß or CRES protein was present in the posterior region of the pituitary gland [Fig. 5Go, (p)]. To control for the specificity of the CRES antiserum, male and female pituitary gland tissue sections were simultaneously incubated with the LHß antiserum and the CRES PI, followed by incubation with the secondary antibodies. As shown in Fig. 5Go, as expected, the cells were FITC positive for LHß protein but showed no specific Texas Red staining for CRES protein with the PI. Because of the lack of a specific staining for CRES protein when the PI is used, the double-exposure photograph, with the FITC and Texas Red filters, therefore detected only the LHß protein (green). In addition to the PI, controls for nonspecific fluorescence included the incubation of tissue sections with CRES antiserum preincubated with CRES protein (block), with secondary antibodies alone, and with both combinations of mismatched primary and secondary antibodies (CRES anti-serum + FITC antiguinea pig secondary antibody, LHß antiserum + Texas Red antirabbit secondary antibody). These experiments resulted in no specific fluorescence signal in the pituitary gland tissue sections (data not shown).



View larger version (105K):
[in this window]
[in a new window]
 
Figure 5. Colocalization of CRES and LHß proteins in anterior pituitary gland gonadotropes. Male and female pituitary gland tissue sections were incubated simultaneously with a rabbit antimouse CRES antiserum ({alpha}-CRES) and guinea pig antirat LHß antiserum ({alpha}-LHß) in double-label immunofluorescence analysis. After washing in PBS, the tissue sections were incubated in the dark with an FITC-conjugated goat antiguinea pig secondary antibody and a Texas Red-conjugated goat antirabbit secondary antibody. Sections were examined using an Olympus Corp. BX-60 microscope equipped for epifluorescence and were photographed at 40x magnification using filters to detect the Texas Red (red, CRES) fluorescence or FITC (green, LHß) fluorescence. A double-exposure photograph of the tissue section, using both the Texas Red and FITC filters, showed that the cells that express CRES protein also express LHß protein (red + green = yellow). The same tissue section was also photographed, using a phase objective to show that only a select population of cells in the pituitary gland express CRES and LHß proteins. To control for the specificity of the CRES antibody, pituitary gland tissue sections were simultaneously incubated with the CRES PI and the LHß antiserum, followed by incubation with the Texas Red and FITC-conjugated secondary antibodies. As shown in the middle two panels, incubation of the tissue section with the CRES PI resulted in only a background red fluorescence with no specific staining of the cells, when examined with the Texas Red filter; whereas, as expected, the same cells examined with the FITC filter were positive for LHß protein. A total of nine different male and female pituitary glands were examined by double-labeling immunofluorescence, and representative tissue sections are shown. p, Posterior pituitary gland.

 
In addition to the representative experiment shown in Fig. 5Go, nine other male and female mouse pituitary glands were examined by double-label immunofluorescence. In these studies, the CRES protein consistently colocalized with LHß protein to the anterior pituitary gonadotropes. A comparison between the individual male pituitary glands showed that, in all males, the gonadotropes appeared fairly homogeneous in size and in the intensity of the LHß and CRES immunofluorescence (Figs. 5Go, 6Go). In contrast, a comparison between individual female pituitary glands showed heterogeneity in the relative size of the gonadotropes and in the intensity of the LHß and CRES immunofluorescence. For example, the gonadotrope cells in the female pituitary gland, shown in Fig. 5Go, appeared similar in size and LHß and CRES immunofluorescence, as in the male gonadotropes. However, in other female pituitary glands, the gonadotropes were more heterogeneous; some gonadotropes appeared smaller, with less intense LHß and CRES immunofluorescence (Fig. 6Go).



View larger version (96K):
[in this window]
[in a new window]
 
Figure 6. CRES and LHß proteins in male and female anterior pituitary glands. Double-label immunofluorescence analysis of male and female pituitary glands was performed as described in Fig. 5Go. The LHß and CRES immunofluorescent staining are shown for one male and three different female pituitary glands. The male pituitary gland shown is from a different male mouse than that shown in Fig. 5Go.

 
Further examination of the double-labeled immunofluorescent pituitary gland sections revealed that, within a gonadotrope cell, the fluorescence intensities for the LHß and CRES proteins varied in a correspondent manner, suggesting that the LHß and CRES proteins colocalize intracellularly. Indeed, under higher magnification, a punctate fluorescent pattern was observed for both LHß and CRES proteins in the gonadotrope cells, suggesting localization within the secretory granules (Fig. 7AGo). In support of these observations, confocal microscopy, which examined the fluorescent intensities for both LHß and CRES proteins in a single plane of a gonadotrope cell, showed similar patterns in fluorescent intensities for the two proteins (Fig. 7BGo). These observations suggest that CRES protein colocalizes intracellularly with LHß protein in the gonadotropes.



View larger version (66K):
[in this window]
[in a new window]
 
Figure 7. Intracellular colocalization of CRES and LHß proteins in the anterior pituitary gonadotrope cells. Male anterior pituitary gland tissue sections were double-labeled with CRES and LHß antibodies, followed by Texas Red- and FITC-conjugated secondary antibodies, as described. A, Immunofluorescent pituitary gland tissue section, photographed at 120x magnification, using an Olympus Corp. BX-60 microscope and filters to detect the Texas Red (CRES) fluorescence and FITC (LHß) fluorescence; B, immunofluorescent pituitary gland tissue section examined using an Olympus Corp. LSM-GB200 confocal microscope. The fluorescence intensities for both LHß and CRES proteins were determined in a single plane of a cell, as indicated by the line drawn though the gonadotrope. The immunofluorescence intensity for each protein, plotted against the distance of the line, is shown. The LHß and CRES immunofluorescence patterns seem identical, suggesting that, throughout the cell, LHß and CRES proteins colocalize. A representative fluorescent image and scan are shown.

 
Hormonal regulation of CRES protein in the anterior pituitary gonadotropes
Gonadectomy and hormone replacement studies were carried out in male and female mice to determine whether CRES protein levels in the gonadotropes were affected by steroid hormones. LHß protein levels were also examined for comparison. Double-label immunofluorescence was carried out using anterior pituitary gland tissue sections from intact, 1-week castrate, and 1-week castrate, followed by 1-week testosterone-replacement (T-Repl.) male mice. Similar experiments were performed on anterior pituitary gland tissue sections from intact, 1-week ovariectomized, and 1-week ovariectomized followed by 1-week estradiol-replacement (E2-Repl.) female mice. As shown in Table 1Go, organ weights of the androgen-dependent seminal vesicles and the estrogen-dependent uterine horns reflected the hormonal status of the animal. After gonadectomy, there was a corresponding decrease in the wet weight of the seminal vesicles and uterine horns and a subsequent increase in tissue weights after hormone replacement. Similarly, RIAs showed that circulating levels of testosterone and estradiol in the male and female mice, respectively, showed a dramatic decrease after gonadectomy, with a corresponding increase after the administration of hormone (Fig. 8Go legend).


View this table:
[in this window]
[in a new window]
 
Table 1. Seminal vesicle and uterine horn organ wet weights from intact and hormone manipulated male and female mice

 


View larger version (117K):
[in this window]
[in a new window]
 
Figure 8. Double-label immunofluorescence analysis of CRES and LHß proteins in the anterior pituitary gonadotrope cells from hormonally manipulated male and female mice. Pituitary gland tissue sections from intact, 1-week castrate (castrate), and 1-week castrate followed by 1-week T-Repl. male mice and from intact, 1-week ovariectomized (Ovx.) and 1-week ovariectomized followed by 1-week of estradiol replacement (E2-Repl.) female mice, were simultaneously incubated with the CRES ({alpha}-CRES) and LHß ({alpha}-LHß) antiserum followed by incubation with FITC and Texas Red-conjugated secondary antibodies. Sections were examined, using an Olympus Corp. microscope equipped for epifluorescence, and photographed at 40x magnification using filters to detect the Texas Red (red, CRES) and FITC (green, LHß) fluorescence. Representative tissue sections are shown from the male intact (n = 3), castrate (n = 4), T-Repl. (n = 4), female intact (n = 3), ovariectomized (n = 4), and E2-Repl. (n = 4) pituitary glands observed. The testosterone levels (ng/ml), as determined by RIA analysis of the serum from individual male mice were (mean ± SE): intact, 7.8 ± 3.2 (n = 3); castrate, 0.65 ± 0.19 (n = 4); T-Repl., 4.9 ± 0.48 (n = 4). The estradiol levels (pg/ml), as determined by RIA analysis of the serum from individual female mice were (mean ± SE): intact, 23 ± 8.3 (n = 3); ovariectomized, 8.3 ± 2.5 (n = 3); and E2-Repl., 24 ± 4.2 (n = 2). Insufficient serum for RIA analysis was obtained from the other ovariectomized and E2-Repl., female mice.

 
Double-label immunofluorescence demonstrated that the levels of CRES protein in the gonadotropes were affected by alterations in the hormonal state of the animal. In the male mouse, castration led to a decrease in the levels of both the LHß and CRES proteins in the gonadotropes, with the majority of the cells possessing barely detectable levels of the two proteins (Fig. 8Go). After the administration of testosterone, for 1 week, to castrate male mice (T-Repl.), the levels of LHß and CRES proteins in the gonadotropes recovered and seemed equivalent, if not slightly greater, than the levels of LHß and CRES proteins in the gonadotropes of intact mice (Fig. 8Go). Comparable changes in LHß and CRES proteins were observed in other intact (n = 3), castrate (n = 4), and T-Repl. (n = 4) male pituitary glands (data not shown). Female mice, however, seemed to respond differently to gonadectomy than did male mice. After ovariectomy, the gonadotropes appeared larger and richer in LHß and CRES proteins than their intact counterpart cells. The administration of estradiol did not seem to dramatically alter the levels of LHß and CRES proteins in the gonadotropes, compared with that observed in ovariectomized mice. However, a decrease in the number of positive cells was observed. Comparable changes in LHß and CRES proteins were observed in other intact (n = 3), ovariectomized (n = 4), and E2-Repl. (n = 4) female mice.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The studies presented herein demonstrate that the CRES gene and protein are expressed in male and female anterior pituitary gonadotropes. Using RT-PCR, CRES mRNA was detected in RNA preparations prepared from pooled male and female mouse pituitary glands. Further analysis of CRES gene expression by Northern blot analysis, using anterior pituitary gland cell lines, demonstrated that the CRES gene was expressed by the gonadotrope cells but not by the somatotrope/lactotrope cells. Moreover, the CRES gene was specifically expressed by the LßT2 gonadotrope cell line, but not the {alpha}T3–1 gonadotrope cell line, suggesting that the expression of the CRES gene is associated with a differentiated phenotype. Indeed, though the {alpha}T3–1 and LßT2 cell lines are responsive to GnRH and express the GnRH receptor and thus are characterized as being of the gonadotrope cell lineage (24, 25), they are distinct from each other. The {alpha}T3–1 cell line represents an undifferentiated gonadotrope cell and expresses the {alpha}-subunit gene common to several peptide hormones, including LH, FSH, TSH, and human CG; whereas the LßT2 cell line represents a differentiated go-nadotrope cell and expresses both the {alpha}-subunit gene and the LHß-subunit gene that determines hormone specificity (24, 25). The expression of the CRES gene exclusively in the LßT2 cells implies that CRES function is associated with functionally mature gonadotrope cells.

Further analysis of the LßT2 cells, by Western blot analysis, demonstrated that CRES protein was synthesized and secreted by the gonadotrope cells in culture. Interestingly, although the 19- and 14-kDa CRES proteins, present in the epididymal tissue lysate and LßT2 secretory granules, were also present in the conditioned media, the predominant CRES proteins present in the conditioned media were 17 and 12 kDa. Because CRES protein levels were low in the LßT2 secretory granules, it is difficult to determine whether the 17- and 12-kDa CRES proteins present in the media were also present intracellularly. The higher levels of CRES protein present in the conditioned media were most likely caused by the fact that the conditioned medium consisted of proteins secreted over a 18- to 24-h period (and therefore, was an accumulation of CRES protein), whereas the secretory granule fraction represented total CRES protein present in the LßT2 cells at a single point in time. Because the CRES protein profile in the whole pituitary lysate was similar to the LßT2 secretory granule fraction, and smaller CRES proteins were also detected in the epididymal lysates, the 17- and 12-kDa CRES proteins seem to occur in tissues as well as in the cell line.

Deglycosylation studies, in which tissue lysates and the LßT2-conditioned media were pretreated with N-glycosidase F or endoglycosidase H, revealed that the higher-molecular-mass CRES proteins (19 and 17 kDa) were the result of N-linked glycosylation, caused by the presence of high mannose residues. The lower-molecular-mass CRES proteins (14 and 12 kDa) lack N-linked glycosylation, because these proteins seemed resistant to the N-glycanase treatment. The presence of N-linked sugars in the CRES proteins was not surprising, considering that the CRES-derived amino acid sequence possesses two putative N-linked glycosylation consensus sites (Asn-X-Ser/Thr) (15). Furthermore, the N-linked glycosylation of the CRES protein is similar to the mouse and rat cystatin C proteins, which have been shown to be present in glycosylated (20 kDa) and nonglycosylated forms (14 kDa) (26, 27, 28).

Though it seems that N-linked glycosylation of the 14- and 12-kDa CRES proteins resulted in the formation of the 19- and 17-kDa CRES forms, there are several possible reasons for the presence of the smaller 12-kDa CRES protein in addition to the 14-kDa CRES protein. We recently have determined that, in all tissues that express the CRES gene, there is an alternatively spliced CRES mRNA that lacks the initiator methione but that contains a downstream methionine in fairly good context for translational initiation (29). Translational initiation at the second methionine predicts a CRES protein of approximately 12 kDa. Furthermore, preliminary in vitro transcription and translation studies suggest that translation can initiate at the second methionine in the CRES mRNA (Sutton and Cornwall, unpublished observations). A second possibility for the presence of the 12-kDa CRES protein is that the 14-kDa CRES protein is proteolytically processed. Indeed, lower-molecular-mass forms of cystatin C protein have been identified in vivo and have been determined to be the result of specific N-terminal proteolysis (30). Finally, the presence of both 12- and 14-kDa CRES proteins may reflect O-linked glycosylation differences between the two proteins. However, preliminary studies using O-glycanase to remove O-linked carbohydrate residues did not result in changes in the molecular mass of the CRES proteins (data not shown). Studies are currently ongoing to examine further the use of different CRES mRNAs and/or N-terminal proteolysis as a means of regulating CRES protein function.

Double-label immunofluorescence studies of mouse male and female pituitary glands showed that CRES protein colocalized with LHß protein to the gonadotrope cells, thereby confirming the in vitro studies with the LßT2 gonadotrope cell line. Examination of the immunostained pituitary gland sections at a higher magnification showed a similar punctate pattern of localization for the CRES and LHß proteins within the gonadotropes, implying that the two proteins also colocalize intracellularly. These observations were confirmed by confocal microscopy, which showed identical LHß and CRES immunofluorescence patterns through a single plane of a gonadotrope cell. Finally, Western blot analysis of the secretory granule fraction of the LßT2 cells showed the presence of CRES proteins. These observations, taken together with the fact that CRES protein is secreted in vitro, suggest that CRES protein is localized in the gonadotrope secretory granules.

An examination of intact male anterior pituitary glands for CRES and LHß proteins, by double-label immunofluorescence, showed little difference between individual mice in the expression of the two proteins in the gonadotropes. In contrast, qualitative differences were observed between individual female anterior pituitary glands with regard to the relative levels of CRES and LHß proteins and the size of the gonadotrope cells. Though some female anterior pituitary glands exhibited gonadotrope cells that were similar to that in the male, with regard to their size and intensity of the CRES and LHß immunofluorescence, the majority of the females showed a more heterogeneous population of go-nadotropes, with some cells being smaller and exhibiting less intense CRES and LHß immunofluorescence. It is likely that the differences observed in the size of the gonadotropes and the relative amounts of LHß protein reflect mice in different stages of the estrus cycle. It was intriguing that, in the female mice examined, the levels of CRES protein fluctuated in the same direction as those of LHß protein. These observations not only suggest that CRES protein in the gonadotropes may be hormonally regulated but that CRES protein regulation may share some features in common with LHß regulation. Hormonal studies in which gonadectomies were performed in the male and female mice, followed by the administration of testosterone to males and estradiol to females, suggested that CRES protein in the gonadotropes may be regulated, in part, by steroid hormones. Because indirect immunofluorescence was used to examine CRES protein in the anterior pituitary gonadotropes, it is difficult to quantitate the levels of CRES protein before and after hormonal manipulations; and therefore, only qualitative conclusions can be made. However, these studies provide the basis for future experiments to examine, in greater detail, the influence of steroid hormones as well as GnRH on CRES protein in the anterior pituitary gland. Studies are also currently ongoing to develop a CRES enzyme-linked immunosorbent assay for quantitative analyses of CRES protein.

It is of interest to note that our observations of pituitary LHß levels (by immunofluorescence) in male and female mice, after gonadectomy and hormone replacement, were similar to that previously observed (by RIA) in mice (31, 32, 33) but quite different from that reported in rats (34). For example, after orchiectomy, although serum LH is elevated, pituitary LH is persistently reduced in male mice and does not become elevated as occurs in chronically castrate rats (34). This response in male mice has been proposed to be caused by a rate of LH secretion that exceeds the rate of synthesis, leading to a depletion of the pituitary LH content in castrate male mice (35). Interestingly, we observed the exact opposite response in female mice after gonadectomy, in that LHß immunofluorescence seemed elevated. Although other studies have shown by RIA that, within the first 24 h after ovariectomy, there is an immediate decline in pituitary LH content in female mice, there is a subsequent progressive increase, resulting in elevated pituitary LH levels and in serum LH within 7 days (32). In this regard, the pituitary response of ovariectomized mice is similar to that of ovariectomized rats (34). Female mice may respond differently from male mice, in that they typically release large amounts of LH during the preovulatory surge and thus may be more capable of replenishing LH protein in the gonadotropes (35). Our lack of a noticeable effect of estradiol on pituitary LHß levels in ovariectomized female mice was unexpected. However, persistently elevated pituitary LH levels have been observed previously in ovariectomized female mice administered similar doses of estradiol (32), suggesting that higher doses of estradiol are required to elicit a response in mice. Although we had insufficient sample for determining serum LH, the similar response of pituitary LHß immunofluorescence (in our studies) to that previously reported by RIA for male and female mice supports the conclusions (from other studies) that mice are distinct from rats in their pituitary response to hormone withdrawal and replacement.

The colocalization of the CRES protein with LHß protein in the gonadotropes raises intriguing possibilities as to its function in the anterior pituitary gland. Because one proposed role of the cystatin proteins is the regulation of prohormone processing, one possibility is that CRES protein may regulate these processing events in the gonadotrope cells. Alternatively, CRES protein function may be extracellular and, after secretion, CRES may have local effects within the pituitary or more distant endocrine effects.


    Acknowledgments
 
The authors would like to gratefully acknowledge Dr. Sandra Whelly for her assistance with the RT-PCR studies.


    Footnotes
 
1 This research was supported by NIH Grant HD-33903 (to G.A.C.), funds from the Medical Scientist Training Program (to H.G.S.), and a grant from The Howard Hughes Medical Institute through the Undergraduate Biological Sciences Education program (to A.F.). Back

Received October 10, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Turk V, Bode W 1991 The cystatins: protein inhibitors of cysteine proteases. FEBS Lett 285:213–219[CrossRef][Medline]
  2. Huh C, Nagle JW, Kozak CA, Abrahamson M, Karlsson S 1995 Structural organization, expression, and chromosomal mapping of the mouse cystatin-C-encoding gene (Cst 3). Gene 152:221–226[CrossRef][Medline]
  3. Grubb A, Lofberg H, Barrett AJ 1986 The disulphide bridges of human cystatin C ({gamma}-trace) and chicken cystatin. FEBS Lett 170:370–374
  4. Jerala R, Trstenjak-Prebanda M, Kroon-Zitko L, Lenarcic B, Turk V 1990 Mutations in the QVVAG region of the cysteine protease inhibitor stefin B. Biol Chem Hoppe Seyler [Suppl] 371:157–160
  5. Nycander M, Bjork I 1990 Evidence by chemical modification that tryptophan-104 of the cysteine-proteinase inhibitor chicken cystatin is located in or near the proteinase-binding site. Biochem J 271:281–284[Medline]
  6. Barrett AJ, Rawlings ND, Davies ME, Machleidt W, Salvensen G, Turk V 1986 In: Barrett AJ, Salvensen G (eds) Proteinase Inhibitors. Elsevier Amsterdam, pp 515–569
  7. Calkins CC, Sloane BF 1995 Mammalian cysteine protease inhibitors: biochemical properties and possible roles in tumor progression. Biol Chem Hoppe Seyler 376:71–80[Medline]
  8. Leung-Tack J, Tavera C, Gensac MC, Martinez J, Colle A 1990 Modulation of phagocytosis-associated respiratory burst by human cystatin C: role of the N-terminal tetrapeptide Lys-Pro-Pro-Arg. Exp Cell Res 188:16–22[CrossRef][Medline]
  9. Orlowski M 1983 Pituitary endopeptidases. Mol Cell Biochem 52:49–74[Medline]
  10. Pennacchio LA, Lehesjoki A-E, Stone, NE, Willour VL, Virtaneva K, Miao J, D’Amato E, Ramirez L, Faham M, Koskiniemi M, Warrington JA, Norio R, de la Chapelle A, Cox DR, Myers RM 1996 Mutations in the gene encoding cystatin B in progressive myoclonus epilepsy (EPM1). Science 271:1731–1734[Abstract]
  11. Ghiso J, Jensson O, Frangione B 1986 Amyloid fibrils in hereditary cerebral hemorrhage with amyloidosis of Icelandic type is a variant of gamma-trace basic protein (cystatin C). Proc Natl Acad Sci USA 83:2974–2978[Abstract/Free Full Text]
  12. Freije JP, Abrahamson M, Olafsson I, Velasco G, Grubb A, Lopez-Otin C 1991 Structure and expression of the gene encoding cystatin D, a novel human cysteine protease inhibitor. J Biol Chem 30:20538–20543
  13. Kellermann J, Haupt H, Auerswald E-A, Muller-Esterl W1989 The arrangement of disulfide loops in human alpha 2-HS glycoprotein. Similarity to the disulfide bridge structures of cystatins and kininogens. J Biol Chem 264:14121–14128
  14. Winderickx J, Hemschoote K, De Clercq N, Van Dijck P, Peeters B, Rombauts W, Verhoven G, Heyns W 1990 Tissue-specific expression and androgen regulation of different genes encoding rat prostatic 22-kilodalton glycoprotein homologous to human and rat cystatin. Mol Endocrinol 4:657–667[Abstract/Free Full Text]
  15. Cornwall GA, Orgebin-Crist M-C, Hann SR 1992 The CRES gene: a unique testis-regulated gene related to the cystatin family is highly restricted in its expression to the proximal region of the mouse epididymis. Mol Endocrinol 6:1653–1664[Abstract/Free Full Text]
  16. Cornwall GA, Hann SR 1995 Transient appearance of CRES protein during spermatogenesis and caput epididymal sperm maturation. Mol Reprod Dev 41:37–46[CrossRef][Medline]
  17. Cornwall GA, Hsia N, Sutton HGStructure, alternative splicing and chromosomal localization of the cystatin-related epididymal spermatogenic gene. Biochem J, in press
  18. Fallest PC, Trader GL, Darrow JM, Shupnik MA 1995 Regulation of rat luteinizing hormone ß gene expression in transgenic mice by steroids and a gonadotropin-releasing hormone antagonist. Biol Reprod 53:103–109[Abstract]
  19. Resko JA, Malley A, Begley D, Hess DL 1973 Radioimmunoassay of testosterone during fetal development of the rhesus monkey. Endocrinology 93:156–161[Abstract/Free Full Text]
  20. Goodman RL 1978 A quantitative analysis of the physiological role of estradiol and progesterone in the control of tonic and surge secretion of luteinizing hormone in the rat. Endocrinology 102:142–150[Abstract/Free Full Text]
  21. Huang Z, Fasco MJ, Kaminsky LS 1996 Optimization of DNase I removal of contaminating DNA from RNA for use in quantitative RNA-PCR. Biotechniques 20:1012–1020[Medline]
  22. Solem M, Rawson C, Lindburg K, Barnes D 1990 Transforming growth factor beta regulates cystatin c in serum-free mouse embryo (SFME) cells. Biochem Biophys Res Commun 172:945–951[CrossRef][Medline]
  23. Conn PM, Janovick JA, Braden TD, Maurer RA, Jennes L 1992 SIIp: a unique secretogranin/chromogranin of the pituitary released in response to gonadotropin-releasing hormone. Endocrinology 130:3033–3040[Abstract/Free Full Text]
  24. Deschepper CF, Seidler CB, Steele MK, Ganong WF 1985 Further studies on the localization of angiotensin-II-like immunoreactivity in the anterior pituitary gland of the male rat, comparing various antisera to pituitary hormones and their specificity. Neuroendocrinology 40:471–475[Medline]
  25. Windle JJ, Weiner RI, Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Mol Endocrinol 4:597–603[Abstract/Free Full Text]
  26. Turgeon JL, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Mol Endocrinol 10:439–450[Abstract/Free Full Text]
  27. Esnard A, Esnard F, Faucher D, Gauthier F 1988 Two rat homologues of human cystatin C. FEBS Lett 236:475–478[CrossRef][Medline]
  28. Esnard A, Esnard F, Guillou F, Gauthier F 1992 Production of the cysteine proteinase inhibitor cystatin C by rat Sertoli cells. FEBS Lett 300:131–135[CrossRef][Medline]
  29. Tsurta JK, O’Brien DA, Griswold MD 1993 Sertoli cell and germ cell cystatin C: stage-dependent expression of two distinct messenger ribonucleic acid transcripts in rat testes. Biol Reprod 49:1045–1054[Abstract]
  30. Kozak M 1989 The scanning model for translation: an update. J Biol Chem 108:229–241
  31. Abrahamson M, Mason RW, Hansson H, Buttle DJ, Grubb A, Ohlsson K 1991 Human cystatin C: role of the N-terminal segment in the inhibition of human cysteine proteinases and in its inactivation by leukocyte elastase. Biochem J 273:621–626
  32. Naik SI, Young LS, Charlton HM, Clayton RN 1984 Pituitary gonadotropin-releasing hormone receptor regulation in mice I: males. Endocrinology 115:106–113[Abstract/Free Full Text]
  33. Naik SI, Young LS, Charlton HM, Clayton RN 1984 Pituitary gonadotropin-releasing hormone receptor regulation in mice II: females. Endocrinology 115:114–120[Abstract/Free Full Text]
  34. Saade G, London DR, Lalloz MRA, Clayton RN 1989 Regulation of LH subunit and prolactin mRNA by gonadal hormones in mice. J Mol Endocrinol 2:213–224[Abstract/Free Full Text]
  35. Clayton RN, Catt KJ 1981 Regulation of pituitary gonadotropin releasing hormone receptors by gonadal hormones. Endocrinology 108:887–895[Abstract/Free Full Text]
  36. McNeilly JR, Brown P, Mullins J, Clark AJ, McNeilly AS 1996 Characterization of the ovine LHß-subunit gene: the promoter is regulated by GnRH and gonadal steroids in transgenic mice. J Endocrinol 151:481–489[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J AndrolHome page
H. G. Sutton-Walsh, S. Whelly, and G. A. Cornwall
Differential Effects of GnRH and Androgens on Cres mRNA and Protein in Male Mouse Anterior Pituitary Gonadotropes
J Androl, November 1, 2006; 27(6): 802 - 815.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Li, C. A. Putnam-Lawson, H. Knapp-Hoch, P. J. Friel, D. Mitchell, R. Hively, and M. D. Griswold
Immunolocalization and Regulation of Cystatin 12 in Mouse Testis and Epididymis
Biol Reprod, November 1, 2005; 73(5): 872 - 880.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
V. Tohonen, J. Frygelius, M. Mohammadieh, U. Kvist, L. J. Pelliniemi, K. O'Brien, K. Nordqvist, and A. Wedell
Normal Sexual Development and Fertility in testatin Knockout Mice
Mol. Cell. Biol., June 15, 2005; 25(12): 4892 - 4902.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
N. Hsia, J. P. Brousal, S. R. Hann, and G. A. Cornwall
Recapitulation of Germ Cell- and Pituitary-Specific Expression With 1.6 kb of the Cystatin-Related Epididymal Spermatogenic (Cres) Gene Promoter in Transgenic Mice
J Androl, March 1, 2005; 26(2): 249 - 257.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. L. Kirby, L. Yang, J. C. Labus, R. J. Lye, N. Hsia, R. Day, G. A. Cornwall, and B. T. Hinton
Characterization of Epididymal Epithelial Cell-Specific Gene Promoters by In Vivo Electroporation
Biol Reprod, August 1, 2004; 71(2): 613 - 619.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Li, P. J. Friel, D. J. McLean, and M. D. Griswold
Cystatin E1 and E2, New Members of Male Reproductive Tract Subgroup Within Cystatin Type 2 Family
Biol Reprod, August 1, 2003; 69(2): 489 - 500.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. A. Cornwall, A. Cameron, I. Lindberg, D. M. Hardy, N. Cormier, and N. Hsia
The Cystatin-Related Epididymal Spermatogenic Protein Inhibits the Serine Protease Prohormone Convertase 2
Endocrinology, March 1, 2003; 144(3): 901 - 908.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Hsia and G. A. Cornwall
Cres2 and Cres3: New Members of the Cystatin-Related Epididymal Spermatogenic Subgroup of Family 2 Cystatins
Endocrinology, March 1, 2003; 144(3): 909 - 915.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. K. Rao, C. M. Wayne, and M. F. Wilkinson
Pem Homeobox Gene Regulatory Sequences That Direct Androgen-dependent Developmentally Regulated Gene Expression in Different Subregions of the Epididymis
J. Biol. Chem., December 6, 2002; 277(50): 48771 - 48778.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Li, P. J. Friel, M. O. Robinson, D. J. McLean, and M. D. Griswold
Identification and Characterization of Testis- and Epididymis-Specific Genes: Cystatin SC and Cystatin TE-1
Biol Reprod, December 1, 2002; 67(6): 1872 - 1880.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Wassler, P. Syntin, H.G. Sutton-Walsh, N. Hsia, D. M. Hardy, and G. A. Cornwall
Identification and Characterization of Cystatin-Related Epididymal Spermatogenic Protein in Human Spermatozoa: Localization in the Equatorial Segment
Biol Reprod, September 1, 2002; 67(3): 795 - 803.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. G. Hamil, Q. Liu, P. Sivashanmugam, S. Yenugu, R. Soundararajan, G. Grossman, R. T. Richardson, Y.-L. Zhang, M. G. O'Rand, P. Petrusz, et al.
Cystatin 11: A New Member of the Cystatin Type 2 Family
Endocrinology, July 1, 2002; 143(7): 2787 - 2796.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. Hsia and G. A. Cornwall
CCAAT/Enhancer Binding Protein {beta} Regulates Expression of the Cystatin-Related Epididymal Spermatogenic (Cres) Gene
Biol Reprod, November 1, 2001; 65(5): 1452 - 1461.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. P. Walsh and D. M. Stocco
Effects of Lindane on Steroidogenesis and Steroidogenic Acute Regulatory Protein Expression
Biol Reprod, April 1, 2000; 63(4): 1024 - 1033.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sutton, H. G.
Right arrow Articles by Cornwall, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sutton, H. G.
Right arrow Articles by Cornwall, G. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals