help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dallman, M. F.
Right arrow Articles by Viau, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dallman, M. F.
Right arrow Articles by Viau, V.
Endocrinology Vol. 140, No. 9 4015-4023
Copyright © 1999 by The Endocrine Society


ARTICLES

Starvation: Early Signals, Sensors, and Sequelae1

Mary F. Dallman, Susan F. Akana, Seema Bhatnagar, M. Elizabeth Bell, SuJean Choi, Alan Chu, Cydney Horsley, Nancy Levin, Onno Meijer, Liza R. Soriano, Alison M. Strack2 and Victor Viau

Department of Physiology, University of California, San Francisco, California 94143-0444; and Amgen, Inc. (N.L.), Thousand Oaks, California 91320

Address all correspondence and requests for reprints to: Dr. Mary F. Dallman, Department of Physiology, Box 0444, University of California, San Francisco, California 94143-0444. E-mail: dallman{at}itsa.ucsf.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To identify the sequences of changes in putative signals, reception of these and responses to starvation, we sampled fed and starved rats at 2- to 6-h intervals after removal of food 2 h before dark. Metabolites, hormones, hypothalamic neuropeptide expression, fat depots, and leptin expression were measured. At 2 h, insulin decreased, and FFA and corticosterone (B) increased; by 4 h, leptin and glucose levels decreased. Neuropeptide Y messenger RNA (mRNA) increased 6 h after food removal and thereafter. Adrenal and plasma B did not follow ACTH and were elevated throughout, with a nadir at the dark-light transition. Leptin correlated inversely with adrenal B. Fat stores decreased during the last 12 h. Leptin mRNA in perirenal and sc fat peaked during the dark period, resembling plasma leptin in fed rats. We conclude that 1) within the first 4 h, hormonal and metabolic signals relay starvation-induced information to the hypothalamus; 2) hypothalamic neuropeptide synthesis responds rapidly to the altered metabolic signals; 3) catabolic activity quickly predominates, reinforced by elevated B, not driven by ACTH, but possibly to a minor extent by leptin, and more by adrenal neural activity; and 4) leptin secretion decreases before leptin mRNA or fat depot weight, showing synthesis-independent regulation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN RAPIDLY GROWING, young male rats, starvation is an acute challenge to the systems that regulate energy balance. Starvation-induced changes in hormones and metabolites are perceived at the hypothalamus, and responses to starvation are mobilized by behavioral, autonomic, and neuroendocrine changes coordinated by the hypothalamus (1).

In rats fed ad libitum, there are diurnal rhythms in the amplitude of the stress response, the sensitivity of ACTH to corticosterone (B) feedback, and the presence of facilitated ACTH responses to prior stress; responses are of high amplitude at the beginning of the light period after rats feed in the dark and of low amplitude at the onset of dark, after they have voluntarily fasted during the light period (2). Overnight starvation markedly decreases the magnitude of ACTH responses to stress, corticosteroid feedback efficacy, and facilitated ACTH responses to acute stress in young male rats (3, 4, 5). These changes in the hypothalamo-pituitary-adrenal (HPA) axis induced by overnight starvation are not caused by corticosterone (B), because they occur in adrenalectomized rats (3) and the amplitude of ACTH responses to stress is increased by gavage feeding during the night of the fast (5). Removal of food for 14 h during the light period does not alter responses in the HPA axis when tested at the end of the light period, although gavage with food during the light (fasting) period does increase ACTH responses to restraint (5). Thus, a brief period of starvation beginning near the onset of dark markedly alters response properties in the HPA axis.

Marked changes in the activity of the HPA axis occur during the first 14 h of starvation in young rats (6). Activation occurs within 3.5 h after food removal before dark, and a temporal pattern of ACTH and B responses reflects patterns of food intake and insulin secretion in controls fed ad libitum. In the last sample collected in that study (at lights on), activity in the HPA axis had returned to or near the control level, suggesting, as in the studies of regulation of HPA axis responsivity by food, that not only fasting but also the cyclic circadian input importantly determine the responses.

We also compared responses to starvation 3, 15, and 48 h after food removal in intact rats and adrenalectomized rats provided with a constant B signal (7). In that study, we examined responses in the HPA axis, hypothalamic neuropeptide Y (NPY) messenger RNA (mRNA) and peptide, glucose, insulin, and leptin. One hour after dark and 3 h after removal of food, HPA variables were elevated; glucose, insulin, and leptin levels were decreased or unchanged; and NPY mRNA was not different in the fed and fasted rats. By 15 h, at lights on, HPA variables were near normal in intact rats, but ACTH was markedly elevated in the starved adrenalectomized B-replaced rats compared with normal ACTH in the fed group. This result suggests that lack of food drives the HPA axis but that the elevated B in intact rats tempers this drive. By 48 h, plasma B (or ACTH) levels were elevated in the starved groups. At 15 and 48 h, glucose, insulin, and leptin levels were low or undetectable. NPY mRNA was elevated in both groups of fasted rats at 15 h and was still higher at 48 h. Overall, there was little, if any, effect of preventing B responses on the other responses to starvation.

In this study we have exposed young male rats to starvation for 24 h. Our goals were to replicate the results of Akana et al. (6) and to characterize temporally the responses of plasma metabolite and hormone levels, hypothalamic neuropeptide expression, and fat depots with the prospect of identifying signals and hypothalamic responses important to the constellation of defense mechanisms provoked by starvation. Such data are essential for the design of future studies to determine the site(s) and mechanism(s) by which changes occur in response to starvation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Young male rats (105–115 g), received from Bantin and Kingman suppliers (Fremont, CA) were placed two per cage in hanging wire baskets in an animal room with a controlled light cycle (12 h of light; lights on at 0600 h) and temperature (23 C). The animals were allowed to adapt to the diet (no. 5008, Ralston Purina, Inc., St. Louis, MO) and room for 3 days before the experiment began. All groups of rats were housed in one room that was used solely for this purpose. The experimental procedure was approved by the University of California San Francisco Committee on Animal Research.

Experiment
All rats were weighed at 0800 h on the morning of the experiment. At 1600 h, a group of 12 rats was killed to determine initial values. Food was then removed from the hoppers, and preweighed food was provided to half of the remaining rats. Groups of 6 fed and 6 starved rats were sampled at 2-h intervals until 1600 h on the following day. The 1800 h (lights out) and 0600 h (lights on) samples were both collected during the light period; during the rest of the dark period, dim red light was used. Alternate pairs of fed and fasted rats were collected at each time interval. All rats were killed by decapitation within 15 sec of touching their cages. Blood (5 ml) was collected from the trunk into chilled plastic centrifuge tubes and was kept on ice until centrifuged, and the plasma was aliquoted. Bodies and heads were weighed; 5 g, representing the weight of blood known to have been removed, were added to the weights. Brains and pituitaries were removed from the skull and were blocked and frozen immediately for subsequent in situ hybridization measurement. Thymus and adrenal glands and various single fat depots were removed and kept in closed, saline-saturated dishes for subsequent cleaning and weighing. At 6-h intervals, samples of the contralateral sc and perirenal fat depots were snap frozen in liquid N2 for subsequent measurement of leptin mRNA. To prevent individual experimenter differences in technique, each task of the experiment was assigned to and carried out by one individual, from performing the collection to cleaning and weighing of tissues.

In a separate experiment, groups of six rats, either fed or with food removed at 1600 h, were anesthetized with a rodent cocktail containing acepromazine-ketamine-xylazine (77:1.5:1.5 mg/ml; 1 mg/kg, sc) and perfused with saline followed by 4% formaldehyde 14 and 27 h after the onset of the fast. Brains from these rats were sliced at 30 µm, and free floating sections were stained with an antibody to Fos protein as described previously (8). Fos-immunoreactive cells were counted in the parvocellular region of the paraventricular nuclei (PVN) and the arcuate nuclei as detailed previously (8).

Measurements
Food intake was calculated by subtracting the weight of the remaining food in the hopper plus the amount spilled from the weight of the food provided initially. At each time there were three values for each group. To estimate food eaten per two rats per 2-h interval, the mean weight of food eaten at a given time was subtracted from the mean of the preceding period.

Adrenal and thymus glands were cleaned and weighed. Adrenals were then homogenized in 20% ethanol-80% normal saline for subsequent measurement of B content. Perirenal, sc (inguinal), and epididymal white fat depots were cleaned of extraneous tissue and weighed. Interscapular brown fat was cleaned of white fat and muscle, weighed, and homogenized for subsequent measurement of uncoupling protein.

Plasma glucose and FFA were measured using the glucose oxidase reaction in a Beckman Coulter, Inc. Glucose Analyzer II (Palo Alto, CA) and a kit based on colorimetric assay (9), respectively.

Because there were more samples than could be measured in a single assay, each measurement was performed over two or three assays that contained equal numbers of samples from fed and fasted rats, usually distributed across the entire experiment. ACTH, B, insulin, and leptin were measured by previously reported RIAs (7). Uncoupling protein was measured in a single assay in interscapular brown adipose tissue at 12-h intervals by a previously reported method (10, 11) with reagents provided by Dr. Jean Himms-Hagen (University of Ontario, Ottawa, Canada).

In situ hybridization
Brains were sliced at 20 µm from the optic chiasm to the ventromedial nuclei, and one in six sections at the appropriate level were reacted for CRF, vasopressin (AVP), POMC, and NPY. The CRF and AVP probes used have been reported previously (12); the NPY probe was provided by Dr. M. W. Schwartz, University of Washington (Seattle, WA) (13), and the POMC probe used was a 45-base complementary DNA (cDNA) oligomer: 5'-CTTCTTGCCCACCGGCTTGCCCCAGCGGAAGTGCT-CCATGGAGTAGGA-3' (14). All hybridizations for a given mRNA were performed in a single lot, and x-ray films of three sections of each of three brains from each group were examined after hybridization. Semiquantitative analyses were performed by subtracting a set threshold value in each of the four analyses and determining the optical density of a standard area in the site of interest using NIH Image (Rasband version 1.4).

Leptin mRNA in perirenal and sc depots
RNA was purified from white adipose tissue samples using Trizol (Life Technologies, Inc., Grand Island, NY), and cDNA was transcribed from each RNA sample using Superscript II RNase H- reverse transcriptase (Life Technologies, Inc.), following protocols supplied by the manufacturers. Quantitative PCR was performed to quantify leptin and {alpha}-tubulin mRNA using the TaqManPCR reagent kit and ABI Prism sequence detection system (PE Applied Biosystems, Foster City, CA) (15). The two rat leptin primers used were (forward) CACACACGCAGTCGGTATCC and (reverse) TGAAGCCCGGGAATGAAGT, and the two rat {alpha}-tubulin primers used were (forward) GCTGTGGTTGAGCCCTACAAT and (reverse) CATTGTCTACCATGAAGGCACAA. A hybridization probe that binds to each PCR product was labeled with a reporter dye, FAM, on the 5'-nucleotide and a quenching dye, TAMRA, on the 3'-nucleotide. Fifty-microliter PCR reactions contained 2 ng of the cDNA sample and 1.25 U TaqGold DNA polymerase (Perkin Elmer Corp., Norwalk, CT). Cycling parameters were 2 min at 50 C, 20 min at 95 C, followed by 40 cycles of 60 sec at 60 C, and 15 sec at 95 C. Serial dilutions of plasmid DNA were analyzed in parallel for each target cDNA. These served as standard curves from which the number of copies of leptin and {alpha}-tubulin in each sample were determined.

Statistics
Two-way ANOVA was used to compare differences between fed and starved rats; overall results of the two-way ANOVAs on plasma and tissue variables are shown in Table 1Go. Post-hoc differences between groups were determined using Fischer’s protected least significant difference test (PLSD), and P <= 0.05 was considered significant. Regression analyses were used to determine the relationships between leptin and fat, insulin, or B. All statistical manipulations were performed using the StatView program (16).


View this table:
[in this window]
[in a new window]
 
Table 1. Statistical results for some measured variables (two-way ANOVA)

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Body weight, food intake, and metabolites (Fig. 1Go)
Similar initially, body weights had diverged in the fed and starved groups by 2000 h and differed significantly at 2400 h and thereafter (Fig. 1Go, top left). By 2000 h, the weight of the fed rats was increased as a consequence of the considerable first bout of food consumption that occurred between 1600–2000 h (Fig. 1Go, top right). Plasma glucose began to decrease in the starved groups at 1800 h and had declined significantly by 2000 h and thereafter (Fig. 1Go, middle left). Plasma insulin had declined significantly in the starved groups at 1800 h, and by 2000 h and thereafter remained just above the limit of detection (Fig. 1Go, middle right). The significant decrease in insulin at 1800 h, when glucose had not yet decreased significantly, suggests that within 2 h of its onset, signals of starvation had been received. Plasma FFA levels were significantly increased at 1800 h, the first time that samples were collected after the onset of starvation; levels remained high for the subsequent 22 h (Fig. 1Go, bottom left). By contrast, plasma FFA in fed rats was low throughout the dark period, but increased to the levels observed in starved rats between 0800–1200 h; the values began to decline again between 1400–1600 h (Fig. 1Go, bottom left), perhaps as a consequence of the meal taken between 1200–1400 h (Fig. 1Go, top right). Plasma leptin began to decrease at 1800 h in the fasted rats and was significantly lower than that in the fed rats from 2200 h and thereafter when many samples were below the limit of detectability (Fig. 1Go, bottom right). In the fed rats, there was a nocturnal excursion in leptin that peaked at 2200 h and maintained a plateau until 0600 h; thereafter, leptin levels fell throughout the light period (Fig. 1Go, bottom right).



View larger version (79K):
[in this window]
[in a new window]
 
Figure 1. Changes with time in body weight, food intake, hormones, and metabolites in young male rats fed ad libitum or starved. Open symbols and dashed lines represent fed rats; closed symbols and solid lines represent starved rats (n = 6/group ± SEM). The arrow represents the time of onset of starvation. The shaded vertical bar represents the 12 h of dark. Analyses of the data are shown in Table 1Go and in the text. *, The first significant difference in fed and starved rats (by Fischer’s PLSD).

 
There were significant negative regressions of FFA on insulin that were stronger in starved than in fed rats (fed: F = 8.07; P = 0.0058; r = -0.310; starved: F = 68.6; P < 0.0001; r = -0.689). Similarly, there were significant regressions of leptin on insulin that were stronger in starved than fed rats (fed: F = 4.28; P = 0.04; r = 0.234; starved: F = 30.0; P < 0.001; r = 0.542), suggesting that changes in insulin may be important for the changes in both FFA and leptin that occur with starvation (not shown).

Hypothalamic neuropeptide expression (Fig. 2Go)
Although not significantly different from the fed rats, the starved rats had higher CRF mRNA expression in the PVN 6 h after the removal of food and lower levels thereafter (Fig. 2AGo); overall, there was a significant difference in CRF mRNA between fed and starved rats (P < 0.05). Vasopressin mRNA measured in the same parvocellular region of PVN as CRF mRNA did not change as a function of starvation, but in both groups there was a slight decline in levels at 0400 h (Fig. 2BGo). In the arcuate nuclei, NPY expression increased significantly (P < 0.01) within 12 h (P < 0.05) of the onset of starvation (Fig. 2CGo). POMC mRNA exhibited a rhythm as a function of time of day (P < 0.05), but there was no effect of the first 24 h of starvation (Fig. 2DGo).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 2. mRNA in the hypothalamus of fed (open symbols, dashed lines) and starved (closed symbols, solid lines) rats with time after the onset of the experiment. CRF and AVP mRNAs (top) were determined in the parvocellular portion of the PVN, and NPY and POMC mRNAs were determined in the rostral, medial, and caudal portions of the arcuate nuclei. Data represent the mean values for three rats per group, and significance is discussed in the text. Black bars represent the 12 h of dark.

 
The number of Fos-immunoreactive neurons was used, in a separate experiment, as an index of neuronal activity in rats 15 and 27 h after the onset of starvation. At both times, compared with fed rats, fewer parvocellular PVN cells were stained with Fos in the starved rats (at 15 h: fed, 93 ± 14; starved, 54 ± 7 cells; at 27 h: fed, 165 ± 19; starved, 92 ± 19 cells; condition: F = 14.0; P < 0.001; time: F = 6.99; P = 0.0145; interaction: P = NS). By contrast, the numbers of Fos immunoreactivity-positive cells in the arcuate nuclei were similar in the two groups at both times of day (not shown).

HPA axis hormones and targets (Fig. 3Go)
As previously (6), there were marked increases in plasma ACTH in the starved rats during the dark (Fig. 3Go, top left) that mirrored the bouts of feeding in the control rats (Fig. 1Go, top right) and that returned to the level in fed rats at the onset of light and thereafter. Significant differences in plasma ACTH between fed and starved rats occurred at 2000 and 0200–0400 h. In starved rats, ACTH levels were higher during the hours of dark than light (174 ± 15 vs. 82 ± 6 pg/ml, respectively; P < 0.0001; Fig. 3Go, top right). Adrenal B content did not follow ACTH in either fed or starved rats, and although higher in starved rats, the B content in the two groups did not differ throughout the dark period (Fig. 3Go, middle, left). The large, sustained peak in ACTH that occurred between 0200–0400 h was not reflected by increased adrenal B in the starved rats. During the light period, adrenal B content in starved rats was always higher than that in the fed animals (Fig. 3Go, middle left), possibly because adrenal weight was increased during the light period (Fig. 3Go, middle right).



View larger version (69K):
[in this window]
[in a new window]
 
Figure 3. Changes with time in activity of the HPA axis and a target for ACTH (adrenal weight) and for glucocorticoids (B). Symbols and shading are explained in Fig. 1Go; the analysis is reported in Table 1Go and in the text. *, Significant post-hoc differences between fed and starved rats (by Fischer’s PLSD).

 
Plasma B was remarkably elevated in starved rats during the first hours of dark (1800–0000 h); it then decreased toward the levels observed in fed rats during the second half of the dark period. Particularly during the second half of the dark and during the light periods, plasma B reflected adrenal B rather than ACTH (Fig. 3Go, bottom left). The regression of plasma on adrenal B was highly significant (F = 85; P < 0.0001) as expected from examination of the curves. Fed rats exhibited a normal rhythm in plasma B throughout the dark with a peak of about 20 µg/dl at 1800 h and a nadir of less than 1 µg/dl at 0400–0600 h. During the light period, plasma (and adrenal) B in the fed rats increased unusually rapidly toward an evening peak, suggesting that there may have been some loss of control in the animal room during the latter part of the experiment. Just as adrenal weight of fasted rats increased during the light, probably as a consequence of the excess ACTH secreted, thymus weight was significantly reduced in the last sample collected, at 1600 h, probably as a consequence of the prolonged and marked elevation in plasma B (Fig. 3Go, bottom right).

Multiple regression analysis of adrenal B on insulin, leptin, FFA, glucose, and log ACTH showed only leptin to be significantly negatively correlated [fed: r = 0.426; P = 0.151; leptin (t) -2.895, P = 0.0051; starved: r = 0.324; P = 0.0061; leptin (t) -3.275, P = 0.0013].

Fat depot weights and leptin expression (Fig. 4Go)
Starved rats lost weight and fed rats gained weight in all fat stores during the 24 h; however, the dynamics differed. The weight of the dynamic, small perirenal fat depot decreased in both groups at 0200 h, 6 h after the first major feeding bout had ended in the fed rats. Perirenal fat weight increased in the fed groups between 0600–1200 h; after a transient trough at 1400 h, coincident with the bout of food intake in fed rats (Fig. 1Go, top right), perirenal fat stores increased again at 1600 h (Fig. 4Go, top left). Compared with fed rats, perirenal fat weight was decreased at 1000, 1200, and 1600 h in starved rats. (The marked changes in perirenal fat weights were apparent to the individual doing the dissection, before obtaining measured weights.) Epididymal fat weights did not differ through the dark period in fed and starved rats; however, again during the light period, weight increased in the fed rats (Fig. 4Go, middle). The weight of this depot in starved rats was significantly decreased at 1000 h and thereafter. The sc fat weight increased in fed rats at 1000–1200 h and then decreased slightly thereafter (Fig. 4Go, bottom). In starved rats, the weight of sc fat fell slowly throughout the day. Leptin mRNA levels were similar in fed and starved rats in both perirenal and sc depots during the hours of darkness (Fig. 4Go, top and bottom right). There were nocturnal increases in leptin expression in the sc depots of both groups (P < 0.05) that temporally mimicked the excursions in circulating leptin in fed rats (Fig. 1Go, bottom right). With the marked loss in perirenal fat weight, leptin expression in this depot appeared to decrease at the end of the dark period and during the light hours.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 4. Changes with time in fat mass and leptin expression. Symbols on the left are explained in Figs. 1Go and 3Go; analysis is reported in Table 1Go and the text. *, The first significant difference in fed and starved rats (by Fischer’s PLSD). Open and solid bars on the right represent results from fed and starved rats, respectively (n = 6/group). Results are discussed in the text.

 
Uncoupling protein content in interscapular brown adipose tissue was not different in starved and fed rats at 12 h, but was decreased at 24 h after the onset of starvation, indicating reduction of sympathetic outflow to this organ in food-deprived rats (fed, 61 ± 7 µg/depot; starved, 38 ± 7 µg/depot; P < 0.05).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Starvation initiated just before the onset of the daily feeding period is a profound stimulus to the energy economy of prepubescent, growing male rats. These results show compensatory responses in metabolites and hormones that begin within 2 h of food deprivation. In addition to direct peripheral effects, changes observed in insulin, FFA, leptin, glucose, and B may provide the afferent signals that organize hypothalamic responses, as these variables change significantly over the first 2–6 h after food removal. Changes in expression of the four hypothalamic neuropeptides show that starvation-induced changes in CRF and NPY, but not AVP or POMC, occur within the first 6–24 h, suggesting that neurons containing these neuropeptides are early sensors that mediate responses to starvation. As reported previously, activity in the HPA axis is stimulated rapidly by fasting and is markedly affected by the circadian cycle. However, control of adrenal and plasma B by ACTH is greatly reduced during the second half of the dark period and thereafter. These results suggest strongly that starvation shifts adrenal regulation of B synthesis and secretion away from hypothalamic control, through CRF and AVP, of ACTH secretion. Fat depots release their stores sequentially: perirenal = epididymal > subcutaneous. However, during the first day of starvation, expression of leptin in sc fat stores is not affected and continues its normal daily variation. By contrast, leptin expression in perirenal fat is decreased.

Systemic effects of starvation
Because food was removed toward the end of the light period, it is unlikely that there were large stores of glycogen available for immediate energy, and the rapid increase in FFA suggests that energy requirements during the early dark were met by mobilization of fat, initially from liver and then from adipose stores and probably muscle. Fat mobilization would be fostered by the immediate and marked reduction in insulin. The plateau of glucose that occurred by 2200 h was maintained at low but constant levels thereafter; this strongly suggests that by this time hepatic gluconeogenesis was sufficient to maintain output of this substrate. Again, the reduction in insulin would foster increased glucagon secretion and glucose synthesis and secretion. Although systemic plasma glucagon levels were not elevated during the dark in Akana’s study (6) (not shown), it is likely that increased glucagon stimulated the liver. Additionally, the nearly immediate increase in B secretion in starved rats would be expected to increase hepatic gluconeogenesis and gluconeogenetic enzymes, thus acting to sustain glucose production throughout the starvation period (17, 18). In the absence of insulin and the presence of high B, increased muscle breakdown and amino acid availability for gluconeogenesis would also be anticipated.

Signals and sensors
Changes in either FFAs or in insulin, leptin, or glucose serve as precise afferent signals to the hypothalamus about decreasing energy stores. Insulin was decreased, and FFA were increased at the first time tested after removal of food. The medial and lateral hypothalamus contains neurons that are directly sensitive to insulin, glucose, and FFA (19, 20); thus, changes in these would be directly perceived. Fatty acids also stimulate afferent nerves (21, 22) and act at the level of both ACTH secretion and directly at the adrenal to alter synthesis and secretion (23, 24, 25). The decrease in plasma leptin that occurs 2 h after the decrease in insulin and the increase in FFAs and B would also be registered by receptors in hypothalamic cell groups (26, 27, 28). The decreases in insulin and leptin would be expected to result in increased NPY synthesis in the arcuate nuclei (29, 30, 31, 32, 33) as would the increase in B (34, 35). Finally, by 2200 h, glucose levels have declined by approximately 30% to a new plateau, which is maintained for the duration of the experiment. This decrease in circulating glucose would be expected to act at the hypothalamus to reinforce the other peripheral signals of energy need. Infusion of glucose into the ventromedial nuclei of the hypothalamus prevents normal sympathetic and endocrine responses to severe insulin-induced hypoglycemia (36), and the sensitivity of these glucoreceptors may be sufficient to respond to the relatively small changes in glucose concentrations observed here. Thus, these studies identify rapid changes in at least five signals known to alter the hypothalamic control of energy balance that are apparent within 2–6 h of the onset of the fast.

The initial small increase in CRF mRNA at 6 h may reflect housekeeping chores in CRF neurons after the pronounced initial ACTH (and presumably CRF) secretion that occurred with the onset of the fast. However, the overall decrease in CRF mRNA during the subsequent hours surprised us, as NPY is stimulatory to CRF (37, 38), and NPY production was clearly elevated from 12 h on. The significantly decreased numbers of c-Fos-immunoreactive cells in the parvocellular PVN supports the idea that input to this region was reduced. However, it may be that the marked and sustained increase in B that occurred at the beginning of the fast curtailed CRF synthesis, as NPY infused intracerebroventricularly for 5 days results in inhibited ACTH and B responses to acute stress (9).

ACTH-adrenal uncoupling
Even during the first part of the dark, adrenal B content did not track ACTH well. During the rest of dark and throughout the light period, adrenal B did not appear to be regulated by ACTH. There was, however, a negative regression of adrenal B on leptin, and this result fits well with the previously reported inhibition of plasma B by leptin in starved rats (39). Thus, changes in leptin concentrations in both fed and starved rats explain at least part of the decoupling between adrenal B and ACTH in this study and where a similar dissociation between ACTH and adrenal B was found (but not shown) (6). Leptin receptors are found in adrenal (40, 41) as well as hypothalamus, and it is not clear whether the relationship we observed between leptin and B is direct or indirect. In addition to the fairly small correlation between B and leptin, there is clearly a strong effect, particularly evident at the dark-light transition, that may be a consequence of altered activity in adrenal nerves (42, 43) directed by changes in hypothalamic activity (44, 45, 46). The combination of adrenal regulatory effects resulted in a marked elevation in mean plasma B in starved vs. fed rats (24.3 vs. 8.7 µg/dl, respectively). This major increase in glucocorticoid levels is sufficient to act on glucocorticoid receptors in targets throughout the animal (47, 48). Although older male rats with fixed, low B levels survive starvation for 48 h, and elevated B is not essential for responses in NPY mRNA (7), it is probable that elevated B levels abet many of the responses determined by other hormones, neural action, and metabolites.

Adipose tissue stores
White adipose tissue depots were mobilized during the light period of the day after the onset of starvation. It is unlikely that changes in sympathetic outflow to white adipose tissue (49) were increased, both because starvation is known to decrease sympathetic outflow (50) and because sympathetic stimulation decreases leptin biosynthesis (51), which was not observed until the later parts of the study. It is also likely that overall sympathetic neural outflow to fat depots was decreased, as shown by the significant decrease in uncoupling protein content in interscapular brown adipose tissue by 24 h. This raises the question of what caused the abrupt decrease in leptin secretion in the absence of a concurrent change in leptin mRNA. Again, it may be that insulin is the effector, as the decrease in insulin precedes the drop in leptin secretion, and insulin is clearly related to both leptin synthesis and secretion (52, 53, 54).

Sequelae
Within several hours of the onset of starvation, young male rats exhibit alterations in metabolism, hormones, and neuropeptides that equip them for survival, if food is to be obtained. The increased NPY mRNA, will act, when the peptide is secreted, to increase the drive for food (55), and thus food-seeking behavior. The late decrease in CRF mRNA should both decrease central sympathetic drive (56, 57) and decrease the anorexogenic effect of CRF (1). Decreases in circulating leptin and insulin, in addition to the peripheral effects they exert, should also bolster the increases in NPY synthesis and secretion (58). The uncoupling of adrenal B regulation from ACTH allows (CRF and) ACTH levels to fall after a pronounced secretory burst, which may have a trophic effect on the adrenals. The persistently increased B level would be expected to stimulate NPY mRNA (59) and decrease CRF mRNA (60), again abetting changes in other hormones and metabolites. Finally, although there is relatively little fat in the young male rats that were studied, mobilization of fat stores provides sufficient metabolic fuel for foraging.


    Footnotes
 
1 This work was supported in part by Grants DK-28172 and DK-09519 (to S.C.). Back

2 Present address: Department of Pharmacology, Merck Corp., Rahway, New Jersey 07065. Back

Received January 14, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schwartz MW, Dallman MF, Woods SC 1995 The hypothalamic response to starvation: implications for the study of wasting disorders. Am J Physiol 269:R949–R957
  2. Akana SF, Scribner KA, Bradbury MJ, Strack AM, Walker C-D, Dallman MF 1992 Feedback sensitivity of the rat hypothalamic-pituitary adrenal axis and its capacity to adjust to exogenous corticosterone. Endocrinology 131:585–594[Abstract/Free Full Text]
  3. Bradbury MJ, Cascio CS, Scribner KA, Dallman MF 1991 Stress-induced adrenocrticotropin secretion: diurnal responses and decreases during stress in the evening are not dependent on corticosterone. Endocrinology 128:680–688[Abstract/Free Full Text]
  4. Akana SF, Dallman MF 1992 Feedback and facilitation in the adrenocortical system: unmasking facilitation by partial inhibition of the glucocorticoid response to prior stress. Endocrinology 131:57–68[Abstract/Free Full Text]
  5. Hanson ES, Bradbury MJ, Akana SF, Scribner KA, Strack AM, Dallman MF 1994 The diurnal rhythm in adrenocorticotropin responses to restraint in adrenalectomized rats is determined by caloric intake. Endocrinology 134:2214–2220[Abstract/Free Full Text]
  6. Akana SF, Strack AM, Hanson ES, Dallman MF 1994 Regulation of activity in the hypothalamo-pituitary-adrenal axis is integral to a larger hypothalamic system that determines caloric flow. Endocrinology 135:1125–1134[Abstract]
  7. Hanson ES, Levin N, Dallman MF 1997 Elevated corticosterone is not required for the rapid induction of NPY gene expression by an overnight fast. Endocrinology 138:1041–1047[Abstract/Free Full Text]
  8. Choi S, Dallman MF 1998 The hypothalamic ventromedial nuclei amplify circadian rhythms: do they contain a food-entrained oscillator? J Neurosci 18:3843–3852[Abstract/Free Full Text]
  9. Akana SF, Hanson ES, Horsley CJ, Strack AM, Bhatnagar S, Bradbury MJ, Milligan ED, Dallman MF 1996 Clamped corticosterone (B) reveals the effect of endogenous B on both facilitated responsivity to acute restraint and metabolic responses to chronic stress. Stress 1:33–49[Medline]
  10. Strack AM, Bradbury MJ, Dallman MF 1995 Corticosterone decreases nonshivering thermogenesis and increases lipid storage in brown adipose tissue. Am J Physiol 268:R183–R191
  11. Lean MEJ, Branch WJ, James WPT, Jennings G, Ashwell M 1983 Measurement of rat brown-adipose-tissue mitochondrial uncoupling protein by radioimmunoassay: increased concentration after cold acclimation. Biosci Rep 3:61–71[CrossRef][Medline]
  12. Akana SF, Dallman MF 1997 Chronic cold in adrenalectomized, corticosterone (B)-treated rats: facilitated corticotropin responses to acute stress emerge as B increases. Endocrinology 138:3249–3258[Abstract/Free Full Text]
  13. Baskin DG, Stahl WL 1993 Fundamentals of quantitative autoradiography by computer densitometry for in situ hybridization, with emphasis on 33P. J Histochem Cytochem 41:1767–1776[Abstract]
  14. Harbuz MS, Lightman SL 1989 Responses of hypothalamic and pituitary mRNA to physical and psychological stress in the rat. J Endocrinol 122:705–711[Abstract/Free Full Text]
  15. Holland PM, Abramson RD, Watson R, Gelfand DH 1991 Detection of specific polymerase chain reaction product by utilizing the 5' to 3' exonuclease activity in thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 85:9436–9440
  16. SAS Institute 1998 StatView 5. SAS Institute, Cary
  17. Thorens B, Flier JS, Lodish HF, Kahn BB 1990 Differential regulation of two glucose transporters in rat liver by fasting and refeeding and by diabetes and insulin treatment. Diabetes 39:712–719[Abstract]
  18. Connolly CC, Myers SR, Neal DW, Hastings JR, Cherrington AD 1996 In the absence of counterregulatory hormones, the increase in hepatic glucose production during insulin-induced hypoglycemia in the dog is initiated in the liver rather than the brain. Diabetes 45:1805–1813[Abstract]
  19. Oomura Y, Yoshimatsu H 1984 Neural network of glucose monitoring system. J Autonomic Nervous System 10:359–372
  20. Levin BE, Routh VH 1996 Role of the brain in energy balance and obesity. Am J Physiol 271:R491–R500
  21. Ritter S, Dinh TT 1994 2-Mercaptoacetate and 2-deoxy-D-glucose induce Fos-like immunoreactivity in rat brain. Brain Res 641:111–120[CrossRef][Medline]
  22. Ritter S, Dinh TT, Friedman MI 1994 Induction of Fos-like immunoreactivity (Fos-li) and stimulation of feeding by 2,5-anhydro-D-mannitol (2,5-AM) require the vagus nerve. Brain Res 646:53–64[CrossRef][Medline]
  23. Widmaier EP, Rosen K, Abbott B 1992 Free fatty acids activate the hypothalamic-pituitary-adrenocortical axis in rats. Endocrinology 131:2313–2318[Abstract/Free Full Text]
  24. Widmaier EP, Margenthaler J, Sarel I 1995 Regulation of pituitary-adrenocortical activity by free fatty acids in vivo and in vitro. Prostaglandins Leukotrienes Essential Fatty Acids 52:179–183[CrossRef][Medline]
  25. Widmaier EP 1996 Fatty acid regulation of endocrine activity. In: Yehuda S, Mostofsky DI (eds) Handbook of Essential Fatty Acid Biology. Humana Press, Totowa, pp 115–135
  26. Mercer JG, Hoggard N, Williams L, Lawrence CB, Hannah LT, Trayhurn P 1996 Localization of leptin receptor mRNA and the long form splice variant (Ob-Rb) in mouse hypothalamus and adjacent brain regions by in situ hybridization. FEBS Lett 387:113–116[CrossRef][Medline]
  27. Schwartz MW, Seeley RJ, Campfield LA, Burn P, Baskin DG 1996 Identification of targets of leptin action in rat hypothalamus. J Clin Invest 98:1101–1106[Medline]
  28. Larsen PJ, Mikkelsen JD 1995 Functional identification of central afferent projections conveying information of acute "stress" to the hypothalamic paraventricular nucleus. J Neurosci 15:2609–2627[Abstract]
  29. Schwartz MW, Sipols AJ, Marks JL, Sanacora G, White JD, Scheurinck A, Kahn SE, Baskin DG, Woods SC, Figlewicz DP, Porte DJ 1992 Inhibition of hypothalamic neuropeptide Y gene expression by insulin. Endocrinology 130:3608–3616[Abstract/Free Full Text]
  30. Mercer JG, Lawrence CB, Atkinson T 1996 Hypothalamic NPY and CRF gene expression in food-deprived syrian hamster. Physiol Behav 60:121–127[CrossRef][Medline]
  31. Stephens TW, Basinski M, Bristow PK, Bue-Valleskey JM, Burgett SG, Craft L, Hale J, Hoffmann J, Hsiung HM, Kriauciunas A, MacKellar W, Rosteck PR, Jr, Schoner B, Smith D, Tinsley FC, Zhang X-Y, Heiman M 1995 The role of neuropeptide Y in the antiobesity action of the obese gene product. Nature 377:530–532[CrossRef][Medline]
  32. Friedman JM 1997 The alphabet of weight control. Nature 385:119–120[CrossRef][Medline]
  33. Schwartz MW, Figlewicz DP, Baskin DG, Woods SC, Porte DJ 1994 Update 1994: insulin and the central control of energy balance. Endocr Rev Monogr 2:109–113
  34. Strack AM, Sebastian RJ, Schwartz MW, Dallman MF 1995 Glucocorticoids and insulin: reciprocal signals for energy balance. Am J Physiol 268:R142–R149
  35. Larsen PJ, Jessop DS, Chowdrey HS, Lightman SL, Mikkelsen JD 1994 Chronic administration of glucocorticoids directly upregulates prepro-neuropeptide Y and Y1-receptor mRNA levels in the arcuate nucleus of the rat. J Neuroendocrinol 6:153–159[CrossRef][Medline]
  36. Borg WP, Sherwin RS, During MJ, Borg MA, Shulman GI 1995 Local ventromedial hypothalamus glucopenia triggers counterregulatory hormone release. Diabetes 44:180–184[Abstract]
  37. Wahlestedt C, Skagerberg G, Ekman R, Heilig M, Sundler F, Hakanson R 1987 Neuropeptide Y (NPY) in the area of the hypothalamic paraventricular nucleus activates the pituitary-adrenocortical axis in the rat. Brain Res 417:33–38[CrossRef][Medline]
  38. Hanson ES, Dallman MF 1995 Neuropeptide Y (NPY) may integrate responses of hypothalamic feeding systems and the hypothalamo-pituitary-adrenal axis. J Neuroendocrinol 7:273–279[CrossRef][Medline]
  39. Ahima RS, Prabakaran D, Mantzoros C, Qu D, Lowell B, Maratos-Flier E, Flier JS 1996 Role of leptin in the neuroendocrine response to fasting. Nature 382:250–253[CrossRef][Medline]
  40. Hoggard N, Mercer JG, Rayner DV, Moar K, Trayhurn P, Williams LM 1997 Localization of leptin receptor-mRNA splice variants in murine peripheral tissues by RT-PCR and in situ hybridization. Biochem Biophys Res Commun 232:383–387[CrossRef][Medline]
  41. Cao G-Y, Considine RB, Lynn RB 1997 Leptin receptors in the adrenal medulla of the rat. Am J Physiol 273:E448–E452
  42. Jasper MS, Engeland WC 1994 Splanchnic neural activity modulates ultradian and circadian rhythms in adrenocortical secretion in awake rats. Neuroendocrinology 59:97–109[Medline]
  43. Dijkstra I, Binnekade R, Tilders FJH 1996 Diurnal variation in resting levels of corticosterone is not mediated by variation in adrenal responsiveness to adrenocorticotropin but involves splanchnic nerve integrity. Endocrinology 137:540–547[Abstract]
  44. Buijs RM, Kalsbeek A, van der Woude TP, van Heerikhuize JJ, Shinn S 1993 Suprachismatic nucleus lesion increases corticosterone secretion. Am J Physiol 264:R1186–R1192
  45. Buijs RM, Wortel J, Van Heerikhuize JJ, Kalsbeek A 1997 Novel environment induced inhibition of corticosterone secretion: physiological evidence for a suprachiasmatic nucleus mediated neuronal hypothalamo-adrenal cortex pathway. Brain Res 758:229–236[CrossRef][Medline]
  46. Kalsbeek A, Buijs RM, van Heerikhuize JJ, Arts M, van der Woude TP 1992 Vasopressin-containing neurons of the suprachiasmatic nuclei inhibit corticosterone release. Brain Res 580:62–67[CrossRef][Medline]
  47. Spencer RL, Young EA, Choo PH, McEwen BS 1990 Adrenal steroid type I and type II receptor binding: estimates of in vivo receptor number, occupancy, and activation with varying level of steroid. Brain Res 514:37–48[CrossRef][Medline]
  48. Spencer RL, Miller AH, Moday H, Stein M, McEwen BS 1993 Diurnal differences in basal and acute stress levels of type I and type II adrenal steroid activation in neural and immune tissues. Endocrinology 133:1941–1950[Abstract/Free Full Text]
  49. Youngstrom TG, Bartness TJ 1995 Catecholaminergic innervation of white adipose tissue in Siberian hamsters. Am J Physiol 268:R744–R751
  50. Young JB, Landsberg L 1977 Suppression of sympathetic nervous system during fasting. Science 196:1473–1475[Abstract/Free Full Text]
  51. Kosaki A, Yamada K, Kuzuya H 1996 Reduced expression of the leptin gene (ob) by catecholamine through a Gs protein-coupled pathway in 3T3–L1 adipocytes. Diabetes 45:1744–1749[Abstract]
  52. Saladin R, De Vos P, Guerre-Millo M, Leturque A, Girard J, Staels B, Auwerx J 1995 Transient increase in obese gene expression after food intake or insulin administration. Nature 377:527–529[CrossRef][Medline]
  53. Cusin I, Sainsbury A, Doyle P, Rohner-Jeanrenaud F, Jeanrenaud B 1995 The ob gene and insulin. A relationship leading to clues to the understanding of obesity. Diabetes 44:531–535[Abstract]
  54. Mizuno TM, Bergen H, Funabashi T, Kleopoulos SP, Zhong Y-G, Baumann WA, Mobbs CV 1996 Obese gene expression: reduction by fasting and stimulation by insulin and glucose in lean mice, and persistent elevation in acquired (diet-induced) and genetic (yellow agouti) obesity. Proc Natl Acad Sci USA 93:3434–3438[Abstract/Free Full Text]
  55. Matson CA, Seeley RJ, Chavez M, Woods SC, Schwartz MW 1995 Behavioral and hypothalamic responses to overfeeding in the rat. Soc Neurosci Abstr 21:696
  56. Fisher LA, Rivier J, Rivier C, Spiess J, Vale W, Brown MR 1982 Corticotropin-releasing factor: effects on the autonomic nervous system and visceral systems. Endocrinology 110:2222–2224[Abstract/Free Full Text]
  57. Fisher LA 1993 Central actions of corticcotropin-releasing factor on autonomic nervous activity and cardiovascular function. Ciba Found Symp 172:243–253[Medline]
  58. Woods SC, Seeley RJ, Porte D, Schwartz MW 1998 Signals that regulate food intake and energy homeostasis. Science 280:1378–1383[Abstract/Free Full Text]
  59. White BD, Dean RD, Edwards GL, Martin RJ 1994 Type II corticosteroid receptor stimulation increases NPY gene expression in basomedial hypothalamus of rats. Am J Physiol 266:R1523–R1529
  60. Swanson LW, Simmons DM 1989 Differential steroid hormone and neural influences on peptide mRNA levels in CRH cells of the paraventricular nucleus: a hybridization histochemical study in the rat. J Comp Neurol 285:413–435[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
A. Stengel, M. Goebel, M. Million, M. P. Stenzel-Poore, P. Kobelt, H. Monnikes, Y. Tache, and L. Wang
Corticotropin-Releasing Factor-Overexpressing Mice Exhibit Reduced Neuronal Activation in the Arcuate Nucleus and Food Intake in Response to Fasting
Endocrinology, January 1, 2009; 150(1): 153 - 160.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Enthoven, M. S. Oitzl, N. Koning, M. van der Mark, and E. R. de Kloet
Hypothalamic-Pituitary-Adrenal Axis Activity of Newborn Mice Rapidly Desensitizes to Repeated Maternal Absence but Becomes Highly Responsive to Novelty
Endocrinology, December 1, 2008; 149(12): 6366 - 6377.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. Salter-Venzon and A. G. Watts
The role of hypothalamic ingestive behavior controllers in generating dehydration anorexia: a Fos mapping study
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1009 - R1019.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. Morgado, M. K. Gordon, M. del Carmen Minana-Solis, E. Meza, S. Levine, C. Escobar, and M. Caba
Hormonal and metabolic rhythms associated with the daily scheduled nursing in rabbit pups
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R690 - R695.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Revsin, D. van Wijk, F. E. Saravia, M. S. Oitzl, A. F. De Nicola, and E. R. de Kloet
Adrenal Hypersensitivity Precedes Chronic Hypercorticism in Streptozotocin-Induced Diabetes Mice
Endocrinology, July 1, 2008; 149(7): 3531 - 3539.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
W. Inoue, G. Somay, S. Poole, and G. N. Luheshi
Immune-to-brain signaling and central prostaglandin E2 synthesis in fasted rats with altered lipopolysaccharide-induced fever
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2008; 295(1): R133 - R143.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. Ellis, K. M. Moar, T. J. Logie, A. W. Ross, P. J. Morgan, and J. G. Mercer
Diurnal profiles of hypothalamic energy balance gene expression with photoperiod manipulation in the Siberian hamster, Phodopus sungorus
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2008; 294(4): R1148 - R1153.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. M. Gorton, A. M. Khan, M. Bohland, G. Sanchez-Watts, C. M. Donovan, and A. G. Watts
A Role for the Forebrain in Mediating Time-of-Day Differences in Glucocorticoid Counterregulatory Responses to Hypoglycemia in Rats
Endocrinology, December 1, 2007; 148(12): 6026 - 6039.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
C. Crane, N. Akhter, B. W. Johnson, M. Iruthayanathan, F. Syed, A. Kudo, Y.-H. Zhou, and G. V. Childs
Fasting and Glucose Effects on Pituitary Leptin Expression: Is Leptin a Local Signal for Nutrient Status?
J. Histochem. Cytochem., October 1, 2007; 55(10): 1059 - 1073.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. L. Dimitrov, M. R. DeJoseph, M. S. Brownfield, and J. H. Urban
Involvement of Neuropeptide Y Y1 Receptors in the Regulation of Neuroendocrine Corticotropin-Releasing Hormone Neuronal Activity
Endocrinology, August 1, 2007; 148(8): 3666 - 3673.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X.-Q. Chen, J. Dong, C.-Y. Niu, J.-M. Fan, and J.-Z. Du
Effects of Hypoxia on Glucose, Insulin, Glucagon, and Modulation by Corticotropin-Releasing Factor Receptor Type 1 in the Rat
Endocrinology, July 1, 2007; 148(7): 3271 - 3278.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Y. Iwasaki, M. Nishiyama, T. Taguchi, M. Kambayashi, M. Asai, M. Yoshida, T. Nigawara, and K. Hashimoto
Activation of AMP-activated protein kinase stimulates proopiomelanocortin gene transcription in AtT20 corticotroph cells
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1899 - E1905.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Shimakura, T. Terada, H. Saito, T. Katsura, and K.-i. Inui
Induction of intestinal peptide transporter 1 expression during fasting is mediated via peroxisome proliferator-activated receptor {alpha}
Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G851 - G856.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
B Beck
Neuropeptide Y in normal eating and in genetic and dietary-induced obesity
Phil Trans R Soc B, July 29, 2006; 361(1471): 1159 - 1185.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. B. S. Harris, E. W. Kelso, W. P. Flatt, T. J. Bartness, and H. J. Grill
Energy Expenditure and Body Composition of Chronically Maintained Decerebrate Rats in the Fed and Fasted Condition
Endocrinology, March 1, 2006; 147(3): 1365 - 1376.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
B. C. Nindl, K. R. Rarick, J. W. Castellani, A. P. Tuckow, J. F. Patton, A. J. Young, and S. J. Montain
Altered secretion of growth hormone and luteinizing hormone after 84 h of sustained physical exertion superimposed on caloric and sleep restriction
J Appl Physiol, January 1, 2006; 100(1): 120 - 128.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Karteris, R. J. Machado, J. Chen, S. Zervou, E. W. Hillhouse, and H. S. Randeva
Food deprivation differentially modulates orexin receptor expression and signaling in rat hypothalamus and adrenal cortex
Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1089 - E1100.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. E. la Fleur, E. C. Wick, P. S. Idumalla, E. F. Grady, and A. Bhargava
From the Cover: Role of peripheral corticotropin-releasing factor and urocortin II in intestinal inflammation and motility in terminal ileum
PNAS, May 24, 2005; 102(21): 7647 - 7652.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. E. la Fleur, H. Houshyar, M. Roy, and M. F. Dallman
Choice of Lard, But Not Total Lard Calories, Damps Adrenocorticotropin Responses to Restraint
Endocrinology, May 1, 2005; 146(5): 2193 - 2199.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
H. Houshyar, S. Manalo, and M. F. Dallman
Time-Dependent Alterations in mRNA Expression of Brain Neuropeptides Regulating Energy Balance and Hypothalamo-Pituitary-Adrenal Activity after Withdrawal from Intermittent Morphine Treatment
J. Neurosci., October 20, 2004; 24(42): 9414 - 9424.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Pecoraro, F. Reyes, F. Gomez, A. Bhargava, and M. F. Dallman
Chronic Stress Promotes Palatable Feeding, which Reduces Signs of Stress: Feedforward and Feedback Effects of Chronic Stress
Endocrinology, August 1, 2004; 145(8): 3754 - 3762.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. F. Dallman, S. E. la Fleur, N. C. Pecoraro, F. Gomez, H. Houshyar, and S. F. Akana
Minireview: Glucocorticoids--Food Intake, Abdominal Obesity, and Wealthy Nations in 2004
Endocrinology, June 1, 2004; 145(6): 2633 - 2638.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. E. la Fleur, S. F. Akana, S. L. Manalo, and M. F. Dallman
Interaction between Corticosterone and Insulin in Obesity: Regulation of Lard Intake and Fat Stores
Endocrinology, May 1, 2004; 145(5): 2174 - 2185.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. G. Watts, S. Tanimura, and G. Sanchez-Watts
Corticotropin-Releasing Hormone and Arginine Vasopressin Gene Transcription in the Hypothalamic Paraventricular Nucleus of Unstressed Rats: Daily Rhythms and Their Interactions with Corticosterone
Endocrinology, February 1, 2004; 145(2): 529 - 540.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Ruiter, S. E. La Fleur, C. van Heijningen, J. van der Vliet, A. Kalsbeek, and R. M. Buijs
The Daily Rhythm in Plasma Glucagon Concentrations in the Rat Is Modulated by the Biological Clock and by Feeding Behavior
Diabetes, July 1, 2003; 52(7): 1709 - 1715.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. Salter and A. G. Watts
Differential suppression of hyperglycemic, feeding, and neuroendocrine responses in anorexia
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2003; 284(1): R174 - R182.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
I. Swart, J. W. Jahng, J. M. Overton, and T. A. Houpt
Hypothalamic NPY, AGRP, and POMC mRNA responses to leptin and refeeding in mice
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2002; 283(5): R1020 - R1026.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. M. Kotz, C. Wang, A. S. Levine, and C. J. Billington
Urocortin in the hypothalamic PVN increases leptin and affects uncoupling proteins-1 and -3 in rats
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2002; 282(2): R546 - R551.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. S. Randeva, E. Karteris, D. Grammatopoulos, and E. W. Hillhouse
Expression of Orexin-A and Functional Orexin Type 2 Receptors in the Human Adult Adrenals: Implications for Adrenal Function and Energy Homeostasis
J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4808 - 4813.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. D. Laugero, M. E. Bell, S. Bhatnagar, L. Soriano, and M. F. Dallman
Sucrose Ingestion Normalizes Central Expression of Corticotropin-Releasing-Factor Messenger Ribonucleic Acid and Energy Balance in Adrenalectomized Rats: A Glucocorticoid-Metabolic-Brain Axis?
Endocrinology, July 1, 2001; 142(7): 2796 - 2804.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Kalsbeek, E. Fliers, J. A. Romijn, S. E. la Fleur, J. Wortel, O. Bakker, E. Endert, and R. M. Buijs
The Suprachiasmatic Nucleus Generates the Diurnal Changes in Plasma Leptin Levels
Endocrinology, June 1, 2001; 142(6): 2677 - 2685.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
I. Castagliuolo, K. Karalis, L. Valenick, A. Pasha, S. Nikulasson, M. Wlk, and C. Pothoulakis
Endogenous corticosteroids modulate Clostridium difficile toxin A-induced enteritis in rats
Am J Physiol Gastrointest Liver Physiol, April 1, 2001; 280(4): G539 - G545.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. D Militante, J. B Lombardini, and S. W Schaffer
The role of taurine in the pathogenesis of the cardiomyopathy of insulin-dependent diabetes mellitus
Cardiovasc Res, June 1, 2000; 46(3): 393 - 402.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Choi, R. Sparks, M. Clay, and M. F. Dallman
Rats with Hypothalamic Obesity Are Insensitive to Central Leptin Injections
Endocrinology, October 1, 1999; 140(10): 4426 - 4433.
[Abstract] [Full Text]


Home page
J. Neurosci.Home page
U. Shalev, J. Yap, and Y. Shaham
Leptin Attenuates Acute Food Deprivation-Induced Relapse to Heroin Seeking
J. Neurosci., February 15, 2001; 21(4): RC129 - RC129.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dallman, M. F.
Right arrow Articles by Viau, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dallman, M. F.
Right arrow Articles by Viau, V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals