| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Isoforms during Ontogeny of the Pituitary Gland1
Institut Alfred Fessard, UPR2212, Centre National de la Recherche Scientifique, 91198 Gif-sur-Yvette-Cedex, France
Address all correspondence and requests for reprints to: Dr. Catherine Pasqualini or Dr. Philippe Vernier, Institut Alfred Fessard, UPR2212, Centre National de la Recherche Scientifique, avenue de la Terrasse, 91198 Gif-sur-Yvette-Cedex, France. E-mail: Catherine.Pasqualini{at}iaf.cnrs-gif.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(ER) was
analyzed by RT-PCR in fetal and newborn rat pituitaries. In addition to
the classical ER messenger RNA (mRNA), three shorter transcripts
were detected and subsequently cloned. Sequence analysis showed that
they corresponded to ER mRNAs lacking exon 3 (which encodes a zinc
finger in the DNA-binding domain), exon 4 (which encodes the nuclear
localization signal and part of the steroid-binding domain), or both
exons 3 and 4. As analyzed by RT-PCR and ribonuclease protection assay,
the respective expression levels of the different transcripts varied
dramatically during pituitary development; short forms appeared 4 days
before full-length ER mRNA. On Western blots from rat pituitaries of
different ages, an ER-specific antiserum labeled four protein bands
of the expected molecular weights, revealing that all four ER mRNAs
are translated in vivo. Immunocytochemistry, using the
same antiserum, showed the ER to be present first in the cytosol of
intermediate lobe cells (around embryonic day 16). Only 5 days later,
nuclear staining became detectable in the anterior lobe. We argue that
the observed cytosolic staining will be essentially due to short ER
isoforms, which are indeed more abundantly expressed in the
intermediate lobe. These data suggest that during pituitary
development, the activity of the ER might be specifically regulated
by differential splicing of its primary transcript, resulting in a
differential subcellular localization of the isoforms. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The mechanisms underlying these diverse functions of estrogens are not
fully understood. In general, these hormones act through binding to the
nuclear estrogen receptors (ERs), ligand-activated transcription
factors of the steroid receptor family. These proteins share a common
structural and functional organization with distinct domains, including
two transcriptional activation regions (the N-terminal AF-1 and the
C-terminal, ligand-dependent AF-2), a DNA-binding domain composed of
two zinc fingers, dimerization regions, and several nuclear
localization signals (13, 14, 15). ERs bind as dimers to highly conserved
DNA sequences known as estrogen response elements present in the
regulatory regions of target genes. Like many other ligand-activated
transcriptional regulators, the rat ERs exist as two subtypes, ER
and ERß, encoded by two different genes (16). Their protein sequences
demonstrate considerable similarity in the DNA-binding domain (>95%
amino acid identity) and in part of the ligand-binding domain (55%
amino acid identity), but they differ considerably in their N-terminal
A/B domains and trans-activation region AF-1 (16, 17). In
the pituitary gland, ERs have been identified in 60–70% of cells
within the anterior lobe (18, 19, 20), and they are also expressed in the
intermediate lobe (21, 22). In the rat, although both ER subtypes are
found (17, 23, 24), the expression of ER is predominant in this
gland (17, 24).
Further molecular diversity in the ER system is provided by alternative
splicing of the ER premessenger RNA (pre-mRNA), which yields several
variant transcripts where single or multiple exons are skipped. These
ER variant transcripts were first isolated in breast cancer tissues
and cell lines (25, 26); they have been proposed to be a characteristic
of breast cancer and to explain the resistance of certain tumors to
antiestrogen therapy as well as estrogen-independent tumor growth.
Although they do not give rise to variant proteins in vivo,
their putative effect on estrogen-responsive genes has been
investigated by transient transfection studies, and some variant
transcripts such as those missing exon 5 were indeed shown to behave as
constitutively active forms of the ER (27, 28), whereas those missing
exon 3 were shown to act as dominant-negative forms of the ER (25).
Conversely, the isoforms lacking exon 2 or exon 7 (25) seem to have no
influence on transcription activity. Actually, isoforms of ER mRNA
are not characteristic of tumors, because they are also found in normal
tissue samples. Transcripts lacking either both exons 3 and 4 or exon 4
alone have been detected in bone tissue (29); the latter was also
detected in brain (30). However, none of these isoforms was shown to be
translated in vivo, and their function remains totally
unknown. The only convincing evidence of ER variant protein
expression has been provided by Friend et al. in adult rat
pituitary (31, 32), although its role remains elusive.
The developmental time course of the ER system has been extensively
studied in rodent brain in general (33, 34, 35, 36, 37, 38), but little is known about
the ontogeny of ER expression in the mammalian pituitary. In fact,
the only data available on the prenatal appearance of
estrogen-concentrating cells concern mice (38).
In this report, we have reexamined the developmental time course of
ER expression in the pituitary gland of male and female rats. In
addition to full-length receptor transcript, three splice variants of
the ER mRNA were shown to be present in this gland. At early stages
in development, the corresponding protein isoforms are expressed more
abundantly than the full-length receptor; moreover, they differ in
subcellular distribution.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For histological studies, embryos were fixed by immersion in 4% paraformaldehyde in 0.1 M PBS (pH 7.2), whereas 5-day-old (P5) rats were perfused intracardially with the same fixative.
RNA extraction, complementary DNA (cDNA) synthesis, and PCR
analysis of total pituitary RNA
Total RNA was analyzed by electrophoresis in denaturing
conditions before use. The isoforms of ER mRNA were analyzed by a
semiquantitative RT-PCR procedure and ribonuclease (RNase) protection
assays. Briefly, RNA samples were reverse transcribed with Superscript
(BRL) primed by a mix of oligo(deoxythymidine) and random nonamers
according to the manufacturer’s protocol. Oligonucleotides located
upstream (sense oligo, GTCTGGTCCTGTGAAGGCTGCA) and downstream
(antisense oligo, TGACGTAGCCAGCAACATGTCAAAG) of the spliced exons of
the ER mRNA were 32P labeled by phosphorylation with
polynucleotide kinase and used as primers for Taq polymerase
(Promega Corp.). Twenty-seven, 32, or 37 amplification
cycles were performed. The radioactive PCR products were quantified by
separating the DNA fragments on a 10% acrylamide gel and directly
measuring the radioactivity on the dried gel with a PhosphorImager
(Molecular Dynamics, Inc., Sunnyvale, CA). The PCR
reaction was optimized and carefully checked over a large range of
cycle numbers (no. 15–45) with different amounts of cDNA. It was shown
to be linear for up to 40 cycles.
Cloning and sequencing of the amplification products
For sequencing and identification of the transcripts revealed in
the PCR experiments described above, additional amplifications of
reverse transcribed RNA extracted from pituitary samples were performed
with high fidelity Pfu polymerase (Stratagene,
La Jolla, CA). The corresponding DNA fragments were directly cloned in
the pCRII vector by the TA cloning method (Invitrogen, San
Diego, CA) and sequenced by the dideoxynucleotide termination method
using Taq polymerase (Amersham, Arlington
Heights, IL). Sequences were handled and analyzed with the Genetic
Computer Group package (8.0) running on a Microvax computer
(Digital).
RNase protection assay
The plasmid was linearized with either ClaI or
BamHI and used as a template for SP6 or T7 RNA polymerase to
generate radiolabeled antisense and sense riboprobes, respectively.
Thus, the linearized fragments were incubated with
[32P]UTP (Amersham) with the transcription
kit (Stratagene) according to the manufacturer’s
protocol. The full-length ER antisense riboprobe was 565 nucleotides
(nt) in length and corresponded to 9 nt from the vector arm, followed
by 556 nt protecting exons 2, 3, 4, and 5 of the ER gene. The
E3–4 antisense riboprobe was 113 nucleotides in length and
corresponded to 10 nt from the vector arm, followed by 103 nt covering
the exon 2-exon 5 junction. The 9- and 10-nt long sequences transcribed
from the vector were thus not protected from RNase degradation.
The radiolabeled transcripts were purified using P10 columns, and aliquots of the labeled probes were analyzed on denaturing polyacrylamide gel. Aliquots of the labeled probes were hybridized to 7 µg total pituitary RNA for 10 h at 50 C. The samples were then digested with 50 µg/ml RNase A and 5 µg/ml RNase T1 at 30 C for 60 min. The specifically protected RNA fragments were separated on a 5% denaturing polyacrylamide-urea gel alongside the sequencing ladder and free probes (5 x 104 cpm) and were visualized by autoradiography.
Immunoblots
After treatment of Rathke’s pouches or pituitaries with Trizol
reagent, total protein was recovered from the organic phase by
isopropanol precipitation (Fig. 5
) or samples were directly prepared
from dissected pituitary lobes (Fig. 9). Samples were boiled for 2 min
in SDS buffer and subjected to PAGE on a microscale (39). Western blots
were reacted with a polyclonal rabbit antibody specifically directed
against the carboxyl-terminus of the mouse ER, which does not
cross-react with ERß or other steroid receptors (1:1000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), followed by the
appropriate horseradish peroxidase (HRP)-coupled secondary antibody
(The Jackson Laboratory, Bar Harbor, ME) and
chemiluminescence detection (Pierce Chemical Co.,
Rockford, IL) or by an alkaline phosphatase-coupled antibody (The Jackson Laboratory) and
5-bromo-4-chloro-3-indolylphosphate (p-toluidine salt)/nitro
blue tetrazolium revelation. Total protein staining with colloidal gold
(AuroDye, Amersham) was used to make sure that equal
amounts of protein were loaded into each lane.
|
|
Cells were transfected with 10 µg expression vector pCDNA3 containing
the different isoforms of ER using a Bio-Rad electroporator
(Bio-Rad Laboratories, Inc., Richmond, CA) and plated for
48 h. They were then harvested, washed twice in PBS, and gently
lysed, and the cell extracts were subjected to SDS-PAGE. Corresponding
Western blots were reacted with the ER-specific antiserum described
above, followed by the appropriate HRP-coupled secondary antibody (The
Jackson Laboratory) and chemiluminescence detection
(Pierce Chemical Co.).
Immunocytochemical studies
Briefly, fixed tissue blocks were cut into 10- or 20-µm thick
sections in a cryostat kept at -20 C. Sections were then subjected to
the following protocol with three 5-min washes (0.1 M PBS)
between steps: 1) 5% normal goat serum in PBS for 2 h, 2) the
anti-ER-specific antiserum described above (1:500; Santa Cruz Biotechnology, Inc.) in PBS containing 2% normal goat serum for
48 h at 4 C, and 3) as secondary antibodies either HRP-coupled or
fluorescein-conjugated antirabbit antibodies for 2 h. The
peroxidase was revealed by enzymatic reaction using
3,3'-diaminobenzidine-HCl (DAB; Sigma Chemical Co., St.
Louis, MO) as chromogen and H2O2 in 0.05
M Tris buffer for 10–30 min at room temperature.
Statistical analysis
To analyze the time course of expression of the different ER
transcripts during pituitary ontogeny (Fig. 3), one-way ANOVA was used,
which allowed us to conclude that, except for the E3–4 isoform, the
variability between group means was significantly larger than the
average variability within the groups and, thus, that there were
significant differences among the values of the groups. Then an
unpaired t test was used to determine which of these
differences was significant.
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
cDNA from embryonic pituitary
reveals the presence of alternatively spliced receptor variants gene expression in the rat
pituitary gland during ontogeny, we applied a semiquantitative RT-PCR
procedure with a few sets of specific oligonucleotide primers. As
expected, the use of oligonucleotides encompassing the region from
exons 2–6 of the ER sequence revealed the presence of full-length
ER mRNA (695 bp). In addition, however, three other amplification
products of 578, 359, and 242 bp, respectively, were found in
considerable amounts a few days before the full-length ER mRNA could
be detected (Fig. 1). The corresponding
fragments were subsequently cloned and sequenced and were shown to
represent ER mRNA isoforms. The first one lacked exon 3 (which
encodes the second zinc finger of the DNA-binding domain), the second
one lacked exon 4 (which encodes the nuclear localization signal and
part of the steroid-binding domain), and the third one lacked both
exons 3 and 4 (Fig. 2). Interestingly,
the three exon-skipping isoforms (hereafter, referred to as E3,
E4, and E3–4 according to the nomenclature for splicing
variants) (26), retained the same reading frame as the full-length
transcript, indicating that the alternatively spliced mRNAs might be
translated into active proteins (see below). To gain more information
about the expression of these ER isoforms during pituitary ontogeny,
the time course of appearance of both transcripts and proteins was
determined.
|
|
transcripts during
pituitary ontogeny-specific primers showed that the presence and the
respective expression levels of the four transcripts varied with the
stage of pituitary development (Fig. 3
).
On E12–E13, the earliest stages studied, the signals for E4 and
E3–4 mRNAs were already strong, whereas no specific signal was
detectable for full-length ER mRNA or for E3 mRNA. Weak signals
for E3 and full-length ER mRNAs were first observed on E15 and
E16, respectively. At this stage, the signals for E4 and E3–4
were still predominant. The expression of full-length ER mRNA began to
increase dramatically from E19 to become highly predominant after
birth, a situation that will persist throughout the lifetime of the
animal. In adult pituitary, the same ER variant mRNAs were also
found, although they represent only minor amounts of transcripts
(Guivarc’h, D., unpublished observation). The signal for E3 mRNA
increased markedly on E19–E20, then underwent a transient decline, and
on P7–P10 was again comparable to the E20 signal. The signal for E4
was constantly strong from E12–E20 and started to decrease just before
birth (on P0 this decrease became statistically significant,
P < 0.05, P0 vs. E20 values), whereas that
for E3–4 remained more or less constant over the period studied. It
should be mentioned that in these first experiments, no particular
attention was paid to the sex of the animal studied.
To further quantify the relative levels of the ER mRNA variants
detected by RT-PCR, we also used RNase protection assays with two
different antisense riboprobes. As shown in Fig. 4, this analysis confirmed the presence
of significant levels of all four transcripts. When total RNA of
embryonic or neonatal pituitaries was analyzed with a probe
corresponding to the full-length ER sequence (565 nt), three protected
fragments (556, 390, and 166 nt) were specifically detected,
corresponding to full-length, E3, and E4 transcripts,
respectively.
|
E3–4 sequence (113
nt), three protected fragments (103, 54, and 49 nt) were revealed,
among which the 103-nt fragment corresponded to the E3–4
transcript, as expected on the basis of the RT-PCR results.
Changes in the expression of the different ER proteins during
ontogeny of the pituitary gland
Western blots performed on rat pituitary from different ages (Fig. 5) demonstrated that the four transcripts
described above are all translated in vivo. Indeed, a
specific antiserum directed against the carboxyl-terminus of the ER
protein stained four protein bands, the molecular masses of which were
in agreement with the size of the observed transcripts: 67, 61.8, 53,
and 45 kDa, respectively, for full-length, E3, E4, and E3–4
ER. The same antiserum also recognized the corresponding proteins
expressed by COS-7 cells that had been transfected with the cDNAs of
the four different transcripts (Fig. 6).
Interestingly, the pattern of appearance of the various ER protein
isoforms during development (Fig. 5) agreed well with that of the
mRNAs. In particular, the shortest protein isoforms, E4 and
E3–4, were expressed significantly before the full-length ER, as
were their encoding transcripts. E4 protein expression decreased
sharply after birth, whereas E3–4 protein was rather constantly
observed at a low level throughout the period studied. The E3
protein was abundant from E18 up to E20, decreased sharply at birth,
and was observed again from P10, whereas the full-length ER protein
was detected from E20 and then increased regularly with time.
|
-specific antiserum was also used to analyze by
immunocytochemistry the expression of ER protein on fixed sections
of pituitary. An ER immunolabeling was first detected in the
intermediate lobe on E16 (Fig. 7), where
it then increased constantly at least until P5. In contrast, in the
anterior lobe, the ER signal was barely detectable before birth, but
increased rapidly thereafter. Thus, comparison of the expression
pattern of ER proteins on Western blots with the immunocytochemical
data suggested that the expression pattern of individual ER isoforms
may correspond to differential expression in different parts of the
pituitary gland.
|
isoforms was analyzed in detail in
the different areas of the pituitary gland during ontogeny.
Immunohistochemical studies showed that a weak, but specific, ER
immunostaining was first recognized exclusively in the cytoplasm of
cells in the intermediate pituitary at E16 (Fig. 7a), that is before
the expression of the full-length receptor was detectable on Western
blots (cf. Fig. 5). The onset of nuclear immunostaining in
the anterior lobe of the pituitary was clearly perinatal (Fig. 7c). The
same temporal and tissular patterns of expression were observed with
both DAB-peroxidase and fluorescence labeling techniques (Fig. 8). It should be mentioned that the
neural lobe remained essentially unlabeled in all of our experiments;
the weak fluorescence observed in this lobe was nonspecific, as it was
found even in control sections reacted in the absence of primary
antibody.
|
immunoreactivity on pituitary sections from
5-day-old (P5) rats (Fig. 8, a and b). The ER-specific staining was
mainly found in nuclei in the anterior lobe cells, although a light
staining was also observed in the cytoplasm (Fig. 8c). In contrast, in
intermediate lobe cells, ER-specific staining was obviously not
nuclear but, instead, was spread all over the cell cytoplasm (Fig. 8d).
In addition, Western blots of extracts from carefully isolated
pituitary lobes of newborn rats from P0–P5 (Fig. 9) showed that on P5 the expression of
E3 and E4 was basically confined to the intermediate pituitary
lobe. Moreover, this Western blot analysis also demonstrated that,
during the critical period of hormone influence on central nervous
system development, the expression patterns of the E3 and E4
isoforms differed between male and female rats in the intermediate lobe
(Fig. 9); the E3 isoform predominated in males up to postnatal day
5, whereas in females, E4 was more intensely expressed. In contrast,
in the anterior pituitary, no striking difference was noticed between
males and females on either Western blots or immunostained tissue
sections.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mRNA,
exhibiting in-frame deletions of exon 3, exon 4 or both, are the major
ER transcripts found at early stages of development in the rat
pituitary gland. Their expression precedes by more than 4 days the
appearance of full-length transcript. The three transcript isoforms are
expressed as proteins, with their relative expression levels varying
during pituitary ontogeny and also according to the sex of the animal.
These findings strongly suggest that these ER isoforms play a
physiologically relevant role before birth, for example as regulators
of estrogen-dependent transcription in the developing gland.
Considering the expression time course of the ER transcripts, the
full-length ER mRNA appeared on E16, whereas E4 and E3–4
transcripts were detected as early as E12, and E3 mRNA was found on
E15. These three short isoforms result from an exon-skipping mechanism
of the ER pre-mRNA. This process is obviously developmentally
regulated, suggesting the involvement of a specific splicing mechanism
during ontogeny. As the reading frame encoding the ER protein was
conserved for all three transcripts, the existence of translation
products of E3, E4, and E3–4 mRNAs was plausible. Indeed, the
use of an antiserum directed against the C-terminal end of the ER
allowed us to detect the corresponding proteins in the pituitaries of
embryonic and newborn rats. Moreover, the present study showed that, in
accordance with the corresponding transcripts, the expression of the
ER protein isoforms changes throughout ontogenetic development.
Whereas the three short proteins could already be observed on E16–E17,
the full-length receptor protein was detected only 1 day before birth.
This last result is consistent with that reported by McLusky et
al. (35), who showed that the development of the pituitary
estrogen system is essentially postnatal and that the rapid increase in
ER binding capacity takes place at the time of birth, thereafter
continuing for several days.
Our finding of an expression as proteins of the three transcript
isoforms contrasts with most previous data about numerous ER splice
variants (E2, E3, E4, E5, E4–7, E3–5, and E5–7
mRNAs) that have been reported in neoplastic tissue samples (26) and
even in some normal adult tissues. Neither the E4 and E3–4 mRNAs
found in normal rat bone tissues by Hoshino et al.
(29) nor the E4 mRNA found in the rat brain by Skipper
et al. (30) were shown to give rise to proteins
in vivo. To our knowledge the only tissue in which some ER
protein isoforms have been convincingly demonstrated is the adult rat
pituitary (31, 32).
As these protein isoforms are lacking specific domains of the ER,
some functional correlates can be predicted. The E3 protein harbors
a deletion of exon 3 encoding the second zinc finger of the DNA-binding
domain. As anticipated, it was shown to be unable to bind to a
canonical estrogen response element (25). Nevertheless, in the MCF-7
breast cancer cell line, E3 inhibits the activation of
estrogen-dependent transcription in a dominant negative fashion when
cotransfected with the full-length ER. Moreover, it has recently been
shown that the amount of this E3 transcript is dramatically reduced
in primary breast cancers and cancer cell lines, whereas transfection
of E3 into MCF-7 cells leads to a suppression of the transformed
phenotype (41). Taken together, these data support the idea that E3
expression in normal tissue may provide a means of decreasing or
blocking estrogen responsiveness. Although developing tissues are
functionally protected from the potentially deleterious effects of
maternal estrogens by -fetoprotein, a plasma estrogen-binding
protein (36), the early expression of E3 that antagonizes
full-length ER could represent an additional protection mechanism.
Interestingly, the demonstration of the existence in vivo of
such an amino-terminally truncated isoform that is able to bind E2 but
is unable to modulate transcription in the absence of the full-length
ER could account for the residual estrogen-binding activity without
estrogen responsiveness found in the uterus (42) or the brain (43) of
ER knockout mice. In these mutants, the gene disruption consisted of
the insertion of a selection gene sequence into the ER exon 2.
Examples are known of exons being "spliced over" when a nonsense
codon is introduced into an exon (44) or when neomycin resistance
sequences have been targeted to an exon (45). Thus, the expression of a
to some degree functional protein cannot be excluded.
The E4 isoform bears a deletion of exon 4, which codes for amino
acids 255–366, corresponding mainly to the hinge region containing one
nuclear localization signal, and to the first 48 amino acids of the
ligand-binding domain. The characteristics of E4, which is a highly
expressed transcript in tumors, suggested to some researchers that it
may play a role as an estrogen-independent transcription factor,
because its DNA-binding domain is intact (30). Lacking a part of the
steroid-binding domain, E4 must be less sensitive to estrogens. The
relative independence of E4 from hormone may allow for some
intrinsic ER activity in the developing brain regardless of the
circulating estrogen levels. Waterman et al. (46) showed
that a truncation of the ER molecule immediately carboxyl-terminal to
the DNA-binding domain, as is the case for E4, results in a
constitutive activation of the receptor. In contrast, Koehorst et
al. (47) reported the absence of heterodimer formation, of DNA
binding and trans-activation by this receptor isoform, as
analyzed by transient transfections in embryonic carcinoma P19EC and in
human choriocarcinoma JEG3 cells. However, in none of the tumor samples
that have been studied, has the corresponding E4 variant protein
ever been found, showing that in those tissues this variant mRNA is not
translated. In contrast, in the present study, we showed that the E4
transcript is translated in vivo in the pituitary during
prenatal life, and that the resulting protein is present at least until
birth. Further studies will show whether this protein indeed retains
some activity as a transcription factor or as a modulator of
full-length ER.
E3–4, which exhibits deletion of both exons 3 and 4, is detected at
early stages in pituitary development as well as in the adult. The
corresponding protein is always observed in the two lobes of the fetal
and newborn pituitary, but no clue as to its physiological role has yet
been obtained.
The fact that pituitary E3 expression levels appear to be sex
dependent during development may be physiologically relevant, although
until now, the pituitary was believed to exhibit no clear sign of
sexual differentiation. Thus, E3 appears to be predominantly
expressed in the intermediate lobe of the pituitary and more abundantly
in male rats than in females, as shown by Western blots from isolated
pituitary lobes. The presence of short forms of ER in the
intermediate lobe is consistent with previous data obtained by Bonsall
et al. (48), who showed the existence of
[3H]estradiol-concentrating cells by autoradiography in
the monkey intermediate lobe, and by Pelletier et al. (21),
who observed a strong labeling of the intermediate lobe of the rat
pituitary by in situ hybridization using an oligonucleotide
probe complementary to sequence 1–24 of the ER mRNA. The
physiological importance of estrogen in the regulation of cell
functions in pars intermedia remains ill defined. However, it is known
that in the adult female rat, estradiol stimulates intermediate
lobe cells to release MSH, which, in turn, can act on
adenohypophysial cells to recruit additional PRL secretors into the
secretory pool (49). Moreover, it should be stressed that the
expression at a relatively late stage of development of the full-length
ER transcript and protein parallels the acquisition of CRF
responsiveness by melanotrophs (50), the increase in voltage-dependent
calcium channels (51), and furthermore, the change in the respective
amounts of the two splice isoforms of the D2 dopamine
receptor (52). This may be interestingly correlated with our recent
demonstration of the key role of ERs in the regulation of the D2
receptor splicing event (10, 11). The expression levels of the E3
isoform, which is predominant in the intermediate lobe and particularly
in male pituitaries, and that of E4, whose signal is more intense in
females, decrease during the so-called critical period. This period, in
which administration of estrogens or androgens can permanently alter
sexual differentiation (53, 54), begins during fetal development and
extends through the first week of postnatal life. Thus, it is tempting
to speculate that in male rats, the E3 isoform could protect cells
of the intermediate lobe from high levels of maternal estrogens,
whereas in females, E4 could represent a form of ER that functions
independently of the circulating estrogen levels.
The subcellular localization of the short isoforms presented here is
consistent with the fact that either their DNA-binding domain or their
nuclear localization signal is missing or disrupted; all three
truncated proteins appear to be mainly nonnuclear, in contrast to
full-length ER. Although the relative detection limits for
individual isoforms may be different for Western blots and
immunocytochemistry, a comparison of Western blot with
immunocytochemical data on E17–E19 strongly suggests that the ER
immunostaining observed in the cytoplasm of the intermediate lobe
corresponded principally to some short ER isoforms. Postnatally, a
weak cytoplasmic immunostaining is also observed in the anterior lobe
and may account for the low level of isoform expression in this tissue.
The existence of cytoplasmic ER isoforms is also consistent with the
results reported by Blaustein (55), who used three antibodies directed
against diverse epitopes on the ER protein. This work showed that in
most rat brain areas if the highest density of reaction product was
indeed located in cell nuclei, an extensive cytoplasmic immunostaining
also existed.
In summary, we show for the first time the existence in fetal and
newborn rat pituitaries of three protein isoforms of the ER that are
differentially expressed during ontogenetic development and
differentially localized in the gland. Thus, the primary transcript of
ER normally undergoes splicing regulation, which leads to the
expression of full-length plus several variant transcripts. Further
studies are now needed to determine whether the truncated proteins
could act as dominant negative or positive transcription factors to
modulate the expression of ER target genes, either by forming
heterodimers with full-length receptors or by competing for another
limiting transcription factor. Depending on the relative abundance of
these variant receptors, the pituitary cells may display different
degrees of estrogen responsiveness. These findings may contribute to
our understanding of the mechanisms underlying the developmental
actions of estrogens in the pituitary and probably also in the brain as
well as of some unexplained results obtained in ER gene-disrupted
animals.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received September 22, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ß. Endocrinology 138:863–870 and
ß in the rat pituitary gland. Endocrinology 139:3976–3983
3) in
breast cancer and the consequences of its reexpression: interference
with estrogen-stimulated properties of malignant transformation. Mol
Endocrinol 11:2004–2015 disrupted mice. Proc Natl Acad Sci USA 94:11008–11012 deficiency results in hair follicle and eye
abnormalities in targeted and waved-1 mice. Cell 73:263–278[CrossRef][Medline]
-Melanocyte-stimulating hormone is a mammotrophic factor released by
neurointermediate lobe cells after estrogen treatment. Endocrinology 130:133–138This article has been cited by other articles:
 |
|
 |
|
  R. Shao, E. Egecioglu, B. Weijdegard, J. J. Kopchick, J. Fernandez-Rodriguez, N. Andersson, and H. Billig Dynamic regulation of estrogen receptor-{alpha} isoform expression in the mouse fallopian tube: mechanistic insight into estrogen-dependent production and secretion of insulin-like growth factors Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1430 - E1442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Shao, B. Weijdegard, J. Fernandez-Rodriguez, E. Egecioglu, C. Zhu, N. Andersson, A. Thurin-Kjellberg, C. Bergh, and H. Billig Ciliated epithelial-specific and regional-specific expression and regulation of the estrogen receptor-beta2 in the fallopian tubes of immature rats: a possible mechanism for estrogen-mediated transport process in vivo Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E147 - E158. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Lin Chang, J. Roh, J.-I. Park, C. Klein, N. Cushman, R. V. Haberberger, and S. Y. T. Hsu Intermedin Functions as a Pituitary Paracrine Factor Regulating Prolactin Release Mol. Endocrinol., November 1, 2005; 19(11): 2824 - 2838. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Varayoud, J G Ramos, L Monje, V Bosquiazzo, M Munoz-de-Toro, and E H Luque The estrogen receptor {alpha} {Sigma}3 mRNA splicing variant is differentially regulated by estrogen and progesterone in the rat uterus J. Endocrinol., July 1, 2005; 186(1): 51 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Balaguer, R. A. Pershing, C. Rodriguez-Sallaberry, W. W. Thatcher, and L. Badinga Effects of Bovine Somatotropin on Uterine Genes Related to the Prostaglandin Cascade in Lactating Dairy Cows J Dairy Sci, February 1, 2005; 88(2): 543 - 552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Rodriguez-Cuenca, M. Monjo, A. M. Proenza, and P. Roca Depot differences in steroid receptor expression in adipose tissue: possible role of the local steroid milieu Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E200 - E207. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. Schreihofer, D. F. Rowe, E. F. Rissman, E. M. Scordalakes, J.-a. Gustafsson, and M. A. Shupnik Estrogen Receptor-{alpha} (ER{alpha}), But Not ER{beta}, Modulates Estrogen Stimulation of the ER{alpha}-Truncated Variant, TERP-1 Endocrinology, November 1, 2002; 143(11): 4196 - 4202. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Menuet, I. Anglade, G. Flouriot, F. Pakdel, and O. Kah Tissue-Specific Expression of Two Structurally Different Estrogen Receptor Alpha Isoforms along the Female Reproductive Axis of an Oviparous Species, the Rainbow Trout Biol Reprod, November 1, 2001; 65(5): 1548 - 1557. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Griffin, G. Flouriot, P. Sharp, G. Greene, and F. Gannon Distribution Analysis of the Two Chicken Estrogen Receptor-Alpha Isoforms and Their Transcripts in the Hypothalamus and Anterior Pituitary Gland Biol Reprod, October 1, 2001; 65(4): 1156 - 1163. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Pasqualini, D. Guivarc'h, J.-V. Barnier, B. Guibert, J.-D. Vincent, and P. Vernier Differential Subcellular Distribution and Transcriptional Activity of {{Sigma}}E3, {{Sigma}}E4, and {{Sigma}}E3-4 Isoforms of the Rat Estrogen Receptor-{{alpha}} Mol. Endocrinol., June 1, 2001; 15(6): 894 - 908. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Nishihara, Y. Nagayama, S. Inoue, H. Hiroi, M. Muramatsu, S. Yamashita, and T. Koji Ontogenetic Changes in the Expression of Estrogen Receptor {alpha} and {beta} in Rat Pituitary Gland Detected by Immunohistochemistry Endocrinology, February 1, 2000; 141(2): 615 - 620. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. J. van Dijk, A. A. M. Hart, and L. J. v.'t Veer Differences in Estrogen Receptor {{alpha}} Variant Messenger RNAs between Normal Human Breast Tissue and Primary Breast Carcinomas Cancer Res., February 1, 2000; 60(3): 530 - 533. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
