help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pasqualini, C.
Right arrow Articles by Vernier, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pasqualini, C.
Right arrow Articles by Vernier, P.
Endocrinology Vol. 140, No. 6 2781-2789
Copyright © 1999 by The Endocrine Society

ARTICLES

Stage- and Region-Specific Expression of Estrogen Receptor {alpha} Isoforms during Ontogeny of the Pituitary Gland1

Catherine Pasqualini, Dominique Guivarc’h, Ysander v. Boxberg, Fatiha Nothias, Jean-Didier Vincent and Philippe Vernier

Institut Alfred Fessard, UPR2212, Centre National de la Recherche Scientifique, 91198 Gif-sur-Yvette-Cedex, France

Address all correspondence and requests for reprints to: Dr. Catherine Pasqualini or Dr. Philippe Vernier, Institut Alfred Fessard, UPR2212, Centre National de la Recherche Scientifique, avenue de la Terrasse, 91198 Gif-sur-Yvette-Cedex, France. E-mail: Catherine.Pasqualini{at}iaf.cnrs-gif.fr


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The expression time course of estrogen receptor {alpha} (ER{alpha}) was analyzed by RT-PCR in fetal and newborn rat pituitaries. In addition to the classical ER{alpha} messenger RNA (mRNA), three shorter transcripts were detected and subsequently cloned. Sequence analysis showed that they corresponded to ER{alpha} mRNAs lacking exon 3 (which encodes a zinc finger in the DNA-binding domain), exon 4 (which encodes the nuclear localization signal and part of the steroid-binding domain), or both exons 3 and 4. As analyzed by RT-PCR and ribonuclease protection assay, the respective expression levels of the different transcripts varied dramatically during pituitary development; short forms appeared 4 days before full-length ER{alpha} mRNA. On Western blots from rat pituitaries of different ages, an ER{alpha}-specific antiserum labeled four protein bands of the expected molecular weights, revealing that all four ER{alpha} mRNAs are translated in vivo. Immunocytochemistry, using the same antiserum, showed the ER{alpha} to be present first in the cytosol of intermediate lobe cells (around embryonic day 16). Only 5 days later, nuclear staining became detectable in the anterior lobe. We argue that the observed cytosolic staining will be essentially due to short ER{alpha} isoforms, which are indeed more abundantly expressed in the intermediate lobe. These data suggest that during pituitary development, the activity of the ER{alpha} might be specifically regulated by differential splicing of its primary transcript, resulting in a differential subcellular localization of the isoforms.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
ESTROGENS are hormonal regulators of gene expression in the adult mammalian anterior pituitary gland, where they may regulate multiple functions in a given cell type. For example, in differentiated lactotroph cells, these gonadal steroids increase PRL synthesis, storage, and release (1, 2, 3) and promote cell growth and proliferation (4, 5). In the same cell type, estrogens are also able to modulate the inhibitory effect of dopamine on PRL secretion (6), by regulating the number (7, 8) and the alternative splicing of dopamine D2 receptors (9, 10, 11). During ontogeny of the pituitary gland, the role of these steroid hormones is less clear. Although apparently not required for specification of pituitary phenotypes, estrogens play a critical role in PRL and gonadotropin gene transcription and are involved in lactotroph cell growth during the perinatal period (12).

The mechanisms underlying these diverse functions of estrogens are not fully understood. In general, these hormones act through binding to the nuclear estrogen receptors (ERs), ligand-activated transcription factors of the steroid receptor family. These proteins share a common structural and functional organization with distinct domains, including two transcriptional activation regions (the N-terminal AF-1 and the C-terminal, ligand-dependent AF-2), a DNA-binding domain composed of two zinc fingers, dimerization regions, and several nuclear localization signals (13, 14, 15). ERs bind as dimers to highly conserved DNA sequences known as estrogen response elements present in the regulatory regions of target genes. Like many other ligand-activated transcriptional regulators, the rat ERs exist as two subtypes, ER{alpha} and ERß, encoded by two different genes (16). Their protein sequences demonstrate considerable similarity in the DNA-binding domain (>95% amino acid identity) and in part of the ligand-binding domain (55% amino acid identity), but they differ considerably in their N-terminal A/B domains and trans-activation region AF-1 (16, 17). In the pituitary gland, ERs have been identified in 60–70% of cells within the anterior lobe (18, 19, 20), and they are also expressed in the intermediate lobe (21, 22). In the rat, although both ER subtypes are found (17, 23, 24), the expression of ER{alpha} is predominant in this gland (17, 24).

Further molecular diversity in the ER system is provided by alternative splicing of the ER{alpha} premessenger RNA (pre-mRNA), which yields several variant transcripts where single or multiple exons are skipped. These ER{alpha} variant transcripts were first isolated in breast cancer tissues and cell lines (25, 26); they have been proposed to be a characteristic of breast cancer and to explain the resistance of certain tumors to antiestrogen therapy as well as estrogen-independent tumor growth. Although they do not give rise to variant proteins in vivo, their putative effect on estrogen-responsive genes has been investigated by transient transfection studies, and some variant transcripts such as those missing exon 5 were indeed shown to behave as constitutively active forms of the ER (27, 28), whereas those missing exon 3 were shown to act as dominant-negative forms of the ER (25). Conversely, the isoforms lacking exon 2 or exon 7 (25) seem to have no influence on transcription activity. Actually, isoforms of ER{alpha} mRNA are not characteristic of tumors, because they are also found in normal tissue samples. Transcripts lacking either both exons 3 and 4 or exon 4 alone have been detected in bone tissue (29); the latter was also detected in brain (30). However, none of these isoforms was shown to be translated in vivo, and their function remains totally unknown. The only convincing evidence of ER{alpha} variant protein expression has been provided by Friend et al. in adult rat pituitary (31, 32), although its role remains elusive.

The developmental time course of the ER system has been extensively studied in rodent brain in general (33, 34, 35, 36, 37, 38), but little is known about the ontogeny of ER{alpha} expression in the mammalian pituitary. In fact, the only data available on the prenatal appearance of estrogen-concentrating cells concern mice (38).

In this report, we have reexamined the developmental time course of ER{alpha} expression in the pituitary gland of male and female rats. In addition to full-length receptor transcript, three splice variants of the ER{alpha} mRNA were shown to be present in this gland. At early stages in development, the corresponding protein isoforms are expressed more abundantly than the full-length receptor; moreover, they differ in subcellular distribution.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Timed pregnant female Wistar rats were obtained from Iffa Credo (L’Arbresle, France). Embryonic day 1 (E1) designates the day following a successful insemination; postnatal day 0 (P0) is the day of birth after a gestation of 21 days. Pregnant rats were decapitated after 12, 13, 15, 16, 17, 18, 19, 20, and 21 days of gestation, and the fetuses were rapidly removed. Postnatal rats before 21 days of age were obtained as litters of about 10 pups of both sexes with lactating females. Adult rats of 250 g were also used. In all cases, Rathke’s pouches and pituitaries were rapidly dissected out, immediately frozen, and stored at -80 C. They were then homogenized in Trizol reagent (Life Technologies, Grand Island, NY) to allow for the simultaneous isolation of total RNA and protein from the same sample according to the manufacturer’s protocol.

For histological studies, embryos were fixed by immersion in 4% paraformaldehyde in 0.1 M PBS (pH 7.2), whereas 5-day-old (P5) rats were perfused intracardially with the same fixative.

RNA extraction, complementary DNA (cDNA) synthesis, and PCR analysis of total pituitary RNA
Total RNA was analyzed by electrophoresis in denaturing conditions before use. The isoforms of ER mRNA were analyzed by a semiquantitative RT-PCR procedure and ribonuclease (RNase) protection assays. Briefly, RNA samples were reverse transcribed with Superscript (BRL) primed by a mix of oligo(deoxythymidine) and random nonamers according to the manufacturer’s protocol. Oligonucleotides located upstream (sense oligo, GTCTGGTCCTGTGAAGGCTGCA) and downstream (antisense oligo, TGACGTAGCCAGCAACATGTCAAAG) of the spliced exons of the ER mRNA were 32P labeled by phosphorylation with polynucleotide kinase and used as primers for Taq polymerase (Promega Corp.). Twenty-seven, 32, or 37 amplification cycles were performed. The radioactive PCR products were quantified by separating the DNA fragments on a 10% acrylamide gel and directly measuring the radioactivity on the dried gel with a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA). The PCR reaction was optimized and carefully checked over a large range of cycle numbers (no. 15–45) with different amounts of cDNA. It was shown to be linear for up to 40 cycles.

Cloning and sequencing of the amplification products
For sequencing and identification of the transcripts revealed in the PCR experiments described above, additional amplifications of reverse transcribed RNA extracted from pituitary samples were performed with high fidelity Pfu polymerase (Stratagene, La Jolla, CA). The corresponding DNA fragments were directly cloned in the pCRII vector by the TA cloning method (Invitrogen, San Diego, CA) and sequenced by the dideoxynucleotide termination method using Taq polymerase (Amersham, Arlington Heights, IL). Sequences were handled and analyzed with the Genetic Computer Group package (8.0) running on a Microvax computer (Digital).

RNase protection assay
The plasmid was linearized with either ClaI or BamHI and used as a template for SP6 or T7 RNA polymerase to generate radiolabeled antisense and sense riboprobes, respectively. Thus, the linearized fragments were incubated with [32P]UTP (Amersham) with the transcription kit (Stratagene) according to the manufacturer’s protocol. The full-length ER{alpha} antisense riboprobe was 565 nucleotides (nt) in length and corresponded to 9 nt from the vector arm, followed by 556 nt protecting exons 2, 3, 4, and 5 of the ER{alpha} gene. The {Sigma}E3–4 antisense riboprobe was 113 nucleotides in length and corresponded to 10 nt from the vector arm, followed by 103 nt covering the exon 2-exon 5 junction. The 9- and 10-nt long sequences transcribed from the vector were thus not protected from RNase degradation.

The radiolabeled transcripts were purified using P10 columns, and aliquots of the labeled probes were analyzed on denaturing polyacrylamide gel. Aliquots of the labeled probes were hybridized to 7 µg total pituitary RNA for 10 h at 50 C. The samples were then digested with 50 µg/ml RNase A and 5 µg/ml RNase T1 at 30 C for 60 min. The specifically protected RNA fragments were separated on a 5% denaturing polyacrylamide-urea gel alongside the sequencing ladder and free probes (5 x 104 cpm) and were visualized by autoradiography.

Immunoblots
After treatment of Rathke’s pouches or pituitaries with Trizol reagent, total protein was recovered from the organic phase by isopropanol precipitation (Fig. 5Go) or samples were directly prepared from dissected pituitary lobes (Fig. 9Go). Samples were boiled for 2 min in SDS buffer and subjected to PAGE on a microscale (39). Western blots were reacted with a polyclonal rabbit antibody specifically directed against the carboxyl-terminus of the mouse ER{alpha}, which does not cross-react with ERß or other steroid receptors (1:1000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), followed by the appropriate horseradish peroxidase (HRP)-coupled secondary antibody (The Jackson Laboratory, Bar Harbor, ME) and chemiluminescence detection (Pierce Chemical Co., Rockford, IL) or by an alkaline phosphatase-coupled antibody (The Jackson Laboratory) and 5-bromo-4-chloro-3-indolylphosphate (p-toluidine salt)/nitro blue tetrazolium revelation. Total protein staining with colloidal gold (AuroDye, Amersham) was used to make sure that equal amounts of protein were loaded into each lane.



View larger version (36K):
[in this window]
[in a new window]
  		Figure 5. Western blot analysis of homogenates from embryonic (E) and postnatal (P) pituitaries showing the different isoforms of ER{alpha} proteins during ontogeny, probed with an anti-ER{alpha} polyclonal antibody. Molecular masses are indicated in kilodaltons.

 


View larger version (26K):
[in this window]
[in a new window]
  		Figure 9. Western blot analysis of dissected [anterior (AL); on P0, P2, and P5) or neurointermediate (NIL; on P2 and P5) pituitary lobe homogenates probed with an anti-ER{alpha} polyclonal antibody. Molecular masses are indicated in kilodaltons.

 
Cell culture and transient transfection studies
COS-7 (i.e. ER-negative) cells were grown in DMEM (Life Technologies) supplemented with 10% FCS. Twenty-four hours before transfections, DMEM without phenol red was supplemented with 10% charcoal/dextran-stripped (twice) FCS.

Cells were transfected with 10 µg expression vector pCDNA3 containing the different isoforms of ER using a Bio-Rad electroporator (Bio-Rad Laboratories, Inc., Richmond, CA) and plated for 48 h. They were then harvested, washed twice in PBS, and gently lysed, and the cell extracts were subjected to SDS-PAGE. Corresponding Western blots were reacted with the ER{alpha}-specific antiserum described above, followed by the appropriate HRP-coupled secondary antibody (The Jackson Laboratory) and chemiluminescence detection (Pierce Chemical Co.).

Immunocytochemical studies
Briefly, fixed tissue blocks were cut into 10- or 20-µm thick sections in a cryostat kept at -20 C. Sections were then subjected to the following protocol with three 5-min washes (0.1 M PBS) between steps: 1) 5% normal goat serum in PBS for 2 h, 2) the anti-ER{alpha}-specific antiserum described above (1:500; Santa Cruz Biotechnology, Inc.) in PBS containing 2% normal goat serum for 48 h at 4 C, and 3) as secondary antibodies either HRP-coupled or fluorescein-conjugated antirabbit antibodies for 2 h. The peroxidase was revealed by enzymatic reaction using 3,3'-diaminobenzidine-HCl (DAB; Sigma Chemical Co., St. Louis, MO) as chromogen and H2O2 in 0.05 M Tris buffer for 10–30 min at room temperature.

Statistical analysis
To analyze the time course of expression of the different ER{alpha} transcripts during pituitary ontogeny (Fig. 3Go), one-way ANOVA was used, which allowed us to conclude that, except for the {Sigma}E3–4 isoform, the variability between group means was significantly larger than the average variability within the groups and, thus, that there were significant differences among the values of the groups. Then an unpaired t test was used to determine which of these differences was significant.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 3. Quantitative analysis of the differential expression of the alternative ER{alpha} mRNA transcripts during pituitary development. Results represent the means (±SEM) of three or four independent RT-PCR experiments. *, P < 0.05, by ANOVA followed by t test.

 

   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Selective amplification of ER{alpha} cDNA from embryonic pituitary reveals the presence of alternatively spliced receptor variants
To follow the time course of ER{alpha} gene expression in the rat pituitary gland during ontogeny, we applied a semiquantitative RT-PCR procedure with a few sets of specific oligonucleotide primers. As expected, the use of oligonucleotides encompassing the region from exons 2–6 of the ER{alpha} sequence revealed the presence of full-length ER{alpha} mRNA (695 bp). In addition, however, three other amplification products of 578, 359, and 242 bp, respectively, were found in considerable amounts a few days before the full-length ER{alpha} mRNA could be detected (Fig. 1Go). The corresponding fragments were subsequently cloned and sequenced and were shown to represent ER{alpha} mRNA isoforms. The first one lacked exon 3 (which encodes the second zinc finger of the DNA-binding domain), the second one lacked exon 4 (which encodes the nuclear localization signal and part of the steroid-binding domain), and the third one lacked both exons 3 and 4 (Fig. 2Go). Interestingly, the three exon-skipping isoforms (hereafter, referred to as {Sigma}E3, {Sigma}E4, and {Sigma}E3–4 according to the nomenclature for splicing variants) (26), retained the same reading frame as the full-length transcript, indicating that the alternatively spliced mRNAs might be translated into active proteins (see below). To gain more information about the expression of these ER{alpha} isoforms during pituitary ontogeny, the time course of appearance of both transcripts and proteins was determined.



View larger version (66K):
[in this window]
[in a new window]
  		Figure 1. RT-PCR analysis of embryonic (E15, E17, and E21) and postnatal (P10) rat pituitary RNA with ER{alpha}-specific primers. Radiolabeled oligonucleotides encompassing exons 2–6 of the rat gene were used for 27, 32, or 37 cycles of amplification. Lane C, Controls. The figure shows the existence of four ER{alpha} transcripts that are differentially expressed during pituitary development.

 


View larger version (23K):
[in this window]
[in a new window]
  		Figure 2. Genomic organization, domain structure, and functional characteristics of ER{alpha} (adapted from Ref. 40): The rat and human ER{alpha} gene spans over more than 140 kb and is comprised of eight exons interrupted by long introns. The exon boundaries do not match with functional domains. Gray and black boxes located in exons 2 and 6 represent the primers used for RT-PCR. Regions and functions missing in the ER{alpha} variants are indicated.

 
Changes in the expression of the different ER{alpha} transcripts during pituitary ontogeny
A series of RT-PCR analyses of embryonic or newborn rat pituitary RNA using ER{alpha}-specific primers showed that the presence and the respective expression levels of the four transcripts varied with the stage of pituitary development (Fig. 3Go). On E12–E13, the earliest stages studied, the signals for {Sigma}E4 and {Sigma}E3–4 mRNAs were already strong, whereas no specific signal was detectable for full-length ER{alpha} mRNA or for {Sigma}E3 mRNA. Weak signals for {Sigma}E3 and full-length ER{alpha} mRNAs were first observed on E15 and E16, respectively. At this stage, the signals for {Sigma}E4 and {Sigma}E3–4 were still predominant. The expression of full-length ER mRNA began to increase dramatically from E19 to become highly predominant after birth, a situation that will persist throughout the lifetime of the animal. In adult pituitary, the same ER{alpha} variant mRNAs were also found, although they represent only minor amounts of transcripts (Guivarc’h, D., unpublished observation). The signal for {Sigma}E3 mRNA increased markedly on E19–E20, then underwent a transient decline, and on P7–P10 was again comparable to the E20 signal. The signal for {Sigma}E4 was constantly strong from E12–E20 and started to decrease just before birth (on P0 this decrease became statistically significant, P < 0.05, P0 vs. E20 values), whereas that for {Sigma}E3–4 remained more or less constant over the period studied. It should be mentioned that in these first experiments, no particular attention was paid to the sex of the animal studied.

To further quantify the relative levels of the ER{alpha} mRNA variants detected by RT-PCR, we also used RNase protection assays with two different antisense riboprobes. As shown in Fig. 4Go, this analysis confirmed the presence of significant levels of all four transcripts. When total RNA of embryonic or neonatal pituitaries was analyzed with a probe corresponding to the full-length ER sequence (565 nt), three protected fragments (556, 390, and 166 nt) were specifically detected, corresponding to full-length, {Sigma}E3, and {Sigma}E4 transcripts, respectively.



View larger version (82K):
[in this window]
[in a new window]
  		Figure 4. Analysis of the RNase protection products. Seven micrograms of total RNA from embryonic (E17 and E21) or postnatal (P3 and P10) pituitary were hybridized (as described in Materials and Methods) to the 32P-labeled single stranded antisense (AS) riboprobe (PCR full-length fragment, specific for exons 2–5, or {Sigma}E3–4 fragment, specific for the exon 2–5 junction) and treated with A and T1 RNases, and the resistant hybrids were separated on sequencing gels. In addition to the expected transcripts, some extra bands were observed; however, they were also observed in the partially purified probe (AS-) and thus are nonspecific. Controls were radiolabeled antisense riboprobe submitted (AS+) or not submitted (AS-) to treatment with RNases; radiolabeled sense probe not submitted to ribonuclease treatment (S-) were also used. In each assay, RNA samples (here P10+S or E17+S, as examples) were also hybridized to the labeled, single stranded sense riboprobe, and no protected fragment was ever seen.

 
Similarly, with a probe corresponding to the {Sigma}E3–4 sequence (113 nt), three protected fragments (103, 54, and 49 nt) were revealed, among which the 103-nt fragment corresponded to the {Sigma}E3–4 transcript, as expected on the basis of the RT-PCR results.

Changes in the expression of the different ER{alpha} proteins during ontogeny of the pituitary gland
Western blots performed on rat pituitary from different ages (Fig. 5Go) demonstrated that the four transcripts described above are all translated in vivo. Indeed, a specific antiserum directed against the carboxyl-terminus of the ER{alpha} protein stained four protein bands, the molecular masses of which were in agreement with the size of the observed transcripts: 67, 61.8, 53, and 45 kDa, respectively, for full-length, {Sigma}E3, {Sigma}E4, and {Sigma}E3–4 ER{alpha}. The same antiserum also recognized the corresponding proteins expressed by COS-7 cells that had been transfected with the cDNAs of the four different transcripts (Fig. 6Go). Interestingly, the pattern of appearance of the various ER{alpha} protein isoforms during development (Fig. 5Go) agreed well with that of the mRNAs. In particular, the shortest protein isoforms, {Sigma}E4 and {Sigma}E3–4, were expressed significantly before the full-length ER, as were their encoding transcripts. {Sigma}E4 protein expression decreased sharply after birth, whereas {Sigma}E3–4 protein was rather constantly observed at a low level throughout the period studied. The {Sigma}E3 protein was abundant from E18 up to E20, decreased sharply at birth, and was observed again from P10, whereas the full-length ER{alpha} protein was detected from E20 and then increased regularly with time.



View larger version (32K):
[in this window]
[in a new window]
  		Figure 6. In vitro expression of the ER{alpha} protein isoforms. Western blot analysis of extracts from COS-7 cells that had been transfected with the cDNAs of the four different ER{alpha} transcripts or with empty pCDNA3 vector (Ctl). Fifty micrograms of protein were loaded onto 10% SDS-PAGE. The corresponding blots were reacted with an anti-ER{alpha} antiserum, followed by an HRP-coupled secondary antibody and chemiluminescence detection.

 
The ER{alpha}-specific antiserum was also used to analyze by immunocytochemistry the expression of ER{alpha} protein on fixed sections of pituitary. An ER immunolabeling was first detected in the intermediate lobe on E16 (Fig. 7Go), where it then increased constantly at least until P5. In contrast, in the anterior lobe, the ER signal was barely detectable before birth, but increased rapidly thereafter. Thus, comparison of the expression pattern of ER{alpha} proteins on Western blots with the immunocytochemical data suggested that the expression pattern of individual ER{alpha} isoforms may correspond to differential expression in different parts of the pituitary gland.



View larger version (93K):
[in this window]
[in a new window]
  		Figure 7. a–c, Ontogeny of ER{alpha} immunoreactivity in the rat pituitary gland. Sagittal (20-µm) sections were obtained from fetal and newborn rat glands (a, E16; b, E19; c, P5) and immunostained with a polyclonal ER{alpha} antibody followed by peroxidase-DAB revelation. Cytoplasmic immunostaining was first detected in the intermediate lobe (IL) on E16 (a) and increased during development; labeled cells were distributed in clusters (b and c). The nuclear ER{alpha} immunostaining in the anterior pituitary lobe (AL) seen on P5 in c was first detected at birth and then increased rapidly. NL, Neural lobe. Magnification: a and b, x250; c, x400.

 
Distribution pattern of ERs in fetal and neonatal pituitary
The localization of the ER{alpha} isoforms was analyzed in detail in the different areas of the pituitary gland during ontogeny. Immunohistochemical studies showed that a weak, but specific, ER{alpha} immunostaining was first recognized exclusively in the cytoplasm of cells in the intermediate pituitary at E16 (Fig. 7aGo), that is before the expression of the full-length receptor was detectable on Western blots (cf. Fig. 5Go). The onset of nuclear immunostaining in the anterior lobe of the pituitary was clearly perinatal (Fig. 7cGo). The same temporal and tissular patterns of expression were observed with both DAB-peroxidase and fluorescence labeling techniques (Fig. 8Go). It should be mentioned that the neural lobe remained essentially unlabeled in all of our experiments; the weak fluorescence observed in this lobe was nonspecific, as it was found even in control sections reacted in the absence of primary antibody.



View larger version (84K):
[in this window]
[in a new window]
  		Figure 8. Lobe-dependent subcellular localization of ER{alpha} immunoreactivity in the rat pituitary detected on sagittal (20-µm) sections from newborn (P5) rats using fluorescein as the chromophore. Note that in the anterior lobe (AL), the nuclei are strongly stained, whereas in the intermediate lobe (IL), the staining is nonnuclear and remains exclusively cytoplasmic (b and d). The IL immunostained cells are distributed in clusters [the asterisk indicates a nonspecific fluorescence in the neural lobe (NL)]. Magnification: a, x200; b, x380; c and d, x1400.

 
Confocal microscopy confirmed the lobe-specific subcellular localization of ER{alpha} immunoreactivity on pituitary sections from 5-day-old (P5) rats (Fig. 8Go, a and b). The ER{alpha}-specific staining was mainly found in nuclei in the anterior lobe cells, although a light staining was also observed in the cytoplasm (Fig. 8cGo). In contrast, in intermediate lobe cells, ER{alpha}-specific staining was obviously not nuclear but, instead, was spread all over the cell cytoplasm (Fig. 8dGo).

In addition, Western blots of extracts from carefully isolated pituitary lobes of newborn rats from P0–P5 (Fig. 9Go) showed that on P5 the expression of {Sigma}E3 and {Sigma}E4 was basically confined to the intermediate pituitary lobe. Moreover, this Western blot analysis also demonstrated that, during the critical period of hormone influence on central nervous system development, the expression patterns of the {Sigma}E3 and {Sigma}E4 isoforms differed between male and female rats in the intermediate lobe (Fig. 9Go); the {Sigma}E3 isoform predominated in males up to postnatal day 5, whereas in females, {Sigma}E4 was more intensely expressed. In contrast, in the anterior pituitary, no striking difference was noticed between males and females on either Western blots or immunostained tissue sections.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Herein, we show that three splice variants of ER{alpha} mRNA, exhibiting in-frame deletions of exon 3, exon 4 or both, are the major ER{alpha} transcripts found at early stages of development in the rat pituitary gland. Their expression precedes by more than 4 days the appearance of full-length transcript. The three transcript isoforms are expressed as proteins, with their relative expression levels varying during pituitary ontogeny and also according to the sex of the animal. These findings strongly suggest that these ER{alpha} isoforms play a physiologically relevant role before birth, for example as regulators of estrogen-dependent transcription in the developing gland.

Considering the expression time course of the ER{alpha} transcripts, the full-length ER{alpha} mRNA appeared on E16, whereas {Sigma}E4 and {Sigma}E3–4 transcripts were detected as early as E12, and {Sigma}E3 mRNA was found on E15. These three short isoforms result from an exon-skipping mechanism of the ER{alpha} pre-mRNA. This process is obviously developmentally regulated, suggesting the involvement of a specific splicing mechanism during ontogeny. As the reading frame encoding the ER protein was conserved for all three transcripts, the existence of translation products of {Sigma}E3, {Sigma}E4, and {Sigma}E3–4 mRNAs was plausible. Indeed, the use of an antiserum directed against the C-terminal end of the ER{alpha} allowed us to detect the corresponding proteins in the pituitaries of embryonic and newborn rats. Moreover, the present study showed that, in accordance with the corresponding transcripts, the expression of the ER{alpha} protein isoforms changes throughout ontogenetic development. Whereas the three short proteins could already be observed on E16–E17, the full-length receptor protein was detected only 1 day before birth. This last result is consistent with that reported by McLusky et al. (35), who showed that the development of the pituitary estrogen system is essentially postnatal and that the rapid increase in ER binding capacity takes place at the time of birth, thereafter continuing for several days.

Our finding of an expression as proteins of the three transcript isoforms contrasts with most previous data about numerous ER{alpha} splice variants ({Sigma}E2, {Sigma}E3, {Sigma}E4, {Sigma}E5, {Sigma}E4–7, {Sigma}E3–5, and {Sigma}E5–7 mRNAs) that have been reported in neoplastic tissue samples (26) and even in some normal adult tissues. Neither the {Sigma}E4 and {Sigma}E3–4 mRNAs found in normal rat bone tissues by Hoshino et al. (29) nor the {Sigma}E4 mRNA found in the rat brain by Skipper et al. (30) were shown to give rise to proteins in vivo. To our knowledge the only tissue in which some ER protein isoforms have been convincingly demonstrated is the adult rat pituitary (31, 32).

As these protein isoforms are lacking specific domains of the ER{alpha}, some functional correlates can be predicted. The {Sigma}E3 protein harbors a deletion of exon 3 encoding the second zinc finger of the DNA-binding domain. As anticipated, it was shown to be unable to bind to a canonical estrogen response element (25). Nevertheless, in the MCF-7 breast cancer cell line, {Sigma}E3 inhibits the activation of estrogen-dependent transcription in a dominant negative fashion when cotransfected with the full-length ER. Moreover, it has recently been shown that the amount of this {Sigma}E3 transcript is dramatically reduced in primary breast cancers and cancer cell lines, whereas transfection of {Sigma}E3 into MCF-7 cells leads to a suppression of the transformed phenotype (41). Taken together, these data support the idea that {Sigma}E3 expression in normal tissue may provide a means of decreasing or blocking estrogen responsiveness. Although developing tissues are functionally protected from the potentially deleterious effects of maternal estrogens by {alpha}-fetoprotein, a plasma estrogen-binding protein (36), the early expression of {Sigma}E3 that antagonizes full-length ER could represent an additional protection mechanism. Interestingly, the demonstration of the existence in vivo of such an amino-terminally truncated isoform that is able to bind E2 but is unable to modulate transcription in the absence of the full-length ER could account for the residual estrogen-binding activity without estrogen responsiveness found in the uterus (42) or the brain (43) of ER{alpha} knockout mice. In these mutants, the gene disruption consisted of the insertion of a selection gene sequence into the ER{alpha} exon 2. Examples are known of exons being "spliced over" when a nonsense codon is introduced into an exon (44) or when neomycin resistance sequences have been targeted to an exon (45). Thus, the expression of a to some degree functional protein cannot be excluded.

The {Sigma}E4 isoform bears a deletion of exon 4, which codes for amino acids 255–366, corresponding mainly to the hinge region containing one nuclear localization signal, and to the first 48 amino acids of the ligand-binding domain. The characteristics of {Sigma}E4, which is a highly expressed transcript in tumors, suggested to some researchers that it may play a role as an estrogen-independent transcription factor, because its DNA-binding domain is intact (30). Lacking a part of the steroid-binding domain, {Sigma}E4 must be less sensitive to estrogens. The relative independence of {Sigma}E4 from hormone may allow for some intrinsic ER activity in the developing brain regardless of the circulating estrogen levels. Waterman et al. (46) showed that a truncation of the ER molecule immediately carboxyl-terminal to the DNA-binding domain, as is the case for {Sigma}E4, results in a constitutive activation of the receptor. In contrast, Koehorst et al. (47) reported the absence of heterodimer formation, of DNA binding and trans-activation by this receptor isoform, as analyzed by transient transfections in embryonic carcinoma P19EC and in human choriocarcinoma JEG3 cells. However, in none of the tumor samples that have been studied, has the corresponding {Sigma}E4 variant protein ever been found, showing that in those tissues this variant mRNA is not translated. In contrast, in the present study, we showed that the {Sigma}E4 transcript is translated in vivo in the pituitary during prenatal life, and that the resulting protein is present at least until birth. Further studies will show whether this protein indeed retains some activity as a transcription factor or as a modulator of full-length ER{alpha}.

{Sigma}E3–4, which exhibits deletion of both exons 3 and 4, is detected at early stages in pituitary development as well as in the adult. The corresponding protein is always observed in the two lobes of the fetal and newborn pituitary, but no clue as to its physiological role has yet been obtained.

The fact that pituitary {Sigma}E3 expression levels appear to be sex dependent during development may be physiologically relevant, although until now, the pituitary was believed to exhibit no clear sign of sexual differentiation. Thus, {Sigma}E3 appears to be predominantly expressed in the intermediate lobe of the pituitary and more abundantly in male rats than in females, as shown by Western blots from isolated pituitary lobes. The presence of short forms of ER{alpha} in the intermediate lobe is consistent with previous data obtained by Bonsall et al. (48), who showed the existence of [3H]estradiol-concentrating cells by autoradiography in the monkey intermediate lobe, and by Pelletier et al. (21), who observed a strong labeling of the intermediate lobe of the rat pituitary by in situ hybridization using an oligonucleotide probe complementary to sequence 1–24 of the ER{alpha} mRNA. The physiological importance of estrogen in the regulation of cell functions in pars intermedia remains ill defined. However, it is known that in the adult female rat, estradiol stimulates intermediate lobe cells to release MSH{alpha}, which, in turn, can act on adenohypophysial cells to recruit additional PRL secretors into the secretory pool (49). Moreover, it should be stressed that the expression at a relatively late stage of development of the full-length ER{alpha} transcript and protein parallels the acquisition of CRF responsiveness by melanotrophs (50), the increase in voltage-dependent calcium channels (51), and furthermore, the change in the respective amounts of the two splice isoforms of the D2 dopamine receptor (52). This may be interestingly correlated with our recent demonstration of the key role of ERs in the regulation of the D2 receptor splicing event (10, 11). The expression levels of the {Sigma}E3 isoform, which is predominant in the intermediate lobe and particularly in male pituitaries, and that of {Sigma}E4, whose signal is more intense in females, decrease during the so-called critical period. This period, in which administration of estrogens or androgens can permanently alter sexual differentiation (53, 54), begins during fetal development and extends through the first week of postnatal life. Thus, it is tempting to speculate that in male rats, the {Sigma}E3 isoform could protect cells of the intermediate lobe from high levels of maternal estrogens, whereas in females, {Sigma}E4 could represent a form of ER that functions independently of the circulating estrogen levels.

The subcellular localization of the short isoforms presented here is consistent with the fact that either their DNA-binding domain or their nuclear localization signal is missing or disrupted; all three truncated proteins appear to be mainly nonnuclear, in contrast to full-length ER{alpha}. Although the relative detection limits for individual isoforms may be different for Western blots and immunocytochemistry, a comparison of Western blot with immunocytochemical data on E17–E19 strongly suggests that the ER immunostaining observed in the cytoplasm of the intermediate lobe corresponded principally to some short ER{alpha} isoforms. Postnatally, a weak cytoplasmic immunostaining is also observed in the anterior lobe and may account for the low level of isoform expression in this tissue. The existence of cytoplasmic ER isoforms is also consistent with the results reported by Blaustein (55), who used three antibodies directed against diverse epitopes on the ER protein. This work showed that in most rat brain areas if the highest density of reaction product was indeed located in cell nuclei, an extensive cytoplasmic immunostaining also existed.

In summary, we show for the first time the existence in fetal and newborn rat pituitaries of three protein isoforms of the ER{alpha} that are differentially expressed during ontogenetic development and differentially localized in the gland. Thus, the primary transcript of ER{alpha} normally undergoes splicing regulation, which leads to the expression of full-length plus several variant transcripts. Further studies are now needed to determine whether the truncated proteins could act as dominant negative or positive transcription factors to modulate the expression of ER target genes, either by forming heterodimers with full-length receptors or by competing for another limiting transcription factor. Depending on the relative abundance of these variant receptors, the pituitary cells may display different degrees of estrogen responsiveness. These findings may contribute to our understanding of the mechanisms underlying the developmental actions of estrogens in the pituitary and probably also in the brain as well as of some unexplained results obtained in ER{alpha} gene-disrupted animals.


   Acknowledgments
 
We thank Jean-Paul Bouillot for photographic assistance, and Lucy Kukstas-Vincent for her helpful comments on the manuscript.


   Footnotes
 
1 This work was supported by grants from the Centre National de la Recherche Scientifique, University Paris-Sud, the Association pour la Recherche sur le Cancer (A.R.C.), and the Institut Universitaire de France. Back

Received September 22, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lieberman ME, Maurer RA, Gorski J 1978 Estrogen control of prolactin synthesis in vitro. Proc Natl Acad Sci USA 75:5946–5949[Abstract/Free Full Text]
  2. Kiino DR, Dannies PS 1981 Insulin and 17ß-estradiol increase the intracellular prolactin content of GH4C1 cells. Endocrinology 109:1264–1269[Abstract]
  3. Maurer RA 1982 Estradiol regulates the transcription of the prolactin gene. J Biol Chem 257:2133–2136[Abstract/Free Full Text]
  4. Lieberman ME, Maurer RA, Claude P, Gorski J 1982 Prolactin synthesis in primary cultures of pituitary cells: regulation by estradiol. Mol Cell Endocrinol 25:277–294[CrossRef][Medline]
  5. Hashi A, Mazawa S, Chen S, Yamakawa K, Kato J, Arita J 1996 Estradiol-induced diurnal changes in lactotroph proliferation and their hypothalamic regulation in ovariectomized rats. Endocrinology 137:3246–3252[Abstract]
  6. Raymond V, Beaulieu M, Labrie F, Boissier JR 1978 Potent antidopaminergic activity of estradiol at the pituitary level on prolactin release. Science 200:1173–1175[Abstract/Free Full Text]
  7. Heiman ML, Ben-Jonathan N 1982 Rat anterior pituitary dopaminergic receptors are regulated by estradiol and during lactation. Endocrinology 111:1057–1060[Medline]
  8. Pasqualini C, Kerdelhue B 1985 L’estradiol module directement le nombre des récepteurs dopaminergiques antéhypophysaires, chez la ratte ovariectomisée. C R Acad Sci [III] (Paris) 17:637–642
  9. Kukstas LA, Domec C, Bascles L, Bonnet J, Verrier D, Israel JM, Vincent J-D 1991 Different expression of two dopaminergic D2 receptors, D2415 and D2444, in two types of lactotroph each characterised by their response to dopamine and modification of expression by sex steroids. Endocrinology 129:1101–1103[Abstract]
  10. Guivarc’h D, Vernier P, Vincent J-D 1995 Sex steroid hormones change the differential distribution of the isoforms of the D2 dopamine receptor messenger RNA in the rat brain. Neuroscience 69:159–166[CrossRef][Medline]
  11. Guivarc’h D, Vincent J-D, Vernier P 1998 Alternative splicing of the dopamine D2 receptor messenger ribonucleic acid is modulated by activated sex steroid receptors in the MMQ prolactin cells. Endocrinology 139:4213–4221[Abstract/Free Full Text]
  12. Scully KM, Gleiberman AS, Lindzey J, Lubahn DB, Korach KS, Rosenfeld MG 1997 Role of estrogen receptor in the anterior pituitary gland. Mol Endocrinol 11:674–681[Abstract/Free Full Text]
  13. Parker MG 1993 Steroid and related receptors. Curr Opin Cell Biol 5:499–504[CrossRef][Medline]
  14. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  15. Beato M, Truss M, Chavez S 1996 Control of transcription by steroid hormones. Ann NY Acad Sci 784:93–123[Medline]
  16. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  17. Kuiper GGJM, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson J-A 1997 Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors {alpha} and ß. Endocrinology 138:863–870[Abstract/Free Full Text]
  18. Morel G, Dubois PM, Benassayag C, Nunez EA, Radanyi C, Redeuilh G, Richard-Foy H, Baulieu EE 1981 Ultrastructural evidence of oestradiol receptor by immunocytochemistry. Exp Cell Res 132:249–257[CrossRef][Medline]
  19. Keefer DA, Stumpf WE, Petrusz P 1976 Quantitative autoradiographic assessment of 3H-estradiol uptake in immunocytochemically characterized pituitary cells. Cell Tissue Res 166:25–35[CrossRef][Medline]
  20. Blaustein JD, Olster DH 1989 Gonadal steroid hormone receptors and social behaviors. In: Balthazart J (ed) Advances in Environmental and Comparative Physiology. Springer, Berlin, vol 3:31–104
  21. Pelletier G, Liao N, Follea N, Govindan M V 1988 Distribution of estrogen receptors in the rat pituitary as studied by in situ hybridization. Mol Cell Endocrinol 56:29–33[CrossRef][Medline]
  22. Yamashita S, Korach KS 1989 A modified immunohistochemical procedure for the detection of estrogen receptor in mouse tissues. Histochemistry 90:325–330[CrossRef][Medline]
  23. Petersen DN, Tkalcevic GT, Koza-Taylor PH, Turi TG, Brown TA 1998 Identification of estrogen receptor ß2, a functional variant of estrogen receptor ß expressed in normal rat tissues. Endocrinology 139:1082–1092[Abstract/Free Full Text]
  24. Mitchner NA, Garlick C, Ben-Jonathan N 1998 Cellular distribution and gene regulation of estrogen receptors {alpha} and ß in the rat pituitary gland. Endocrinology 139:3976–3983[Abstract/Free Full Text]
  25. Wang Y, Miksicek R J 1991 Identification of a dominant negative form of the human estrogen receptor. Mol Endocrinol 5:1707–1715[Abstract]
  26. Pfeffer U, Fecarotta E, Arena G, Forlani A, Vidali G 1996 Alternative splicing of the estrogen receptor primary transcript normally occurs in estrogen receptor positive tissues and cell lines. J Steroid Biochem Mol Biol 56:99–105[CrossRef][Medline]
  27. Fuqua SAW, Fitzgerald SD, Chamness GC, Tandon AK, McDonnell DP, Nawaz Z, O’Malley BW, McGuire WL 1991 Variant human breast tumor estrogen receptor with constitutive transcriptional activity. Cancer Res 51:105–109[Abstract/Free Full Text]
  28. Rea D, Parker MG 1996 Effects of an exon 5 variant of the estrogen receptor in MCF-7 breast cancer cells. Cancer Res 56:1556–1563[Abstract/Free Full Text]
  29. Hoshino S, Inoue S, Hosoi T, Saito T, Ikegami A, Kaneki M, Ouchi Y, Orimo H 1995 Demonstration of isoforms of the estrogen receptor in the bone tissues and in osteoblastic cells. Calcif Tissue Int 57:466–468[CrossRef][Medline]
  30. Skipper JK, Young LJ, Bergeron JM, Tetzlaff MT, Osborn CT, Crews D 1993 Identification of an isoform of the estrogen receptor messenger RNA lacking exon four and present in the brain. Proc Natl Acad Sci USA 90:7172–7175[Abstract/Free Full Text]
  31. Friend KE, Ang LW, Shupnik MA 1995 Estrogen regulates the expression of several different estrogen receptor mRNA isoforms in rat pituitary. Proc Natl Acad Sci USA 92:4367–4371[Abstract/Free Full Text]
  32. Friend KE, Resnick EM, Ang LW, Shupnik MA 1997 Specific modulation of estrogen receptor mRNA isoforms in rat pituitary throughout the estrous cycle and in response to steroid hormones. Mol Cell Endocrinol 131:147–155[CrossRef][Medline]
  33. Attardi B, Ohno S 1976 Androgen and estrogen receptors in the developing mouse brain. Endocrinology 99:1279–1290[Abstract]
  34. Fox TO, Vito CC, Wieland SJ 1979 Estrogen and androgen receptor proteins in embryonic and neonatal brain: hypotheses for roles in sexual differentiation and behavior. Am Zool 18:525–537
  35. MacLusky NJ, Lieberburg I, McEwen BS 1979a The development of estrogen receptor systems in the rat brain: perinatal development. Brain Res 178:129–142
  36. MacLusky NJ, Chaptal C, McEwen BS 1979b The development of estrogen receptor systems in the rat brain and pituitary: postnatal development. Brain Res 178:143–160
  37. Vito CC, Fox TO 1982 Androgen and estrogen receptors in embryonic and neonatal rat brain. Dev Brain Res 2:97–110[CrossRef]
  38. Keefer D, Holderegger C 1985 The ontogeny of estrogen receptors: brain and pituitary. Dev Brain Res 19:183–194[CrossRef]
  39. Von Boxberg Y 1988 Protein analysis on two-dimensional polyacrylamide gels in the femtogram range: use of a new sulfur-labeling reagent. Anal Biochem 169:372–375[CrossRef][Medline]
  40. Ponglikitmongkol M, Green S, Chambon P 1988 Genomic organization of the human estrogen receptor gene. EMBO J 7:3385–3388[Medline]
  41. Erenburg I, Schachter B, Mira y Lopez R, Ossowski L 1997 Loss of an estrogen receptor isoform (ER{alpha}{Delta}3) in breast cancer and the consequences of its reexpression: interference with estrogen-stimulated properties of malignant transformation. Mol Endocrinol 11:2004–2015[Abstract/Free Full Text]
  42. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O 1993 Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci USA 90:11162–11166[Abstract/Free Full Text]
  43. Shughrue PJ, Lubahn DB, Negro-Vilar A, Korach KS, Merchenthaler I 1997 Responses in the brain of estrogen receptor-{alpha} disrupted mice. Proc Natl Acad Sci USA 94:11008–11012[Abstract/Free Full Text]
  44. Dietz HC, Valle D, Francomano CA, Kendzior RJ, Pyeritz RE, Cutting GR 1993 The skipping of constitutive exons in vivo induced by nonsense mutations. Science 259:680–683[Abstract]
  45. Luetteke NC, Qiu TH, Peiffer RL, Oliver P, Smithies O, Lee DC 1993 TGF{alpha} deficiency results in hair follicle and eye abnormalities in targeted and waved-1 mice. Cell 73:263–278[CrossRef][Medline]
  46. Waterman ML, Adler SR, Nelson CA, Greene GL, Evans RM, Rosenfeld MG 1988 A single domain of the estrogen receptor confers DNA binding and transcriptional activity of the rat PRL gene. Mol Endocrinol 2:14–21[Abstract]
  47. Koehorst SGA, Cox JJ, Donker GH, Lopes da Silva S, Burbach JPH, Thijssen JHH, Blankenstein MA 1994 Functional analysis of an alternatively spliced estrogen receptor lacking exon 4 isolated from MCF-7 breast cancer cells and meningioma tissue. Mol Cell Endocrinol 101:237–245[CrossRef][Medline]
  48. Bonsall RW, Rees HD, Michael RP 1986 [3H]Estradiol and its metabolites in the brain, pituitary gland and reproductive tract of the male rhesus monkey. A combined autoradiographic and chromatographic study. Neuroendocrinology 43:98–109[Medline]
  49. Ellerkmann E, Nagy GM, Frawley LS 1992 {alpha}-Melanocyte-stimulating hormone is a mammotrophic factor released by neurointermediate lobe cells after estrogen treatment. Endocrinology 130:133–138[Abstract]
  50. Lugo DI, Pintar JE 1996 Ontogeny of basal and regulated proopiomelanocortin-derived peptide secretion from fetal and neonatal pituitary intermediate lobe cells: melanotrophs exhibit transient glucocorticoid responses during development. Dev Biol 173:110–118[CrossRef][Medline]
  51. Beatty DM, Sands SA, Morris SJ, Chronwall BM 1996 Types and activities of voltage-operated calcium channels change during development of rat pituitary neurointermediate lobe. Int J Dev Neurosci 14:597–612[CrossRef][Medline]
  52. Chronwall BM, Sands SA, Dickerson DS, Sibley DR, Gary KA 1996 Melanotrope dopamine D2 receptor isoform expression in the developing rat pituitary. Int J Dev Neurosci 14:77–86[Medline]
  53. Gorski RA 1971 Gonadal hormones and perinatal development of neuroendocrine function. In: Martini L, Ganong WF (eds) Frontiers in Neuroendocrinology. Oxford University Press, New York, pp 237–290
  54. Raisman G, Field PM 1973 Sexual dimorphism in the neuropile of the preoptic area of the rat and its dependence on neonatal androgen. Brain Res 54:1–29[CrossRef][Medline]
  55. Blaustein JD 1992 Cytoplasmic estrogen receptors in rat brain: immunocytochemical evidence using three antibodies with distinct epitopes. Endocrinology 131:1336–1342[Abstract]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
R. Shao, E. Egecioglu, B. Weijdegard, J. J. Kopchick, J. Fernandez-Rodriguez, N. Andersson, and H. Billig
Dynamic regulation of estrogen receptor-{alpha} isoform expression in the mouse fallopian tube: mechanistic insight into estrogen-dependent production and secretion of insulin-like growth factors
Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1430 - E1442.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
R. Shao, B. Weijdegard, J. Fernandez-Rodriguez, E. Egecioglu, C. Zhu, N. Andersson, A. Thurin-Kjellberg, C. Bergh, and H. Billig
Ciliated epithelial-specific and regional-specific expression and regulation of the estrogen receptor-beta2 in the fallopian tubes of immature rats: a possible mechanism for estrogen-mediated transport process in vivo
Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E147 - E158.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
C. Lin Chang, J. Roh, J.-I. Park, C. Klein, N. Cushman, R. V. Haberberger, and S. Y. T. Hsu
Intermedin Functions as a Pituitary Paracrine Factor Regulating Prolactin Release
Mol. Endocrinol., November 1, 2005; 19(11): 2824 - 2838.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
J Varayoud, J G Ramos, L Monje, V Bosquiazzo, M Munoz-de-Toro, and E H Luque
The estrogen receptor {alpha} {Sigma}3 mRNA splicing variant is differentially regulated by estrogen and progesterone in the rat uterus
J. Endocrinol., July 1, 2005; 186(1): 51 - 60.
[Abstract] [Full Text] [PDF]

Home page
 J DAIRY SCIHome page
S. A. Balaguer, R. A. Pershing, C. Rodriguez-Sallaberry, W. W. Thatcher, and L. Badinga
Effects of Bovine Somatotropin on Uterine Genes Related to the Prostaglandin Cascade in Lactating Dairy Cows
J Dairy Sci, February 1, 2005; 88(2): 543 - 552.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
S. Rodriguez-Cuenca, M. Monjo, A. M. Proenza, and P. Roca
Depot differences in steroid receptor expression in adipose tissue: possible role of the local steroid milieu
Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E200 - E207.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. A. Schreihofer, D. F. Rowe, E. F. Rissman, E. M. Scordalakes, J.-a. Gustafsson, and M. A. Shupnik
Estrogen Receptor-{alpha} (ER{alpha}), But Not ER{beta}, Modulates Estrogen Stimulation of the ER{alpha}-Truncated Variant, TERP-1
Endocrinology, November 1, 2002; 143(11): 4196 - 4202.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
A. Menuet, I. Anglade, G. Flouriot, F. Pakdel, and O. Kah
Tissue-Specific Expression of Two Structurally Different Estrogen Receptor Alpha Isoforms along the