help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dace, A.
Right arrow Articles by Torresani, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dace, A.
Right arrow Articles by Torresani, J.
Endocrinology Vol. 140, No. 7 2983-2990
Copyright © 1999 by The Endocrine Society

ARTICLES

Transient Expression of c-erbAß1 Messenger Ribonucleic Acid and ß1 Thyroid Hormone Receptor Early in Adipogenesis of Ob 17 Cells1

Alexandra Dace, Gaiane Sarkissian, Laetitia Schneider, Claire Martin-El Yazidi, Jeannine Bonne, Alain Margotat, Richard Planells and Janine Torresani

INSERM U-476 et IFR 35, Université de la Méditerranée, Faculté de Médecine, 13385 Marseille Cedex 5, France

Address all correspondence and requests for reprints to: Dr. Janine Torresani, INSERM U-476, Faculté de Médecine, 27 boulevard Jean-Moulin, 13385 Marseille Cedex 5, France. E-mail: Janine.Torresani{at}medecine.univ-mrs.fr


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the murine Ob 17 preadipocyte cell line, the thyroid hormone T3 is an adipogenic factor necessary at an early stage for differentiation into adipocyte. We demonstrate here that this T3 dependence may involve a transient expression (at both the messenger RNA and the protein levels) of c-ErbA ß-type receptors (T3R), although a large body of T3R remained the product of the c-erbA{alpha} gene, as previously described. c-ErbAß1 (and not ß2) expression emerged significantly at growth arrest, peaked 2 days later, and almost disappeared in maturing adipocytes. This expression is related to the presence of T3, as total deprivation of culture medium from T3 prevented it, and the addition of 1.5 nM T3 to preconfluent cultures was able to restore it. When cells were cultured in the presence of T3 and thus were able to differentiate, the c-erbAß peak was accompanied by sequential rapid increases in CAAT/enhancer-binding protein-{delta} (C/EBP{delta}), peroxisome proliferator-activated-{gamma} receptor (PPAR{gamma}), and C/EBP{alpha} gene expressions. On the contrary, under thyroid hormone-deprived culture conditions that result in nondifferentiation of the preadipocytes, c-erbAß1, PPAR{gamma}, and the large C/EBP{alpha} expressions were blunted, and a moderate early increase in c-erbA{alpha}1 transcripts was sustained for a longer period. Addition of T3 to T3-deprived preconfluent cells restored PPAR{gamma} and C/EBP{alpha} expressions. Taken together, the results highlight the important role of T3 in the adipogenesis of Ob 17 cells through the involvement of both ß1 and {alpha}1 T3R subtypes.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
IN VERTEBRATES, the thyroid hormone 3,5,3'-triiodo-L-thyronine (T3) is involved in metabolic-energetic homeostasis and in development through the control of cell proliferation and differentiation. The actions of T3 are mainly initiated in the nucleus through nuclear T3 receptors (T3R), which modulate the expression of target genes. T3 receptors belong to the steroid/thyroid-retinoid superfamily of nuclear hormone receptors that function as ligand-activated transcription factors (1, 2). To date, three functional T3 receptors have been described as issuing from two homologous c-ErbA{alpha} and c-ErbAß genes (c-ErbA{alpha}1, c-ErbAß1, and c-ErbAß2 proteins). Alternative splicing of the c-erbA{alpha} gene also produces nonreceptor variants (c-ErbA{alpha}2 and -{alpha}3). Most of the rat, mouse, and human tissues express both {alpha}1- and ß1-type T3R, although with great differences in total abundance, subtype distribution, and regulation (3, 4). The ß2-type T3R is restricted to pituitary and particular brain regions of the rodent (3, 4, 5, 6) and has not yet been detected in the human. Both {alpha}- and ß-type T3Rs are able to recognize thyroid hormone response elements (TRE) in vitro and to trans-activate TRE-driven receptor genes when overexpressed in eukaryotic cells. Nevertheless, minor differences exist in the DNA-binding domain sequences between the two T3R types, which suggests specific functions for both (7). Furthermore, the expression of c-erbA{alpha} and -ß genes does not follow the same developmental pattern in rodent and chicken brain maturation (8, 9, 10) or during amphibian metamorphosis (11): the c-erbA{alpha} gene has been shown to be expressed early, before the onset of endogenous thyroid function, whereas ß-type transcripts generally emerge later. The c-erbAß gene expression peaks in rodent brain within the hormone-sensitive period and in the amphibian during the metamorphic climax, in each case coincidently with the rise of endogenous thyroid hormones. Furthermore, in a few cases, a preferential involvement of ß-type T3R in specific functions has been reported (12, 13, 14) and T3 has been demonstrated to induce c-erbAß gene expression in amphibians (11, 15). Taken together, these data suggest that the different T3Rs might be involved in specific developmental gene expression patterns, probably by discriminating between T3 target genes.

The thyroid hormone is an obvious adipogenic factor in adipose differentiation of the Ob 17 preadipocyte cell line. When added at physiological concentrations at an early preadipocyte stage, T3 has been shown to be necessary for the transition to adipocyte (16, 17, 18, 19). The adipogenic role of T3, although not exclusive (20, 21), has also been evidenced in other preadipocyte cultures (22, 23). This is in the line of previous in vivo studies that showed that adipose tissue cellularity can be controlled by thyroid status, with increased or decreased white adipocyte number in hyper- or hypothyroid rats, respectively (24). In more recent studies using transgenic mice, it appeared that the ectopic expression of trans-dominant negative factors for T3R actions, such as the c-ErbA-related v-ErbA oncoprotein, produces a reduction of body mass and a marked reduction of adipose tissues (25); this reduction of adipose tissue, although as yet largely undeciphered, suggests that the T3Rs may be implied in adipogenesis. The Ob 17 cells contain T3 nuclear receptors whose concentration is within the range of that observed in T3 target tissues (26). We previously identified these T3Rs as products of the c-erbA{alpha} gene on the basis of both messenger RNA (mRNA) analyses (27, 28) and T3R immunoprecipitation using antipeptide antibodies that discriminate between {alpha}- and ß-type T3Rs (27, 28, 29). In these studies, an expression of the c-erbAß gene was not identified. Nevertheless, it remained worth considering that T3 could also exert its triggering adipogenic action through a ß-type T3R, as such a role for this subtype has been reported in the differentiation process of neuro-2a cells (14) or during the development of specialized functions (10, 12, 13). Therefore, we sought a possible expression of the c-erbAß gene during the early steps of preadipocyte differentiation and adipocyte maturation. We demonstrate in this report that Ob 17 preadipocytes contain a low, but significant, level of c-erbAß1 mRNA as well as ß-T3 receptors. These ß-type c-ErbA products become undetectable in maturing adipocytes, are abolished under thyroid hormone-depleted culture conditions, and are restored when T3 is added early to preadipocyte culture medium. The demonstration of an early transient expression of ß-type T3R prompted us to reassign comparatively the temporal expressions of several genes known to be involved in terminal adipocyte differentiation. Adipocyte differentiation is a complex process involving a cascade of expression of many transcription factors and adipocyte-specific genes. Two families of transcription factors, CCAAT/enhancer-binding proteins (C/EBPs) and peroxisome proliferator-activated receptors (PPARs), play important roles, as was shown in the course of 3T3-L1 preadipocyte differentiation (30, 31, 32). Here, we show that differentiation of Ob 17 preadipocytes displays the same sequence of expression for adipogenic transcription factors. Within this sequence, specific expression of T3R ß1 occurs as soon as PPAR{gamma} gene expression starts increasing and precedes the large increase in C/EBP{alpha} gene expression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture
Ob 17 cells (33), plated at a density of 2 x 103 cells/cm2, were grown in DMEM supplemented with 200 U/ml penicillin, 50 µg/ml streptomycin, 33 µM biotin, 17 µM sodium pantothenate, and 10% FBS (standard medium). At confluence (day 0; i.e. 5 days after plating), the medium was generally supplemented with 17 nM insulin, which amplifies the terminal differentiation, with or without 1.5 nM T3 (differentiation medium). When thyroid hormone-deprived culture conditions were applied, FBS was treated with an AG 1x8 exchange resin, which lowered T4 and T3 below detectable levels in immunoassays (stripped serum) (27). When indicated, the cells were synchronized using a serum deprivation method (34): the day after plating, the cells were washed with isotonic saline-phosphate buffer, pH 7.25 (PBS), and grown for 1 day in DMEM containing 0.05% BSA. The medium was then changed for standard medium containing normal or stripped FBS.

Analysis of nuclear T3 receptors and c-ErbA proteins
The nuclei were purified from the 1000 x g pellet of cells washed in PBS and homogenized in 250 mM sucrose, 1 mM MgCl2, and 20 mM Tris-HCl, pH 7.9 (26). The T3 receptors were solubilized with 0.4 M KCl in 20 mM Tris-HCl, 1 mM MgCl2, and 2 mM EDTA, pH 7.9 (26).

For immunodetection of {alpha}- or ß-type T3R, the nuclear extracts (500 µg protein/ml) were preincubated with 0.1 nM [125I]T3 (3000 µCi/µg; Amersham, Aylesbury, UK) in the presence of 2 mM dithiothreitol (DTT; 16 h, 0 C), then with antiserum or preimmune serum in 0.1 M KCl, 20 mM Tris-HCl, 1 mM MgCl2, 1 mM EDTA, and 1 mM DTT, pH 7.9 (serum dilution, 1:5) for 24 h at 0 C. The anti-{alpha} T3R and anti-ß T3R antisera were directed against immunogenic peptides, which corresponded to the amino acids 144–162 and 62–82 of T3R {alpha} and T3R ß1 human sequences, respectively. Both antisera presented exclusive {alpha}-type or ß1-type T3R recognition and did not alter T3 binding to T3R (29). The fraction of T3R bound to antibodies was estimated by size exclusion chromatography using Bio-Gel A 0.5 m (Bio-Rad Laboratories, Inc., Richmond, CA) as previously described (29). Detection of c-ErbA proteins in nuclear extracts was carried out in electrophoretic mobility shift assays, using different TREs and the ability of TRE-T3R complexes to be supershifted by anti-c-ErbA{alpha} or -ß antibodies. The TREs were as follows: TRE F2 (chicken lysozyme) (35), 5'-gatcc TTATTGACCCCAGCTGAGGTCAAGTTACG g-3'; and TRE-ME (rat malic enzyme) (36), 5'-gatcc AGGACGTTGGGGTTAGGGGAGGACAGTGGAC g-3'. The hexanucleotide sequences of TRE half-sites are underlined. One microgram of the double stranded oligonucleotides was labeled using the Klenow fragment of DNA polymerase I and [{alpha}-32P]deoxy-CTP (3,000 Ci/mmol; Amersham). Four microliters of Ob 17 nuclear extracts (2 µg protein) were incubated with the labeled TRE (20–40 fmol, 10,000 cpm) for 30 min at 20 C in 50 µl containing 20 mM Tris-HCl (pH 8.0), 1 mM EDTA, 50 mM NaCl, 1 mM MgCl2, 2.5 mM DTT, 10% glycerol (vol/vol), and 40 µg/ml poly[d(I-C)]. For supershift analyses, the mixture was preincubated overnight at 0 C, before addition of the labeled TRE, with either 1 µl antiserum (or preimmune serum) or an equivalent amount of affinity-purified IgG, with or without the immunogenic peptide (20 µg) as competitor. The antipeptide antisera were directed to c-ErbA{alpha}- or -ß-type sequences ({alpha}150–166, ß162–82, and ß1204–220) and discriminated between {alpha}- and ß-type T3Rs (29). Affinity purification of the IgGs was performed as previously described (29). After incubation, the protein-DNA complexes were analyzed by electrophoresis at 4 C in a nondenaturing 5% polyacrylamide gel in 0.5 x Tris-borate-EDTA as running buffer. After electrophoresis, the gels were dried on Whatman 3MM (Clifton, NJ) and autoradiographed. In control assays, recombinant T3R ß1 was synthesized in vitro by transcription-translation from a human c-ErbAß1 complementary DNA (cDNA; peA 101 in pGEM3, given by R. Evans), using the TNT-coupled reticulocyte lysate in vitro translation kit (Promega Corp., Madison, WI).

RNA analysis
Total RNA was extracted from Ob 17 cells harvested on different days during their differentiation process and using Trizol reagent according to the supplier’s recommendations (Life Technologies, Grand Island, NY). RNA was used only when the spectrophotometric A260/A280 ratio was greater than 1.8 and was submitted to deoxyribonuclease I digestion.

One microgram of total RNA from Ob 17 cells was reverse transcribed with random hexanucleotides as primers and Moloney mouse leukemia virus reverse transcriptase as enzyme, according to the supplier’s recommendations (Promega Corp.). cDNA preparations were then submitted to PCR amplifications with specific sets of primers (see Table 1Go and included Ref. 37, 38, 39, 40, 41, 42, 43). Amplification of reverse transcribed c-erbA{alpha}1 and vitamin D3 receptor (VDR) transcripts was carried out as previously described (28, 20). Similar conditions were applied to PPAR{delta}, PPAR{gamma}, C/EBP{alpha}, and C/EBP{delta} PCR amplifications. For c-erbAß cDNA amplification, the MgCl2 concentration was 2 mM.


View this table:
[in this window]
[in a new window]
  		Table 1. List of sets of primers used in RT-PCR

 
Estimation of relative transcript abundance was assayed by specific RT-PCR coamplification of each transcript and of ß-actin (which was thus considered as an internal standard) using a primer dropping method, as previously adapted for c-erbA {alpha}1 transcript estimation (28). Primers for mouse ß-actin (44) and other transcripts were selected so as to present similar annealing temperatures. The ß-actin primers were as follows: 5'-CTCACGCCATCCTGCGTCTGGACC-3' and 5'-TACTCCTGCTTGCTGATCGACATCTGC-3'. To take into account the disparity between the abundance of the different transcripts, the ß-actin primers were added at the seventh cycle, and the total number of cycles was limited to 27 for c-erbA{alpha}1, VDR, C/EBP{delta}, PPAR{gamma}, and PPAR{delta} and to 30 for C/EBP{alpha}. For c-erbAß transcripts, the total number of cycles was 34, whereas ß-actin amplification was limited to 20 cycles. Under these conditions, the transcripts and ß-actin products accumulated exponentially with parallel slopes; this allowed individual mRNA estimation with regard to ß-actin mRNA. The amount of ß-actin transcripts, chosen as an internal standard, did not change significantly during the differentiation process of Ob 17 cells (45).

Statistical analyses
Data are reported as the mean ± SE. Statistical significance was estimated by Student’s t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Presence of c-erbA ß1 mRNA, protein, and T3R in early preadipocytes
In our previous reports, the analysis of T3R in Ob 17 adipocytes revealed an apparently exclusive expression of the c-erbA{alpha} gene. Indeed, as shown in Fig. 1Go, c-erbA{alpha}1, -{alpha}2, and -{alpha}3 transcripts were unambiguously identified after specific RT-PCR in adipose cells cultured for 10 days. Nevertheless, when similar RT-PCR experiments were performed with mRNAs from preadipocytes at confluence (day 0), faint c-erbAß expression could be detected at 30 cycles of amplification. To specify the time course of this c-erbAß expression more accurately, amplifications were performed on cells submitted to a synchronization procedure. Figure 2Go shows the results obtained at different stages of the differentiation process, beginning 2 days before confluence. In such conditions, a single band was reproducibly obtained. This amplification product was of the expected size and was detected over the preconfluent and preadipocyte period (days -2 to 4); this expression disappeared at later stages, although it may reappear at a late adipocyte stage (day 12). Sequence analysis of this amplification product perfectly matches the mouse c-erbAß sequence (5). Two other sets of primers were then designed in the 5'-c-erbAß-coding sequence so as to discriminate between the ß1 and ß2 variants. Once more, a single product of the expected size and sequence was obtained with the c-erbAß1 primers and followed the same developmental pattern. The ß2-specific primers did not allow detection of any amplified product, even after 34 cycles of amplification.



View larger version (44K):
[in this window]
[in a new window]
  		Figure 1. RT-PCR analysis of c-erbA mRNA expression in Ob 17 cells at confluence (day 0) and after 10 days of culture in the differentiation medium. After RT of cell RNAs, the c-erbA cDNAs were PCR amplified between sets of primers specific for c-erbA{alpha}1, -{alpha}2/{alpha}3, and -ß subtypes, as described in Materials and Methods. The figure shows the electrophoretic patterns obtained after 23 and 30 cycles of amplification compared to those of molecular mass markers.

 


View larger version (101K):
[in this window]
[in a new window]
  		Figure 2. RT-PCR analysis of c-erbAß transcripts in late proliferating-differentiating Ob 17 cells. The Ob 17 cells were submitted to a synchronization protocol on day -4, as described in Materials and Methods, then cultured under standard conditions; 1.5 nM T3 was added at confluence (day 0). The PCR amplification product was analyzed by ethidium bromide staining after 34 cycles. In parallel is shown the amplification pattern of ß-actin after 30 cycles. DNA analyses of parallel cell dishes show that three mitoses occur between days -3 and 0, followed by a 1.6-fold increase in DNA content per dish between days 0–10.

 
We then sought the expression of c-ErbAß at the protein level. To this end, we used antipeptide antisera (or IgGs) directed against c-ErbAß-specific sequences and previously controlled as bearing ß-type specificity in the recognition of natural or recombinant T3 receptors (29). These antibodies, and anti-c-ErbA{alpha} antibodies for comparison, were applied to [125I]T3-receptor complexes in nuclear extracts from Ob 17 preadipocytes and adipocytes. The formation of higher Mr complexes with IgGs was detected using size exclusion chromatography. Figure 3Go shows that anti-c-ErbAß62–82 antibodies immunoshifted a small part of the [125I]T3-receptor complexes toward higher Mr species. This shift was clearly observed in preadipocyte nuclear extracts (mean ± SE, 9.9 ± 1.1% of total bound T3; n = 3) and significantly different from the low level observed in adipocyte nuclear extracts (6.6 ± 0.3%; n = 2) or from the nonspecific shift due to preimmune serum (in preadipocytes: 4.9 ± 0.5%; n = 3; in adipocytes: 4.7 ± 0.3%). Furthermore, this shift was abolished when the nuclear extracts were previously supplemented with the ß62–82 peptide as competitor (Fig. 3Go, lower panel).



View larger version (26K):
[in this window]
[in a new window]
  		Figure 3. Size exclusion chromatography of Ob 17 [125I]T3-receptor complexes preincubated with anti-c-ErbAß1- or -{alpha}-specific antibodies. Preadipocyte (day 0) or adipocyte (day 10) nuclear extracts were incubated with [125I]T3, then with the respective antibodies, anti-ß162–82 or anti-{alpha}144–162 ({circ}), or with the preimmune sera (C; •), as described inMaterials and Methods. The incubates were applied to Bio-Gel A 0.5 m columns (10 x 60 mm) equilibrated in binding buffer (29 ). Radioactivity was counted in the eluted fractions (0.6 ml). The arrows indicate the elution of thyroglobulin (Tg), ovalbumin (Ov), and free T3 (fT3). In the lower panels, the extent of immunoshifted [125I]T3-T3R complexes (fractions 16–25 in the upper panels) was expressed as a percentage of the total [125I]T3-T3R complexes estimated by two methods, which gave similar results: 1) peak counts on the elution profiles (fractions 16–38); and 2) analysis of bound [125I]T3 in an aliquot fraction of the incubated nuclear extracts using a Dowex 1x8 anion exchange resin that traps free T3 (29 ). The ß62–82 peptide (P) was applied (20 µg/100 µl) to preadipocyte nuclear extract during incubation with the anti-ß162 antiserum (a-ß). * and **, P < 0.05 and 0.02, respectively.

 
The presence of c-ErbAß proteins in Ob 17 preadipocyte nuclear extracts could also be evidenced in electrophoretic mobility shift assays using 32P-labeled thyroid response elements and anti-c-ErbAß-specific antisera or IgGs. Figure 4Go gives the results obtained with two TREs: TRE F2 bearing an inverted palindrome of the hexanucleotide motif (35), and TRE ME bearing a DR4-type repetition of this motif (36). With both TREs, the retarded band pattern given by nuclear extracts was more complex than that obtained with in vitro synthesized c-ErbAß1 protein (lanes 3 and 8 vs. lane 1 in Fig. 4Go). Supershifted protein-bound TREs were obtained after preincubation of preadipocyte nuclear extracts with anti-c-ErbAß-specific antisera (anti-ß62–82, lane 4; anti-ß204–220, lanes 5 and 13) or IgG (anti-ß204–220, lane 15). These supershifted bands were not obtained after preincubation with preimmune serum. These bands could be attenuated (lane 14) or suppressed (lane 16) when supplementing the incubation with the immunogenic peptide as a competitor. Nuclear extracts of adipocytes did not display any supershift with anti-ß-specific antibodies (lanes 9 and 17). As expected, application of anti-c-ErbA{alpha} antibodies to preadipocyte or adipocyte nuclear extracts produced supershifted bands of greater abundance (see lane 6).



View larger version (65K):
[in this window]
[in a new window]
  		Figure 4. Detection of c-ErbAß-related protein in Ob 17 preadipocyte nuclear extracts, through a combination of binding to TRE and immunoshift by anti-c-ErbAß-specific antibodies, in electrophoretic mobility shift assays. Two TREs, F2 at the left and ME at the right, were used after 32P radiolabeling and incubated with either recombinant c-ErbAß1 protein in reticulocyte lysate (RL; 5 µl; lanes 1, 2, and 10–12) or nuclear extract from preadipocyte on day 0 (lanes 3–7 and 13–16) or adipocyte on day 10 (lanes 8, 9, 17, and 18). Prior incubation of the proteins with antisera or IgG was performed as indicated above the electrophoretic patterns. The antibodies are designated by their first amino acid. The competitors were the peptide ß204–220 (lanes 14, 16, and 18) or the unlabeled TRE (lane 7). Incubations and electrophoretic separations were as described in Materials and Methods. Under the applied conditions, the unbound [32P]TRE migrated in front of the gel. NS, Nonspecific binding. The brackets indicate the specific immunoshifts. The lower panels give the results of densitometric analyses presented as immunoshifted radiolabeled TRE as a percentage of the total shifted label. Values include the data from the lanes presented above and some additional data from other experimental series. The mean ± range are then given.

 
Developmental pattern of c-erbAß transcript expression
To gain insight into the levels of c-erbAß1 gene expression along the differentiation process, and as this expression is far lower than ß-actin expression, which is taken as an internal standard, we adopted a primer dropping method of RT-PCR coamplification that we previously applied for c-erbA{alpha}1 transcript estimation (28). The amplification process was then performed for 34 cycles for c-erbAß1 and 20 cycles for ß-actin. When cells were submitted to a synchronization protocol, a low level of c-erbAß1 transcripts was detected on day -3. The ratio of c-erbAß1 transcripts/ß-actin transcripts was referred to as 1 on that day. Under standard culture conditions (Fig. 5AGo), this ratio increased 2- to 3-fold between days -2 and 4, with a peak on day 2, and decreased thereafter to the basal level up to day 10 (see also Fig. 2Go). A later increase was detected on day 12, when cells accumulate triacylglycerols and present high levels of several late adipose markers, such as glycerol-3-phosphate dehydrogenase activity (18) (data not shown).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 5. Temporal changes in the relative abundance of transcripts for several nuclear receptors and adipogenic trans-acting factors in Ob 17 cells. The RNA were prepared from Ob 17 cells on different days of their proliferation/differentiation process in culture under standard conditions at the left (A) or thyroid hormone-depleted conditions at the right (B; stripped serum) and submitted to a synchronization protocol on day -4. Normal or stripped FBS were applied on day -3. The different transcripts were estimated by a quantitative RT-PCR method relatively to ß-actin transcripts, as described in Materials and Methods. The ratio of each transcript to ß-actin was normalized to 1 on day -3. The results are the mean ± SE of duplicate RT-PCR in three cell series. The statistical significance of changes in transcript levels, relative to those on day -2, is represented as * or ** for P < 0.05 or 0.02, respectively.

 
The Ob 17 cells are known to undergo their differentiation process under the control of physiological levels of T3, and it was thus interesting to determine whether T3 was able to modulate this specific expression of T3Rß. When the cells were cultured under thyroid hormone-depleted conditions (resin-stripped serum added on day -3), c-erbAß1 expression was blunted. As shown in Fig. 5BGo, the c-erbAß transcript level, relative to the ß-actin-mRNA level, did not increase over the level observed on day -3 and even slowly decreased during the following days.

Addition of 1.5 nM T3 to the standard culture medium on day -3 produced a significant increase in the relative level of c-erbAß1 transcripts analyzed on day 2. Indeed, the c-erbAß1 mRNA/ß-actin mRNA apparent ratio (apparent as the numbers of cycles applied for the two sets of primers were different) amounted to 0.66 ± 0.08 in T3-treated cells, whereas it was only 0.39 ± 0.04 in untreated cells (n = 3; P < 0.05). Moreover, in cells cultured in the presence of stripped serum, 1.5 nM T3 added on day -3 restored an increase in T3R ß gene expression (on day 2, in two independent experimental series, T3R ß transcript abundance increased 1.7 ± 0.2-fold above the level observed on day -3 and 2.4 ± 0.2-fold above the stripped serum level on the same day). As expected, T3 addition allowed terminal adipose differentiation to be achieved in this case. It should be noted that the T3R ß mRNA level decreased to the basal level from days 5–10 in standard culture conditions.

Comparative development of transcripts for other nuclear receptors and early adipogenic factors
This transient expression of the c-erbAß gene in early Ob 17 preadipocyte cells had to be compared with the expression of other nuclear receptors whose ligands are known to be adipogenic as well as with other transcription factors involved in the adipogenic cascade. Figure 5Go shows the temporal changes in the relative abundance of specific mRNA coding for these trans-acting factors. The same quantitative RT-PCR method was applied for each set of primers and gave only one product of the expected size and sequence. Figure 5AGo shows their simultaneous expression in cells cultured under standard conditions (normal FBS). With regard to the ß-actin mRNA level, c-erbA{alpha}1 (T3R {alpha}1) and calcitriol receptor (VDR) transcripts only moderately increased over the basal level on day -3. This increase occurred very early (in subconfluent cells) and was transient (only a few days). A second moderate increase occurred later on days 8–10. Transcripts for PPAR{delta}, a nuclear receptor described to be implied early in Ob 17 cell differentiation (40), did not change markedly during the period of analysis. Conversely, PPAR{gamma} and C/EBP{alpha} transcripts increased in a progressive and sustained manner. PPAR{gamma} expression is clearly enhanced as early as day 0, whereas C/EBP{alpha} transcript abundance increased after day 6. In addition, a moderate peak of C/EBP{alpha} transcript abundance was detected early, from days -2 to 2. The abundance of C/EBP{delta} transcripts also increased from day 0 in a sustained manner, with a peak on day 2 and a further late increase. This pattern of development was reproducibly obtained in three different cell series. The abundance of the different transcripts differed largely. Triplex coamplifications in PCR assays with the same cDNA pools and with different combinations of primers allowed a semiquantitative and relative estimation. In analysis on day 0, the abundance of PPAR{delta} transcripts was the highest, being approximately 3-fold higher than that of PPAR{gamma}, which was higher by approximately 2-fold than that of c-erbA{alpha}1 and VDR transcripts, whereas the level of C/EBP{alpha} was 1.5-fold lower than that of VDR. The level of c-erbAß1 transcripts were the lowest, approximately 25-fold lower than that of C/EBP{alpha}.

When cells were cultured in the absence of T3 (stripped serum conditions), this temporal pattern of expression was deeply modified (Fig. 5BGo). Concomitantly with the blunting of c-erbA ß expression, the very early moderate increase in c-erbA {alpha}1 transcripts was sustained over a longer time period. VDR transcript abundance and temporal changes were not significantly modified. PPAR{delta} transcripts displayed the same temporal changes at a moderately higher level. The abundance of C/EBP{delta} transcripts plateaued at the level it had reached on day 0. Remarkably, the large increases in C/EBP{alpha} and PPAR{gamma} were not detected until a late stage; this correlates with the constant observation that terminal adipose differentiation cannot significantly develop under stripped serum, unsupplemented conditions (18). The addition of 1.5 nM T3 to the stripped serum culture medium restored the terminal adipose differentiation and increased the C/EBPs and PPAR{gamma} abundance as analyzed relatively to ß-actin transcripts (increases of 1.28 ± 0.11-, 1.95 ± 0.50-, and 2.76 ± 0.05-fold on day 9 in two series for C/EBP{delta}, PPAR{gamma}, and C/EBP{alpha}, respectively).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In Ob 17 cells, T3 is an adipogenic factor that is necessary for preadipocytes to convert to adipocytes and that acts optimally at the physiological concentration of 1.5 nM. In our previous reports (27, 28, 29), the T3 receptors in Ob 17 adipocytes were detected as products of the c-erbA{alpha} gene, as also reported for 3T3-L1 adipocytes (7, 46). We demonstrate here that under standard FBS-supplemented culture conditions, which allow full adipose differentiation, Ob 17 cells transiently express the c-erbAß gene at an early preadipocyte step. Both c-ErbAß1 mRNA and protein were detected at low, but significant, levels. The c-ErbA ß-type expression (T3R sites, protein, mRNA) became undiscernible in late preadipocytes and maturing adipocytes. These temporal changes in the c-erbAß gene expression may be connected with previously reported results. Indeed, such a decline of the expression of the c-erbAß gene has been described in rat brown adipose tissue development during the late fetal-early neonatal period (47) as well as in brown fat cells during their differentiation in primary culture (48). Nevertheless, in this latter case, a low level of c-erbAß transcripts remained detectable by Northern blot techniques in differentiated cells. It is noteworthy that in Ob 17 cells, c-ErbA{alpha} mRNAs and {alpha}-type T3R were always detected at high levels in both preadipocytes and adipocytes, unlike c-ErbAß.

When estimated at growth arrest, the c-erbAß1 transcript abundance was significantly increased if 1.5 nM T3 had been added 2 days before. This ß1 transcript up-regulation is in line with previous reports on pituitary cells (49) and rat brown fat cells (48). Remarkably, the emergence of a significant level of ß-transcripts did not occur in cells cultured in the presence of thyroid hormone-depleted serum and was restored by the early addition of T3. These results support the hypothesis of an induction of c-erbAß gene expression, possibly through the action of thyroid hormones present in FBS. This is in agreement with other reports on T3R ß induction by T3 in amphibian metamorphosis (11, 15) and in cultured astrocytes (50). The presence of TREs has been identified in human and amphibian T3R ß genes (51, 52) and may drive an induction through T3-activated {alpha}-type T3Rs that are expressed in advance to ß-type T3R.

In this study the expression of the c-erbAß gene was compared with that of a series of other genes that encode adipogenic trans-acting factors and that were described as being expressed sequentially in differentiating 3T3-L1 preadipocytes (30, 31, 32). A similar cascade of gene expression is detected here in Ob 17 cells, but depending on whether the serum contained thyroid hormones, two opposite patterns in the different expressions were revealed. Taken together, these results suggest that both T3R {alpha}1 with an early transient increase and the subsequent transient expression of T3R ß1 may play roles in the adipogenic action of T3 in Ob 17 cells.

The present study also analyzes the mRNA level for two other nuclear receptors that are activated by other adipogenic agents: VDR, activated by calcitriol, and PPAR{delta}, activated by long chain fatty acids. It has been reported that calcitriol, or fatty acids, could substitute for T3 in inducing adipogenesis in Ob 17 or Ob 1771 cells (20, 53). The present results indicate a transient moderate increase in both VDR and PPAR{delta} gene expression at growth arrest and during the following 2–3 days. However, the VDR mRNA increment was detected earlier, coincident with the c-ErbA{alpha}1 mRNA increment. A second increase in VDR and PPAR{delta} transcripts occurred later in adipocytes. It must be noted that the decrease observed for different nuclear receptor transcripts, T3R {alpha}1 and ß1, VDR, and PPAR{delta}, in between the two periods of increase, i.e. between approximately days 5–10, might explain the unresponsiveness of these receptors to their respective ligands in maturing adipocytes of that age. It is also worth emphasizing that adipose differentiation is preferentially controlled in Ob 17 cells by agents that activate receptors of the second subfamily of nuclear receptors (T3, calcitriol, retinoic acid, and fatty acids) (18, 19, 20, 21, 53). On the contrary, the glucocorticoid receptor (subfamily I) is preferentially involved in 3T3-L1 cells (30, 31), which express T3 receptors at a markedly lower level than Ob 17 cells (54). Some nuclear hormone receptors may thus play an important role in controlling the expression of adipogenic trans-acting factor genes, particularly the C/EBP gene family. Glucocorticoids have been implied in the induction of C/EBP{delta} gene expression in 3T3-L1 cells (55, 56). A positive control by T3 was recently reported for C/EBP{alpha} and -ß mRNA and protein abundance in developing rat liver (57) and is here detected in differentiating Ob 17 cells at the T3R ß transcript level and, with a longer delay, at the abundant C/EBP{delta}, PPAR{gamma}, and C/EBP{alpha} transcript level. Whether other nuclear receptors could be implied in C/EBP gene expression remains to be determined.

Our results clearly show that during the adipose differentiation of Ob 17 cells, several nuclear receptor genes are expressed early, with an increase at the end of the exponential growth and during the following days. An early expression was also reported for retinoic acid receptors (RAR) {alpha} and {gamma}, and for retinoid X receptors {alpha} and ß in Ob 1771 cells (21). These nuclear receptors are activated by different agents, which are described as adipogenic and may display some redundancy in their action. Remarkably, reduced adipose tissue development was recently evidenced in transgenic mice expressing the T3R {alpha}1-related v-ErbA oncoprotein, which is known as a dominant negative antagonist of T3R and RAR action (25). The critical role played by T3 in Ob 17 cell differentiation is emphasized by the peculiarities of c-erbA{alpha}1 and -ß1 transcript developmental pattern described in this report. Indeed, consecutive expressions of T3R {alpha}1, then T3R ß1, are closely associated to the induction of adipogenesis, as evidenced by increasing expressions of PPAR{gamma} and C/EBP{alpha}. Conversely, the sustained presence of T3R {alpha}1 in thyroid hormone-deprived Ob 17 cell cultures should play a role in the block of adipogenesis together with the absence of T3R ß1. This result together with our previous findings clearly underline that optimal adipose differentiation was associated with a partial (approximately half) depletion of the T3 receptor sites, whether adipogenesis was triggered by T3, calcitriol, or both (27, 28). Taken together, these results suggest a possible role for unoccupied T3R {alpha}1 in the block of adipogenesis, which agrees with recent reports that underline the fact that the presence of unoccupied T3R {alpha}1 may display an antagonistic repressive action on T3 target genes (58, 59, 60). Furthermore, it has recently been demonstrated that unoccupied T3R and RAR act as transcription repressors in the absence of their respective ligand, and that this involves the action of a corepressor that dissociates from the receptor upon ligand binding (59, 60). Therefore, during the Ob 17 differentiation process, a fine-tuned equilibrium between both {alpha}1- and ß1-type T3Rs and other related nuclear receptors is probably an important basis in the modulation of adipogenesis. The T3R ß1 transient expression in adipogenesis demonstrates that T3 could interfere in this process through specific interactions with both receptor types.


   Acknowledgments
 
The authors are indebted to C. Malezet-Desmoulin for sequence controls, and to E. Macchia for the gift of anti-{alpha} 144 and anti-ß 62 antibodies.


   Footnotes
 
1 This work was supported by INSERM, Centre National de la Recherche Scientifique, Association pour la Recherche sur le Cancer, and Université d’Aix-Marseille II. Back

Received October 13, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  2. Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14:184–193[Abstract/Free Full Text]
  3. Hodin RA, Lazar MA, Chin WW 1990 Differential and tissue-specific regulation of the multiple rat c-erbA messenger RNA species by thyroid hormone. J Clin Invest 85:101–105
  4. Bradley DJ, Towle HC, Young III WS 1992 Spatial and temporal expression of {alpha}- and ß-thyroid hormone receptor mRNAs, including the ß2-subtype, in the developing mammalian nervous system. J Neurosci 12:2288–2302[Abstract]
  5. Wood WM, Ocran KW, Gordon DF, Ridgway EC 1991 Isolation and characterization of mouse complementary DNAs encoding {alpha} and ß thyroid hormone receptors from thyrotrope cells: the mouse pituitary-specific ß2 isoform differs at the amino terminus from the corresponding species from rat pituitary tumor cells. Mol Endocrinol 5:1049–1061[Abstract/Free Full Text]
  6. Lechan RM, Qi Y, Jackson IMD, Mahdavi V 1994 Identification of thyroid hormone receptor isoforms in thyrotropin-releasing neurons of the hypothalamic paraventricular nucleus. Endocrinology 135:92–100[Abstract]
  7. Murray BM, Zilz ND, MC Greary NL, Mc Donald MJ, Towle HC 1988 Isolation and characterization of rat cDNA clones for two distinct thyroid hormone receptors. J Biol Chem 263:12770–12777[Abstract/Free Full Text]
  8. Mellström B, Naranjo TR, Santos A, Gonzales AM, Bernal J 1991 Independent expression of the {alpha} and ß c-ErbA genes in developing rat brain. Mol Endocrinol 5:1339–1350[Abstract/Free Full Text]
  9. Forrest D, Hallböök F, Peroson H, Vennström B 1991 Distinct functions for thyroid hormone receptors {alpha} and ß in brain development indicated by differential expression of receptor genes. EMBO J 10:269–275[Medline]
  10. Bradley DJ, Towle HC, Young III WS 1994 {alpha} and ß thyroid hormone receptor (TR) gene expression during auditory neurogenesis: evidence for TR isoform-specific transcriptional regulation in vivo. Proc Natl Acad Sci USA 91:439–443[Abstract/Free Full Text]
  11. Kanamori A, Brown DD 1992 The regulation of thyroid hormone receptor ß gene by thyroid hormone in Xenopus laevis. J Biol Chem 267:739–745[Abstract/Free Full Text]
  12. Strait KA, Zou L, Oppenheimer JH 1992 ß1 isoform-specific regulation of a triiodothyronine-induced gene during cerebellar development. Mol Endocrinol 6:1874–1880[Abstract/Free Full Text]
  13. Lezoualc’h F, Hassan AHS, Giraud P, Loeffler JP, Lee SL, Demeneix BA 1992 Assignment of the ß-thyroid hormone receptor to 3,5,3'-triiodothyronine-dependent inhibition of transcription from the thyrotropin-releasing hormone promoter in chick hypothalamic neurons. Mol Endocrinol 6:1797–1804[Abstract/Free Full Text]
  14. Lebel JM, Dussault JH, Puymirat J 1994 Overexpression of the ß1 thyroid receptor induces differentiation in Neuro-2a cells. Proc Natl Acad Sci USA 91:2644–2648[Abstract/Free Full Text]
  15. Baker BS, Tata JR 1992 Prolactin prevents the autoinduction of thyroid hormone receptor mRNAs during amphibian metamorphosis. Dev Biol 149:463–467[CrossRef][Medline]
  16. Gharbi-Chihi J, Facchinetti T, Bergé-Lefranc JL, Bonne J, Torresani J 1991 Triiodothyronine control of ATP-citrate lyase and malic enzyme during differentiation of a murine preadipocyte cell line. Horm Metab Res 23:423–427[Medline]
  17. Dani C, Amri EZ, Bertrand B, Enerback S, Bjursell G, Grimaldi P, Ailhaud G 1990 Expression and regulation of pOb 24 and lipoprotein lipase during adipose conversion. J Cell Biochem 43:103–110[CrossRef][Medline]
  18. Gharbi-Chihi J, Teboul M, Bismuth J, Bonne J, Torresani J 1993 Increase of differentiation by hypolipidemic fibrate drugs in Ob 17 preadipocytes: requirement for thyroid hormones. Biochim Biophys Acta 1177:8–14[Medline]
  19. Darimont C, Gaillard D, Ailhaud G, Negrel R 1993 Terminal differentiation of mouse preadipocyte cells: adipogenic and antimitogenic role of triiodothyronine. Mol Cell Endocrinol 98:67–73[CrossRef][Medline]
  20. Dace A, Martin-El Yazidi C, Bonne J, Planells R, Torresani J 1997 Calcitriol is a positive effector of adipose differentiation in the Ob 17 cell line. Relationship with the adipogenic action of triiodothyronine. Biochem Biophys Res Commun 232:771–776[CrossRef][Medline]
  21. Safonova I, Darimont C, Amri EZ, Grimaldi P, Ailhaud G, Reichert U, Shroot B 1994 Retinoids are positive effectors of adipose cell differentiation. Mol Cell Endocrinol 104:201–211[CrossRef][Medline]
  22. Deslex S, Negrel R, Ailhaud G 1987 Development of a chemically-defined serum-free medium for complete differentiation of rat adipose precursor cells. Exp Cell Res 168:15–30[CrossRef][Medline]
  23. Flores-Delgado G, Marsch-Moreno M, Kuri-Harcuch W 1987 Thyroid hormone stimulates adipocyte differentiation of 3T3-L1 cells. Mol Cell Biochem 76:35–43[Medline]
  24. Picon L, Levacher C 1979 Thyroid hormones and adipose tissue development. J Physiol Paris 75:539–543[Medline]
  25. Barlow C, Meister B, Lardelli M, Lendahl U, Vennström B 1994 Thyroid abnormalities and hepatocellular carcinoma in mice transgenic for v-ErbA. EMBO J 13:4241–4250[Medline]
  26. Anselmet A, Gharbi-Chihi J, Torresani J 1984 Nuclear T3 receptors in differentiating preadipocytes cloned from obese and lean mice. Endocrinology 114:450–455[Abstract/Free Full Text]
  27. Teboul M, Bismuth J, Ghiringhelli O, Bonne J, Torresani J 1991 Developmental and thyroidal regulation of the nuclear T3 receptors/c-ErbA protooncogene products in the Ob 17 cell line. J Receptor Res 11:865–882[Medline]
  28. Lenoir C, Dace A, Martin C, Bonne J, Teboul M, Planells R, Torresani J 1996 Calcitriol down-modulates the 3,5,3'-triiodothyronine (T3) receptors and affects, in a biphasic manner, the T3-dependent adipose differentiation of Ob 17 preadipocytes. Endocrinology 137:4268–4276[Abstract]
  29. Bismuth J, Lenoir C, Teboul M, Daadi M, Giorgilli G, Bonne J, Macchia E, Planells R, Torresani J 1995 Antibodies against restricted sequences in human c-ErbA hinge domain recognize differentially natural mammalian {alpha}- or ß-type triiodothyronine receptors and interfere differently with hormone binding. Eur J Endocrinol 132:347–356[Abstract/Free Full Text]
  30. MacDougald OA, Lane MD 1995 Transcriptional regulation of gene expression during adipocyte differentiation. Annu Rev Biochem 64:345–373[CrossRef][Medline]
  31. Smas CM, Sul HS 1995 Control of adipocyte differentiation. Biochem J 309:697–710
  32. Brun RP, Kim JB, Hu E, Altiok S, Spiegelman BM 1996 Adipocyte differentiation: a transcriptional regulatory cascade. Curr Opin Cell Biol 8:826–832[CrossRef][Medline]
  33. Negrel R, Grimaldi P, Ailhaud G 1978 Establishement of a preadipocyte clonal line from epididymal fat pad of ob/ob mouse that responds to insulin and to lipolytic hormones. Proc Natl Acad Sci USA 75:6054–6058[Abstract/Free Full Text]
  34. Chang HL, Baserga R 1977 Time of replication of genes responsible for a temperature-sensitive function in a cell cycle-specific ts mutant from a hamster cell line. J Cell Physiol 92:333–344[CrossRef][Medline]
  35. Baniahmad A, Steiner C, Kohne AC, Renkawitz R 1990 Modular structure of a chicken lysozyme silencer: involvement of an unusual thyroid hormone receptor binding site. Cell 61:505–514[CrossRef][Medline]
  36. Desvergne B, Petty KJ, Nikodem VM 1991 Functional characterization and receptor binding studies of the malic enzyme thyroid hormone response element. J Biol Chem 266:1008–1013[Abstract/Free Full Text]
  37. Masuda M, Yasuhara S, Yamashita M, Shibuya M, Odaka T 1990 Nucleotide sequence of the murine thyroid hormone receptor ({alpha}1) cDNA. Nucleic Acids Res 18:3055[Free Full Text]
  38. Prost E, Koenig RJ, Moore DD, Larsen PR, Whalen RG 1988 Multiple sequences encoding potential thyroid hormone receptors isolated from mouse skeletal muscle cDNA libraries. Nucleic Acids Res 16:6248[Free Full Text]
  39. Kamei Y, Kawada T, Fukuwatari T, Ono T, Kato S, Sugimoto E 1995 Cloning and sequencing of the gene encoding the mouse vitamin D receptor. Gene 152:281–282[CrossRef][Medline]
  40. Amri E, Bonino F, Ailhaud G, Abumrad NA, Grimaldi PA 1995 Cloning of a protein that mediates transcriptional effects of fatty acids in preadipocytes. Homology to peroxisome proliferator-activated receptors. J Biol Chem 270:2367–2371[Abstract/Free Full Text]
  41. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPPAR{gamma}2: tissue specific regulator of an adipocyte enhancer. Genes Dev 8:1224–1234[Abstract/Free Full Text]
  42. Christy RJ, Kaestner KH, Geiman DE, Lane MD 1991 CCAAT/enhancer binding protein gene promoter: binding of nuclear factors during differentiation of 3T3-L1 preadipocytes. Proc Natl Acad Sci USA 88:2593–2597[Abstract/Free Full Text]
  43. Cao Z, Umek RM, McKnight SL 1991 Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 5:1538–1552[Abstract/Free Full Text]
  44. Tokunaga K, Taniguchi H, Yoda K, Shimizu M, Sakiyamas 1986 Nucleotide sequence of a full-length cDNA for mouse cytoskeletal ß-actin mRNA. Nucleic Acids Res 14:2829[Free Full Text]
  45. Dani C, Doglio A, Amri E, Bardon S, Fort P, Bertrand B, Grimaldi P, Ailhaud G 1989 Cloning and regulation of a mRNA specifically expressed in the preadipose state. J Biol Chem 264:10119–10125[Abstract/Free Full Text]
  46. Chawla A, Lazar MA 1993 Induction of Rev-ErbA {alpha}, an orphan receptor encoded on the opposite strand of the {alpha}-thyroid hormone receptor gene, during adipocyte differentiation. J Biol Chem 268:16265–16269[Abstract/Free Full Text]
  47. Tuca A, Giralt M, Villarroya F, Vinas O, Mampel O, Iglesias R 1993 Ontogeny of thyroid hormone receptors and c-ErbA expression during brown adipose tissue development: evidence of fetal acquisition of the mature thyroid status. Endocrinology 132:1913–1920[Abstract/Free Full Text]
  48. Hernandez A, Obregon MJ 1996 Presence and mRNA expression of T3 receptors in differentiating rat brown adipocytes. Mol Cell Endocrinol 121:37–46[CrossRef][Medline]
  49. Hodin RA, Lazar MA, Chin WW 1990 Differential and tissue-specific regulation of the multiple rat c-ErbA messenger RNA species by thyroid hormone. J Clin Invest 85:101–105
  50. Lebel JM, L’Herault S, Dussault JH, Puymirat J 1993 Thyroid hormone up-regulates thyroid hormone receptor ß gene expression in rat cerebral hemisphere astrocyte cultures. Glia 9:105–112[CrossRef][Medline]
  51. Suzuki S, Miyamoto T, Opsahi A, Sakurai A, DeGroot LJ 1994 Two thyroid hormone response elements are present in the promoter of human thyroid hormone receptor ß1. Mol Endocrinol 8:305–314[Abstract/Free Full Text]
  52. Ranjan M, Wong J, Shi YB 1994 Transcriptional repression of Xenopus TRß gene is mediated by a thyroid hormone response element located near the start site. J Biol Chem 269:24699–24705[Abstract/Free Full Text]
  53. Amri E, Ailhaud G, Grimaldi P 1994 Fatty acids as signal transducing molecules: involvement in the differentiation of preadipose to adipose cells. J Lipid Res 35:930–937[Abstract]
  54. Gharbi-Chihi J, Bismuth J, Anselmet A, Torresani J 1984 Modulation du récepteur nucléaire de la triiodothyronine (T3) au cours de la différentiation de lignées préadipocytaires de souris. C R Soc Biol 178:633–640
  55. Wu Z, Bucher NLR, Farmer SR 1996 Induction of proxisome proliferator activated receptor {gamma} during the conversion of the 3T3 fibroblasts into adipocytes is mediated by C/EBP ß, C/EBP {delta} and glucocorticoids. Mol Cell Biol 16:4129–4130
  56. Yeh WC, Cao Z, Classon M, McKnight SL 1995 Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev 9:168–181[Abstract/Free Full Text]
  57. Menendez-Hurtado A, Vega-Nunez E, Perez-Castillo A 1997 Regulation by thyroid hormone and retinoic acid of the CCAAT/enhancer binding protein {alpha} and ß genes during liver development. Biochem Biophys Res Commun 234:605–610[CrossRef][Medline]
  58. Fondell JD, Roy AL, Roeder RG 1993 Unliganded thyroid hormone receptor inhibits formation of a functional preinitiation comlex: implications for active repression. Genes Dev 7:1400–1410[Abstract/Free Full Text]
  59. Hörlein AJ, Näär AM, HeinzelT, Torchia J, Gloss B, Kurokawa R, Ryan A, Kameil Y, Södenström M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  60. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J Mol EndocrinolHome page
L. Schneider, C. El-Yazidi, A. Dace, M. Maraninchi, R. Planells, A. Margotat, and J. Torresani
Expression of the 1,25-(OH)2 vitamin D3 receptor gene during the differentiation of mouse Ob17 preadipocytes and cross talk with the thyroid hormone receptor signalling pathway
J. Mol. Endocrinol., February 1, 2005; 34(1): 221 - 235.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dace, A.
Right arrow Articles by Torresani, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dace, A.
Right arrow Articles by Torresani, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals