| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Physiology, University of California, San Francisco, California 94143-0444; and Amgen, Inc. (N.L.), Thousand Oaks, California 91320
Address all correspondence and requests for reprints to: Dr. Mary F. Dallman, Department of Physiology, Box 0444, University of California, San Francisco, California 94143-0444. E-mail: dallman{at}itsa.ucsf.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In rats fed ad libitum, there are diurnal rhythms in the amplitude of the stress response, the sensitivity of ACTH to corticosterone (B) feedback, and the presence of facilitated ACTH responses to prior stress; responses are of high amplitude at the beginning of the light period after rats feed in the dark and of low amplitude at the onset of dark, after they have voluntarily fasted during the light period (2). Overnight starvation markedly decreases the magnitude of ACTH responses to stress, corticosteroid feedback efficacy, and facilitated ACTH responses to acute stress in young male rats (3, 4, 5). These changes in the hypothalamo-pituitary-adrenal (HPA) axis induced by overnight starvation are not caused by corticosterone (B), because they occur in adrenalectomized rats (3) and the amplitude of ACTH responses to stress is increased by gavage feeding during the night of the fast (5). Removal of food for 14 h during the light period does not alter responses in the HPA axis when tested at the end of the light period, although gavage with food during the light (fasting) period does increase ACTH responses to restraint (5). Thus, a brief period of starvation beginning near the onset of dark markedly alters response properties in the HPA axis.
Marked changes in the activity of the HPA axis occur during the first 14 h of starvation in young rats (6). Activation occurs within 3.5 h after food removal before dark, and a temporal pattern of ACTH and B responses reflects patterns of food intake and insulin secretion in controls fed ad libitum. In the last sample collected in that study (at lights on), activity in the HPA axis had returned to or near the control level, suggesting, as in the studies of regulation of HPA axis responsivity by food, that not only fasting but also the cyclic circadian input importantly determine the responses.
We also compared responses to starvation 3, 15, and 48 h after food removal in intact rats and adrenalectomized rats provided with a constant B signal (7). In that study, we examined responses in the HPA axis, hypothalamic neuropeptide Y (NPY) messenger RNA (mRNA) and peptide, glucose, insulin, and leptin. One hour after dark and 3 h after removal of food, HPA variables were elevated; glucose, insulin, and leptin levels were decreased or unchanged; and NPY mRNA was not different in the fed and fasted rats. By 15 h, at lights on, HPA variables were near normal in intact rats, but ACTH was markedly elevated in the starved adrenalectomized B-replaced rats compared with normal ACTH in the fed group. This result suggests that lack of food drives the HPA axis but that the elevated B in intact rats tempers this drive. By 48 h, plasma B (or ACTH) levels were elevated in the starved groups. At 15 and 48 h, glucose, insulin, and leptin levels were low or undetectable. NPY mRNA was elevated in both groups of fasted rats at 15 h and was still higher at 48 h. Overall, there was little, if any, effect of preventing B responses on the other responses to starvation.
In this study we have exposed young male rats to starvation for 24 h. Our goals were to replicate the results of Akana et al. (6) and to characterize temporally the responses of plasma metabolite and hormone levels, hypothalamic neuropeptide expression, and fat depots with the prospect of identifying signals and hypothalamic responses important to the constellation of defense mechanisms provoked by starvation. Such data are essential for the design of future studies to determine the site(s) and mechanism(s) by which changes occur in response to starvation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Experiment
All rats were weighed at 0800 h on the morning of the
experiment. At 1600 h, a group of 12 rats was killed to determine
initial values. Food was then removed from the hoppers, and preweighed
food was provided to half of the remaining rats. Groups of 6 fed and 6
starved rats were sampled at 2-h intervals until 1600 h on the
following day. The 1800 h (lights out) and 0600 h (lights on)
samples were both collected during the light period; during the rest of
the dark period, dim red light was used. Alternate pairs of fed and
fasted rats were collected at each time interval. All rats were killed
by decapitation within 15 sec of touching their cages. Blood (5 ml) was
collected from the trunk into chilled plastic centrifuge tubes and was
kept on ice until centrifuged, and the plasma was aliquoted. Bodies and
heads were weighed; 5 g, representing the weight of blood known to
have been removed, were added to the weights. Brains and pituitaries
were removed from the skull and were blocked and frozen immediately for
subsequent in situ hybridization measurement. Thymus and
adrenal glands and various single fat depots were removed and kept in
closed, saline-saturated dishes for subsequent cleaning and weighing.
At 6-h intervals, samples of the contralateral sc and perirenal fat
depots were snap frozen in liquid N2 for subsequent
measurement of leptin mRNA. To prevent individual experimenter
differences in technique, each task of the experiment was assigned to
and carried out by one individual, from performing the collection to
cleaning and weighing of tissues.
In a separate experiment, groups of six rats, either fed or with food removed at 1600 h, were anesthetized with a rodent cocktail containing acepromazine-ketamine-xylazine (77:1.5:1.5 mg/ml; 1 mg/kg, sc) and perfused with saline followed by 4% formaldehyde 14 and 27 h after the onset of the fast. Brains from these rats were sliced at 30 µm, and free floating sections were stained with an antibody to Fos protein as described previously (8). Fos-immunoreactive cells were counted in the parvocellular region of the paraventricular nuclei (PVN) and the arcuate nuclei as detailed previously (8).
Measurements
Food intake was calculated by subtracting the weight of the
remaining food in the hopper plus the amount spilled from the weight of
the food provided initially. At each time there were three values for
each group. To estimate food eaten per two rats per 2-h interval, the
mean weight of food eaten at a given time was subtracted from the mean
of the preceding period.
Adrenal and thymus glands were cleaned and weighed. Adrenals were then homogenized in 20% ethanol-80% normal saline for subsequent measurement of B content. Perirenal, sc (inguinal), and epididymal white fat depots were cleaned of extraneous tissue and weighed. Interscapular brown fat was cleaned of white fat and muscle, weighed, and homogenized for subsequent measurement of uncoupling protein.
Plasma glucose and FFA were measured using the glucose oxidase reaction in a Beckman Coulter, Inc. Glucose Analyzer II (Palo Alto, CA) and a kit based on colorimetric assay (9), respectively.
Because there were more samples than could be measured in a single assay, each measurement was performed over two or three assays that contained equal numbers of samples from fed and fasted rats, usually distributed across the entire experiment. ACTH, B, insulin, and leptin were measured by previously reported RIAs (7). Uncoupling protein was measured in a single assay in interscapular brown adipose tissue at 12-h intervals by a previously reported method (10, 11) with reagents provided by Dr. Jean Himms-Hagen (University of Ontario, Ottawa, Canada).
In situ hybridization
Brains were sliced at 20 µm from the optic chiasm to the
ventromedial nuclei, and one in six sections at the appropriate level
were reacted for CRF, vasopressin (AVP), POMC, and NPY. The CRF and AVP
probes used have been reported previously (12); the NPY probe was
provided by Dr. M. W. Schwartz, University of Washington (Seattle,
WA) (13), and the POMC probe used was a 45-base complementary DNA
(cDNA) oligomer:
5'-CTTCTTGCCCACCGGCTTGCCCCAGCGGAAGTGCT-CCATGGAGTAGGA-3' (14). All
hybridizations for a given mRNA were performed in a single lot, and
x-ray films of three sections of each of three brains from each
group were examined after hybridization. Semiquantitative analyses were
performed by subtracting a set threshold value in each of the four
analyses and determining the optical density of a standard area in the
site of interest using NIH Image (Rasband version 1.4).
Leptin mRNA in perirenal and sc depots
RNA was purified from white adipose tissue samples using Trizol
(Life Technologies, Inc., Grand Island, NY), and cDNA was
transcribed from each RNA sample using Superscript II RNase
H- reverse transcriptase (Life Technologies, Inc.), following protocols supplied by the manufacturers.
Quantitative PCR was performed to quantify leptin and 
-tubulin mRNA
using the TaqManPCR reagent kit and ABI Prism sequence detection system
(PE Applied Biosystems, Foster City, CA) (15). The two rat
leptin primers used were (forward) CACACACGCAGTCGGTATCC and (reverse)
TGAAGCCCGGGAATGAAGT, and the two rat -tubulin primers used were
(forward) GCTGTGGTTGAGCCCTACAAT and (reverse) CATTGTCTACCATGAAGGCACAA.
A hybridization probe that binds to each PCR product was labeled with a
reporter dye, FAM, on the 5'-nucleotide and a quenching dye, TAMRA, on
the 3'-nucleotide. Fifty-microliter PCR reactions contained 2 ng of the
cDNA sample and 1.25 U TaqGold DNA polymerase (Perkin Elmer Corp., Norwalk, CT). Cycling parameters were 2 min at 50 C, 20
min at 95 C, followed by 40 cycles of 60 sec at 60 C, and 15 sec at 95
C. Serial dilutions of plasmid DNA were analyzed in parallel for each
target cDNA. These served as standard curves from which the number of
copies of leptin and -tubulin in each sample were determined.
Statistics
Two-way ANOVA was used to compare differences between fed and
starved rats; overall results of the two-way ANOVAs on plasma and
tissue variables are shown in Table 1
.
Post-hoc differences between groups were determined using
Fischer’s protected least significant difference test (PLSD),
and P 
0.05 was considered significant. Regression
analyses were used to determine the relationships between leptin and
fat, insulin, or B. All statistical manipulations were performed using
the StatView program (16).
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
), top left). By 2000 h, the
weight of the fed rats was increased as a consequence of the
considerable first bout of food consumption that occurred between
1600–2000 h (Fig. 1, top right). Plasma glucose began to
decrease in the starved groups at 1800 h and had declined
significantly by 2000 h and thereafter (Fig. 1, middle
left). Plasma insulin had declined significantly in the starved
groups at 1800 h, and by 2000 h and thereafter remained just
above the limit of detection (Fig. 1, middle right). The
significant decrease in insulin at 1800 h, when glucose had not
yet decreased significantly, suggests that within 2 h of its
onset, signals of starvation had been received. Plasma FFA levels were
significantly increased at 1800 h, the first time that samples
were collected after the onset of starvation; levels remained high for
the subsequent 22 h (Fig. 1, bottom left). By contrast,
plasma FFA in fed rats was low throughout the dark period, but
increased to the levels observed in starved rats between 0800–1200 h;
the values began to decline again between 1400–1600 h (Fig. 1, bottom left), perhaps as a consequence of the meal taken
between 1200–1400 h (Fig. 1, top right). Plasma leptin
began to decrease at 1800 h in the fasted rats and was
significantly lower than that in the fed rats from 2200 h and
thereafter when many samples were below the limit of detectability
(Fig. 1, bottom right). In the fed rats, there was a
nocturnal excursion in leptin that peaked at 2200 h and maintained
a plateau until 0600 h; thereafter, leptin levels fell throughout
the light period (Fig. 1, bottom right).
|
Hypothalamic neuropeptide expression (Fig. 2)
Although not significantly different from the fed rats, the
starved rats had higher CRF mRNA expression in the PVN 6 h after
the removal of food and lower levels thereafter (Fig. 2A); overall,
there was a significant difference in CRF mRNA between fed and starved
rats (P < 0.05). Vasopressin mRNA measured in the same
parvocellular region of PVN as CRF mRNA did not change as a function of
starvation, but in both groups there was a slight decline in levels at
0400 h (Fig. 2B). In the arcuate nuclei, NPY expression increased
significantly (P < 0.01) within 12 h
(P < 0.05) of the onset of starvation (Fig. 2C). POMC
mRNA exhibited a rhythm as a function of time of day (P
< 0.05), but there was no effect of the first 24 h of starvation
(Fig. 2D).
|
HPA axis hormones and targets (Fig. 3)
As previously (6), there were marked increases in plasma
ACTH in the starved rats during the dark (Fig. 3, top left)
that mirrored the bouts of feeding in the control rats (Fig. 1
, top right) and that returned to the level in fed rats at the
onset of light and thereafter. Significant differences in plasma ACTH
between fed and starved rats occurred at 2000 and 0200–0400 h. In
starved rats, ACTH levels were higher during the hours of dark than
light (174 ± 15 vs. 82 ± 6 pg/ml, respectively;
P < 0.0001; Fig. 3, top right). Adrenal B
content did not follow ACTH in either fed or starved rats, and although
higher in starved rats, the B content in the two groups did not differ
throughout the dark period (Fig. 3, middle, left). The
large, sustained peak in ACTH that occurred between 0200–0400 h was
not reflected by increased adrenal B in the starved rats. During the
light period, adrenal B content in starved rats was always higher than
that in the fed animals (Fig. 3, middle left), possibly
because adrenal weight was increased during the light period (Fig. 3, middle right).
|
, bottom left). The regression of plasma on adrenal B was
highly significant (F = 85; P < 0.0001) as
expected from examination of the curves. Fed rats exhibited a normal
rhythm in plasma B throughout the dark with a peak of about 20 µg/dl
at 1800 h and a nadir of less than 1 µg/dl at 0400–0600 h.
During the light period, plasma (and adrenal) B in the fed rats
increased unusually rapidly toward an evening peak, suggesting that
there may have been some loss of control in the animal room during the
latter part of the experiment. Just as adrenal weight of fasted rats
increased during the light, probably as a consequence of the excess
ACTH secreted, thymus weight was significantly reduced in the last
sample collected, at 1600 h, probably as a consequence of the
prolonged and marked elevation in plasma B (Fig. 3, bottom
right). Multiple regression analysis of adrenal B on insulin, leptin, FFA, glucose, and log ACTH showed only leptin to be significantly negatively correlated [fed: r = 0.426; P = 0.151; leptin (t) -2.895, P = 0.0051; starved: r = 0.324; P = 0.0061; leptin (t) -3.275, P = 0.0013].
Fat depot weights and leptin expression (Fig. 4)
Starved rats lost weight and fed rats gained weight in all fat
stores during the 24 h; however, the dynamics differed. The weight
of the dynamic, small perirenal fat depot decreased in both groups at
0200 h, 6 h after the first major feeding bout had ended in
the fed rats. Perirenal fat weight increased in the fed groups between
0600–1200 h; after a transient trough at 1400 h, coincident with
the bout of food intake in fed rats (Fig. 1, top right),
perirenal fat stores increased again at 1600 h (Fig. 4, top
left). Compared with fed rats, perirenal fat weight was decreased
at 1000, 1200, and 1600 h in starved rats. (The marked changes in
perirenal fat weights were apparent to the individual doing the
dissection, before obtaining measured weights.) Epididymal fat weights
did not differ through the dark period in fed and starved rats;
however, again during the light period, weight increased in the fed
rats (Fig. 4, middle). The weight of this depot in starved
rats was significantly decreased at 1000 h and thereafter. The sc
fat weight increased in fed rats at 1000–1200 h and then decreased
slightly thereafter (Fig. 4, bottom). In starved rats, the
weight of sc fat fell slowly throughout the day. Leptin mRNA levels
were similar in fed and starved rats in both perirenal and sc depots
during the hours of darkness (Fig. 4, top and bottom
right). There were nocturnal increases in leptin expression in the
sc depots of both groups (P < 0.05) that temporally
mimicked the excursions in circulating leptin in fed rats (Fig. 1, bottom right). With the marked loss in perirenal fat weight,
leptin expression in this depot appeared to decrease at the end of the
dark period and during the light hours.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Systemic effects of starvation
Because food was removed toward the end of the light period, it is
unlikely that there were large stores of glycogen available for
immediate energy, and the rapid increase in FFA suggests that energy
requirements during the early dark were met by mobilization of fat,
initially from liver and then from adipose stores and probably muscle.
Fat mobilization would be fostered by the immediate and marked
reduction in insulin. The plateau of glucose that occurred by 2200
h was maintained at low but constant levels thereafter; this strongly
suggests that by this time hepatic gluconeogenesis was sufficient to
maintain output of this substrate. Again, the reduction in insulin
would foster increased glucagon secretion and glucose synthesis and
secretion. Although systemic plasma glucagon levels were not elevated
during the dark in Akana’s study (6) (not shown), it is likely that
increased glucagon stimulated the liver. Additionally, the nearly
immediate increase in B secretion in starved rats would be expected to
increase hepatic gluconeogenesis and gluconeogenetic enzymes, thus
acting to sustain glucose production throughout the starvation period
(17, 18). In the absence of insulin and the presence of high B,
increased muscle breakdown and amino acid availability for
gluconeogenesis would also be anticipated.
Signals and sensors
Changes in either FFAs or in insulin, leptin, or glucose serve as
precise afferent signals to the hypothalamus about decreasing energy
stores. Insulin was decreased, and FFA were increased at the first time
tested after removal of food. The medial and lateral hypothalamus
contains neurons that are directly sensitive to insulin, glucose, and
FFA (19, 20); thus, changes in these would be directly perceived. Fatty
acids also stimulate afferent nerves (21, 22) and act at the level of
both ACTH secretion and directly at the adrenal to alter synthesis and
secretion (23, 24, 25). The decrease in plasma leptin that occurs 2 h
after the decrease in insulin and the increase in FFAs and B would also
be registered by receptors in hypothalamic cell groups (26, 27, 28). The
decreases in insulin and leptin would be expected to result in
increased NPY synthesis in the arcuate nuclei (29, 30, 31, 32, 33) as would the
increase in B (34, 35). Finally, by 2200 h, glucose levels have
declined by approximately 30% to a new plateau, which is maintained
for the duration of the experiment. This decrease in circulating
glucose would be expected to act at the hypothalamus to reinforce the
other peripheral signals of energy need. Infusion of glucose into the
ventromedial nuclei of the hypothalamus prevents normal sympathetic and
endocrine responses to severe insulin-induced hypoglycemia (36), and
the sensitivity of these glucoreceptors may be sufficient to respond to
the relatively small changes in glucose concentrations observed here.
Thus, these studies identify rapid changes in at least five signals
known to alter the hypothalamic control of energy balance that are
apparent within 2–6 h of the onset of the fast.
The initial small increase in CRF mRNA at 6 h may reflect housekeeping chores in CRF neurons after the pronounced initial ACTH (and presumably CRF) secretion that occurred with the onset of the fast. However, the overall decrease in CRF mRNA during the subsequent hours surprised us, as NPY is stimulatory to CRF (37, 38), and NPY production was clearly elevated from 12 h on. The significantly decreased numbers of c-Fos-immunoreactive cells in the parvocellular PVN supports the idea that input to this region was reduced. However, it may be that the marked and sustained increase in B that occurred at the beginning of the fast curtailed CRF synthesis, as NPY infused intracerebroventricularly for 5 days results in inhibited ACTH and B responses to acute stress (9).
ACTH-adrenal uncoupling
Even during the first part of the dark, adrenal B content did
not track ACTH well. During the rest of dark and throughout the light
period, adrenal B did not appear to be regulated by ACTH. There was,
however, a negative regression of adrenal B on leptin, and this result
fits well with the previously reported inhibition of plasma B by leptin
in starved rats (39). Thus, changes in leptin concentrations in both
fed and starved rats explain at least part of the decoupling between
adrenal B and ACTH in this study and where a similar dissociation
between ACTH and adrenal B was found (but not shown) (6). Leptin
receptors are found in adrenal (40, 41) as well as hypothalamus, and it
is not clear whether the relationship we observed between leptin and B
is direct or indirect. In addition to the fairly small correlation
between B and leptin, there is clearly a strong effect, particularly
evident at the dark-light transition, that may be a consequence of
altered activity in adrenal nerves (42, 43) directed by changes in
hypothalamic activity (44, 45, 46). The combination of adrenal regulatory
effects resulted in a marked elevation in mean plasma B in starved
vs. fed rats (24.3 vs. 8.7 µg/dl,
respectively). This major increase in glucocorticoid levels is
sufficient to act on glucocorticoid receptors in targets throughout the
animal (47, 48). Although older male rats with fixed, low B levels
survive starvation for 48 h, and elevated B is not essential for
responses in NPY mRNA (7), it is probable that elevated B levels abet
many of the responses determined by other hormones, neural action, and
metabolites.
Adipose tissue stores
White adipose tissue depots were mobilized during the light period
of the day after the onset of starvation. It is unlikely that changes
in sympathetic outflow to white adipose tissue (49) were increased,
both because starvation is known to decrease sympathetic outflow (50)
and because sympathetic stimulation decreases leptin biosynthesis (51),
which was not observed until the later parts of the study. It is also
likely that overall sympathetic neural outflow to fat depots was
decreased, as shown by the significant decrease in uncoupling protein
content in interscapular brown adipose tissue by 24 h. This raises
the question of what caused the abrupt decrease in leptin secretion in
the absence of a concurrent change in leptin mRNA. Again, it may be
that insulin is the effector, as the decrease in insulin precedes the
drop in leptin secretion, and insulin is clearly related to both leptin
synthesis and secretion (52, 53, 54).
Sequelae
Within several hours of the onset of starvation, young male rats
exhibit alterations in metabolism, hormones, and neuropeptides that
equip them for survival, if food is to be obtained. The increased NPY
mRNA, will act, when the peptide is secreted, to increase the drive for
food (55), and thus food-seeking behavior. The late decrease in CRF
mRNA should both decrease central sympathetic drive (56, 57) and
decrease the anorexogenic effect of CRF (1). Decreases in circulating
leptin and insulin, in addition to the peripheral effects they exert,
should also bolster the increases in NPY synthesis and secretion (58).
The uncoupling of adrenal B regulation from ACTH allows (CRF and) ACTH
levels to fall after a pronounced secretory burst, which may have a
trophic effect on the adrenals. The persistently increased B level
would be expected to stimulate NPY mRNA (59) and decrease CRF mRNA
(60), again abetting changes in other hormones and metabolites.
Finally, although there is relatively little fat in the young male rats
that were studied, mobilization of fat stores provides sufficient
metabolic fuel for foraging.
|
Footnotes |
|---|
2 Present address: Department of Pharmacology, Merck Corp.,
Rahway, New Jersey 07065.
Received January 14, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  Y. Revsin, D. van Wijk, F. E. Saravia, M. S. Oitzl, A. F. De Nicola, and E. R. de Kloet Adrenal Hypersensitivity Precedes Chronic Hypercorticism in Streptozotocin-Induced Diabetes Mice Endocrinology, July 1, 2008; 149(7): 3531 - 3539. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Inoue, G. Somay, S. Poole, and G. N. Luheshi Immune-to-brain signaling and central prostaglandin E2 synthesis in fasted rats with altered lipopolysaccharide-induced fever Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2008; 295(1): R133 - R143. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ellis, K. M. Moar, T. J. Logie, A. W. Ross, P. J. Morgan, and J. G. Mercer Diurnal profiles of hypothalamic energy balance gene expression with photoperiod manipulation in the Siberian hamster, Phodopus sungorus Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2008; 294(4): R1148 - R1153. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Gorton, A. M. Khan, M. Bohland, G. Sanchez-Watts, C. M. Donovan, and A. G. Watts A Role for the Forebrain in Mediating Time-of-Day Differences in Glucocorticoid Counterregulatory Responses to Hypoglycemia in Rats Endocrinology, December 1, 2007; 148(12): 6026 - 6039. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Crane, N. Akhter, B. W. Johnson, M. Iruthayanathan, F. Syed, A. Kudo, Y.-H. Zhou, and G. V. Childs Fasting and Glucose Effects on Pituitary Leptin Expression: Is Leptin a Local Signal for Nutrient Status? J. Histochem. Cytochem., October 1, 2007; 55(10): 1059 - 1073. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Dimitrov, M. R. DeJoseph, M. S. Brownfield, and J. H. Urban Involvement of Neuropeptide Y Y1 Receptors in the Regulation of Neuroendocrine Corticotropin-Releasing Hormone Neuronal Activity Endocrinology, August 1, 2007; 148(8): 3666 - 3673. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-Q. Chen, J. Dong, C.-Y. Niu, J.-M. Fan, and J.-Z. Du Effects of Hypoxia on Glucose, Insulin, Glucagon, and Modulation by Corticotropin-Releasing Factor Receptor Type 1 in the Rat Endocrinology, July 1, 2007; 148(7): 3271 - 3278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Iwasaki, M. Nishiyama, T. Taguchi, M. Kambayashi, M. Asai, M. Yoshida, T. Nigawara, and K. Hashimoto Activation of AMP-activated protein kinase stimulates proopiomelanocortin gene transcription in AtT20 corticotroph cells Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1899 - E1905. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Shimakura, T. Terada, H. Saito, T. Katsura, and K.-i. Inui Induction of intestinal peptide transporter 1 expression during fasting is mediated via peroxisome proliferator-activated receptor {alpha} Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G851 - G856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. S. Harris, E. W. Kelso, W. P. Flatt, T. J. Bartness, and H. J. Grill Energy Expenditure and Body Composition of Chronically Maintained Decerebrate Rats in the Fed and Fasted Condition Endocrinology, March 1, 2006; 147(3): 1365 - 1376. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. C. Nindl, K. R. Rarick, J. W. Castellani, A. P. Tuckow, J. F. Patton, A. J. Young, and S. J. Montain Altered secretion of growth hormone and luteinizing hormone after 84 h of sustained physical exertion superimposed on caloric and sleep restriction J Appl Physiol, January 1, 2006; 100(1): 120 - 128. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Karteris, R. J. Machado, J. Chen, S. Zervou, E. W. Hillhouse, and H. S. Randeva Food deprivation differentially modulates orexin receptor expression and signaling in rat hypothalamus and adrenal cortex Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1089 - E1100. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. la Fleur, E. C. Wick, P. S. Idumalla, E. F. Grady, and A. Bhargava From the Cover: Role of peripheral corticotropin-releasing factor and urocortin II in intestinal inflammation and motility in terminal ileum PNAS, May 24, 2005; 102(21): 7647 - 7652. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. la Fleur, H. Houshyar, M. Roy, and M. F. Dallman Choice of Lard, But Not Total Lard Calories, Damps Adrenocorticotropin Responses to Restraint Endocrinology, May 1, 2005; 146(5): 2193 - 2199. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Houshyar, S. Manalo, and M. F. Dallman Time-Dependent Alterations in mRNA Expression of Brain Neuropeptides Regulating Energy Balance and Hypothalamo-Pituitary-Adrenal Activity after Withdrawal from Intermittent Morphine Treatment J. Neurosci., October 20, 2004; 24(42): 9414 - 9424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Pecoraro, F. Reyes, F. Gomez, A. Bhargava, and M. F. Dallman Chronic Stress Promotes Palatable Feeding, which Reduces Signs of Stress: Feedforward and Feedback Effects of Chronic Stress Endocrinology, August 1, 2004; 145(8): 3754 - 3762. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
|
