Endocrinology Vol. 140, No. 6 2721-2732
Copyright © 1999 by The Endocrine Society
Cystatin-Related Epididymal Spermatogenic Protein Colocalizes with Luteinizing Hormone-ß Protein in Mouse Anterior Pituitary Gonadotropes1
H. Gayle Sutton,
Angelina Fusco and
Gail A. Cornwall
Department of Cell Biology and Biochemistry, Texas Tech
University Health Sciences Center, Lubbock, Texas 79430.
Address all correspondence and requests for reprints to: Gail A. Cornwall, Ph.D., Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, 3601 4th Street, Lubbock, Texas 79430. E-mail: cbbgc{at}wpoffice.net.ttuhsc.edu
 |
Abstract
|
|---|
The CRES (cystatin-related epididymal spermatogenic) protein, a member
of the cystatin superfamily of cysteine protease inhibitors, exhibits
highly restricted expression in the mouse testis and epididymis,
suggesting roles in reproduction. Considering the well-established
relationship that exists between the gonads and the neuroendocrine
system, the present studies were undertaken to determine whether the
CRES messenger RNA and protein are expressed in the anterior
pituitary gland and, if so, whether the expression is regulated by
hormones. RT-PCR analysis of whole pituitary gland RNA preparations,
and Northern blot analyses of pituitary gland cell lines, demonstrated
that the CRES gene is expressed in the male and female anterior
pituitary gland gonadotropes. Furthermore, Western blot analysis
demonstrated that CRES protein was present in whole mouse pituitary
glands and was synthesized and secreted by the LßT2 gonadotrope cell
line. Interestingly, whereas the predominant CRES proteins present in
epididymal lysates, LßT2 secretory granules, and whole pituitary
gland lysates were 19 and 14 kDa, the predominant CRES proteins present
in the cell culture conditioned media were 17 and 12 kDa.
Deglycosylation studies revealed that the higher-molecular-mass CRES
proteins (19 and 17 kDa) were the result of N-linked glycosylation,
caused by the presence of high mannose residues. Double-label
immunofluorescence and confocal microscopic analysis of male and female
mouse pituitary gland tissue confirmed the RNA studies and showed that
CRES protein colocalized with LHß protein in the gonadotropes.
Finally, gonadectomy and hormone replacement studies suggest that CRES
protein in the gonadotropes is hormonally regulated. These studies
suggest that CRES protein may perform a role in the
gonadotrope-mediated control of reproduction.
 |
Introduction
|
|---|
THE CRES (cystatin-related epididymal
spermatogenic) gene is a highly conserved gene, which is a member of
the cystatin superfamily of cysteine protease inhibitors. The cystatin
superfamily consists of three well-characterized families, including
the intracellular stefins, and the secreted cystatins and kininogens
(1). The cystatins (family 2 cystatins), with which the CRES gene shows
the highest sequence similarity, are characterized by their 3-exon
structure, a broad tissue distribution, and promoters with features of
housekeeping genes (2). The family 2 cystatin genes, including
cystatins C, D, S, SA, and SN, encode secreted proteins of 1213 kDa,
which are present in most body fluids (1). The proteins possess four
highly conserved cysteine residues necessary for protein folding (3)
and three consensus motifs thought to be involved in the inhibition of
cysteine proteases (4, 5). Although in vitro studies have
clearly established that the cystatins are cysteine protease inhibitors
with specificities against the papain-like cysteine proteases [such as
cathepsin B, S, H, and L (6)], the in vivo function of the
cystatins is not well understood. However, roles in tumor invasion,
inflammation, and prohormone processing have been suggested (7, 8, 9). The
critical role these proteins play is further emphasized by the
association of several neurological diseases with mutations in specific
cystatin genes (10, 11).
Recently, several new cystatin genes have been identified that differ
from the family 2 cystatin genes based on their tissue-specific
expression, altered consensus sequences, and/or their gene structure
(12, 13, 14). These cystatin genes may represent new families in the
cystatin superfamily that have evolved to perform tissue-specific
functions distinct from the housekeeping cystatin genes described
earlier. We have previously reported that CRES gene and protein
expression are restricted to the round/elongating spermatids in the
testis and to the proximal caput epididymidis, with no detectable
expression in 26 other tissues examined, including the reproductive
tract of the female (15, 16). Furthermore, castration and hormone
replacement studies showed that CRES gene expression within the
epididymis required the presence of unknown testicular factors other
than androgens (15). Recent genomic cloning and chromosomal
localization studies demonstrated that the CRES gene exhibits exon
structure similar to that of mouse cystatin C and cosegregates with
cystatin C at the same genetic loci (16A ). However, the CRES promoter
is distinct from the cystatin C promoter, in that it contains DNA
regulatory elements typical of regulated genes. Taken together, these
observations suggest that the CRES gene represents a new family of the
cystatin superfamily that plays implicit roles in reproduction.
Our previous observations, that the CRES gene and protein are expressed
in gonadal tissues, raised the question as to whether the CRES gene was
also expressed in the neuroendocrine system, specifically within the
pituitary gland, which is directly involved in the regulation of
gonadal function via its secretion of gonadotropins. Therefore, the
present experiments were designed to determine whether the CRES gene
and protein are expressed in the anterior pituitary gland gonadotrope
cells, and if so, whether CRES expression is hormonally regulated. In
the studies presented here, we demonstrate by RT-PCR and Northern blot
analysis that the CRES gene is expressed in the gonadotrope cells in
the male and female anterior pituitary gland. Furthermore, Western blot
analyses, double-label immunofluorescence, and confocal microscopy show
that CRES protein colocalizes with LHß protein in the gonadotropes
and is secreted. Finally, our studies suggest that CRES protein levels
in the gonadotropes are regulated by hormones.
 |
Materials and Methods
|
|---|
Experimental animals
Intact mature male and female ICR and C57Bl6/J mice and
bilaterally castrate ICR male and bilaterally ovariectomized ICR female
mice were purchased from Harlan Sprague Dawley, Inc.
(Indianapolis, IN) and were maintained under a constant 12-h
light, 12-h dark cycle, with food and water ad libitum.
Testosterone replacement was by the implantation of a 5-mg testosterone
pellet (Innovative Research of America, Sarasota,
FL) directly under the skin on the back of each mouse. Estrogen
replacement was by a daily sc injection of 300 ng 17ß estradiol in
0.1 ml corn oil/mouse (Sigma Chemical Co. St. Louis, MO),
as previously described (17). At the time mice were killed, the
remainder of the testosterone pellet was isolated from each implanted
mouse to ensure that it had not been lost during the replacement
period. Also, the seminal vesicles and uteri were removed and weighed,
and blood was collected for RIA determination of circulating
testosterone and estrogen levels in the male and female mice,
respectively. RIAs were performed by the Endocrine Services Laboratory
at the Oregon Regional Primate Research Center (Beaverton, OR)
under the direction of David Hess, using the assays previously reported
(18, 19). All animal studies were conducted in accordance with the NIH
guidelines for the Care and Use of Experimental Animals.
Cell and organ culture
Gonadotrope cell lines
T31 and LßT2 were a generous gift
of P. Mellon, University of California, San Diego, whereas the
somatotrope/lactotrope GH3 cell line was from ATCC
(Rockville, MD). The
T31 and LßT2 cells were cultured in 100-mm
tissue culture dishes and were maintained in DMEM with 4.5 mg/ml
glucose, 5% FCS, 5% calf serum, 100 U/ml penicillin, and 0.1 mg/ml
streptomycin, at 37 C in an atmosphere of 5% CO2. GH3
cells were maintained in DMEM with 10% FCS, 100 U/ml penicillin, and
0.1 mg/ml streptomycin. Media and antibiotics were from Gibco BRL (Grand Island, NY), and serum was from HyClone Laboratories, Inc. (Logan, UT).
Isolation of RNA
Total RNA was isolated from tissues pooled from 56 mice using
Trizol reagent (Gibco BRL, Grand Island, NY), following
the manufacturers protocol. For the isolation of RNA from cultured
cells, media was aspirated from tissue culture plates, the plates were
rinsed quickly with cold PBS, and 5 ml Trizol was added directly to
each plate. The cells were resuspended by scraping the plate with a
sterile spatula, followed by repeated pipetting and then isolation of
RNA, following the manufacturers protocol.
RT-PCR
RT-PCR was performed using 3 µg total RNA from male and female
mouse pituitary glands and 1 µg total RNA from mouse testis. Total
RNA was incubated in RT reaction buffer containing 5 mM
MgCl2, 50 mM KCl, 10 mM Tris (pH
8.3), 0.5 mM deoxynucleotide triphosphates, 20 U RNasin
(RNase inhibitor), and 2.5 µM oligo-dT for 30 min
at 37 C in the presence of 3 U deoxyribonuclease (DNase) I
(Boehringer Mannheim, Indianapolis, IN). After heat
inactivation of the DNase I at 75 C for 5 min (20), 50 U MuLV reverse
transcriptase (Perkin-Elmer Corp., Foster City, CA) was
added, and the reaction mixture was incubated at 42 C for 15 min, then
at 99 C for 5 min to inactivate the enzyme. Eighteen of the 20
microliter RT reaction was used for PCR amplification of the CRES
complementary (cDNA) in the presence of 2 mM
MgCl2, 10 mM Tris (pH 8.3), 50 mM
KCl, 0.2 mM deoxynucleotide triphosphates, 0.5
µM forward and 0.5 µM reverse CRES-specific
primers, 1.5 µCi [
-32P]deoxycytidine triphosphate,
and 1.25 U Taq DNA polymerase (Sigma Chemical Co.). After an initial denaturation at 95 C, PCR was
carried out at 94 C for 1 min; 65 C for 1 min for 36 cycles, and 72 C
for 7 min using a minicycler (MJ Research, Inc.,
Watertown, MA). For a constitutive control, 1 µl of a 1:50 dilution
of the same RT reaction was amplified by PCR under the same conditions
described above using primers specific for mouse cystatin C. The RT-PCR
products were analyzed by electrophoresis in a 1.5% agarose/1x Tris
acetate EDTA gel, which was then dried under vacuum onto filter
paper for 1 h at 50 C. The dried gel was exposed to film for
4872 h at room temperature.
Oligonucleotide primer pairs
Oligonucleotide primers for PCR were designed from the known
sequences for mouse CRES (15) and cystatin C (21) cDNAs. The primers
used for CRES PCR amplification were 5'CAAGGAAAGTGAGGACAAATATGTC3'
(forward) and 5'GTGACAGACTTGAACCACAGGTT3' (reverse), to yield a PCR
product of 340 bp. The primers used for cystatin C PCR amplification
were 5'CCCAAGCTTGGCATTTTTGCAGCTGAA3' (forward) and
5'CGCGGATCCGATGACGATGACAAAGCGACCCCAAAACAAGG3' (reverse), to yield a PCR
product of 354 bp.
Northern blot analysis
Total RNA from mouse tissues and cultured cell lines was
separated on a 1% agarose gel containing borate buffer (pH 8.2) and
0.66 M formaldehyde. The RNA samples were heated at 95 C
for 2 min before loading. To verify equal loading of RNA in each gel
lane, ethidium bromide was included in each RNA sample. The gels were
washed extensively in water to remove formaldehyde before vacuum
transfer (Oncor, Gaithersburg, MD) to nylon membrane (Nytran,
Schleicher & Schuell; Keene, NH). Blots were
prehybridized for 2 h at 42 C in hybridization buffer containing
50% formamide, 5x saline-sodium citrate (SSC), 0.2 mg/ml salmon sperm
DNA, 0.4 mg/ml yeast RNA, 50 µg/ml BSA, 0.1% SDS, and 12.5
mM sodium phosphate buffer, pH 6.6, followed by
hybridization overnight at 42 C in the presence of cDNA probe at a
concentration of 3 x 105 cpm/ml hybridization buffer.
cDNA probes for mouse CRES, rat LHß (a generous gift of P. Mellon),
and mouse 18S RNA were prepared by random priming (Prime-It II,
Stratagene, La Jolla, CA). After hybridization, the blots
were washed in 2x SSC, 1% SDS at 42 C for 3045 min with several
changes, and then at 65 C, before exposure to film. After hybridization
with the CRES cDNA, blots were stripped by washing twice in 0.1x SSC,
1% SDS at 50 C for 30 min, and then successively probed with the LHß
cDNA and 18S cDNA as a loading control. The Northern blots were
repeated several times, and representative blots are shown.
Sequence analysis
RT-PCR products were cycle sequenced by the Texas Tech
University Biotechnology Core facility under the direction of Susan
SanFrancisco, Ph.D.
Preparation of protein extracts
Mouse testes and epididymides were pooled from four C57Bl6/J or
ICR mice and homogenized in lysis buffer containing 0.02 M
Tris (pH 7.5), 0.05 M NaCl, 1.0 mM EDTA, 0.5%
Triton-X 100, 0.5% deoxycholate, 0.5% SDS, and 0.01 mg/ml aprotinin.
LßT2 cells were grown, as described above, to near confluency. The
day before harvesting, the media was replaced with DMEM minus serum.
The following day, the conditioned media was collected, concentrated to
one fourth the original volume, using Centricon concentrators (Amicon,
Beverly, MA), and an equal volume of 2x lysis buffer was added. LßT2
cells were scraped off the plates and homogenized by 80 strokes with a
Dounce homogenizer on ice in the presence of 0.5 M sucrose,
50 mM Tris (pH 8), 25 mM KCl, 2 mM
MgCl2, 1 mM CaCl2 (TMCK buffer). A
crude secretory granule fraction was prepared, following the protocol
of Conn et al. (22). Briefly, homogenates were centrifuged
at 1,000 x g for 10 min at 4 C to pellet nuclei with
associated organelles and any remaining intact cells. The supernatant
was removed and centrifuged at 12,000 x g for 20 min
at 4 C to pellet secretory granules/organelles (granular fraction). The
nuclear pellet from the first low-speed spin was resuspended in 200
µl PBS containing 0.5% Tween-20 and was kept on ice for 20 min. The
nuclear extract was then layered onto a 0.5 M sucrose
cushion prepared in TMCK buffer and centrifuged at 1,000 x
g for 10 min. The upper layer, containing organelles, was
then combined with the granular fraction. Mouse whole pituitary gland
protein samples were prepared using the Trizol reagent (Gibco BRL, Gaithersburg, MD), following the manufacturers protocol.
Proteins present in the phenol/ethanol supernatant, remaining after the
isolation of RNA and DNA, were precipitated by the addition of
isopropanol, followed by centrifugation at 12,000 x g
for 10 min. The protein pellet was washed three times in 0.3
M guanidine hydrochloride in 95% ethanol by incubating the
pellet in the wash solution for 20 min each time, followed by a 5-min
spin at 7,500 x g. The protein pellet was dried and
resuspended in 2.5% SDS, followed by heating until dissolved. The
protein solution was then diluted to 1% SDS with water. Protein
concentrations for all samples were determined using the BCA protein
assay (Pierce Chemical Co., Rockland, IL).
Western blot analysis
One hundred to 150 µg protein were separated by 17.5%
SDS-PAGE, followed by transfer to nitrocellulose (Protran,
Schleicher & Schuell, Inc.) for Western blot
analysis. Blots were incubated in milk buffer containing 5% powdered
milk, 0.2% Tween 20 in PBS (pH 7.4), for 1 h at room temperature,
followed by an overnight incubation at 4 C with an affinity-purified
CRES antibody (2 µg/ml) or preimmune serum (PI, 1:5000 dilution) in
milk buffer containing 1% powdered milk, 0.2% Tween-20 in PBS, pH
7.4. The following day, the blots were washed in PBS-Tween, followed by
incubation with a goat antirabbit horseradish peroxidase-conjugated
secondary antibody (Biosource International, Camarillo,
CA) at 1:40,000 dilution in milk buffer for 1 h at room
temperature. The blots were then washed extensively in 1% milk buffer
before exposure to Super Signal chemiluminescent substrate
(Pierce Chemical Co.) for 5 min, followed by exposure to
film. For some Western blots, 125I-labeled protein A
(ICN Radiochemicals, Irvine, CA) was used in place of the
goat antirabbit horseradish peroxidase-conjugated secondary antibody
and the chemiluminescent substrate.
Carbohydrate analysis
To determine whether the CRES proteins possess N-linked
carbohydrate residues, protein extracts were treated with two different
N-glycosidases and examined by Western blot analysis.
Specifically, 125 µg protein extract, prepared (as described above)
from mouse testis, epididymis, and LßT2 gonadotrope cell culture
media, was denatured by boiling for 10 min in the presence of 0.5% SDS
and 1% ß-mercaptoethanol. The denatured proteins were incubated
overnight at 37 C in the presence of 50 mM sodium phosphate
buffer (pH 7.5) containing 1% NP-40 and 500 U N-glycosidase
F (PNGase F, New England Biolabs, Inc., Beverly, MA) or in
the presence of 50 mM sodium citrate (pH 5.5) and 500 U
endoglycosidase H (New England Biolabs, Inc.). The
following day, the samples were separated by SDS-PAGE, followed by
Western blot analysis, as described above.
Immunofluorescence
Mouse pituitary glands were fixed in 4% paraformaldehyde in
PBS, pH 7.4, for 1 h at 4 C and then washed successively for 30
min each at 4 C in PBS, 0.9% NaCl, 0.45% NaCl/50% ethanol, 70%
ethanol, and stored in 70% ethanol at 4 C overnight. The tissues were
then dehydrated by incubation in 95% ethanol for 30 min at 4 C,
followed by 100% ethanol for 30 min, and then two incubations of 100%
ethanol each for 1 h at 4 C. Tissues were washed in xylenes for 40
min and then 1 h at room temperature, followed by embedding in
paraffin. Four micron paraffin sections were cut and mounted onto glass
slides by the Texas Tech University Health Sciences Center Electron
Microscopy Center. Tissue sections were deparaffinized by incubating at
room temperature twice (for 10 min each) in xylenes, once (for 3 min)
in 100% ethanol, and once (for 3 min) in 95% ethanol. The slides were
allowed to dry, and sections were circled with a Pap pen to allow small
incubation volumes. After a 20-min incubation in PBS, the tissue
sections were covered with 100% normal goat serum and placed in a
humidified chamber at 37 C to block for 90 min. A high percentage of
goat serum was used for blocking, to minimize the background
fluorescence observed in the pituitary glands. The blocked tissue
sections were briefly washed with 510 drops of 5% normal goat serum
in PBS and then incubated in a humidified chamber at 37 C for 2 h
with both a rabbit antimouse CRES antiserum (1:400) and a guinea pig
antirat LHß antiserum (1:3000), developed by A. F. Parlow and a
gift from the National Hormone and Pituitary Program, NIDDK. For
controls, pituitary gland tissue sections were incubated with the LHß
antiserum (1:3000) and CRES PI (1:400) or the rabbit antimouse CRES
antiserum, preincubated with recombinant CRES protein (block; 1:400).
The specificity of the guinea pig antirat LHß antiserum has been
demonstrated previously (23). After incubation of the tissue sections
with the primary antibodies, sections were washed three times for 5 min
each at room temperature in PBS and incubated, for 1 h at 37 C in
a dark humidified chamber, with an fluorescein isothiocyanate
(FITC)-conjugated goat antiguinea pig secondary antibody (1:50 in PBS)
(Jackson ImmunoResearch Laboratories, Inc., West Grove,
PA) and a Texas Red-conjugated goat antirabbit secondary antibody (1:50
in PBS) (Jackson ImmunoResearch Laboratories, Inc.).
Sections were washed in PBS three times for 5 min each at room
temperature in the dark and then once in PBS, pH 8.5. Slides were
inverted onto coverslips containing 1520 µl mounting medium [92
mM Tris (pH 8.5), 18.5% dimethylsulfoxide, 23% methanol,
0.092 mg/ml Mowiol 488 (Fisher Scientific, Pittsburgh PA)], to which p-phenyline diamine (1 mg/ml
final; Sigma Chemical Co.) was added immediately before
use, and sections were allowed to cure overnight in the dark. The
sections were examined using an Olympus Corp. BX-60
microscope equipped for epifluorescence and were photographed using
both a wide yellow filter for rhodamine (Texas Red) and a narrow band
filter for FITC. The sections were also examined using an Olympus Corp. LSM-GB200 confocal microscope.
 |
Results
|
|---|
CRES gene expression in the pituitary gland
We have previously shown that, of the 26 mouse tissues examined,
the CRES gene exhibits highly restricted expression in the testis and
epididymis (15). A recent examination of additional tissues, by
Northern blot analysis, suggested that the CRES gene was expressed also
in the pituitary gland (data not shown). However, because of the low
levels of the CRES messenger RNA (mRNA), which resulted in lengthy
exposure times for the Northern blots, we used the more sensitive
approach of RT-PCR to examine CRES gene expression in the mouse
pituitary gland. Pituitary glands were pooled from 46 male and
cycling female ICR strain mice, and RNA was isolated and used for
RT-PCR. For comparison, whole testicular RNA was used as a positive
control. As shown in Fig. 1
, CRES mRNA
was expressed in the testis as well as in all RNA preparations from the
pituitary glands of both male and female mice. Control experiments,
including RT-PCR of water (to test for the presence of cDNA in the
reaction components) and PCR only, of each RNA sample (to test for DNA
contamination), did not result in a PCR product, indicating that the
CRES signal observed by RT-PCR was attributable to the presence of CRES
mRNA in the pituitary gland RNA preparations. Furthermore, cycle
sequencing confirmed that the 340-bp PCR product was indeed CRES cDNA.
The same reverse transcriptase reactions were also used for PCR
amplification of the mouse cystatin C cDNA. We have previously
determined, by Northern blot analysis, that cystatin C expression does
not vary between RNA samples prepared from different pooled mouse
pituitary glands (data not shown), and therefore, it served as a
constitutive control for the RT-PCR reactions. The differences observed
in the cystatin C levels thus reflect slight differences in the amount
of RNA used in the RT-PCR reactions.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 1. Expression of the CRES gene in the male and female
mouse pituitary gland. RT-PCR (+) was performed using approximately 1
µg total RNA from the mouse testis (TE) and 3 µg total RNA from
pooled pituitary glands from male and cycling female mice. The pooled
pituitaries from five to six mice were used for each RNA preparation,
and five separate RNA preparations were examined for male mice, and
three separate RNA preparations were examined for female mice. After
RT, using oligo-dT to prime cDNA synthesis, the same RT reaction was
used for the PCR amplification of CRES and cystatin C (cyst C) cDNA,
which served as an internal control. PCR was carried out in the
presence of 1.5 µCi [ -32P]deoxycytidine
triphosphate, and RT-PCR reactions were analyzed by agarose gel
electrophoresis, followed by exposure of the dried gel to film. Control
experiments included RT-PCR of water (+) and PCR only (-) of each RNA
sample to test for the presence of contaminating cDNA in the reagents
and RNA preparations.
|
|
The anterior pituitary gland is composed of multiple cell populations,
including gonadotropes that express LH and FSH, somatotropes that
express GH, and lactotropes that express PRL. Available pituitary cell
lines were therefore examined to determine the cell type(s) that
express the CRES gene. Total RNA, isolated from the mouse gonadotrope
T31 and LßT2 cell lines and from the rat somatotrope/lactotrope
GH3 cell line, was examined for CRES gene expression in Northern blot
analysis. Total RNA, isolated from the mouse testis and epididymis, was
included in the Northern blot analysis as positive controls. As shown
in Fig. 2
, in addition to the expected
expression of the CRES mRNA in the mouse testis and epididymis, the 700
bp CRES mRNA was also expressed in the LßT2 gonadotrope cells but not
in the
T31 gonadotrope cells or in the GH3 cells. The absence of
CRES mRNA in the rat somatotrope/lactotrope GH3 cells was not caused by
the inability of the mouse cDNA to recognize the rat CRES mRNA, because
we have previously determined (by Northern blot analysis) that the
mouse cDNA was able to recognize the rat CRES mRNA in the epididymis
(data not shown). When the Northern blots were stripped and reprobed
with an LHß cDNA, the LHß mRNA was only detected in the LßT2
cells that represent a differentiated gonadotrope cell line and not in
the
T3-1 cells that represent a less differentiated gonadotrope cell
line. The somatotrope/lactotrope GH3 cell line also did not express
LHß mRNA.

View larger version (81K):
[in this window]
[in a new window]
|
Figure 2. Cell-type specific expression of the CRES mRNA in
the pituitary gland. Northern blot analysis of 10 µg total RNA
isolated from the mouse TE, epididymis (EPI), T31 and LßT2
gonadotrope cell lines, and the GH3 somatotrope/lactotrope cell line,
probed with the mouse CRES cDNA insert. The CRES cDNA insert recognized
the 0.7-kb CRES mRNA in the testis, epididymis, and LßT2 gonadotrope
cell line. The blot was then stripped and reprobed with an LHß cDNA,
followed by 18S cDNA, to confirm equal loading of RNA in each lane. A
representative Northern blot is shown.
|
|
CRES protein expression in the pituitary gland
Because RT-PCR and Northern blot analysis showed the presence of
CRES mRNA in the mouse pituitary gland gonadotropes, studies were next
undertaken to examine CRES protein. The gonadotrope LßT2 cells were
grown to near confluency, and secretory granules and conditioned media
from the cultured cells and whole mouse pituitary glands were examined
for CRES protein using an affinity-purified rabbit antimouse CRES
antibody in Western blot analysis. We previously have identified two
CRES proteins, of 19 and 14 kDa, in the mouse testis and epididymis
(16); therefore, epididymal extracts were also examined by Western blot
analysis as a positive control. As shown in Fig. 3A
, although low levels of CRES proteins
were detected in the LßT2 secretory granules, higher levels of CRES
proteins were detected in the conditioned media. Interestingly, in
addition to the 19- and 14-kDa CRES proteins present in the LßT2
secretory granules, two proteins of 17 and 12 kDa were also observed in
the conditioned media, with the 12-kDa CRES protein being the
predominant form. In contrast, in the epididymis, the 19- and 14-kDa
proteins were the predominant forms, with lower levels of the 17- and
12-kDa proteins present. The CRES protein profile in the whole mouse
pituitary gland appeared similar to that observed in the secretory
granules isolated from the LßT2 cultured cells, although little-to-no
14-kDa CRES protein was detected. The 22- and 29-kDa proteins present
in the epididymis, cultured cells, and whole pituitary lysates may
represent proteins with cross-reacting epitopes or CRES protein
complexes resistant to the reducing conditions used. Western blot
analysis, carried out with PI, did not show the presence of the CRES
proteins in the tissue and cell lysates or media, confirming the
specificity of the antibody for CRES protein (Fig. 3B
).

View larger version (71K):
[in this window]
[in a new window]
|
Figure 3. CRES protein expression in the gonadotrope cells.
Western blot analysis of 100 µg epididymal lysate EPI, LßT2
secretory granules (SG) and conditioned media (M), and whole male mouse
pituitary gland lysate (PIT) were separated by 17.5% SDS-PAGE,
followed by transfer to nitrocellulose and incubation with (A) an
affinity purified mouse CRES antibody (2 µg/ml) or (B) PI (1:5000).
The blots were then incubated with a goat antirabbit horseradish
peroxidase-conjugated secondary antibody, followed by Pierce Chemical Co. Super Signal substrate and exposure to film.
Arrows indicate the 19-, 17-, 14-, and 12-kDa CRES
proteins. A representative Western blot is shown.
|
|
The predicted amino acid sequence of the mouse CRES protein possesses
two putative N-linked glycosylation sites (Asn-X-Ser/Thr). Also,
Western blots revealed the presence of two predominant CRES proteins:
19- and-14 kDa in the epididymis, whole mouse pituitary glands, and
LßT2-cultured cells; and 17- and 12-kDa in the LßT2-conditioned
media. Therefore, studies were next carried out to determine whether
the higher-molecular-mass CRES proteins were the result of N-linked
glycosylation. Mouse testicular and epididymal tissue lysates and the
LßT2 gonadotrope cell conditioned media were incubated in the
presence or absence of N-glycosidase F, which hydrolyzes
most types of N-glycan chains from glycoproteins, and then
examined by Western blot analysis. As shown in Fig. 4
, incubation of the tissue lysates and
conditioned media in the presence of the N-glycosidase F resulted in a
shift of the higher-molecular-mass CRES proteins (19 and 17 kDa) to the
lower-molecular-mass CRES proteins (14 and 12 kDa), indicating that the
higher-molecular-mass CRES proteins were the result of
N-linked glycosylation. The lower-molecular-mass CRES
proteins (14 and 12 kDa) seemed to be resistant to the
N-glycanase treatment, given that no smaller CRES proteins
were detected. Similarly, tissue lysates and conditioned media
incubated with endoglycosidase H, which cleaves only high mannose
residues and some hybrid oligosaccharides from N-linked
glycoproteins, also caused the higher-molecular-mass CRES proteins to
shift to the lower-molecular-mass CRES proteins (data not shown). Taken
together, the deglycosylation studies suggest that the 5-kDa difference
in molecular mass between the two forms of the CRES proteins is caused
by the presence of high mannose residues.

View larger version (82K):
[in this window]
[in a new window]
|
Figure 4. Carbohydrate analysis of the CRES protein in the
testis, epididymis, and LßT2 gonadotrope cells. Western blot analysis
of 125 µg of testis TE, epididymal tissue lysate EPI, and LßT2 cell
conditioned media incubated overnight in the presence (+) or absence
(-) of N-glycosidase F. The samples were then separated
by 17.5% SDS-PAGE, followed by transfer to nitrocellulose and
incubation with an affinity-purified mouse CRES antibody (2 µg/ml).
The blots were then incubated with 125I protein A, followed
by exposure to film.
|
|
Colocalization of CRES and LHß proteins in the anterior pituitary
gonadotropes
To confirm that CRES protein was expressed by the anterior
pituitary gonadotropes in vivo, double-label
immunofluorescence analysis was performed. Male and female mouse
pituitary gland tissue sections were simultaneously incubated with a
rabbit antimouse CRES antiserum and a guinea pig antirat LHß
antiserum, followed by incubation with a Texas Red-conjugated goat
antirabbit antiserum and an FITC-conjugated goat antiguinea pig
antiserum, respectively. The tissue sections were viewed using a
fluorescent microscope and the appropriate filters to detect the Texas
Red (red) or FITC (green) fluorescence. As shown in Fig. 5
, FITC fluorescence demonstrated that,
in both male and female mice, LHß protein was present in a distinct
population of cells scattered throughout the pituitary gland sections,
indicating that these cells are gonadotropes. Examination of the Texas
Red fluorescence in the same tissue sections showed CRES protein to be
localized to the same population of cells expressing LHß protein.
This was confirmed by a double-exposure photograph, with the FITC and
Texas Red filters, to detect both the LHß and CRES proteins,
respectively (green + red = yellow). No detectable LHß or CRES
protein was present in the posterior region of the pituitary gland
[Fig. 5
, (p)]. To control for the specificity of the CRES antiserum,
male and female pituitary gland tissue sections were simultaneously
incubated with the LHß antiserum and the CRES PI, followed by
incubation with the secondary antibodies. As shown in Fig. 5
, as
expected, the cells were FITC positive for LHß protein but showed no
specific Texas Red staining for CRES protein with the PI.
Because of the lack of a specific staining for CRES protein when the PI
is used, the double-exposure photograph, with the FITC and Texas Red
filters, therefore detected only the LHß protein (green). In addition
to the PI, controls for nonspecific fluorescence included the
incubation of tissue sections with CRES antiserum preincubated with
CRES protein (block), with secondary antibodies alone, and with both
combinations of mismatched primary and secondary antibodies (CRES
anti-serum + FITC antiguinea pig secondary antibody, LHß antiserum +
Texas Red antirabbit secondary antibody). These experiments resulted in
no specific fluorescence signal in the pituitary gland tissue sections
(data not shown).

View larger version (105K):
[in this window]
[in a new window]
|
Figure 5. Colocalization of CRES and LHß proteins in
anterior pituitary gland gonadotropes. Male and female pituitary gland
tissue sections were incubated simultaneously with a rabbit antimouse
CRES antiserum ( -CRES) and guinea pig antirat LHß antiserum
( -LHß) in double-label immunofluorescence analysis. After washing
in PBS, the tissue sections were incubated in the dark with an
FITC-conjugated goat antiguinea pig secondary antibody and a Texas
Red-conjugated goat antirabbit secondary antibody. Sections were
examined using an Olympus Corp. BX-60 microscope equipped
for epifluorescence and were photographed at 40x magnification using
filters to detect the Texas Red (red, CRES) fluorescence
or FITC (green, LHß) fluorescence. A double-exposure
photograph of the tissue section, using both the Texas Red and FITC
filters, showed that the cells that express CRES protein also express
LHß protein (red + green =
yellow). The same tissue section was also photographed,
using a phase objective to show that only a select population of cells
in the pituitary gland express CRES and LHß proteins. To control for
the specificity of the CRES antibody, pituitary gland tissue sections
were simultaneously incubated with the CRES PI and the LHß antiserum,
followed by incubation with the Texas Red and FITC-conjugated secondary
antibodies. As shown in the middle two panels,
incubation of the tissue section with the CRES PI resulted in only a
background red fluorescence with no specific staining of
the cells, when examined with the Texas Red filter; whereas, as
expected, the same cells examined with the FITC filter were positive
for LHß protein. A total of nine different male and female pituitary
glands were examined by double-labeling immunofluorescence, and
representative tissue sections are shown. p, Posterior pituitary
gland.
|
|
In addition to the representative experiment shown in Fig. 5
, nine other male and female mouse pituitary glands were examined by
double-label immunofluorescence. In these studies, the CRES protein
consistently colocalized with LHß protein to the anterior pituitary
gonadotropes. A comparison between the individual male pituitary glands
showed that, in all males, the gonadotropes appeared fairly homogeneous
in size and in the intensity of the LHß and CRES immunofluorescence
(Figs. 5
, 6
). In contrast, a comparison between individual female
pituitary glands showed heterogeneity in the relative size of the
gonadotropes and in the intensity of the LHß and CRES
immunofluorescence. For example, the gonadotrope cells in the female
pituitary gland, shown in Fig. 5
, appeared similar in size and LHß
and CRES immunofluorescence, as in the male gonadotropes. However,
in other female pituitary glands, the gonadotropes were more
heterogeneous; some gonadotropes appeared smaller, with less intense
LHß and CRES immunofluorescence (Fig. 6
).
Further examination of the double-labeled immunofluorescent
pituitary gland sections revealed that, within a gonadotrope cell, the
fluorescence intensities for the LHß and CRES proteins varied in a
correspondent manner, suggesting that the LHß and CRES proteins
colocalize intracellularly. Indeed, under higher magnification, a
punctate fluorescent pattern was observed for both LHß and CRES
proteins in the gonadotrope cells, suggesting localization within the
secretory granules (Fig. 7A
). In support
of these observations, confocal microscopy, which examined the
fluorescent intensities for both LHß and CRES proteins in a single
plane of a gonadotrope cell, showed similar patterns in fluorescent
intensities for the two proteins (Fig. 7B
). These observations suggest
that CRES protein colocalizes intracellularly with LHß protein in the
gonadotropes.

View larger version (66K):
[in this window]
[in a new window]
|
Figure 7. Intracellular colocalization of CRES and LHß
proteins in the anterior pituitary gonadotrope cells. Male anterior
pituitary gland tissue sections were double-labeled with CRES and LHß
antibodies, followed by Texas Red- and FITC-conjugated secondary
antibodies, as described. A, Immunofluorescent pituitary gland tissue
section, photographed at 120x magnification, using an Olympus Corp. BX-60 microscope and filters to detect the Texas Red
(CRES) fluorescence and FITC (LHß) fluorescence; B, immunofluorescent
pituitary gland tissue section examined using an Olympus Corp. LSM-GB200 confocal microscope. The fluorescence
intensities for both LHß and CRES proteins were determined in a
single plane of a cell, as indicated by the line drawn though the
gonadotrope. The immunofluorescence intensity for each protein, plotted
against the distance of the line, is shown. The LHß and CRES
immunofluorescence patterns seem identical, suggesting that, throughout
the cell, LHß and CRES proteins colocalize. A representative
fluorescent image and scan are shown.
|
|
Hormonal regulation of CRES protein in the anterior pituitary
gonadotropes
Gonadectomy and hormone replacement studies were carried out in
male and female mice to determine whether CRES protein levels in the
gonadotropes were affected by steroid hormones. LHß protein levels
were also examined for comparison. Double-label immunofluorescence was
carried out using anterior pituitary gland tissue sections from intact,
1-week castrate, and 1-week castrate, followed by 1-week
testosterone-replacement (T-Repl.) male mice. Similar
experiments were performed on anterior pituitary gland tissue sections
from intact, 1-week ovariectomized, and 1-week ovariectomized followed
by 1-week estradiol-replacement (E2-Repl.) female mice. As
shown in Table 1
, organ weights of the
androgen-dependent seminal vesicles and the estrogen-dependent uterine
horns reflected the hormonal status of the animal. After gonadectomy,
there was a corresponding decrease in the wet weight of the seminal
vesicles and uterine horns and a subsequent increase in tissue weights
after hormone replacement. Similarly, RIAs showed that circulating
levels of testosterone and estradiol in the male and female mice,
respectively, showed a dramatic decrease after gonadectomy, with a
corresponding increase after the administration of hormone (Fig. 8
legend).
View this table:
[in this window]
[in a new window]
|
Table 1. Seminal vesicle and uterine horn organ wet weights
from intact and hormone manipulated male and female mice
|
|

View larger version (117K):
[in this window]
[in a new window]
|
Figure 8. Double-label immunofluorescence analysis of CRES
and LHß proteins in the anterior pituitary gonadotrope cells from
hormonally manipulated male and female mice. Pituitary gland tissue
sections from intact, 1-week castrate (castrate), and 1-week castrate
followed by 1-week T-Repl. male mice and from intact, 1-week
ovariectomized (Ovx.) and 1-week ovariectomized followed by 1-week of
estradiol replacement (E2-Repl.) female mice, were
simultaneously incubated with the CRES ( -CRES) and LHß ( -LHß)
antiserum followed by incubation with FITC and Texas Red-conjugated
secondary antibodies. Sections were examined, using an Olympus Corp. microscope equipped for epifluorescence, and photographed
at 40x magnification using filters to detect the Texas Red
(red, CRES) and FITC (green, LHß)
fluorescence. Representative tissue sections are shown from the male
intact (n = 3), castrate (n = 4), T-Repl. (n = 4),
female intact (n = 3), ovariectomized (n = 4), and
E2-Repl. (n = 4) pituitary glands observed. The
testosterone levels (ng/ml), as determined by RIA analysis of the serum
from individual male mice were (mean ± SE): intact,
7.8 ± 3.2 (n = 3); castrate, 0.65 ± 0.19 (n = 4);
T-Repl., 4.9 ± 0.48 (n = 4). The estradiol levels (pg/ml),
as determined by RIA analysis of the serum from individual female mice
were (mean ± SE): intact, 23 ± 8.3 (n =
3); ovariectomized, 8.3 ± 2.5 (n = 3); and
E2-Repl., 24 ± 4.2 (n = 2). Insufficient serum
for RIA analysis was obtained from the other ovariectomized and
E2-Repl., female mice.
|
|
Double-label immunofluorescence demonstrated that the levels of CRES
protein in the gonadotropes were affected by alterations in the
hormonal state of the animal. In the male mouse, castration led to a
decrease in the levels of both the LHß and CRES proteins in the
gonadotropes, with the majority of the cells possessing barely
detectable levels of the two proteins (Fig. 8
). After the
administration of testosterone, for 1 week, to castrate male mice
(T-Repl.), the levels of LHß and CRES proteins in the gonadotropes
recovered and seemed equivalent, if not slightly greater, than the
levels of LHß and CRES proteins in the gonadotropes of intact mice
(Fig. 8
). Comparable changes in LHß and CRES proteins were observed
in other intact (n = 3), castrate (n = 4), and T-Repl.
(n = 4) male pituitary glands (data not shown). Female mice,
however, seemed to respond differently to gonadectomy than did male
mice. After ovariectomy, the gonadotropes appeared larger and richer in
LHß and CRES proteins than their intact counterpart cells. The
administration of estradiol did not seem to dramatically alter the
levels of LHß and CRES proteins in the gonadotropes, compared with
that observed in ovariectomized mice. However, a decrease in the number
of positive cells was observed. Comparable changes in LHß and CRES
proteins were observed in other intact (n = 3), ovariectomized
(n = 4), and E2-Repl. (n = 4) female mice.
 |
Discussion
|
|---|
The studies presented herein demonstrate that the CRES
gene and protein are expressed in male and female anterior pituitary
gonadotropes. Using RT-PCR, CRES mRNA was detected in RNA preparations
prepared from pooled male and female mouse pituitary glands. Further
analysis of CRES gene expression by Northern blot analysis, using
anterior pituitary gland cell lines, demonstrated that the CRES gene
was expressed by the gonadotrope cells but not by the
somatotrope/lactotrope cells. Moreover, the CRES gene was specifically
expressed by the LßT2 gonadotrope cell line, but not the
T31
gonadotrope cell line, suggesting that the expression of the CRES gene
is associated with a differentiated phenotype. Indeed, though the
T31 and LßT2 cell lines are responsive to GnRH and express the
GnRH receptor and thus are characterized as being of the gonadotrope
cell lineage (24, 25), they are distinct from each other. The
T31 cell line represents an undifferentiated gonadotrope cell and
expresses the
-subunit gene common to several peptide hormones,
including LH, FSH, TSH, and human CG; whereas the LßT2 cell line
represents a differentiated go-nadotrope cell and expresses both
the
-subunit gene and the LHß-subunit gene that determines hormone
specificity (24, 25). The expression of the CRES gene exclusively in
the LßT2 cells implies that CRES function is associated with
functionally mature gonadotrope cells.
Further analysis of the LßT2 cells, by Western blot analysis,
demonstrated that CRES protein was synthesized and secreted by the
gonadotrope cells in culture. Interestingly, although the 19- and
14-kDa CRES proteins, present in the epididymal tissue lysate and
LßT2 secretory granules, were also present in the conditioned
media, the predominant CRES proteins present in the conditioned media
were 17 and 12 kDa. Because CRES protein levels were low in the LßT2
secretory granules, it is difficult to determine whether the 17- and
12-kDa CRES proteins present in the media were also present
intracellularly. The higher levels of CRES protein present in the
conditioned media were most likely caused by the fact that the
conditioned medium consisted of proteins secreted over a 18- to 24-h
period (and therefore, was an accumulation of CRES protein), whereas
the secretory granule fraction represented total CRES protein present
in the LßT2 cells at a single point in time. Because the CRES protein
profile in the whole pituitary lysate was similar to the LßT2
secretory granule fraction, and smaller CRES proteins were also
detected in the epididymal lysates, the 17- and 12-kDa CRES proteins
seem to occur in tissues as well as in the cell line.
Deglycosylation studies, in which tissue lysates and the
LßT2-conditioned media were pretreated with N-glycosidase
F or endoglycosidase H, revealed that the higher-molecular-mass
CRES proteins (19 and 17 kDa) were the result of N-linked
glycosylation, caused by the presence of high mannose residues. The
lower-molecular-mass CRES proteins (14 and 12 kDa) lack N-linked
glycosylation, because these proteins seemed resistant to the
N-glycanase treatment. The presence of N-linked sugars in
the CRES proteins was not surprising, considering that the CRES-derived
amino acid sequence possesses two putative N-linked glycosylation
consensus sites (Asn-X-Ser/Thr) (15). Furthermore, the N-linked
glycosylation of the CRES protein is similar to the mouse and rat
cystatin C proteins, which have been shown to be present in
glycosylated (20 kDa) and nonglycosylated forms (14 kDa) (26, 27, 28).
Though it seems that N-linked glycosylation of the 14- and 12-kDa CRES
proteins resulted in the formation of the 19- and 17-kDa CRES forms,
there are several possible reasons for the presence of the smaller
12-kDa CRES protein in addition to the 14-kDa CRES protein. We recently
have determined that, in all tissues that express the CRES gene, there
is an alternatively spliced CRES mRNA that lacks the initiator methione
but that contains a downstream methionine in fairly good context for
translational initiation (29). Translational initiation at the second
methionine predicts a CRES protein of approximately 12 kDa.
Furthermore, preliminary in vitro transcription and
translation studies suggest that translation can initiate at the second
methionine in the CRES mRNA (Sutton and Cornwall, unpublished
observations). A second possibility for the presence of the 12-kDa CRES
protein is that the 14-kDa CRES protein is proteolytically processed.
Indeed, lower-molecular-mass forms of cystatin C protein have been
identified in vivo and have been determined to be the result
of specific N-terminal proteolysis (30). Finally, the presence of both
12- and 14-kDa CRES proteins may reflect O-linked glycosylation
differences between the two proteins. However, preliminary studies
using O-glycanase to remove O-linked carbohydrate residues did not
result in changes in the molecular mass of the CRES proteins (data not
shown). Studies are currently ongoing to examine further the use of
different CRES mRNAs and/or N-terminal proteolysis as a means of
regulating CRES protein function.
Double-label immunofluorescence studies of mouse male and female
pituitary glands showed that CRES protein colocalized with LHß
protein to the gonadotrope cells, thereby confirming the in
vitro studies with the LßT2 gonadotrope cell line. Examination
of the immunostained pituitary gland sections at a higher magnification
showed a similar punctate pattern of localization for the CRES and
LHß proteins within the gonadotropes, implying that the two proteins
also colocalize intracellularly. These observations were confirmed by
confocal microscopy, which showed identical LHß and CRES
immunofluorescence patterns through a single plane of a gonadotrope
cell. Finally, Western blot analysis of the secretory granule fraction
of the LßT2 cells showed the presence of CRES proteins. These
observations, taken together with the fact that CRES protein is
secreted in vitro, suggest that CRES protein is localized in
the gonadotrope secretory granules.
An examination of intact male anterior pituitary glands for CRES and
LHß proteins, by double-label immunofluorescence, showed little
difference between individual mice in the expression of the two
proteins in the gonadotropes. In contrast, qualitative differences were
observed between individual female anterior pituitary glands with
regard to the relative levels of CRES and LHß proteins and the size
of the gonadotrope cells. Though some female anterior pituitary glands
exhibited gonadotrope cells that were similar to that in the male, with
regard to their size and intensity of the CRES and LHß
immunofluorescence, the majority of the females showed a more
heterogeneous population of go-nadotropes, with some cells being
smaller and exhibiting less intense CRES and LHß immunofluorescence.
It is likely that the differences observed in the size of the
gonadotropes and the relative amounts of LHß protein reflect mice in
different stages of the estrus cycle. It was intriguing that, in the
female mice examined, the levels of CRES protein fluctuated in the same
direction as those of LHß protein. These observations not only
suggest that CRES protein in the gonadotropes may be hormonally
regulated but that CRES protein regulation may share some features in
common with LHß regulation. Hormonal studies in which gonadectomies
were performed in the male and female mice, followed by the
administration of testosterone to males and estradiol to females,
suggested that CRES protein in the gonadotropes may be regulated,
in part, by steroid hormones. Because indirect immunofluorescence
was used to examine CRES protein in the anterior pituitary
gonadotropes, it is difficult to quantitate the levels of CRES protein
before and after hormonal manipulations; and therefore, only
qualitative conclusions can be made. However, these studies provide the
basis for future experiments to examine, in greater detail, the
influence of steroid hormones as well as GnRH on CRES protein in the
anterior pituitary gland. Studies are also currently ongoing to develop
a CRES enzyme-linked immunosorbent assay for quantitative analyses of
CRES protein.
It is of interest to note that our observations of pituitary LHß
levels (by immunofluorescence) in male and female mice, after
gonadectomy and hormone replacement, were similar to that previously
observed (by RIA) in mice (31, 32, 33) but quite different from that
reported in rats (34). For example, after orchiectomy, although serum
LH is elevated, pituitary LH is persistently reduced in male mice and
does not become elevated as occurs in chronically castrate rats (34).
This response in male mice has been proposed to be caused by a rate of
LH secretion that exceeds the rate of synthesis, leading to a depletion
of the pituitary LH content in castrate male mice (35). Interestingly,
we observed the exact opposite response in female mice after
gonadectomy, in that LHß immunofluorescence seemed elevated. Although
other studies have shown by RIA that, within the first 24 h after
ovariectomy, there is an immediate decline in pituitary LH content in
female mice, there is a subsequent progressive increase, resulting in
elevated pituitary LH levels and in serum LH within 7 days (32). In
this regard, the pituitary response of ovariectomized mice is similar
to that of ovariectomized rats (34). Female mice may respond
differently from male mice, in that they typically release large
amounts of LH during the preovulatory surge and thus may be more
capable of replenishing LH protein in the gonadotropes (35). Our lack
of a noticeable effect of estradiol on pituitary LHß levels in
ovariectomized female mice was unexpected. However, persistently
elevated pituitary LH levels have been observed previously in
ovariectomized female mice administered similar doses of estradiol
(32), suggesting that higher doses of estradiol are required to elicit
a response in mice. Although we had insufficient sample for determining
serum LH, the similar response of pituitary LHß immunofluorescence
(in our studies) to that previously reported by RIA for male and female
mice supports the conclusions (from other studies) that mice are
distinct from rats in their pituitary response to hormone withdrawal
and replacement.
The colocalization of the CRES protein with LHß protein in the
gonadotropes raises intriguing possibilities as to its function in the
anterior pituitary gland. Because one proposed role of the cystatin
proteins is the regulation of prohormone processing, one possibility is
that CRES protein may regulate these processing events in the
gonadotrope cells. Alternatively, CRES protein function may be
extracellular and, after secretion, CRES may have local effects within
the pituitary or more distant endocrine effects.
 |
Acknowledgments
|
|---|
The authors would like to gratefully acknowledge Dr. Sandra
Whelly for her assistance with the RT-PCR studies.
 |
Footnotes
|
|---|
1 This research was supported by NIH Grant HD-33903 (to G.A.C.), funds
from the Medical Scientist Training Program (to H.G.S.), and a grant
from The Howard Hughes Medical Institute through the Undergraduate
Biological Sciences Education program (to A.F.). 
Received October 10, 1998.
 |
References
|
|---|
-
Turk V, Bode W 1991 The cystatins: protein
inhibitors of cysteine proteases. FEBS Lett 285:213219[CrossRef][Medline]
-
Huh C, Nagle JW, Kozak CA, Abrahamson M, Karlsson
S 1995 Structural organization, expression, and chromosomal
mapping of the mouse cystatin-C-encoding gene (Cst 3). Gene 152:221226[CrossRef][Medline]
-
Grubb A, Lofberg H, Barrett AJ 1986 The disulphide
bridges of human cystatin C (
-trace) and chicken cystatin. FEBS Lett 170:370374
-
Jerala R, Trstenjak-Prebanda M, Kroon-Zitko L, Lenarcic
B, Turk V 1990 Mutations in the QVVAG region of the cysteine
protease inhibitor stefin B. Biol Chem Hoppe Seyler [Suppl] 371:157160
-
Nycander M, Bjork I 1990 Evidence by chemical
modification that tryptophan-104 of the cysteine-proteinase inhibitor
chicken cystatin is located in or near the proteinase-binding site.
Biochem J 271:281284[Medline]
-
Barrett AJ, Rawlings ND, Davies ME, Machleidt W,
Salvensen G, Turk V 1986 In: Barrett AJ, Salvensen G (eds)
Proteinase Inhibitors. Elsevier Amsterdam, pp 515569
-
Calkins CC, Sloane BF 1995 Mammalian cysteine
protease inhibitors: biochemical properties and possible roles in tumor
progression. Biol Chem Hoppe Seyler 376:7180[Medline]
-
Leung-Tack J, Tavera C, Gensac MC, Martinez J, Colle
A 1990 Modulation of phagocytosis-associated respiratory burst by
human cystatin C: role of the N-terminal tetrapeptide Lys-Pro-Pro-Arg.
Exp Cell Res 188:1622[CrossRef][Medline]
-
Orlowski M 1983 Pituitary endopeptidases. Mol Cell
Biochem 52:4974[Medline]
-
Pennacchio LA, Lehesjoki A-E, Stone, NE, Willour
VL, Virtaneva K, Miao J, DAmato E, Ramirez L, Faham M, Koskiniemi M,
Warrington JA, Norio R, de la Chapelle A, Cox DR, Myers RM 1996 Mutations in the gene encoding cystatin B in progressive myoclonus
epilepsy (EPM1). Science 271:17311734[Abstract]
-
Ghiso J, Jensson O, Frangione B 1986 Amyloid
fibrils in hereditary cerebral hemorrhage with amyloidosis of Icelandic
type is a variant of gamma-trace basic protein (cystatin C). Proc Natl
Acad Sci USA 83:29742978[Abstract/Free Full Text]
-
Freije JP, Abrahamson M, Olafsson I, Velasco G, Grubb A,
Lopez-Otin C 1991 Structure and expression of the gene encoding
cystatin D, a novel human cysteine protease inhibitor. J Biol Chem 30:2053820543
-
Kellermann J, Haupt H, Auerswald E-A, Muller-Esterl W1989 The arrangement of disulfide loops in human alpha 2-HS
glycoprotein. Similarity to the disulfide bridge structures of
cystatins and kininogens. J Biol Chem 264:1412114128
-
Winderickx J, Hemschoote K, De Clercq N, Van Dijck
P, Peeters B, Rombauts W, Verhoven G, Heyns W 1990 Tissue-specific
expression and androgen regulation of different genes encoding rat
prostatic 22-kilodalton glycoprotein homologous to human and rat
cystatin. Mol Endocrinol 4:657667[Abstract/Free Full Text]
-
Cornwall GA, Orgebin-Crist M-C, Hann SR 1992 The
CRES gene: a unique testis-regulated gene related to the cystatin
family is highly restricted in its expression to the proximal region of
the mouse epididymis. Mol Endocrinol 6:16531664[Abstract/Free Full Text]
-
Cornwall GA, Hann SR 1995 Transient appearance of
CRES protein during spermatogenesis and caput epididymal sperm
maturation. Mol Reprod Dev 41:3746[CrossRef][Medline]
-
Cornwall GA, Hsia N, Sutton HGStructure,
alternative splicing and chromosomal localization of the
cystatin-related epididymal spermatogenic gene. Biochem J, in press
-
Fallest PC, Trader GL, Darrow JM, Shupnik MA 1995 Regulation of rat luteinizing hormone ß gene expression in transgenic
mice by steroids and a gonadotropin-releasing hormone antagonist. Biol
Reprod 53:103109[Abstract]
-
Resko JA, Malley A, Begley D, Hess DL 1973 Radioimmunoassay of testosterone during fetal development of the rhesus
monkey. Endocrinology 93:156161[Abstract/Free Full Text]
-
Goodman RL 1978 A quantitative analysis of the
physiological role of estradiol and progesterone in the control of
tonic and surge secretion of luteinizing hormone in the rat.
Endocrinology 102:142150[Abstract/Free Full Text]
-
Huang Z, Fasco MJ, Kaminsky LS 1996 Optimization of
DNase I removal of contaminating DNA from RNA for use in quantitative
RNA-PCR. Biotechniques 20:10121020[Medline]
-
Solem M, Rawson C, Lindburg K, Barnes D 1990 Transforming growth factor beta regulates cystatin c in serum-free
mouse embryo (SFME) cells. Biochem Biophys Res Commun 172:945951[CrossRef][Medline]
-
Conn PM, Janovick JA, Braden TD, Maurer RA, Jennes
L 1992 SIIp: a unique secretogranin/chromogranin of the pituitary
released in response to gonadotropin-releasing hormone. Endocrinology 130:30333040[Abstract/Free Full Text]
-
Deschepper CF, Seidler CB, Steele MK, Ganong WF 1985 Further studies on the localization of angiotensin-II-like
immunoreactivity in the anterior pituitary gland of the male rat,
comparing various antisera to pituitary hormones and their specificity.
Neuroendocrinology 40:471475[Medline]
-
Windle JJ, Weiner RI, Mellon PL 1990 Cell lines of
the pituitary gonadotrope lineage derived by targeted oncogenesis in
transgenic mice. Mol Endocrinol 4:597603[Abstract/Free Full Text]
-
Turgeon JL, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation
of luteinizing hormone and GnRH receptor in a novel gonadotrope cell
line. Mol Endocrinol 10:439450[Abstract/Free Full Text]
-
Esnard A, Esnard F, Faucher D, Gauthier F 1988 Two
rat homologues of human cystatin C. FEBS Lett 236:475478[CrossRef][Medline]
-
Esnard A, Esnard F, Guillou F, Gauthier F 1992 Production of the cysteine proteinase inhibitor cystatin C by rat
Sertoli cells. FEBS Lett 300:131135[CrossRef][Medline]
-
Tsurta JK, OBrien DA, Griswold MD 1993 Sertoli
cell and germ cell cystatin C: stage-dependent expression of two
distinct messenger ribonucleic acid transcripts in rat testes. Biol
Reprod 49:10451054[Abstract]
-
Kozak M 1989 The scanning model for translation: an
update. J Biol Chem 108:229241
-
Abrahamson M, Mason RW, Hansson H, Buttle DJ, Grubb A,
Ohlsson K 1991 Human cystatin C: role of the N-terminal segment in
the inhibition of human cysteine proteinases and in its inactivation by
leukocyte elastase. Biochem J 273:621626
-
Naik SI, Young LS, Charlton HM, Clayton RN 1984 Pituitary gonadotropin-releasing hormone receptor
regulation in mice I: males. Endocrinology 115:106113[Abstract/Free Full Text]
-
Naik SI, Young LS, Charlton HM, Clayton RN 1984 Pituitary gonadotropin-releasing hormone receptor regulation in mice
II: females. Endocrinology 115:114120[Abstract/Free Full Text]
-
Saade G, London DR, Lalloz MRA, Clayton RN 1989 Regulation of LH subunit and prolactin mRNA by gonadal hormones in
mice. J Mol Endocrinol 2:213224[Abstract/Free Full Text]
-
Clayton RN, Catt KJ 1981 Regulation of
pituitary gonadotropin releasing hormone receptors by gonadal hormones.
Endocrinology 108:887895[Abstract/Free Full Text]
-
McNeilly JR, Brown P, Mullins J, Clark AJ, McNeilly
AS 1996 Characterization of the ovine LHß-subunit gene: the
promoter is regulated by GnRH and gonadal steroids in transgenic mice.
J Endocrinol 151:481489[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
H. G. Sutton-Walsh, S. Whelly, and G. A. Cornwall
Differential Effects of GnRH and Androgens on Cres mRNA and Protein in Male Mouse Anterior Pituitary Gonadotropes
J Androl,
November 1, 2006;
27(6):
802 - 815.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, C. A. Putnam-Lawson, H. Knapp-Hoch, P. J. Friel, D. Mitchell, R. Hively, and M. D. Griswold
Immunolocalization and Regulation of Cystatin 12 in Mouse Testis and Epididymis
Biol Reprod,
November 1, 2005;
73(5):
872 - 880.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Tohonen, J. Frygelius, M. Mohammadieh, U. Kvist, L. J. Pelliniemi, K. O'Brien, K. Nordqvist, and A. Wedell
Normal Sexual Development and Fertility in testatin Knockout Mice
Mol. Cell. Biol.,
June 15, 2005;
25(12):
4892 - 4902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hsia, J. P. Brousal, S. R. Hann, and G. A. Cornwall
Recapitulation of Germ Cell- and Pituitary-Specific Expression With 1.6 kb of the Cystatin-Related Epididymal Spermatogenic (Cres) Gene Promoter in Transgenic Mice
J Androl,
March 1, 2005;
26(2):
249 - 257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Kirby, L. Yang, J. C. Labus, R. J. Lye, N. Hsia, R. Day, G. A. Cornwall, and B. T. Hinton
Characterization of Epididymal Epithelial Cell-Specific Gene Promoters by In Vivo Electroporation
Biol Reprod,
August 1, 2004;
71(2):
613 - 619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, P. J. Friel, D. J. McLean, and M. D. Griswold
Cystatin E1 and E2, New Members of Male Reproductive Tract Subgroup Within Cystatin Type 2 Family
Biol Reprod,
August 1, 2003;
69(2):
489 - 500.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. A. Cornwall, A. Cameron, I. Lindberg, D. M. Hardy, N. Cormier, and N. Hsia
The Cystatin-Related Epididymal Spermatogenic Protein Inhibits the Serine Protease Prohormone Convertase 2
Endocrinology,
March 1, 2003;
144(3):
901 - 908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hsia and G. A. Cornwall
Cres2 and Cres3: New Members of the Cystatin-Related Epididymal Spermatogenic Subgroup of Family 2 Cystatins
Endocrinology,
March 1, 2003;
144(3):
909 - 915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Rao, C. M. Wayne, and M. F. Wilkinson
Pem Homeobox Gene Regulatory Sequences That Direct Androgen-dependent Developmentally Regulated Gene Expression in Different Subregions of the Epididymis
J. Biol. Chem.,
December 6, 2002;
277(50):
48771 - 48778.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, P. J. Friel, M. O. Robinson, D. J. McLean, and M. D. Griswold
Identification and Characterization of Testis- and Epididymis-Specific Genes: Cystatin SC and Cystatin TE-1
Biol Reprod,
December 1, 2002;
67(6):
1872 - 1880.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wassler, P. Syntin, H.G. Sutton-Walsh, N. Hsia, D. M. Hardy, and G. A. Cornwall
Identification and Characterization of Cystatin-Related Epididymal Spermatogenic Protein in Human Spermatozoa: Localization in the Equatorial Segment
Biol Reprod,
September 1, 2002;
67(3):
795 - 803.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. G. Hamil, Q. Liu, P. Sivashanmugam, S. Yenugu, R. Soundararajan, G. Grossman, R. T. Richardson, Y.-L. Zhang, M. G. O'Rand, P. Petrusz, et al.
Cystatin 11: A New Member of the Cystatin Type 2 Family
Endocrinology,
July 1, 2002;
143(7):
2787 - 2796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hsia and G. A. Cornwall
CCAAT/Enhancer Binding Protein {beta} Regulates Expression of the Cystatin-Related Epididymal Spermatogenic (Cres) Gene
Biol Reprod,
November 1, 2001;
65(5):
1452 - 1461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. P. Walsh and D. M. Stocco
Effects of Lindane on Steroidogenesis and Steroidogenic Acute Regulatory Protein Expression
Biol Reprod,
April 1, 2000;
63(4):
1024 - 1033.
[Abstract]
[Full Text]
|
 |
|