help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, H.
Right arrow Articles by Montrose-Rafizadeh, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, H.
Right arrow Articles by Montrose-Rafizadeh, C.
Endocrinology Vol. 140, No. 6 2859-2867
Copyright © 1999 by The Endocrine Society

ARTICLES

Differential Expression of a Novel Seven Transmembrane Domain Protein in Epididymal Fat from Aged and Diabetic Mice

Huan Yang, Josephine M. Egan, Buel D. Rodgers, Michel Bernier and Chahrzad Montrose-Rafizadeh

Diabetes Section, Laboratory of Clinical Investigation, National Institute on Aging, National Institutes of Health, Baltimore, Maryland 21224

Address all correspondence and requests for reprints to: Chahrzad Montrose-Rafizadeh, Ph.D., Eli Lilly and Company, Lilly Corporate Center, Drop Code 1543, Indianapolis, Indiana 46285. E-mail: montrose{at}lilly.com


   Abstract
Top
 Abstract
Introduction
 Material and Methods
 Results
 Discussion
 References
 
To identify novel seven transmembrane domain proteins from 3T3-L1 adipocytes, we used PCR to amplify 3T3-L1 adipocyte complementary DNA (cDNA) with primers homologous to the N- and C-termini of pancreatic glucagon-like peptide-1 (GLP-1) receptor. We screened a cDNA library prepared from fully differentiated 3T3-L1 adipocytes using a 500-bp cDNA PCR product probe. Herein describes the isolation and characterization of a 1.6-kb cDNA clone that encodes a novel 298-amino acid protein that we termed TPRA40 (transmembrane domain protein of 40 kDa regulated in adipocytes). TPRA40 has seven putative transmembrane domains and shows little homology with the known GLP-1 receptor or with other G protein-coupled receptors. The levels of TPRA40 mRNA and protein were higher in 3T3-L1 adipocytes than in 3T3-L1 fibroblasts. TPRA40 is present in a number of mouse and human tissues. Interestingly, TPRA40 mRNA levels were significantly increased by 2- to 3-fold in epididymal fat of 24-month-old mice vs. young controls as well as in db/db and ob/ob mice vs. nondiabetic control littermates. No difference in TPRA40 mRNA levels was observed in brain, heart, skeletal muscle, liver, or kidney. Furthermore, no difference in TPRA40 expression was detected in brown fat of ob/ob mice when compared with age-matched controls. Taken together, these data suggest that TPRA40 represents a novel membrane-associated protein whose expression in white adipose tissue is altered with aging and type 2 diabetes.


   Introduction
Top
 Abstract
 Introduction
Material and Methods
 Results
 Discussion
 References
 
GLUCAGON-LIKE peptide 1 (GLP-1) is an incretin hormone secreted from the intestinal L-cells in response to food intake (1). Upon GLP-1 binding to the GLP-1 receptor, a member of the G protein-coupled receptor (GPCR) family, there is activation of the receptor that promotes its interaction with heterotrimeric GTP-binding proteins (G proteins) (2). The pancreatic GLP-1 receptor has been cloned from both rat and human pancreas (3, 4). This receptor isoform is linked to activation of adenylate cyclase and phospholipase C (5), resulting in enhanced insulin secretion from the pancreatic ß-cells (6) and a diminution in the plasma levels of glucagon (7). However, we and others have provided evidence to suggest that GLP-1 can also augment glucose utilization in insulin-sensitive cells (8, 9, 10). Incubation of 3T3-L1 adipocytes with GLP-1 rapidly results in increased insulin-mediated lipid synthesis and inhibition of isoproterenol-induced lipolysis (8, 11). Similarly, incubation of L6 muscle cells with GLP-1 results in increased glycogen synthesis (9). The insulinomimetic effects of GLP-1 in fully-differentiated 3T3-L1 adipocytes and in L6 myotubes occur in conjunction with a decrease in cAMP levels, which is mediated by a receptor that is functionally different than the known pancreatic GLP-1 receptor (9, 11). These studies suggest that diversity in coupling specificity for the GLP-1 receptor may derive from the expression of a new GLP-1 receptor isoform in extrapancreatic tissues.

The goal of this study was to identify a novel GLP-1 receptor isoform from a 3T3-L1 adipocyte complementary DNA (cDNA) library. We report here the isolation and partial characterization of a novel seven transmembrane domain protein whose mRNA and protein levels are highly expressed in 3T3-L1 adipocytes but with lower expression in 3T3-L1 preadipose cells. We term this protein, TPRA40 (transmembrane domain protein of 40-kDa regulated in adipocytes). This protein, however, is not a receptor for GLP-1. Using aged animals as well as animal models of diabetes [e.g. db/db and ob/ob mice (12)], we found that TPRA40 expression was increased in epididymal fat but not in other tissues tested when compared with their nondiabetic littermate controls. Aging and obesity have been shown to be accompanied by pathologic insulin resistance that ultimately results in the perturbation of energy balance (13, 14). These results indicate an association between perturbations of glucose homeostasis and enhanced TPRA40 expression in white adipose tissue.


   Material and Methods
Top
 Abstract
 Introduction
 Material and Methods
Results
 Discussion
 References
 
Cell culture
3T3-L1 preadipocytes (American Type Culture Collection, Rockville, MD) were cultured in DMEM (Paragon Biotech Inc., Baltimore, MD) containing 24 mM D-glucose, 110 mg/liter pyruvate, 10% FCS, and penicillin-streptomycin (50 U/ml and 50 µg/ml, respectively) at 37 C in an atmosphere of air/CO2 (95:5). At confluence, monolayers of preadipocytes were induced to differentiate into adipocytes by switching to DMEM in the presence of 10% FBS (HyClone Laboratories, Inc., Logan, UT) supplemented with methylisobutylxanthine, dexamethasone and insulin (8). Insulin was withdrawn from the medium 4 days after initiating cell differentiation. Cells were then maintained in DMEM and 10% FBS for an additional 4 days, with a medium change every 2 days.

Animals
Male C57BL/6J mice, homozygous db/db (C57BL/KsJdb/db) and ob/ob (C57BL/6J-ob/ob) mice and their heterozygous littermates db/+ and ob/+ were purchased from The Jackson Laboratory (Maine) and allowed to age in our animal facility. Mice were housed in a 12-h light, 12-h dark cycle, and were fed ad libitum. Animals were killed by cervical dislocation, and various tissues were removed, quickly frozen in liquid nitrogen and stored at -80 C. Blood was also collected for glucose, insulin, and hemoglobin A1c (HbA1c) determination. This experimental protocol was approved by the Animal Care and Use Committee of the NIA.

Cloning of TPRA40
Total RNA from confluent 3T3-L1 adipocytes was extracted using either the STAT-60 reagent (Tel-Test "B" Inc., Friendswood, TX) or the guanidinium thiocyanate method followed by centrifugation through CsCl cushion (15). The integrity of RNA was visualized on an agarose/formaldehyde gel. Poly A+ RNA was isolated from total RNA with an oligo-dT cellulose column (poly prep chromatography columns; BioRad Laboratories, Inc., Hercules, CA). Single stranded complementary DNA (cDNA) was synthesized from poly A+ RNA using Maloney murine leukemia virus reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, MD) with either an oligo (dT) primer or random hexanucleotide primer (Pharmacia LKB Biotechnology Inc., Piscataway, NJ). Primers (Paragon Biotech Inc., Baltimore, MD) from the known sequences of rat pancreatic GLP-1 receptor were used to amplify this cDNA by PCR. The forward primer 5'ATGGCCGTCACCCCCAGC3' was constructed from the N-terminal nontransmembrane domain whereas the reverse primer 5'TTTGGCAGGTGGCTGCATACAC3' was constructed from the C-terminal nontransmembrane domain (3). First strand cDNA was initially amplified (Gene Amp kit, Perkin Elmer Corp., Branchburg, NJ) for 40 cycles with an annealing temperature of 42 C. Five microliters of the first reaction was further amplified with 20 additional cycles and the PCR products were subcloned into pBluescript SK- (Strategene, La Jolla, CA) at the XbaI and EcoRI sites and sequenced. One of the PCR products was 500 bp and had an open reading frame whose sequence suggested the presence of membrane spanning domains, having 30–40% similarity to other transmembrane domain proteins. This 500-bp PCR product was labeled by random priming (Rediprime kit; Amersham, Arlington Heights, IL) with 32P-dCTP (Amersham), and used as probe.

A lamda ZAP (Strategene) cDNA library from fully differentiated 3T3-L1 adipocytes (a gift from Dr. M. Daniel Lane, The Johns Hopkins University School of Medicine, Baltimore, MD) was screened with the 32P-labeled 500-bp amplified PCR product described above. The filters were prehybridized in a solution containing 40% formamide, 5 x SSC [750 mM NaCl, 75 mM Na · citrate (pH 7.0)], 50 mM NaPO4 (pH 6.8), 1 mM EDTA (pH 8.0), 1% SDS, 2.5 x Denhardt’s (0.05% polyvinylpyrolidone, 0.05% BSA, 0.05% Ficoll) and 200 µg/ml salmon sperm DNA at 42 C for 6 h. After an overnight hybridization with 106 cpm/ml labeled probe at 42 C, filters were washed twice with 2 x SSC at room temperature, and then twice with 0.2 x SSC and 0.1% SDS at 42 C for 30 min each time. Positive clones were isolated and sequenced with the Sequenase 2.0 kit (United States Biochemicals, Cleveland, OH). Their sizes ranged between 1.2 and 1.6 kb, and all had identical 3' ends.

RNA extraction and analysis
Human and mouse multiple tissues Northern blot filters were purchased from CLONTECH Laboratories, Inc., Palo Alto, CA. Otherwise, 20 µg total RNA were electrophoresed on 1.2% agarose/17% formaldehyde gels and transferred to Nylon membranes (Nytran; Schleicher & Schuell, Keene, NH). The membranes were hybridized overnight with random primed 32P-labeled 500 bp initial PCR product encompassing the nucleotide sequence 233 to 678 of the transcript shown in Fig. 1Go, in the presence of 50% formamide, 5 x SSC (pH 7.0), 50 mM NaPO4 (pH 6.8), 1 mM EDTA (pH 8.0), 1% SDS, 2.5 x Denhardt’s and 200 µg/ml salmon sperm DNA at 42 C. The membranes were washed as described above.



View larger version (77K):
[in this window]
[in a new window]
  		Figure 1. Mouse TPRA40 cDNA nucleotide sequence and predicted amino acid sequence. The polyadenylation signal AATAAA and the TGA stop codon are in boldface. The putative seven transmembrane domains (I–VII) are underlined; the potential N-linked glycosylation sites are in boldface; putative protein kinase C phosphorylation sites are indicated by asterisks; and potential myristoylation sites are circled. The accession number of the sequence reported in this paper has been deposited in the GenBank database (BankIt 175252 AF 051098).

 
RNase protection assay (RPA II kit; Ambion Inc., Austin, TX) was used to quantitate TPRA40 and ß-actin mRNA levels in multiple mouse tissues and in 3T3-L1 cells. The antisense RNA probe (MAXI script, in vitro transcription kits; Ambion) was labeled with [{alpha}-32P]UTP (800 Ci/mmol; Amersham), whereas the molecular weight markers were prepared by using pBR322 plasmid DNA digested with MSP I (New England Biolabs, Inc., Beverly, MA) and then end-labeled with Klenow enzyme (Strategene) in the presence of [{alpha}-32P]dCTP (800 Ci/mmol; Amersham). An antisense riboprobe of TPRA40 was synthesized using T7 RNA polymerase on Bcl I linearized pTPRA40/Bluescript SK-plasmid, which produces a single protected transcript of 292 bp and a full-length probe of 322 bp. A ß-actin DNA (Ambion) riboprobe was also synthesized using T7 RNA polymerase, giving rise to a single protected band of 245 bp and a full-length probe of 330 bp. Cyclophilin riboprobe (165 bp) was synthesized by T7 RNA polymerase, and the protected transcript was 105 bp. The messenger RNA (mRNA) levels were quantitated electronically with an InstantImager (Packard Instrument Co., Meriden, CT).

Cellular membrane preparation
Frozen epididymal fat (0.5–1 g) was grinded with a mortar and pestle, and transferred into 4 ml of ice-cold homogenization buffer containing 10 mM HEPES (pH 7.5), 0.25 M sucrose, 5 mM EDTA, 1 mM orthovanadate, 8% 2-mercaptoethanol, 1 mM benzamidine, 0.25 mM pefablock-SC (Boehringer Mannheim, Indianapolis, IN), and protease inhibitor cocktail set III (Calbiochem, La Jolla, CA) containing 1 mM AEBSF hydrochloride, 0.8 µM aprotinin, 50 µM bestatin, 15 µM E-64, 20 µM leupeptin, and 10 µM pepstatin. Tissue was then homogenized using a polytron (Brinkmann Instruments, Inc., Westbury, NY) set at 13.7 for 45 sec on ice and subsequently centrifuged at 10,000 x g for 20 min at 4 C. The clarified supernatant was then centrifuged for 1 h at 100,000 x g to pellet the membranes. Protein determination was carried out by the method of Bradford using bovine {gamma}-globulin as standard (16). 3T3-L1 adipocytes and fibroblasts grown in 100-mm dish were washed twice with ice-cold PBS, scraped into homogenization buffer, and fractionated as above.

Western blot analysis
The membrane pellets were solubilized in NuPAGE sample buffer (Novex, San Diego, CA) containing 7.5% 2-mercaptoethanol. After heating at 70 C for 10 min, insoluble material was pelleted by centrifugation. Equal amounts of protein from each sample (50 µg) were separated on gradient 4–12% SDS-polyacrylamide Bis-Tris NuPage gels along with prestained protein markers (Novex) and electrotransferred onto polyvinylidene difluoride membranes (Novex). Common G protein ß subunit (cGß) and TPRA40 proteins were detected by Western immunoblotting with a polyclonal C-terminal cGß antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and with an anti-TPRA40 antibody, respectively. Anti-TPRA40 antibody was produced by immunizing rabbits with a synthetic 14-amino acid peptide (KTPLKERVSLPSRR-amide) corresponding to residues 210–223 of mouse TPRA40 and conjugated to a carrier protein, diphtheria toxoid, using maleimidocaproyl-N-hydroxycuccimide as a linker. BLASTp analysis indicated that this sequence is not contained within any other known proteins.

Assays
Plasma glucose and insulin were measured by the glucose oxidase method and by RIA, respectively, as previously reported (17). Levels of HbA1c were measured as described previously (18, 19).

Statistical analysis
Data are presented as mean ± SEM. Differences between groups were determined by two-tailed Student’s t test.


   Results
Top
 Abstract
 Introduction
 Material and Methods
 Results
Discussion
 References
 
Isolation of a novel clone with a cDNA library from differentiated 3T3-L1 adipocytes
To elucidate the GLP-1 signaling pathways in 3T3-L1 adipocytes and L6 myocytes, we searched for an extrapancreatic GLP-1 receptor isoform. Toward this aim, primers homologous to the pancreatic GLP-1 receptor were used to amplify a 3T3-L1 adipocyte cDNA template by PCR. We isolated a 500-bp PCR product that had an open reading frame, four putative membrane spanning domains (MEMSAT program; 20) and shared 30–40% similarity to other membrane proteins including a C-elegans gene product, D1046.5 (GenBank Accession Number e348544; 21), multidrug resistance protein 2 (GenBank Accession Number P39843; 22) and an epithelial membrane protein (GenBank Accession Number P54850; 23). This PCR product was then used to screen a 3T3-L1 adipocyte cDNA library. Of 9 x 105 total phage screened, 31 positive clones were obtained, one of which was a 1626-bp cDNA clone containing a 900-bp open reading frame (Fig. 1Go). DNA sequences from this novel clone revealed that it encoded a 298-amino acid protein with a predicted molecular mass of 33 kDa. The use of MEMSAT, a program for prediction of transmembrane domains (20), revealed that the protein has seven putative transmembrane domains. A second program, SOSUI (24), also predicted seven transmembrane domains in the regions similar to the ones found by the MEMSAT program. In addition, this clone contained two putative N-glycosylation sites at the amino terminus, three serine residues that could act as possible protein kinase C phosphorylation sites, and four putative myristoylation sites in the second, third, and sixth transmembrane domains at glycine 91, 133, 230, and 240. BLASTp search of GenBank (25) revealed that this clone was 46–62% similar at the amino acid level (p = 1.6e-39) to a C. elegans protein, D1046.5 (21), and 42% similar (P = 0.05) to multidrug efflux transporter (22) but had no sequence homology to the pancreatic GLP-1 receptor nor to other members of this family. TPRA40 did not contain any of the signature motifs found in other G protein-coupled receptors (kindly analyzed by Drs. Gert Vriend and Florence Horn, Heidelberg, Germany, and Refs. 26, 27). However, further analysis of the predicted amino acid sequence of TPRA40 showed sequence homology at the second transmembrane domain with the rat and human orexin-2 G-protein coupled receptor (80% similarity over 16 amino acids, GeneBank Accession Number AF041246 and AF041245, respectively), whose role in the regulation of feeding behavior has been recently proposed (28). The second transmembrane domain of TPRA40 also displayed homology to the human orphan P2Y-like G protein-coupled receptor (87% similarity over 16 amino acids, GenBank Accession Number Y12546) and the human orexin-1 G-protein coupled receptor (74% similarity over 16 amino acids, GenBank Accession Number AF041243; 28). In addition, the seventh transmembrane domain (19 amino acids) showed sequence homology to the mouse orphan G protein-coupled receptor, KY411 (78% similarity over 18 amino acids GenBank Accession Number d1024681).

Because TPRA40 cDNA was isolated from a cDNA library prepared from 3T3-L1 adipocytes, its expression pattern was assessed in 3T3-L1 cells. RNase protection assay of RNA isolated from both 3T3-L1 fibroblasts and fully-differentiated adipocytes was performed. As shown in Fig. 2AGo, a single protected fragment of 292 bp was detected in both cells but with an enhanced signal in 3T3-L1 adipocytes. In contrast, cyclophilin expression was much higher in 3T3-L1 fibroblasts. In order to characterize the protein encoded by the TPRA40 gene, polyclonal antibodies were raised against a peptide corresponding to residues 210–223 of TPRA40. Membranes prepared from 3T3-L1 cells were solubilized in Laemmli sample buffer, and the proteins separated by reducing SDS-PAGE followed by immunoblotting with anti-TPRA40 antibodies. As shown in Fig. 2BGo, the antiserum recognized a protein with an apparent molecular weight of 40K. Addition of competing peptide during immunoblotting resulted in a marked reduction in the detection of TPRA40 (data not shown). Consistent with the expression pattern of TPRA40 mRNA in 3T3-L1 cells, the amount of TPRA40 protein was significantly higher in 3T3-L1 adipocytes. Reprobing the same membranes with an antibody raised against an epitope common for all G protein ß-subunits revealed little variation in the relative abundance of Gß proteins between 3T3-L1 fibroblasts and fully differentiated 3T3-L1 adipocytes. TPRA40 protein was also observed in parental chinese hamster ovary (CHO) cells (data not shown). We have shown previously that GLP-1 does not bind nor activate parental CHO cells (2, 29); therefore, this observation indirectly suggests that it is unlikely that this protein is another GLP-1 receptor isoform.



View larger version (33K):
[in this window]
[in a new window]
  		Figure 2. Enhanced expression of TPRA40 in 3T3-L1 adipocytes. A, Total RNA (20 µg) isolated from subconfluent 3T3-L1 fibroblasts (lane 1) and fully-differentiated adipocytes (lane 2) was analyzed for levels of TPRA40 (upper panel) and cyclophilin (lower panel) mRNA by RNase protection as described in Materials and Methods. B, Membrane-cell lysates were separated by SDS-PAGE followed by immunoblotting with anti-TPRA40 antibodies (upper panel) and reprobed with pan anti-G-protein ß subunit antibodies (lower panel).

 
Tissue distribution of TPRA40
To determine the tissue distribution of TPRA40 mRNA, a mouse multiple-tissue Northern blot was hybridized with a probe prepared from the TPRA40 cDNA (Fig. 3Go). Two size classes of TPRA40 mRNA were detected with tissue-specific variation in their relative abundance. TPRA40 mRNA expression was elevated in heart, brain, lung, liver, and kidney. Lesser amounts were found in spleen and skeletal muscle, whereas we could barely detect TPRA40 mRNA in testis. The most prominent TPRA40 transcript was approximately 2 kb, with a somewhat lower detection of a 6-kb transcript in some tissues. TPRA40 transcripts of the same size were also detected in RNA isolated from mouse pancreas and epididymal fat tissue (data not shown). A human multiple-tissue Northern blot was hybridized with the same probe (Fig. 4Go), and the results indicated that TPRA40 mRNA expression was highest in heart, placenta, and kidney. Moderate amounts were found in liver, skeletal muscle, and pancreas, with lowest amounts in brain and lung. As in its murine counterpart, the size of the major transcript was approximately 2 kb. These results demonstrate that TPRA40 is expressed in differentiated 3T3-L1 adipocytes and insulin-responsive tissues such as heart, muscle, liver, and fat, and defines TPRA40 as a possible relevant effector in insulin signaling.



View larger version (116K):
[in this window]
[in a new window]
  		Figure 3. Tissue distribution of TPRA40 mRNA in mouse. A Northern blot containing mouse poly(A+) RNA (2 µg per lane) from the indicated tissues was hybridized with the 500-bp PCR product cDNA (upper panel). The sizes of two major transcripts in kilobases are shown on the right. The membrane was then stripped and rehybridized with a ß-actin probe to estimate the relative amount of RNA in each lane (lower panel).

 


View larger version (108K):
[in this window]
[in a new window]
  		Figure 4. Tissue distribution of TPRA40 mRNA in human. A Northern blot containing human poly(A+) RNA (2 µg per lane) from the indicated tissues was hybridized with the 500-bp PCR product cDNA (upper panel). The position of the 2-kb size transcript is indicated by an arrow. The positions of RNA size markers in kilobases are shown on the left. The membrane was then stripped and rehybridized with a ß-actin probe to estimate the relative amount of RNA in each lane (lower panel).

 
Expression of TPRA40 in aging mice
It has been shown that aging is associated with insulin resistance both in mouse (30, 31, 32) and humans (33, 34). To define whether aging may be a contributing factor in regulating TPRA40 gene expression, we determined its expression pattern in various tissues from 9- and 24-month old mice. RNase protection assay of total RNA isolated from heart, brain, skeletal muscle, liver, epididymal fat, and kidney was performed as indicated above. The amount of ß-actin mRNA was also measured to control for RNA integrity and quantitation. As shown in Fig. 5AGo, a single protected fragment of 292 bp was detected in all tissues analyzed. The measurement of the old/young ratio in each tissue was then used as an index of TPRA40 gene expression that occurs with aging. It was found that TPRA40 mRNA levels were significantly increased by 2.3-fold in epididymal fat of old vs. young animals (P < 0.02), whereas no significant differences were observed in other tissues examined (Fig. 5BGo). Therefore, a possible relationship may exist between TPRA40 expression levels in adipocyte and age-related insulin resistance.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 5. Effect of age on TPRA40 gene expression. A, Representative RNase protection of TPRA40 mRNA isolated from heart (h), brain (b), skeletal muscle (m), liver (l), epididymal fat (f), and kidney (k) of 24-month (old) and 9-month (young) old male C57BL/6J mice. The effect of RNase treatment on 32P-labeled RNA probe is illustrated in the first two lanes. The positions of RNA size markers (M) in bp are shown on the right. The migration position of the radiolabeled, protected 292-bp fragment is shown with an arrow. B, Quantitation of TPRA40 mRNA. Normalization of RNA between samples was verified by RPA of ß actin mRNA. The blots were quantified by densitometry, and the data, represented as bars, show the ratio of old versus young in each tissue surveyed. Values are means ± SEM (n = 5–8 per group. *, Significantly higher than younger group (P < 0.02, Student’s t test).

 
Enhanced expression of TPRA40 in adipose tissue from obesity-linked diabetic mice
The diabetic homozygous db/db mice, known to have a nonfunctional leptin receptor (35), showed increased body weight and exhibited diabetes with hyperglycemia, elevated plasma insulin, and increased HbA1c (Table 1Go). We found a significant 3-fold increase in TPRA40 mRNA level in the epididymal fat of 3-month-old db/db mice when compared with that found in their age-matched lean littermates (db/+) (P < 0.01) (Fig. 6Go). No significant change in TPRA40 expression was observed in the other tissues surveyed. The expression of TPRA40 protein was then examined in crude membranes of epididymal fat. Equivalent amounts of protein were analyzed by Western blotting with anti-TPRA40 antibody (Fig. 7AGo). The 40-kDa TPRA40 was readily detected in fat from db/db mice, whereas a low level of expression was detected in control littermates. To control for protein loading, the blot was reprobed with an antibody directed against common G protein ß-subunit. Band intensity of several experiments were quantified by scanning densitometry and the values were expressed as relative amount of TPRA40 protein normalized to that of G protein ß subunit (Fig. 7BGo). Our results indicate that the TPRA40 signal was 6.4-fold higher in epididymal fat from db/db mice (P < 0.001).


View this table:
[in this window]
[in a new window]
  		Table 1. Body weight, Plasma glucose and insulin, and % HbA1c Levels in db/db and ob/ob mice

 


View larger version (33K):
[in this window]
[in a new window]
  		Figure 6. TPRA40 gene expression in db/db mice. Three-month-old male db/db and age-matched db/+ littermates were killed, and the RNA isolated from the indicated tissues was analyzed for levels of TPRA40 mRNA by RNase protection, as described in the legend of Fig. 5Go. A, A representative blot is shown. The migration position of the radiolabeled, protected 292-bp fragment is shown with an arrow. B, Quantitative analysis of TPRA40 mRNA expression. Normalization of RNA between samples was verified by RPA of ß actin mRNA. Values are means ± SEM (n = 5 per group). *, Significantly higher than db/+ littermate group (P < 0.01, Student’s t test).

 


View larger version (22K):
[in this window]
[in a new window]
  		Figure 7. Western analysis of TPRA40 protein in epididymal fat from db/db mice. A, Membrane-cell lysates (50 µg) prepared from epididymal fat of 3-month-old male db/db and db/+ mice were separated by SDS-PAGE followed by immunoblotting with anti-TPRA40 antibodies (upper panel) and rehybridized with pan anti-G-protein ß subunit antibodies (lower panel). Molecular mass markers (in kilodaltons) are on the left. B, The blots were quantified by densitometry, and the signal associated with db/+ group was arbitrarily set at 1.0. Values are means ± SEM (n = 4). ***, Significantly higher than db/+ littermate group (P < 0.001).

 
In the ob/ob mouse, mutation in the ob gene (36) results in profound obesity and is accompanied by hyperinsulinemia and, usually, mild hyperglycemia (Table 1Go) (12). The level of TPRA40 mRNA was found to be 2.5-fold higher in epididymal fat of 5-month old ob/ob mice when compared with their control lean littermates (ob/+) (P < 0.001) (Fig. 8AGo). No significant difference in TPRA40 gene expression was noted in skeletal muscle (Fig. 8BGo) or in brown adipose tissue (data not shown).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 8. Regulation of TPRA40 mRNA expression in epididymal fat of ob/ob mice. RNA from epididymal fat (A) or skeletal muscle (B) of 5 month-old male ob/ob mice and their age-matched ob/+ littermates was analyzed for levels of TPRA40 mRNA by RNase protection. For each tissue, a representative blot is shown along with quantitative analysis of TPRA40 mRNA expression. Normalization of RNA between samples was verified by RPA of ß actin mRNA. Values are means ± SEM (n = 5 per group). ***, Significantly higher than ob/+ littermate group (P < 0.001).

 

   Discussion
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
References
 
We have isolated a novel 1.6 kb cDNA from 3T3-L1 adipocytes which encodes a 900-bp open reading frame, termed TPRA40. RNAse protection assays and Northern blot analysis indicated that TPRA40 is ubiquitously expressed and that there are two splice variants of TPRA40 that may result in tissue-specific expression of two different isoforms. Analysis of the predicted amino acid sequence of TPRA40 revealed seven putative transmembrane domains and potential N-glycosylation sites at the N terminus suggesting posttranslational processing of the protein and could explain the difference between its predicted molecular weight of 33K and the observed molecular weight of 40K. The presence of potential myristoylation sites as well as protein kinase C phosphorylation sites suggest that TPRA40 may participate in and/or be regulated by multiple signaling cascades (37, 38, 39, 40).

The amino acid sequence of TPRA40 is highly homologous to a transmembrane domain protein from C-elegans (21). No other extended high homology was observed with other proteins. TPRA40 appears to be a membrane protein since two different programs predicted the existence of seven putative transmembrane domains and because Western blot analysis detected an immunoreactive band within plasma membrane preparations of 3T3-L1 adipocytes and mouse epididymal fat. Although the second and seventh putative transmembrane domains are homologous to other G protein-coupled receptors, TPRA40 shares no significant extended homology outside of these domains. TPRA40 is not a GLP-1 receptor isoform since it has no sequence homology to the pancreatic GLP-1 receptor or to other members of this G protein-coupled receptor family. In addition, while the levels of TPRA40 in parental CHO cells were high enough to be readily detectable by Western blot, GLP-1 did not bind nor activated parental CHO cells (2, 29), suggesting indirectly that TPRA40 may not be another GLP-1 receptor isoform. Furthermore, none of the G protein-coupled receptor signature motifs was identified (26, 27), suggesting that TPRA40 may be a member of a novel seven transmembrane domain protein family.

An association exists between insulin resistance and aging as well as between insulin resistance and obesity-related diabetes. The observation that TPRA40 expression increased in epididymal fat of aged and diabetic mice, but not in other insulin target tissues (e.g. skeletal muscle and liver), may represent an event unique to white adipose tissue. Indeed, enhanced expression of TPRA40 mRNA and protein is observed upon differentiation of 3T3-L1 fibroblasts to adipocytes. The expression of many fat cell-specific genes critical to insulin action is increased during adipocyte differentiation such as GLUT4, the adipocyte fatty acid binding protein, aP2, and leptin, the product of the ob gene (41, 42). The ob/ob and db/db mouse models of insulin resistance exhibit ablated leptin synthesis and impaired leptin receptor signaling, respectively (43, 44). These mice become obese and eventually develop insulin resistance and diabetes. However, the mechanisms that link obesity to insulin resistance and diabetes remain unknown. Novel genes predominantly or differentially expressed in adipose tissue may be the missing link between these two related disorders.

We found that TPRA40 expression was higher in the epididymal fat of db/db mice that were hyperinsulinemic and hyperglycemic and of ob/ob mice that were hyperinsulinemic but normoglycemic. This observation indicates that the severity of insulin resistance as shown by the wide difference in plasma glucose between db/db and ob/ob mice may not be the factor influencing TPRA40 expression. Alternatively, because both animal models lack leptin responsiveness and are obese, increased adiposity may be responsible for the high levels of TPRA40 expression. However, TPRA40 mRNA levels were also elevated in aged mice that developed glucose intolerance suggesting that TPRA40 expression may be either independent of lipogenesis in aged mice and/or that additional factors associated with aging are involved. In all three mice models, a dysregulation of glucose homeostasis was associated with increased TPRA40 expression.

Although the major action of insulin is at the level of muscle, the adipose cells are known to play a complex role in energy homeostasis by storing excess calories as fat and by releasing several biologically active molecules that control glucose homeostasis and metabolism. These include the cytokine tumor necrosis factor-{alpha} (TNF{propto}) and leptin. The involvement of TNF{propto} in obesity-linked insulin resistance has been well established (45, 46) as is the control of energy balance by leptin (43, 44, 47, 48). The discovery of isoforms of uncoupling proteins and ß adrenergic receptors in fat and other tissues (49, 50, 51, 52, 53) indicates the complexity of the mechanisms involved in the control of energy balance. Our results showing that TPRA40 expression is significantly increased in epididymal fat of aged and diabetic mice may be an adaptive response to these metabolic disorders. Alternatively, unregulated TPRA40 expression may be a causative factor in the development of insulin resistance and diabetes. We are currently in the process of performing tissue-specific overexpression of TPRA40 in transgenic mice using an adipose-specific promoter/enhancer in an attempt to establish whether differences in its expression could have physiological implications for the control of energy homeostasis. This adipocyte-specific promoter/enhancer has been used previously to overexpress proteins specifically in adipocytes of transgenic mice (54, 55).

In summary, we have identified a novel transmembrane protein whose expression is elevated during 3T3-L1 adipocytes differentiation and in white fat isolated from aged and diabetic mice. Whether this increased expression is causative or symptomatic of aging-associated glucose intolerance and obesity-associated diabetes remains to be determined.


   Acknowledgments
 
We would like to thank Lisa Adams for her technical expertise; Dr. M. Daniel Lane for providing us with the cDNA library from 3T3-L1 adipocytes; Ray Thornton, Mark Kurtis, and Dr. Whaseon Lee-Kwon for their initial effort in the study; and Drs. Gert Vriend and Florence Horn for helping us with the structure analysis.

Received November 18, 1998.


   References
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 References
 

  1. Fehmann H-C, Goke R, Goke B 1995 Cell and molecular biology of the incretin hormones glucagon-like peptide-I and glucose-dependent insulin releasing polypeptide. Endocr Rev 16:390–410[Abstract/Free Full Text]
  2. Montrose-Rafizadeh C, Avdonin P, Garant MJ, Rodgers BD, Kole S, Yang Y, Levine MA, Schwindinger W, Bernier M 1999 Pancreatic GLP-1 receptor couples to multiple G-protein and activates MAP kinase pathways in chinese hamster ovary cells. Endocrinology 140:1132–1140[Abstract/Free Full Text]
  3. Thorens B 1992 Expression cloning of the pancreatic beta cell receptor for the gluco-incretin hormone glucagon-like peptide I. Proc Natl Acad Sci USA 89:8641–8645[Abstract/Free Full Text]
  4. Dillon JS, Tanizawa Y, Wheeler MB, Leng X-H, Ligon B, Rabin DU, Yoo-Warren H, Permutt MA, Boyd III AE 1993 Cloning and functional expression of the human glucagon-like peptide-1 (GLP-1) receptor. Endocrinology 133:1907–1910[Abstract/Free Full Text]
  5. Wheeler MD, Lu M, Dillon JS, Leng X-H, Chen C, Boyd AE 1993 Functional expression of the rat glucagon-like peptide-I receptor: evidence for coupling to adenylyl cyclase and phospholipase C. Endocrinology 133:57–62[Abstract/Free Full Text]
  6. Montrose-Rafizadeh C, Egan JM, Roth J 1994 Incretin hormones regulate glucose-dependent insulin secretion in RIN 1046-38 cells: mechanism of action. Endocrinology 135:589–594[Abstract]
  7. Gutniak M, Orskov C, Holst JJ, Ahren B, Efendic S 1992 Antidiabetogenic effect of glucagon-like peptide-1 (7-36) amide in normal subjects and patients with diabetes mellitus. N Engl J Med 326:1316–1322[Abstract]
  8. Egan JM, Montrose-Rafizadeh C, Wang Y, Bernier M, Roth J 1994 Glucagon-like peptide-1 (7-36) amide (GLP-1) enhances insulin-stimulated glucose metabolism in 3T3–L1 adipocytes: one of several potential extrapancreatic sites of GLP-1 action. Endocrinology 135:2070–2075[Abstract]
  9. Yang H, Egan JM, Wang Y, Moyes CD, Roth J, Montrose MH, Montrose-Rafizadeh C 1998 GLP-1 action in L6 myotubes is via a receptor different from the pancreatic GLP-1 receptor. Am J Physiol 275:C675–C683
  10. Valverde I, Morales M, Felipe C, Lopez-Delgado MI, Delgado E, Perea A, Villanueva-Penacarrilla, ML 1994 Glucagon-like peptide-I: a potent glycogenic hormone. FEBS Lett 349:313–316[CrossRef][Medline]
  11. Montrose-Rafizadeh C, Yang H, Wang Y, Roth J, Montrose MH, Adams LG 1997 Novel signal transduction and peptide specificity of glucagon-like peptide receptor in 3T3–L1 adipocytes. J Cell Physiol 172:275–281[CrossRef][Medline]
  12. Coleman DL 1978 Obese and diabetes: two mutant genes causing diabetes-obesity syndromes in mice. Diabetologia 14:141–148[CrossRef][Medline]
  13. Muller DC, Elahi D, Tobin JD, Andres R 1996 The effect of age on insulin resistance and secretion: a review. Semin Nephrol 16:289–298[Medline]
  14. Landsberg L 1996 Obesity and the insulin resistance syndrome. Hypertens Res [Suppl 1]19:S51–S55
  15. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294–5299[CrossRef][Medline]
  16. Bradford MM 1976 A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  17. Wang Y, Kole HK, Montrose-Rafizadeh C, Perfetti R, Bernier M, Egan JM 1997 Regulation of glucose transporters and hexose uptake in 3T3–L1 adipocytes: glucagon-like peptide-1 and insulin interaction. J Mol Endocrinol 19:241–248[Abstract/Free Full Text]
  18. Ersser RS, Barlow GB, Drew RG, Hjelm M 1986 Packing materials suitable for rapid, analytical, low-pressure chromatography of haemoglobins on midget columns. Biomed Chromatogr 1:183–188[CrossRef][Medline]
  19. Jaynes PK, Willis MC, Chou PP 1985 Evaluation of a mini-column chromatographic procedure for the measurement of hemoglobin A1c. Clin Biochem 18:32–36[CrossRef][Medline]
  20. Jones DT, Taylor WR, Thornton JM 1994 A model recognition approach to the prediction of all-helical membrane protein structure and topology. Biochemistry 33:3038–3049[CrossRef][Medline]
  21. Wilson R et al. 1994 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368:32–38[CrossRef][Medline]
  22. Ahmed M, Lyass L, Markham PN, Taylor SS, Vazquez-Laslop N, Neyfakh AA 1995 Two highly similar multidrug transporters of Bacillus subtilis whose expression is differentially regulated. J Bacteriol 177:3904–3910[Abstract/Free Full Text]
  23. Marvin KW, Fujimoto W, Jetten AM 1995 Identification and characterization of a novel squamous cell-associated gene related to PMP22. J Biol Chem 270:28910–28916[Abstract/Free Full Text]
  24. Hirokawa T, Boon-Chieng S, Mitaku S 1998 SOSUI: classification and secondary structure predition system for membrane proteins. Bioinformatics 14:378–379[Abstract/Free Full Text]
  25. Altschul SF, Madden TL, Schaffer JZ, Zhang Z, Miller W, Lipman DJ 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402[Abstract/Free Full Text]
  26. Attwood TK, Findlay JB 1994 Fingerprinting G-protein-coupled receptors. Protein Eng 7:195–203[Abstract/Free Full Text]
  27. Horn F, Weare J, Beukers MW, Horsch S, Bairoch A, Chen W, Edvardsen O, Campagne F, Vriend G 1998 GPCRDB: an information system for G protein-coupled receptors. Nucleic Acids Res 26:275–279[Abstract/Free Full Text]
  28. Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, Williams SC, Richardson JA, Kozlowski GP, Wilson S, Arch JRS, Buckingham RE, Haynes AC, Carr SA, Annan RS, McNulty DE, Liu W-S, Terrett JA, Elshourbagy NA, Bergsma DJ, Yanagisawa M 1998 Orexins and orexin receptors: A family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92:573–585[CrossRef][Medline]
  29. Montrose-Rafizadeh C, Yang H, Rodgers BD, Beday A, Pritchette L, Eng J 1997 High potency antagonists of the pancreatic glucagon-like peptide-1 receptor. J Biol Chem 272:21201–21206[Abstract/Free Full Text]
  30. Bailey CJ, Flatt PR 1982 Hormonal control of glucose homeostasis during development and aging in mice. Metabolism 31:238–246[CrossRef][Medline]
  31. Lavine RL, Chick WL, Like AA 1971 Glucose tolerance and insulin secretion in neonatal and adult mice. Diabetes 20:134–139
  32. Murray TM, Desai KS, Cinader B 1993 Age-related changes in hepatic and splenic insulin receptors and serum insulin and glucose levels in inbred mice. Metabolism 42:140–144[CrossRef][Medline]
  33. Chen M, Bergman RN, Pacini G, Porte Jr. D 1985 Pathogenesis of age-related glucose intolerance in man: insulin resistance and decreased beta-cell function. J Clin Endocrin Metab 60:13–20[Abstract/Free Full Text]
  34. Meneilly GS, Elahi D, Minaker KL, Sclater AL, Rowe JW 1989 Impairment of noninsulin-mediated glucose disposal in the elderly. J Clin Endocrin Metab 63:566–571
  35. Ghilardi N, Ziegler S, Wiestner A, Stoffel R, Heim MH, Skoda RC 1996 Defective STAT signaling by the leptin receptor in diabetic mice. Proc Natl Acad Sci U S A 93:6231–6235[Abstract/Free Full Text]
  36. Friedman JM, Leibel RL, Siegel DS, Walsh J, Bahary N 1991 Molecular mapping of the mouse ob mutation. Genomics 11:1054–1062[CrossRef][Medline]
  37. Lu Y, Durkin JP 1997 Protein kinase C in IL-2 signal transduction. Immunol Res 16:355–374[Medline]
  38. Arao M, Yamaguchi T, Sugimoto T, Fukase M, Chihara K 1994 Protein kinase C is crucial for the stimulation of sodium dependent phosphate transport by parathyroid hormone-related peptide in osteoblast-like cells. Biochem Biophys Res Commun 199:1216–1222[CrossRef][Medline]
  39. Milligan G, Parenti M, Magee A 1995 The dynamic role of palmitoylation in signal transduction. Trends Biochem Sci 20:181–186[CrossRef][Medline]
  40. Degtyarev MY, Spiegel AM, Jones TL 1994 Palmitoylation of a G-protein alpha I subunit requires membrane localization not myristoylation. J Biol Chem 269:30898–30903[Abstract/Free Full Text]
  41. Garcia de Herreros A, Birnbaum MJ 1989 The acquisition of increased insulin-responsive hexose transport in 3T3–L1 adipocytes correlates with expression of a novel transporter gene. J Biol Chem 264:19994–19999[Abstract/Free Full Text]
  42. MacDougald OA, Lane MD 1995 Transcriptional regulation of gene expression during adipocyte differentiation. Ann Rev Biochem 64:345–373, 1995[CrossRef][Medline]
  43. Chen H, Charlat O, Tartaglia LA, Woolf EA, Weng X, Ellis SJ, Laker ND, Culpepper J, Moore KJ, Breitbart RE, Duyk GM, Tepper RI, Morgenstern JP 1996 Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell 84:491–495[CrossRef][Medline]
  44. Zhang Y, Proenca R, Maffei M, Leopold L, Friedman JM 1994 Positional cloning of the mouse ob gene and its human homologue. Nature 372:425–432[CrossRef][Medline]
  45. Grewal IS, Grewal KD, Wong FS, Picarella DE, Janeway Jr CA, Flavell RA 1996 Local expression of transgene encoded TNF alpha in islets prevents autoimmune diabetes in nonobese diabetic (NOD) mice by preventing the development of auto-reactive islet-specific T cells. J Exp Med 184:1963–1974[Abstract/Free Full Text]
  46. Rabinovitch A, Suarez-Pinzon WL, Strynadka K, Lakey JR, Rajotte RV 1996 Human pancreatic beta-cell destruction by cytokines involves oxygen free radicals and aldehyde production. J Clin Endocrin Metab 81:3197–3202[Abstract]
  47. Miller SG, De Vos P, Guerre-Millo M, Wong K, Hermann T, Stael SB, Briggs MR, Auwerx J 1996 The adipocyte specific transcription factor C/EBP alpha modulates human ob gene expression. Proc Natl Acad Sci USA 93:5507–5511[Abstract/Free Full Text]
  48. De Vos P, Lefebvre AM, Miller SG, Guerre-Millo M, Wong K, Saladin R, Humann LG, Satael SB, Briggs MR, Auwerx J 1996 Thiazolidinediones represses ob gene expression in rodents via activation of PPAR gamma. J Clin Invest 98:1004–1009[Medline]
  49. Camirand A, Marie V, Rabelo R, Silva JE 1998 Thiazolidinediones stimulate uncoupling protein-2 expression in cell lines representing white and brown adipocytes and skeletal muscle. Endocrinology 139:428–431[Abstract/Free Full Text]
  50. Ilet L, Vidal H, Andreelli F, Larrowy D, Riou JP, Ricquier D, Laville M, Langin D 1997 Increased uncoupling protein-2 and -3 mRNA expression during fasting in obese and lean humans. J Clin Invest 100:2665–2670[Medline]
  51. Shimabukuro M, Zhou YT, Lee Y, Unger RH 1997 Induction of uncoupling protein-2 mRNA by troglitazone in the pancreatic islets of Zucker diabetic fatty rats. Biochem Biophys Res Commun 18:359–361
  52. Granneman JG 1995 Why do adipocytes make the ß3 adrenergic receptor? Cell Signal 7:9–15[CrossRef][Medline]
  53. Susulic VS, Frederich RC, Lawitts J, Tozzo E, Kahn BB, Harper M-E, Himms-Hagen J, Flier JS, Lowell BB 1995 Targeted disruption of the ß3-adrenergic receptor gene. J Biol Chem 270:29483–29492[Abstract/Free Full Text]
  54. Shepherd PR, Gnudi L, Tozzo E, Yang H, Leach F, Kahn BB 1993 Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue. J Biol Chem 268:22243–22246[Abstract/Free Full Text]
  55. Ross SR, Graves RA, Spiegelman BM 1993 Targeted expression of a toxin gene to adipose tissue: transgenic mice resistant to obesity. Genes Dev 7:1318–1324[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, H.
Right arrow Articles by Montrose-Rafizadeh, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, H.
Right arrow Articles by Montrose-Rafizadeh, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals