Endocrinology Vol. 140, No. 8 3534-3542
Copyright © 1999 by The Endocrine Society
The Rat 17ß-Hydroxysteroid Dehydrogenase Type III: Molecular Cloning and Gonadotropin Regulation
Chon Hwa Tsai-Morris1,
Azra Khanum1,
Pei-Zhong Tang and
Maria L. Dufau
Section on Molecular Endocrinology, Endocrinology and Reproduction
Research Branch, National Institute of Child Health and Human
Development, National Institutes of Health, Bethesda, Maryland
20892
Address all correspondence and requests for reprints to: Dr. M. L. Dufau, National Institutes of Health, Building 49, Room 6A-36, 49 Convent Road, Bethesda, Maryland 20892-4510. E-mail
dufau{at}helix.nih.gov
 |
Abstract
|
|---|
17ß-Hydroxysteroid dehydrogenase (17ßHSD), the enzyme that
catalyzes the final step of testosterone biosynthesis in the testis,
was cloned from a rat Leydig cell complementary DNA library to gain
insights into the functional requirements, activation mechanisms, and
molecular regulation. The 17ßHSD complementary DNA encoded 306 amino
acids (molecular mass of 33.7 kDa) and displayed 75% and 85% amino
acid sequence homology to the human and mouse 17ßHSD type III
enzymes, respectively. Northern analysis revealed a single 1.4-kb
messenger RNA (mRNA) species in rat Leydig cells, whereas ovarian mRNA
was detected only by RT-PCR amplification. The cloned 17ßHSD
expressed in mammalian cell lines specifically catalyzed the reductive
reaction in androgen formation with androstenedione as the preferred
substrate. This reaction was significantly reduced in the absence of
glucose. Expression of the endogenous 17ßHSD gene in rat Leydig cells
was inhibited by a single dose of hCG in vivo, with
maximum reduction of steady state mRNA levels at 24 h and recovery
at 9 days. Such agonist-induced down-regulation of 17ßHSD expression,
which preceded the marked reduction of LH receptors, resulted from
changes at the transcriptional level and was accompanied by loss of
enzymatic activity. These studies have demonstrated a glucose
requirement for optimal activity of the enzyme in vitro
and for a role of gonadotropin in regulating the expression of 17ßHSD
gene in vivo. Cloning of the 17ßHSD type III enzyme
from rat Leydig cells will facilitate further investigation of the
molecular regulation of its activity in the testis.
 |
Introduction
|
|---|
17ß-HYDROXYSTEROID dehydrogenase
(17ßHSD) is one of the essential enzymes involved in the regulation
of intracellular levels of biologically active androgens and estrogens
in gonadal and extragonadal tissues (1). It catalyzes the reversible
interconversion of estrone and estradiol, androstenedione and
testosterone, and dehydroepiandrosterone and
5-androstene-3ß,17ß-diol. Seven distinct 17ßHSD
isoenzymes have been cloned and characterized from various tissues and
are designated types I, II, III, IV (revieved in Refs. 2, 3, 4); V (5); VI
(6); and VII (7). Types I-IV, VI, and VII are members of the short
chain alcohol dehydrogenase super family (2, 3, 4, 6, 7). However, type V
belongs to the aldo-keto reductase family (5). The 17ßHSD isoenzymes
differ in their tissue/cellular localization, substrate specificities,
cofactor requirements, and preference for oxidation or reduction
reactions. Three of the isoforms, types I, III, and VII, catalyze the
reductive reaction, whereas the other four preferentially catalyze the
oxidation reaction.
The type III isoform was isolated from the human and mouse testes (8, 9). The human type III enzyme appears to be testis specific (8),
whereas the mouse type III 17ßHSD, in addition to its strong
expression in the testis, is weakly expressed in the ovary, uterus,
seminal vesicle, and prostate, as determined by PCR amplification (9).
The human type III enzyme is predominantly associated with the
production of testosterone by testicular Leydig cells. Mutations of the
human testicular type III 17ßHSD that involve either spliced junction
abnormalities or single base substitutions result in nonexpression or
severely compromised enzyme activity, respectively, and cause male
pseudohermaphroditism (8, 10, 11). In the rat Leydig cell, 17ßHSD
activity is under ATP control, and intracellular glucose plays an
important role in the regulation of the enzyme. The contribution of the
glycolytic pathway to meet optimal provision of functional ATP for
17ßHSD activity has been recently demonstrated (12). However,
hormonal regulation of 17ßHSD type III activity and its gene
expression in the gonads have not been investigated. Gonadotropins
exhibit dual control of testicular Leydig cell function (reviewed in
Ref. 13). Low doses of LH/hCG maintain LH/hCG receptors and
steroidogenic enzymes in the up-regulated state, whereas high doses
cause receptor down-regulation and desensitization of steroidogenic
enzymes. Previous studies have demonstrated a blockade at the site of
conversion of progesterone to androgens and a consequent reduction of
testosterone production that is partly attributable to a decrease of
CYP17 (17-hydroxylase/lyase) expression (14, 15). More recently, we
have demonstrated rapid gonadotropin-induced negative transcriptional
control of types I and II 3ß-hydroxysteroid dehydrogenase genes in
rat Leydig cells (16). However, the participation of 17ßHSD in this
desensitizing process remains to be elucidated.
To further understand the functional requirements of the enzyme, the
mechanism of its activation, and molecular regulation, we have cloned
the 17ßHSD type III enzyme from rat Leydig cells in this study. The
rat type III enzyme encodes a single 1.4-kb messenger RNA (mRNA)
species with high similarity to the human and mouse type III isoform. A
glucose requirement for 17ßHSD optimal activity was observed in cells
transiently transfected with 17ßHSD complementary DNA (cDNA).
Moreover, 17ßHSD was down-regulated in vivo by hCG in
a dose- and a time-dependent manner. These studies provide a basis for
further investigation of the metabolic and molecular regulation of this
enzyme.
 |
Materials and Methods
|
|---|
Cloning of 17ßHSD type III cDNA
mRNA was isolated from rat Leydig cells purified by
centrifugal elutriation (17) using the Invitrogen isolation method
(Carlsgad, CA). mRNA was reverse transcribed using a random primer and
SuperScript reverse transcriptase (Life Technologies Inc.,
Gaithersburg, MD). Subsequently, PCR was carried out using specific
oligonucleotides based on the published sequence of human 17ßHSD type
III (8) to generate a specific probe for screening of a rat Leydig cell
ZAP library (18). The set of primers 5-ATGTTGTCCTTATTA
GCCGGACGC-3(270293 nucleotides) and
5-AAATGCGCACACAAACGCCTTGGAAGCTGAGTA-3 (673641 nucleotides)
generated the expected size product of 403 bp. This PCR product was
subcloned into TA cloning vector (Invitrogen) and subjected to sequence
analysis. This fragment showed 82% similarity with the 17ßHSD human
type III DNA and was used for screening the rat Leydig cell cDNA
library. Approximately 5 x 105 clones were screened
with a randomly labeled rat 17ßHSD fragment by standard colony
hybridization (19). One of four positively identified clones with a
1087-bp insert was sequenced by the dideoxy chain termination method
(20) using Sequenase version 2.0 kit (U. S. Biochemical Corp., Cleveland, OH). The sequence analysis revealed 75%
similarity with the human type III sequence and had two missing bases
of the initiation codon (AT). A fragment containing the missing 5'-end
bases was obtained by rapid amplification of cDNA 5'-ends analysis
essentially as previously described (Life Technologies,
Gaithersburg, MD) using mRNA isolated from rat Leydig cells (21). First
strand cDNA was synthesized using a primer oligonucleotide
corresponding to nucleotides 326347 of rat 17ßHSD
(ATTTTACCAGAGAAGACATCTA) by reverse transcriptase and 3'-end tailed
with deoxy-CTP using terminal deoxynucleotidyltransferase, followed by
PCR with reverse primer 288309 nucleotides of the rat 17ßHSD
(GAGGACCACTGGAAGCCGTGTG) and forward dG adaptor primer
(GGCCACGCGTCGACTAG-TACGGGIIGGGIIGGGIIG). The PCR product of 309 bp
was cloned into TA cloning vector (Invitrogen, San Diego, CA) and
sequenced. Thereafter, to obtain a full-length cDNA, a fragment was
isolated by digestion with EcoRI (restriction site at the TA
vector) and Sau96I (within insert) and ligated to a 820-bp
Sau96I site of the initial isolated 17ßHSD cDNA clone. The
nucleotide sequence of the full-length cDNA was verified by sequence
analysis. The full-length 17ßHSD in pBK expression plasmid
driven by cytomegalovirus promoter (Stratagene, La Jolla,
CA) was used in expression studies.
Animal treatment and Leydig cell preparation
Adult male rats (200250 g; Charles River Laboratories, Inc., Wilmington, MA) were housed in pathogen-free, temperature-
and light-controlled conditions (20 C; alternating 14-h light, 10-h
dark cycles). All animal studies were approved by the NICHHD animal and
care and use committee (protocols 97039 and 97041). The male adult
rats were given single sc injections of various doses of Pregnyl
(Organon, West Orange, NJ): 0.1, 1, and 25 IU, equivalent
to 0.01, 0.1, and 2.5 µg purified hCG, in 100 µl of Dulbeccos
PBS. hCG international units (IU) are equivalent to hCG USP (United
States Pharmacopea unit). Control animals were injected with vehicle
alone. Animals were killed by asphyxiation with CO2 and
decapitated 24 h after hCG treatment unless otherwise indicated.
Leydig cells were prepared by collagenase dispersion and purified by
centrifugal elutriation, as previously described (17). These cells were
immediately frozen on dry ice and maintained at -70 C until extraction
of RNA. In vivo ovarian luteinization and down-regulation of
LH receptor (LHR) and LHR mRNA was induced by sequential PMSG/hCG
treatment of 21-day-old female rats (Sprague Dawley, Charles River Laboratories, Inc., Wilmington, MA) following established
protocols (22). The animals received a sc injection of 50 IU PMSG, a
preparation rich in FSH activity that produces follicular maturation,
followed 65 h later by injection of 25 IU hCG
(superovulation/luteinization). Six days later, the animals
received a second injection of 25 IU hCG (LHR down-regulation,
steroidogenic desensitization). Animals were killed, and their ovaries
were removed, rapidly frozen, and preserved at -70 C until RNA
extraction.
Ribonuclease (RNase) protection analysis
The RNase protection assay was performed by established
methodology (23). The 17ßHSD complementary RNA (cRNA) probes were
generated by PCR followed by subcloning. Primers F2 (5-ATGTTGTACTTA
TCAGCCGGACAC-3) and R5
(5-AAATGTGCACACAAAAGCCTTGGAAGCTGAGTA-3) were used to
amplify the fragment complementary to the coding region from 230633
nucleotides relative to the translational start site of 17ßHSD.
Primers of 5-GCTACAGCTTCACCAC CACA-3 and 5-GGTCTTTACGGATGTCAACG-3,
located at exons 4 and 5, respectively, of the rat ß-actin gene (24),
were employed to amplify the ß-actin fragment used as an internal
control for the RNase protection assay. The fragments were cloned into
pGEM vector (Promega Corp., Madison, WI) and verified by
sequencing. The constructs were linearized by the digestion with
SpeI. The cRNA probes were produced by in vitro
transcription with RNA polymerase T7 (Life Technologies)
following the manufacturers protocol and labeled by
[32P]UTP (800 Ci/mmol; ICN Biomedicals, Inc., Costa Mesa, CA). Ten micrograms of total RNA samples were
applied for hybridization. Ribonuclease T1 (Life Technologies) and ribonuclease A (Amersham,
Arlington Heights, IL) were used for the digestion of unhybridized RNA
and cRNA probe. The protected fragments were resolved on a 6%
sequencing gel, dried, and autoradiographed for visual evaluation only.
Bands were quantified by phosphorimage analysis using PhosphorImager
Scanner model Storm 860 from Molecular Dynamics, Inc.
(Sunnyvale, CA).
Northern blot and mRNA half-life analysis
mRNA was extracted from rat Leydig cells and from various male
and female rat tissues using the Invitrogen isolation method (Carlsbad,
CA). The mRNA samples (10 µg for each lane) were resolved on 1%
agarose gels and transferred onto a Gene Screen membrane (Biotechnology
System NEN Research Products, Boston, MA). The fixed membrane was
prehybridized with 0.5 M phosphate buffer (pH 7.0)
containing 0.1 mM EDTA, 0.5% BSA, and 7% SDS at 50 C for
3 h and hybridized with a 32P-labeled PCR-generated
403-bp fragment (230633 bp) at 50 C overnight. Thereafter, the
membrane was washed twice in 2 x SSC (standard saline
citrate)-0.1% SDS at 50 C for 15 min each and twice in 0.5 x
SSC-0.1% SDS for 10 min each. In experiments investigating the
half-life of the 17ßHSD mRNA, cells were incubated with 10 µg/ml
actinomycin D for 0, 1, 3, 6, and 10 h in medium 199/0.1% BSA.
Ten micrograms of mRNA samples were resolved as described above.
Hybridization was recorded by radioautography and quantified by
phosphorimage analysis. The half-life of mRNA was calculated by linear
regression analysis.
The expression of 17ßHSD type III in the ovary was followed by RT-PCR
analysis using total RNA of ovaries at different times after treatment
of animals with two doses of hCG (2.5 µg). RNA (1 µg) was reverse
transcribed using random hexamers and Superscript II RNase H reverse
transcriptase. Paired primers corresponding to nucleotide positions
6181 and 311331 of 17ßHSD cDNA were used to amplify the 270-bp
fragment. Also, primers corresponding to exons 4 and 5 of ß-actin
(24) were used to amplify a 290-bp fragment for use as an internal
control. PCR products were analyzed in 3% agarose gels.
Nuclear run-off assay
Nuclei were isolated from batches of 50 x 106
rat Leydig cells from rats injected with or without 2.5 µg hCG were
prepared as previously described and suspended in 50 mM
Tris-HCl (pH 8.3), 40% glycerol, and 5 mM
MgCl2 (16). Nuclear RNA was labeled by in vitro
transcription as previously described (25). Two hundred microliters of
Leydig cell nuclear extracts (30 x 106 nuclei) were
incubated with 20 µl [
-32P]UTP (3000 Ci/mmol; 10
mCi/ml; from DuPont NEN) and 200 µl buffer containing 10
mM Tris-HCl (pH 8); 5 mM MgCl2; 0.3
M KCl; and 1 mM each of unlabeled ATP, CTP, and
GTP for 30 min at 30 C. After deoxyribonuclease I and proteinase K
treatments, the labeled transcripts were extracted by
phenol-chloroform-isoamyl alcohol (25:24:1) and subsequently
subjected to chromatography on G-25 columns to remove free nucleotides.
The linearized complementary DNA fragments of 17ßHSD type III,
ß-actin, and pGEM vector were immobilized to the nitrocellulose
membranes using a slot blot apparatus. The labeled RNA (3 x
106 cpm) were then hybridized to the membranes in 2 ml
hybridization buffer (10 mM
N-Tris[hydroxymethyl]methyl-2-aminoethanesulfonic
acid, 10 mM EDTA, 0.2% SDS, and 0.3 M
NaCl) for 20 h at 60 C. The membranes were washed with 2 x
SSC and exposed to Kodak x-ray film (Eastman Kodak Co.,
Rochester, NY) at -70 C with intensifier screens. The densities of the
bands were quantified by phosphorimage analysis.
Transient expression of rat 17ßHSD type III in mammalian
cells
Expression studies were performed in COS-1 and 293 cells
(American Type Tissue Collection, Manassas, VA). The cells were plated
into six-well plates in DMEM supplemented with 10% FBS, penicillin
(100 IU/ml), and streptomycin (100 IU/ml) and were transfected at
approximately 7080% confluence using DOTAP
(N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl
ammonium methyl sulfate) following the manufacturers procedure
(Boehringer Mannheim, Indianapolis, IN). Briefly, empty
vector (pBK) or pBK-17HSD (2 µg/well each) were incubated for 15 min
with 15 µg/well DOTAP in 140 µl HBS (20 mM
HEPES containing 150 mM NaCl, pH 7.4). After
incubation, the reaction mixture was added to wells containing 2 ml
OPTI-MEM I (Life Technologies, Inc.). Transfection
was carried out for 5 h; subsequently, OPTI-MEM I was replaced by
fresh DMEM, and cells were further cultured for 48 h.
Measurement of 17ßHSD activity
Both reductive and oxidative activities of 17ßHSD were
measured essentially as previously described (4, 12) in Leydig cells
and in transiently transfected COS-1 and 293 cells with 17ßHSD cDNA
(see above). Enzyme activity assays were performed by addition to cell
suspensions (Leydig cells) and cell cultures (COS-1 and 293 cells) of 2
µM 14C-labeled substrate in the presence of 5
µM of the respective unlabeled substrates:
androstenedione (53.86 mCi/mmol), testosterone (mCi/mmol),
dehydroepiandrosterone (54 mCi/mmol), estrone (57 mCi/mmol), and
estradiol (54 mCi/mmol), purchased from DuPont NEN
(Boston, MA). Forty-eight hours after transfection, cell cultures were
washed three times with serum and glucose-free DMEM-0.1% BSA. Enzyme
activity was determined in 1 ml DMEM-0.1% BSA in the presence or
absence of 5.8 mM glucose. The Leydig cells were first
incubated with 100 µg/ml aminoglutethimide (Sigma Chemical Co., St. Louis, MO) for 15 min to block steroid metabolism early
(cholesterol side-chain cleavage) and distally (aromatase) in the
pathway (26). This was followed by incubation with
14C-labeled androstenedione (2 µM) and
unlabeled substrate (5 µM) in HEPES buffer (5
mM; pH 7.4) containing 4 mM KCl, 140
mM NaCl, 1 mM MgCl2, 2.5
mM CaCl2, 5.8 mM glucose, and 0.1%
BSA with the addition of substrate(s) (see above). After incubation for
the designated times, the media were collected, and steroids were
extracted with ethyl acetate and separated on silica-coated TLC plates
with chloroform and ethyl acetate (3:1, vol/vol) as previously
described (12). Plates were exposed to x-ray films for visual record
only. The radioactivities corresponding to unconverted steroid
substrates and products in the TLC plate were quantified by
phosphorimage analysis.
The LHR binding studies included in Fig. 5
are taken from our recent
report (16) and are presented for comparison with the changes observed
in 17ßHSD gene expression. The materials obtained for analysis were
derived from the same experiments. LH receptor binding presented in
Fig. 4
was performed as previously described (16).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 5. Temporal analysis of 17ßHSD gene expression by
hCG in rat Leydig cells. Leydig cells were obtained and purified from
male rat at different times after sc injection of vehicles (control) or
2.5 µg hCG at different times. A, [125I]LH/hCG binding
activity in rat Leydig cells was measured after releasing endogenous
bound hCG with acid-glycine treatment. LHR binding activity was
expressed as a percentage (mean ± SE) relative to the
control value. A is taken from Ref. 16 and has been placed here for
comparative purposes. B, 17ßHSD mRNA level was determined by RNase
protection (403 bp) at 1, 4, and 12 h after in vivo
hCG treatment and by Northern analysis (1.4 kb) on days 1, 4, and 9.
Results were normalized by ß-actin gene expression and are expressed
as a percentage (mean ± SE) relative to the control
value. The representative data shown are from one of three individual
experiments, each performed in triplicate.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Figure 4. Dose-dependent hCG regulation of 17ßHSD gene
expression by RNase protection assay. RNA samples were prepared from
Leydig cells of rats 24 h after treatment with a single sc
injection of different doses of hCG (0.01, 0.1, and 2.5 µg) or
vehicle (control). RNA samples (10 µg) were hybridized to the
32P-labeled 17ßHSD probe and ß-actin probe (control).
The protected fragment was resolved in a denaturing sequencing gel,
recorded by autoradiography by visual display (middle
panel), and quantified by phosphorimager (lower
panel). Data are presented as the mean ± SE
relative to the saline control of triplicate determinations and are
from one of three individual experiments. Counts of 17ßHSD were
normalized to ß-actin. LHR binding activity was determined by binding
of [125I]hCG to intact Leydig cells in suspension and
expressed as a percentage (mean ± SE) relative to the
control value (upper panel).
|
|
All experiments were performed three times in triplicate unless
specified. Results are the mean ± SE. Statistical
significance was evaluated by ANOVA followed by Duncans multiple
range test.
 |
Results
|
|---|
Molecular cloning of rat 17ßHSD type III cDNA
A full-length cDNA (1111 bp) of 17ßHSD was cloned from a rat
Leydig cell cDNA library. It contains 21 bases of 5'-untranslated
sequence, an open reading frame of 918 nucleotides encoding an
hydrophobic protein of 306 amino acids with an apparent molecular
mass of 33.7 kDa, and 172 bases of 3'-untranslated region (Fig. 1A
; GenBank accession no. AF035156).
The sequence identity between the rat type III 17ßHSD and
previously cloned human and mouse type III 17ßHSD is shown in Fig. 1B
. Pairwise comparison of rat type III to human and mouse displays an
overall 75% and 85% amino acid similarity, respectively (Fig. 1B
).
The encoded protein contains a region of homology to the short chain
alcohol dehydrogenase super family (amino acids 174225) with the
conserved YXXXK structure (amino acids 194) found in all members of
short chain alcohol dehydrogenase/reductase family. The N-terminal of
17ßHSD contains a putative secretory signal sequence of 20 amino
acids. Two putative transmembrane helixes are predicted at amino acid
position 221 close to the N-terminus, and at amino acid
position 255277 close to the C-terminus. The primary structure
also shows the presence of four potential N-linked
glycosylation sites (amino acids 153, 178, 236, and 302), four
potential PKC sites (amino acids 170, 237, 251, and 287), three casein
kinase II sites (amino acids 104, 142, and 243), and at least three
potential sites for phosphorylation by cAMP-dependent protein kinase
and cGMP-dependent protein kinase (27) at amino acids 61, 256, and 296.
A consensus NADPH binding motif (GXXXGXG) is located at amino acids
5157 (PC Gene PROSITE program).

View larger version (53K):
[in this window]
[in a new window]
|
Figure 1. Nucleotide sequence of cDNA encoding rat 17ßHSD
type III and deduced amino acid sequence. A, Nucleotides are numbered
at the right with position 1 assigned to the first nucleotide in the
cloned cDNA. Initiation codon ATG is at nucleotide position 22. *, Stop
codon. B, Amino acid alignment of rat (R), human (H), and mouse (M)
17ßHSD type III. Differences in the sequences are boxed. SCAD, The
conserved region characteristic of members of the short chain alcohol
dehydrogenase superfamily. , NADPH binding motif. TM1 and -2,
Putative transmembrane region. *, Potential
N-glycosylation site. , Potential protein kinase C.
, Casein kinase II. , Sites for cAMP- and cGMP-dependent protein
kinases.
|
|
Tissue distribution of 17ßHSD type III
Northern analysis revealed the presence of a single mRNA
transcript of 1.4 kb only in rat Leydig cells (Fig. 2
). The molecular size of the mRNA is
slightly higher than the 1.1-kb 17ßHSD cDNA isolated from the rat
Leydig cell library (Fig. 2A
). This difference may be due to the
presence of additional sequences at the 5'- and/or 3'-end in the mRNA.
Only using RT-PCR amplification, a minor band of 17ßHSD mRNA could be
detected in rat ovaries at 9 and 24 h after PMSG administration
and after hCG treatment in rats with superovulated/luteinized ovaries
(Fig. 2B
).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 2. Tissue distribution of 17ßHSD type III mRNA. A,
Polyadenylated RNA (10 µg) from several tissues of adult male and
female rat was subjected to Northern blot analysis. The loading of the
RNA was monitored by hybridization of ß-actin. B, RT-PCR analysis in
rat ovary and Leydig cells. RNA samples extracted from rat Leydig cells
and from ovaries of rat treated with hormones (see Materials and
Methods and diagram in this figure) were reverse transcribed as
described in Materials and Methods. RT-PCR transcripts
of Leydig cell RNA was used as a positive control.
|
|
Transient expression of 17ßHSD in COS-1 cells
The cloned 17ßHSD enzyme significantly converted androstenedione
to testosterone in transfected COS-1 cells (Fig. 3
). The time-course study revealed
significant 17ßHSD activity within 15 min of substrate addition in
the presence of glucose in the medium compared with that in cells
incubated in the absence of glucose or cells transfected with vector
only. A further increase in activity was observed in the presence of
glucose at the 60 min point and reached a plateau at 120 min. In the
absence of glucose, the enzyme activity was undetectable at 15 and 30
min and increased at 60 and 240 min to 29% and 65%, respectively, of
the activity observed in the presence of glucose. Overall, the 17ßHSD
activity in COS-1 cells was significantly increased by the addition of
glucose in the medium throughout the time examined (P
< 0.001; Fig. 3
).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 3. Activity of 17ßHSD in transiently transfected
mammalian COS-1 cells. Cells were transfected with pBK (control) and
pBK-17ßHSD for 48 h. Subsequently, the 17ßHSD enzyme activity
was measured in culture cells incubated for 04 h in DMEM-0.1% BSA
medium with or without 5.8 mM glucose at different time
intervals. [14C]Androstenedione (A; 2 µM)
was used as substrate. The substrate [14C]androstenedione
and product [14C]testosterone (T) were separated by TLC,
and radioactivity from product and substrate were quantified by
phosphorimager analysis. Values are the mean ± SE of
triplicate determinations from a representative experiment. Three
separate experiments were performed. G, Glucose.
|
|
Substrate specificity for cloned 17ßHSD cDNA
To assess the catalytic properties of the enzyme, the substrate
specificity for the cloned 17ßHSD expressed in different
mammalian cells was evaluated. 14C-labeled steroids
(androstenedione, testosterone, dihydroepiandrosterone,
estrone, and estradiol) were used as substrates (Table 1
). The rat type III isozyme
catalyzed the reductive reaction almost exclusively with substrate
preference for androstenedione over dihydroepiandrosterone in both cell
types employed. Estrogen failed to serve as a substrate for the cloned
17ßHSD enzyme.
In vivo regulation of 17ßHSD activity by hCG in rat testicular
Leydig cells
To gain insights into gonadotropin regulation of 17ßHSD gene
expression, we initially examined the activity of the enzyme in Leydig
cells 24 h after single sc injections of various doses of hCG to
adult rats. Administration of 0.012.5 µg hCG caused dose-dependent
inhibition of 17ßHSD mRNA steady state levels (Fig. 4
). A small, but significant, inhibition
of 17ßHSD mRNA levels was observed even at low doses of hCG (by 30%;
P < 0.007 at 0.01 µg hCG; P < 0.003
at 0.1 µg hCG), and marked down-regulation was induced by the high
dose of hCG (2.5 µg; by
80%; P < 0.001).
Temporal analysis of 17ßHSD gene expression using the high dose hCG
(2.5 µg) showed no significant changes in 17ßHSD mRNA levels at 1
and 4 h (P > 0.05), whereas these were
significantly inhibited at 12 and 24 h (P <
0.001) and recovered to control levels on day 9 post-hCG treatment
(Fig. 5B
). It is important to note that
the significant reduction of 17ßHSD gene expression (Fig. 5B
) at
12 h preceded the major down-regulation of LH/hCG receptors
observed at 24 h (Fig. 5A
). This result suggests that regulation
of 17ßHSD gene transcription is not related to the loss of
hormone-binding sites. Furthermore, the 17ßHSD enzyme activity was
inhibited at 12 h by 30% (P < 0.001; Fig. 6
), and a further reduction was observed
at 24 h (to 25% of controls; P < 0.001).
Although major reductions in 17ßHSD mRNA levels were observed at 12
and 24 h, the enzyme activity was only moderately reduced at
12 h, whereas a marked decrease was observed at 24 h (Fig. 5
).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 6. A, Down-regulation of enzymatic activity of
17ßHSD by hCG in rat Leydig cells. Leydig cells were obtained from
male rats injected sc with vehicle (control) or 2.5 µg hCG and
obtained at different times (1, 4, 12, and 24 h) after treatment.
Intact cells (1 x 106 cells) after preincubation with
aminoglutethimide (100 µg) were incubated with 2 µM
[14C]androstenedione (A) and 5 µM unlabeled
A for 60 min in the presence of 5.8 mM glucose. The
substrate [14C]A and product
[14C]testosterone (T) were separated by TLC, and
radioactivity from product and substrate were recorded by
autoradiography for visual display (upper panel). TLCs
were quantified by phosphorimager analysis (lower
panel). Results represent the percent conversion to
testosterone from androstenedione relative to the control value. A
representative experiment (mean ± SE) of triplicates
is shown. Three separate such experiments were performed. B,
Comparative profiles of type III 17ßHSD and 3ßßHSD enzyme
activities after administration of a single dose of hCG (2.5 µg).
Results for 3ßHSD are from our previous study (16 ) and used for
comparative purpose in the Discussion.
|
|
Transcriptional regulation of 17ßHSD activity by hCG
We further investigated whether a transcriptional or
posttranscriptional mechanism was involved in the hCG-induced
down-regulation of 17ßHSD gene expression in Leydig cells (Fig. 7
). To determine whether the
gonadotropin-induced decline in steady state levels of 17ßHSD mRNA
was due to increased mRNA degradation, mRNA stability was evaluated
after the addition of actinomycin D to control and hCG-treated groups.
Significant reduction of 17ßHSD gene expression by hCG was observed
at all times after actinomycin D treatment (P <
0.001). The rates of degradation were similar for the two groups, with
half-lives of 3.8 and 3.5 h for the control and hCG-treated
groups, respectively (Fig. 7A
).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 7. Determination of the effect of hCG on 17ßHSD
mRNA stability (A) and transcription rate (B) in rat Leydig cells. A,
Leydig cells were obtained from male rats 12 h after sc injection
of vehicle (control) or 2.5 µg hCG. Cells were incubated with 10
µg/ml actinomycin D for 0, 1, 3, 6, and 10 h in medium 199 with
0.1% BSA. The mRNA samples were isolated and analyzed by Northern
analysis. Results were recorded by autoradiography for visual display
(upper panel) and quantified by phosphorimage analysis
(lower panel). B, Run-off transcription assays of nuclei
obtained from rat Leydig cells at 24 h after in
vivo vehicle (control) or 2.5 µg hCG treatment. The in
vitro transcribed [32P]UTP-labeled RNA sample
were hybridized to immobilized cDNA corresponding to 10 and 20 µg
17ßHSD, ß-actin, and vector. The corresponding hybridization
results are shown in the upper panel. Results were
quantified by phosphorimager, normalized by ß-actin, and expressed as
a percentage of the control value (lower panel). Values
in A and B are the mean ± SE of triplicate
determinations from a representative experiment of three experiments
performed.
|
|
Nuclear run-off assays showed that newly synthesized mRNA was
significantly reduced (P < 0.01) in hCG-treated Leydig
cells compared with control cells (Fig. 7B
).
 |
Discussion
|
|---|
These studies have provided information about the primary
structure, tissue distribution, and characterization of the rat
testicular type III 17ßHSD enzyme. Furthermore, relevant aspects of
the hormonal regulation of type III 17ßHSD gene expression in Leydig
cell were elucidated. The amino acid sequence of the cloned rat type
III 17ßHSD displays a high degree of overall homology to those
reported for the human and mouse enzymes (8, 9). This includes the
sequence common to the short chain alcohol dehydrogenase family, and
other motifs such as Tyr-X (3)-Lys (amino acid position 194198) and
Gly-X (3)-Gly-X-Gly (amino acid position 5157), which have been
proposed to participate in the catalytic reaction and to be associated
with cofactor binding, respectively (28). However, the rat type III
17ßHSD and other isoforms (I II, IV, VI, and VII) share little amino
acid similarity except for the common short chain alcohol dehydrogenase
sequence (2, 3, 4, 6, 7, 28, 29).
The highest expression of rat 17ßHSD type III mRNA was observed in
the Leydig cells, in contrast to the ovary, where it could only be
detected by RT-PCR amplification. This is consistent with a previous
report that the human type III 17ßHSD was only detected in the testis
(8). However, the mouse type III form detected by RT-PCR was reported
to be ubiquitously expressed in gonadal and nongonadal tissues, with
highest expression in the testis (9). The low level of mRNA expression
observed in murine nongonadal tissues indicates their potential
capacity for conversion of 17-ketosteroids to 17-hydroxysteroids.
The apparent difference in tissue distribution patterns between species
is in part attributable to the level of sensitivity of the analysis
employed (Northern blot vs. RT-PCR amplification). In the
gonads (ovary vs. testis), the catalytic activity of
17ßHSD is dependent on the presence of the specific isoform and the
level of its expression. Previous expression studies (8, 30, 31) have
shown that the various isoforms will catalyze the conversion of both
C19 and C18 steroids with different affinities.
The type I isoform displays high affinity for the reduction of
C18 steroids, whereas the type III enzyme reduces
C19 steroids with high affinity. In this study, the rat
type III isozyme was mainly responsible for the synthesis of
testosterone. This enzyme prefers androstenedione (C19) as
a substrate, and its failure to convert C18 steroids
(e.g. estrone to estradiol or vice versa)
demonstrated that the cloned rat type III 17ßHSD possesses catalytic
activity only for androgen formation (Table 1
). The findings of the
present study, which have demonstrated that the main function of the
rat type III enzyme is the testicular production of testosterone, and
those of previous reports (8, 30, 31), indicating that the type I
isoform is expressed mainly in the ovary and catalyzes the conversion
of estrone to estradiol, are consistent with the low expression of the
type III enzyme found in the ovary.
When transiently expressed in COS-1 cells, type III 17ßHSD displayed
catalytic activity that was markedly stimulated by the presence of
glucose in the medium. This finding indicated that the cloned enzyme
had similar requirements to the endogenous Leydig cell enzyme, where
the integrity of the glucose transport system and the viability of the
glycolytic pathway for ATP generation are necessary for optimal
17ßHSD activity at the final step of androgen pathway (12). However,
no such requirement was observed for other enzymes of the steroidogenic
pathway (12). Thus, further investigation with the cloned enzyme should
reveal the extent to which posttranslational events, such as
phosphorylation or ATP binding, are of relevance to the control of
17ßHSD activity in the Leydig cell.
Hormonal regulation of 17ßHSD gene expression in rat Leydig cells
became evident during our investigation of hCG action on 17ßHSD mRNA
expression and activity as components of steroidogenic desensitization.
These studies demonstrated a gonadotropin-induced steroidogenic block
at the level of conversion of androstenedione to testosterone by
17ßHSD in rat Leydig cells, in addition to the impairment of other
steroidogenic enzymes, including 3ßHSD (16) and
17
-hydroxylase/lyase (14, 15). In intact animals, treatment with hCG
inhibited 17ßHSD type III gene expression in a dose-dependent manner.
This reduction was observed even with low doses of the hormone 24
h after treatment (0.01 and 0.1 µg/hCG; by 40%). This is in contrast
with the lack of effect of low doses of hormone on 3ß-hydroxysteroid
dehydrogenase type II gene expression (16). The high dose of hCG (2.5
µg) reduced 17ßHSD mRNA levels significantly after 12 h, and a
further decrease was observed at 24 h followed by recovery over
several days. The reduction at 12 h preceded the major decrease in
LH receptors induced by the hormone, which occurred at 24 h,
indicating that the former change was not related to receptor
down-regulation. Moreover, with the lower doses of the hormone (0.01
and 0.1 µg/hCG) the changes in 17ßHSD mRNA levels were not
accompanied by changes on the LHR, further confirming the lack of
dependence between these parameters. The hormone-induced reduction of
17ßHSD gene expression resulted in decreased 17ßHSD activity and
probably contributed to the in vitro decrease in
testosterone responses to hCG in rat Leydig cells (13). Although major
reductions in 17ßHSD mRNA levels (by 60%) were observed at 12
h, the activity of the enzyme was only modestly reduced (by 30%).
However, at 24 h the major decrease in mRNA (by 80%) was
consistent with the changes in enzyme activity. Overall, the changes
observed in 17ßHSD mRNA and enzyme activity were noted at later times
than those in 3ßHSD (12 vs. 4 h).
These studies have shown that hCG treatment decreased the incorporation
of [
-32P]UTP into 17ßHSD transcripts in total
nuclear RNA and had no effect on the apparent half-life of the enzyme,
indicating that the loss of 17ßHSD type III gene expression results
from an inhibitory action of hCG at the transcriptional level. It is
possible that the consequences of desensitization by hCG include
changes in transcriptional regulation of the steroidogenic enzymes
through a common control mechanism. The promoter domain and 5'-flanking
region of 17ßHSD type III gene and the mechanisms of its regulation
have not been determined. However, the control of this enzyme could be
exerted directly or indirectly by the actions of steroid products or
second messengers elicited by the hormonal stimulus.
In conclusion, the present study describes the cloning and
characterization of the rat type III 17ßHSD. Furthermore, we have
demonstrated that the Leydig cell enzyme is down-regulated at the
transcriptional level by gonadotropin. The cloning of the rat type III
17ßHSD will permit further elucidation of the structural requirements
that influence the enzymatic activity of the gene product.
 |
Footnotes
|
|---|
1 Both authors contributed equally to the study. 
Received January 22, 1999.
 |
References
|
|---|
-
Labrie F, Simard J, Luu-The V, Pelletier G, Belghmi
K, Belanger A 1994 Structure, regulation and role of
3ß-hydroxysteroid dehydrogenase, 17ß-hydroxysteroid dehydrogenase
and aromatase enzymes in the formation of sex steroids in classical and
peripheral intracrine tissues. Bailliere Clin Endocrinology Metab 8:451474
-
Penning TM 1997 Molecular endocrinology of
hydroxysteroid dehydrogenase. Endocr Rev 18:281305[Abstract/Free Full Text]
-
Andersson S 1995 17ß-Hydroxysteroid
dehydrogenase:isozymes and mutations. J Endocrinol 146:197200[Medline]
-
Luu-The V, Zhang Y, Poirier D, Labrie F 1995 Characteristics of human types 1,2- and 3,17ß-hydroxysteroid
dehydrogenase activities: Oxidation/reduction and inhibition. J Steroid
Biochem Mol Biol 55:581587[CrossRef][Medline]
-
Deyashiki Y, Ohshima K, Nakanishi M, Sato K, Matsuura
K, Hara A 1995 Molecular cloning and characterization of mouse
estradiol 17ß-dehydrogenase (A-specific), a member of the
aldoketoreductase family. J Biol Chem 270:1046110467[Abstract/Free Full Text]
-
Biswas MG, Russell DW 1997 Expression cloning and
characterization of oxidative 17ß- and 3
-hydroxysteroid
dehydrogenases from rat and human prostate. J Biol Chem 272:1595915966[Abstract/Free Full Text]
-
Nokelainen P, Peltoketo H, Vihko R, Vihko P 1998 Expression cloning of a novel estrogenic mouse 17ß-hydroxysteroid
dehydrogenase/17-ketosteroid reductase (m17HSD7), previously described
as a prolactin receptor-associated protein (PRAP) in rat. Mol
Endocrinol 12:10481059[Abstract/Free Full Text]
-
Geissler WM, Davis DL, Wu L, Bradshaw KD, Patel S,
Mendonca BB, Elliston KO, Wilson JD, Russell DW, Andersson S 1994 Male pseudohermaphroditism caused by mutations of testicular
17ß-hydroxysteroid dehydogenase 3. Nat Genet 7:3439[CrossRef][Medline]
-
Sha JA, Dudley K, Rajapaksha WRAKJS, OShaughnessy
PJ 1997 Sequence of mouse 17ß-hydroxysteroid dehydrogenase type
3 cDNA and tissue distribution of the type 1 and type 3 isoform mRNAs.
J Steroid Biochem Mol Biol 60:1924[CrossRef][Medline]
-
Moghrabi N, Andersson S 1998 17ß-hydroxysteroid dehydrogenase: physiological roles in
health and disease. Trends Endocrinol Metab 9:265270[Medline]
-
Andersson S, Geissler WM, Wu L, Davis DL, Grumbach MM,
New MI, Schwarz HP, Blethen SL, Mendonca BB, Bloise W, Witchel SF,
Cutler Jr GB, Griffin JE, Wilson JD, Russell DW 1996 Molecular
genetics and pathophysiology of 17ß-hydroxysteroid
dehydrogenase 3 deficiency. J Clin Endocrinol Metab 81:130136[Abstract]
-
Khanum A, Buczko E. Dufau ML 1997 Essential role of
adenosine triphosphate in activation of 17ß-hydroxysteroid
dehydrogenase in the rat Leydig cell. Endocrinology 138:16121620[Abstract/Free Full Text]
-
Dufau ML 1988 Endocrine regulation and
communicating functions of the Leydig cell. Annu Rev Physiol 50:483508[CrossRef][Medline]
-
Cigorraga SB, Dufau ML, Catt KJ 1978 Regulation of
luteinizing hormone receptors and steroidogenesis in
gonadotropin-desensitized Leydig cells. J Biol Chem 253:42974304[Free Full Text]
-
Dufau ML, Cigorraga S, Baukal AJ, Bator JM, Sorrell S,
Neubauer JF, Catt KJ 1979 Steroid biosynthetic lesions in
gonadotropin-desensitized Leydig cells. J Steroid Biochem 11:193199[CrossRef][Medline]
-
Tang PZ, Tsai-Morris CH, Dufau ML 1998 Regulation
of 3ß-hydroxysteroid dehydrogenase in gonadotropin-induced
steroidogenic desensitization of Leydig cells. Endocrinology 139:44964505[Abstract/Free Full Text]
-
Aquilano DR, Dufau ML 1984 Functional and
morphological studies on isolated Leydig cells: purification by
centrifugal elutriation and metrizamide fractionation. Endocrinology 114:499510[Abstract]
-
Tsai-Morris CH, Buczko E, Wang W, Dufau ML 1990 Intronic nature of the rat luteinizing hormone receptor gene defines a
soluble receptor subspecies with hormone binding activity. J Biol
Chem 265:1938519388[Abstract/Free Full Text]
-
Sambrook J, Fritsch EF, Maniatis T 1989 In
Molecular Cloning: A Laboratory Manual, ed 2. Cold Spring Harbor
Laboratory, Cold Spring Harbor, pp 108113
-
Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing
with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:54635467[Abstract/Free Full Text]
-
Frohman MA 1990 RACE: rapid amplification of cDNA
ends. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR
Protocols. Academic Press, New York, pp 2838
-
Conti M, Harwood JP, Dufau ML, Catt KJ 1977 Effect
of gonadotropin induced receptor regulation on biological responses of
isolated rat luteal cells. J Biol Chem 252:88698874[Free Full Text]
-
Gilman L 1987 Ribonuclease protection assay. In:
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA,
Struhl K (eds) The Current Protocol in Molecular Biology. Greene and
Wiley-Interscience, New York, pp 4.7.14.7.8
-
Nudel U, Zakut R, Shani M, Neuman S, Levy Z, Yaffe
D 1983 The nucleotide sequence of the rat cytoplsmic ß-actin
gene. Nucleic Acids Res 11:17591771[Abstract/Free Full Text]
-
Greenberg ME, Bender TP 1990 Nuclear runoff
transcription in mammalian cells. In: Ausubel FM, Brent R, Kingston RE,
Moore DD, Seidman JG, Smith JA, Struhl K (eds) The Current Protocol in
Molecular Biology. Greene and Wiley-Interscience, New York, pp
4.10.14.10.9
-
Aquilano DR, Tsai-Morris CH, Hattori M, Dufau ML 1995 Mitochondrial cholesterol availability during tropic
hormone-induced Leydig cell desensitization. Endocrinology 116:17451754[Abstract]
-
Pearson R, Kemp BE 1991 Protein kinase
phosphorylation site sequences and consensus specificity motifs:
tabulations. Methods Enzymol 200:6281[Medline]
-
Krozowski Z 1992 11ß-Hydroxysteroid dehydrogenase
and the short-chain alcohol dehydrogenase (SCAD) superfamily. Mol Cell
Endocrinol 84:C2531
-
Bairoch A 1992 Prosite: a dictionary of sites and
patterns in proteins. Nucleic Acids Res 20:20132018
-
Nokelainen P, Puranen T, Peltoketo H, Orava M, Vihko P,
Vihko R 1997 Molecular cloning of mouse 17ß-hydroxysteroid
dehydrogenase type 1 and characterization of enzyme activity. Eur
J Biochem 236:482490[Medline]
-
Akinola LA, Poutanen M, Vihko R 1996 Cloning of rat
17ß-hydroxysteroid dehydrogenase type 2 and characterization of
tissue distribution and catalytic activity of rat type 1 and type 2
enzymes. Endocrinology 137:15721579[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
J. F. Couse, M. M. Yates, K. F. Rodriguez, J. A. Johnson, D. Poirier, and K. S. Korach
The Intraovarian Actions of Estrogen Receptor-{alpha} Are Necessary to Repress the Formation of Morphological and Functional Leydig-Like Cells in the Female Gonad
Endocrinology,
August 1, 2006;
147(8):
3666 - 3678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R Mindnich, F Haller, F Halbach, G Moeller, M H. de Angelis, and J Adamski
Androgen metabolism via 17{beta}-hydroxysteroid dehydrogenase type 3 in mammalian and non-mammalian vertebrates: comparison of the human and the zebrafish enzyme
J. Mol. Endocrinol.,
October 1, 2005;
35(2):
305 - 316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Couse, M. M. Yates, R. Sanford, A. Nyska, J. H. Nilson, and K. S. Korach
Formation of Cystic Ovarian Follicles Associated with Elevated Luteinizing Hormone Requires Estrogen Receptor-{beta}
Endocrinology,
October 1, 2004;
145(10):
4693 - 4702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Samson, F. V. Peale Jr., G. Frantz, N. Rioux-Leclercq, E. Rajpert-De Meyts, and N. Ferrara
Human Endocrine Gland-Derived Vascular Endothelial Growth Factor: Expression Early in Development and in Leydig Cell Tumors Suggests Roles in Normal and Pathological Testis Angiogenesis
J. Clin. Endocrinol. Metab.,
August 1, 2004;
89(8):
4078 - 4088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Couse, M. M. Yates, V. R. Walker, and K. S. Korach
Characterization of the Hypothalamic-Pituitary-Gonadal Axis in Estrogen Receptor (ER) Null Mice Reveals Hypergonadism and Endocrine Sex Reversal in Females Lacking ER{alpha} But Not ER{beta}
Mol. Endocrinol.,
June 1, 2003;
17(6):
1039 - 1053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tena-Sempere, M. L. Barreiro, L. C. Gonzalez, F. Gaytan, F.-P. Zhang, J. E. Caminos, L. Pinilla, F. F. Casanueva, C. Dieguez, and E. Aguilar
Novel Expression and Functional Role of Ghrelin in Rat Testis
Endocrinology,
February 1, 2002;
143(2):
717 - 725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P.-Z. Tang, C.-H. Tsai-Morris, and M. L. Dufau
Cloning and characterization of a hormonally regulated rat long chain acyl-CoA synthetase
PNAS,
May 24, 2001;
(2001)
121046998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. O'Shaughnessy, P. J. Baker, M. Heikkila, S. Vainio, and A. P. McMahon
Localization of 17{beta}-Hydroxysteroid Dehydrogenase/17-Ketosteroid Reductase Isoform Expression in the Developing Mouse Testis--Androstenedione Is the Major Androgen Secreted by Fetal/Neonatal Leydig Cells
Endocrinology,
July 1, 2000;
141(7):
2631 - 2637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P.-Z. Tang, C.-H. Tsai-Morris, and M. L. Dufau
A Novel Gonadotropin-regulated Testicular RNA Helicase. A NEW MEMBER OF THE DEAD-BOX FAMILY
J. Biol. Chem.,
December 31, 1999;
274(53):
37932 - 37940.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P.-Z. Tang, C.-H. Tsai-Morris, and M. L. Dufau
Cloning and characterization of a hormonally regulated rat long chain acyl-CoA synthetase
PNAS,
June 5, 2001;
98(12):
6581 - 6586.
[Abstract]
[Full Text]
[PDF]
|
 |
|