| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Division of Bone and Mineral Metabolism, Charles A. Dana and Thorndike Laboratories, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215
Address all correspondence and requests for reprints to: Dr. Michael Chorev, Division of Bone and Mineral Metabolism, Department of Medicine, Beth Israel Deaconess Medical Center, 330 Brookline Avenue (HIM 944), Boston, Massachusetts 02215. E-mail: mchorev{at}warren.med.harvard.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Two parallel approaches have been used to study bimolecular interactions of these hormones and their receptors: the "hormone-centered" and the "receptor-centered" approaches. Each relies on modification of the structure of either the hormones or the receptors exclusively. Using the "hormone-centered" approach, we and others showed that position 5 in both hormones represents a "specificity switch" for the PTH2R. Swapping His5 in PTHrP with its counterpart Ile5 from PTH yields the analog [Ile5]-PTHrP (134), which becomes "PTH-like" (and unlike PTHrP) and binds to and activates PTH2R. The reciprocal exchange yields the analog [His5]-PTH (134), which is "PTHrP-like" in that it has very low efficacy in the PTH2R system (3, 13).
Using a receptor-centered approach, several important regions in the PTH2R responsible for ligand-specificity were identified. In one report, residues in transmembrane domain (TMD) 3, TMD 7, and the N-terminal extracellular tail were shown to disrupt recognition of PTHrP by the PTH2R (14). It was postulated that the extracellular portion of the TMD bundle functions as a selectivity filter or barrier that prevents PTHrP from interacting with the PTH2R. Additionally, Clark et al. (15) concluded that the N-terminal tail and the extracellular loop (ECL) 3 of PTH1R and PTH2R interact similarly with PTH and that both domains contribute to differential interaction with PTHrP. Nevertheless, they did not identify specific sites of interaction (15). Bergwitz and co-workers (16) identified two single amino acids in PTH2R, Ile244 in TMD 3, and Tyr318 in ECL 2, as being involved in the ligand-derived His5/Ile5 receptor subtype specificity switch.
We have applied a photoaffinity cross-linking approach, which examines directly the nature of the hormone-receptor interface, to specifically identify the "contact domains" between PTH analogs and the PTH2R. Such studies will help develop an experimentally derived model of ligand-receptor complexes in the PTH/PTHrP system and contribute to the understanding of the mechanism of receptor subtype specificity. Observations made in these studies could shed light on the nature of "molecular recognition" in the GPCR system in general.
| Materials and Methods |
|---|
|
|
|---|
Radioiodinations
[Nle8,18,Tyr34]bPTH-(134)NH2
(PTH-(134)),
[Bpa1,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]bPTH-(134)NH2
(Bpa1-PTH),
[Bpa6,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]bPTH-(134)NH2
(Bpa6-PTH), and
[Nle8,18,Lys13(
-pBz2),L-2-Nal23,Arg26,27,Tyr34]bPTH-(134)NH2
(K13) were radioiodinated and RP-HPLC-purified as previously described
(17, 18, 19), but with the following modification: all iodination reactions
were carried out for 12 min.
Cell culture
HEK-293 cells, PTH2R-expressing HEK-293/BP-16 cells (
160,000
receptors/cell) and COS-7 cells (a generous gift of Dr. Steven
Goldring, Beth Israel Deaconess Medical Center) were cultured in DMEM
supplemented with 10% FBS as previously described (2).
PTH2R binding
HEK-293/BP-16 cells were subcultured in 24-well plates and grown
to confluence. Radioreceptor binding assays were carried out as
previously described using
125I-[Nle8,18,Tyr34]PTH-(134)NH2
(125I-PTH),
125I-[Bpa1,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]bPTH-(134)NH2
(125I-Bpa1-PTH),
125I-[Bpa6,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]bPTH-(134)NH2
(125I-Bpa6-PTH) or
125I-[Nle8,18,Lys13(
-pBz2),Arg26,27,L-2-Nal23,Tyr34]bPTH-(134)NH2
(125I-K13) as radioligands (2, 20) as noted. The values
presented in Table 1
were obtained
directly from three independent competition dose-dependent graphs
(e.g. Fig. 1A
).
|
|
Photoaffinity cross-linking and membrane protein preparation
Photoaffinity cross-linking (preparative and analytical scales)
and of 125I-K13 and 125I-Bpa1-PTH
to the PTH2R and membrane protein preparation were carried
out as previously described for the PTH1R (17, 19, 21).
Enzymatic and chemical digestions of the ligand-receptor
conjugates
Samples of the isolated SDS-PAGE bands representing either the
radiolabeled hormone-receptor conjugates or conjugated fragments were
prepared in small volumes (typically 1020 µl) of 25 mM
Tris-HCl (pH 8.5) Triton X-100 (0.1% vol/vol), SDS (0.01% wt/vol).
Endo-F digestions were carried out at 37 C for 24 h, according to
the manufacturers procedure. Lys-C digestions were performed by
treatments with 0.15 U (in 10 µl water) at 37 C for 24 h. CNBr
digestions were performed with 100 µl of 50 mg/ml in 70% formic acid
in darkness at RT for 24 h. NCS cleavage was carried out with 100
µl of 10 mg/ml in 50% acetic acid in darkness at RT for 24 h.
Samples were dried on Speed-vac and dissolved in reducing sample buffer
(22) before PAGE analysis.
Electrophoresis and autoradiography
Electrophoretic analyses were performed using 7.5% (wt/vol)
SDS-PAGE for the intact and deglycosylated hormone-receptor conjugates
and 16.5% (wt/vol) Tricine/SDS-PAGE for the cleavage products (19).
Appropriate molecular weight markers (Amersham Pharmacia Biotech) were included in each gel. Gels were dried and exposed
to x-ray films (X-omat, Eastman Kodak Co., Rochester, NY)
with intensifying screens (XAR-5, Kodak). Following
autoradiography, the radioactive fragments were excised from the dried
gels, electroeluted (Bio-Rad Laboratories, Inc.,
Electroeluter 422) in SDS-PAGE running buffer and concentrated on a
Speed-Vac.
Receptor mutagenesis
Single mutations, V380M and K137R were introduced into the PTH2R
complementary DNA (cDNA). Primer pairs (sense and antisense) were
prepared containing these amino acid modifications (Life Technologies, Inc. Custom primers): sense V380M (5' to 3')
CATTACATCGTGTTCATGTGCCTGCCTCACTCC; sense K137R (5' to 3')
CCAGATATCAGCATAGGACGACAAGAATTCTTTGAACGC. Primer pairs were used in the
PCR-based Quik-Change Site-Directed Mutagenesis Kit
(Stratagene, La Jolla, CA), using PTH2R (1) in the pZeoSV2
(Invitrogen) mammalian expression vector as a template.
The double mutant PTH2R[V380M/M395L] was generated in a similar
fashion by introducing a single mutation into the point mutated
PTH2R[V380M] receptor cDNA with the primer pair: sense (5' to 3')
GCTCGGGTGGGAGATCCGCTTACACTGTGAACTCTTCTTC. Individual PCR reactions were
used to transform Epicurian Coli XL1-Blue supercompetent cells
(Stratagene). Transformations were plated on bacteriologic
agar containing Zeocine (Invitrogen, Carlsbad, CA).
Colonies were identified and selected for plasmid isolation (Miniprep
Kit, QIAGEN, Valencia, CA). Plasmid preparations
were cycle sequenced (Genomix, Foster City, CA) to confirm the fidelity
of the mutation using oligonucleotide primers located 5' and 3' to the
regions of the PTH2R targeted for mutation.
Transient transfection
For photoaffinity cross-linking experiments, COS-7 cells were
plated at 3 x 105 cells/well in a six-well dish,
24 h before transient transfections. Two micrograms of vector, or
vector containing mutant or wild-type receptor cDNA inserts were
transfected using 6 µl FuGENE 6 (Roche Molecular Biochemicals) transfection reagent. For binding and AC assays,
COS-7 cells were plated at 65,000 cells/well in 24-well dishes, 24
h before transfection, and assayed as described above 48 h after
transfection. Transfection efficiencies were typically 5070% as
estimated by Lac Z assay (23).
| Results |
|---|
|
|
|---|
160,000 receptors/cell,
HEK-293/BP-16). Binding affinity was measured by competition with
125I-[Nle8,18,Tyr34]bPTH-(134)NH2
(125I-PTH) (Fig. 1A
The most potent analogs in this series, Bpa1- and
Bpa6-PTH, were further evaluated. Following
radioiodination, 125I-Bpa1-PTH exhibited full
binding capacity (Fig. 1C
), whereas
125I-Bpa6-PTH lost more than 60% of its total
binding, compared with the radioiodinated 125I-PTH (not
shown). More importantly, the ability of iodinated Bpa1-PTH
(I-Bpa1-PTH) to stimulate AC activity was similar to that
of the noniodinated Bpa1-PTH (Fig. 1D
). Therefore,
Bpa1-PTH was selected for the photoaffinity cross-linking
studies described below.
Photoaffinity labeling of the PTH2R with125I-Bpa1-PTH. Photocross-linking of
125I-Bpa1-PTH to the PTH2R yielded a single
diffuse band migrating at approximately 90 kDa as analyzed by 7.5%
SDS-PAGE (Fig. 2A
, lane 2). This band is
receptor-specific because it is not observed in similar experiments
with parental HEK-293 cells that do not express the receptor (Fig. 2A
, lane 1). Moreover, formation of the ligand-receptor conjugate was
completely inhibited by the presence of excess (1 µM)
unlabeled agonist PTH-(134) or antagonist PTH-(734) (Fig. 2A
, lanes
3 and 5, respectively). Excess of unlabeled PTHrP-(134) (1
µM) inhibited very weakly the formation of the
ligand-receptor photoconjugate (Fig. 2A
, lane 4), whereas
[Leu11,D-Trp12]PTHrP-(734)NH2,
a potent PTHrP-derived antagonist for the PTH1R (24), competed more
effectively compared with PTHrP-(134) (Fig. 2A
, lane 6), in agreement
with the binding affinities of these analogs for the PTH2R determined
previously (2). Endo-F-treatment of the 90-kDa band shifted the
radiolabeled band to approximately 60-kDa band, generating the
deglycosylated 125I-Bpa1-PTH-PTH2R
photoconjugate (Fig. 2B
, lane 2).
|
60 kDa) yielded a fragment with the same
apparent molecular weight (not shown), suggesting the absence of
glycosylation sites within the Lys-C-generated fragment Ia.
CNBr treatment of the excised and eluted approximately 12 kDa
(Ia) conjugate fragment produced a single band with apparent
mass of approximately 8 kDa (Ib) (Fig. 3A
|
Because 125I-Bpa1-PTH has a molecular weight of
4487, the receptor contribution to the final approximately 8 kDa
conjugated fragment, resulting from consecutive Lys-C and CNBr
treatments, is estimated to be approximately 34 kDa. Restriction
digestion analysis (Lys-C and CNBr) of the deduced amino acid sequence
of the PTH2R (1) reveals only one possible nonglycosylated fragment of
the anticipated size, which could be generated by the fragmentation
scheme described above. This fragment,
Ser364-Met395, is 32-amino acid long containing
most of TMD 6 and part of ECL 3 (see Fig. 8
).
|
Met (PTH2R[V380M]), and the other is
a double mutant, Val380
Met and Met395
Leu (PTH2R[V380M/M395L]). The introduction of these mutations is
anticipated to alter the digestion pattern obtained by CNBr-treatment
of the ligand-receptor conjugates. PTH-(134) binding and stimulation
of AC activity in COS-7 cells, transiently expressing either wild-type
or mutated receptors were very similar (Fig. 4
90-kDa radioiodinated bands, corresponding to the
125I-Bpa1-PTH-receptor phoconjugates, were
excised and eluted from 7.5% SDS gels before treatment with CNBr),
these findings suggest that in both receptor mutants cross-linking
occurred on the S-CH3 of the Met introduced by
site-directed mutagenesis at position 380. In such a case,
CNBr-treatment would yield a ligand modified by a
"CH3-SCN" moiety and represented by the approximately
4.5-kDa band (17, 25).
|
70% compared with PTH) (Fig. 5C
|
|
The third digestion pathway (3) consisted of Lys-C-cleavage
of the intact approximately 90 kDa ligand-receptor photoconjugate, and
yielded a band with an apparent molecular mass of approximately 12 kDa
(3a) (Fig. 6D
, lane 2). Similar treatment of the
deglycosylated conjugate (approximately 60 kDa) yielded a band with the
same apparent molecular weight (data not shown), suggesting the absence
of glycosylation sites within the Lys-C-generated fragment
3a. The approximately 12 kDa Lys-C-generated band was
subjected to a CNBr-cleavage which produced a band at approximately 6
kDa (3b) (Fig. 6D
, lane 3). The complementary digestion
pathway (4), the reciprocal of 3, consisted of a
Lys-C-digestion of the approximately 20 kDa CNBr-derived band
(4a, which is the same band as 2a), generated
from the intact approximately 90-kDa ligand-receptor photoconjugate (as
in pathway 2) (Fig. 6D
, lane 4). Lys-C-digestion of the
approximately 20-kDa band yielded a single band, 4b,
migrating at approximately 6 kDa, similarly to 3b (compare
Fig. 6D
, lanes 3 and 5).
A fifth digestion pathway (5) consisted of treatment with
N-chlorosuccinimmide (NCS), which cleaves at the carboxyl side of
tryptophanyl residues, yielding a broad band with an apparent molecular
mass of approximately 26 kDa (5a) (Fig. 6E
, lane 1).
Following Endo-F-mediated deglycosylation, the apparent mass was
reduced to approximately 20 kDa (5b) (Fig. 6E
, lane 2).
Figure 6F
summarizes schematically the five fragmentation pathways
employed in the analysis of the 125I-K13-PTH2R
conjugate.
Examination of the deduced amino acid sequence of the PTH2R reveals
only one possible contact domain,
Gln138-Met147. This 10-amino acid segment is
located in the C-terminal portion of the N-terminal extracellular
tail of the receptor. Figure 8
summarizes
schematically the putative CNBr, Lys-C and NCS cleavage sites flanking
this digestion-restricted domain containing the contact site
("contact domain").
Characterization of transfected COS-7 cells expressing PTH2R
mutated in the N-terminal extracellular tail. To validate our
analysis of the contact domain between 125I-K13 and the
PTH2R, we generated a point-mutated receptor, Lys137
Arg (PTH2R[K137R]). This point mutation eliminates the Lys-C
digestion site at Lys137 required for generating the
above-described putative contact domain
Gln138-Met147. PTH-(134) binding affinities
in COS-7 cells, transiently expressing either native or mutated
receptors, are similar (Fig. 8
, A and B
for binding and AC activities, respectively). Both the native and the
mutated receptors photocross-linked to 125I-K13, yielding a
single diffuse band migrating at approximately 90 kDa as analyzed by
7.5% SDS-PAGE (Fig. 7C
, lanes 1 and 3 for wild-type and mutant
receptors, respectively). This band is receptor specific because it is
not observed in similar experiments with mock-transfected parental
COS-7 cells (data not shown). Additionally, formation of the
ligand-receptor photoconjugates was completely inhibited in the
presence of excess (1 µM) unlabeled agonist PTH-(134)
(Fig. 7C
, lanes 2 and 4, for native and mutant receptors,
respectively). Lys-C-treatment of the isolated
125I-K13-PTH2R[K137R] conjugate yielded a band with an
apparent molecular mass of approximately 20 kDa (Fig. 7D
, lane 2). This
band is approximately 8 kDa larger in size than the band generated by
Lys-C-treatment of wild-type receptor transiently expressed in COS-7
cells (compare Fig. 7D
, lanes 1 and 2). The size of this band is in
good agreement with the glycosylated fragment
Thr118-Lys197, which was predicted following
the elimination of the Lys-C-digestion site in PTH2R[K137R].
|
| Discussion |
|---|
|
|
|---|
For the recently discovered PTH2R, PTH-(134) and PTH-(734) are potent agonist and antagonist, respectively (2). In sharp contrast to the potent biological activity of PTHrP-(134) with the PTH1R, it has negligible activity with the PTH2R (1, 2, 3). Surprisingly, it was found that PTHrP-(734) binds to and antagonizes the PTH2R (2), even though the parent hormone PTHrP-(134) is essentially inactive. These findings suggest that both receptor subtypes share common modes of interactions with PTH, and, to a lesser extent, with portions of the PTHrP molecule.
The premise of any photoaffinity cross-linking study is that analogs of
a parent peptide hormone with similar pharmacological profile share
similar bioactive conformation and generate topochemically equivalent
ligand-receptor complexes. The series of photoreactive analogs
[Bpa16]-PTH was designed specifically for photoaffinity
scanning studies aimed at investigating the bimolecular interactions of
the activation domain of PTH with either the PTH1R or the PTH2R
subtype. Modifications in PTH-(134), which include
Met8,18
Nle8,18, Lys13,26,27
Arg13,26,27, and Trp23
2-Nal23, render the ligand resistant to the various
chemical and enzymatic cleavage agents (i.e. CNBr, Lys-C and
NCS) that it is exposed to during the digestion of the radiolabeled
ligand-receptor photoconjugate. These modifications do not
affect the ligands binding affinity or signaling efficacy
(17, 19).
Characterization of bimolecular interactions between the principal activation domain in PTH and PTH receptors is important for understanding receptor activation and signaling. To identify a photoaffinity ligand that would be suitable for use as a reagent in cross-linking studies focusing on this domain we "scanned" positions 16 by making a Bpa substitution at each position, generating the [Bpa16]-PTH series. Only two analogs in this series, Bpa1- and Bpa6-PTH, displayed bioactivity profiles similar to those of the parent hormone PTH-(134) in both receptor subtypes. We therefore selected Bpa1-PTH, for which a contact domain and a putative contact point in the PTH1R has been recently identified, as the photoreactive analog to carry out a comparative study in the PTH2R. Not surprisingly, other analogs in the series were not as active, indicating that not all positions are amenable to Bpa substitution. A second analog (K13), carrying the photoreactive moiety in the mid-region of the molecule, was also used. Importantly, both Bpa1-PTH and K13 compete for radiolabeled 125I-PTH binding to the PTH2R, and reciprocally, PTH-(134) competes with the radioiodinated 125I-Bpa1-PTH and 125I-K13 with similar affinities. These pharmacological results strongly suggest that these two analogs interact with PTH2R similarly to the unmodified PTH-(134).
Cross-linking 125I-Bpa1-PTH to the PTH2R followed by digestion of the photoconjugate and protein mapping leads to the identification of the sequence Ser364-Met395 as the contact domain. This region is 32 amino acids long and is located in TMD 6 and part of ECL 3. The confidence in the identity of this contact domain was further confirmed by using the reciprocal pathway for digestion.
Alignment of the sequences of the PTH1R and the PTH2R to reveal maximal
homology suggests that Val380 in the latter receptor
corresponds to Met425 in the former. Cross-link-ing of
125I-Bpa1-PTH to the fully functional mutated
PTH2R[V380M] receptor generated a band after treatment with CNBr,
which has an apparent mass similar to the ligand itself (
4.5 kDa)
and significantly different from the one obtained with the wild-type
receptor. Such a small size band could be obtained by cross-linking the
benzophenone moiety to the S-CH3 of a methionine.
Subsequent CNBr-cleavage of such a conjugate yields the free ligand
modified by an additional 73 atomic mass units, resulting from the
insertion of CH3-S-CN across the benzophenone carbonyl
(25). Alternatively, it is possible that cross-linking occurs within
the domain Cys381-Met395. In such a case,
CNBr-treatment would also generate a low molecular weight fragment
(
5.56 kDa), which may be indistinguishable from an approximately
4.5-kDa band by SDS-PAGE analysis. To exclude this possibility, the
double mutant V380M/M395L receptor was generated and characterized. The
biological profile (PTH-binding and stimulation of AC activity) of this
mutant was similar to that of the wild-type PTH2R. Photocross-linking
to 125I-Bpa1-PTH generated the anticipated
approximately 90-kDa photoconjugate. Subsequent CNBr-treatment of this
conjugate generated the same approximately 4.5-kDa band obtained with
the 125I-Bpa1-PTH-PTH2R[V380M] conjugate. If
cross-linking had occurred to a site C-terminal to Met380,
CNBr-treatment would have generated a significantly larger fragment
[
10 kDa, comprised of 125I-Bpa1-PTH-PTH2R
(381427)]. These results support the conclusion that
125I-Bpa1-PTH cross-links to position 380 in
PTH2R. It is known that the tertiary hydrogen in the side chain of Val,
as well as the CH3-S of Met, are favored reaction sites for
the benzophenone moiety (27). However, given the photochemical
properties of the benzophenone moiety and the topological requirements
for the hydrogen abstraction by the biradical, the reactive C-H bond
participating in the photoconjugation must be located within
approximately 3.1 Å from the benzophenone moiety (27).
Analysis of the photoaffinity cross-linking of 125I-Bpa1-PTH to the PTH1R identified a single amino acid, Met425 in the extracellular end of TMD 6, as a putative "contact point" (17). Hence, even the putative "contact points" for 125I-Bpa1-PTH appear analogous in the two receptor subtypes. The two receptor subtypes are homologous, but differ in size. Our findings indicate that the putative "contact domain" for Bpa1-PTH in PTH2R is located in a position which is the counterpart of a previously identified contact domain for the same photoligand in PTH1R.
The K13 analog, in which the benzophenone moiety is present in position 13 of PTH, cross-links to a distinct contact domain in the PTH2R, positions 138147, which is located at the carboxyl side of the N-terminal extracellular tail and includes several residues in TMD 1. The Lys-C-digestion of the point-mutated PTH2R[K137R] receptor provides an additional and independent validation of the identity of the putative contact domain.
The "contact domain" of the same analog, 125I-K13, in the PTH1R has been recently reported (19). It spans a 17-amino acid region, Phe173-Met189, located at precisely the same place as the PTH2R contact domain identified for the same ligand in this report. Very recently, the 17-amino acid contact site in the PTH1R has been refined to a domain only 8 amino acids in length: Glu182-Met189. Within this contact domain, Arg186 was shown to be essential for cross-linking (21). This amino acid in the PTH1R corresponds to the homologous Arg143 in the PTH2R contact domain, Gln138-Met147. However, single point mutations in PTH2R at this site (R143A), or other sites within the contact domain (V144A and L146A), did not abolish cross-linking to 125I-K13 (Behar, V., unpublished results). All receptor mutants employed, displayed binding and signaling properties similar to the wild-type receptor. This is the first finding that may suggest that there is a minor structural feature within the 125I-K13 binding domain of the PTH2R, which is distinct from the homologous domain in PTH1R. At this point, the level of structural information attainable by the photoaffinity scanning approach cannot distinguish between such subtle structural differences.
In conclusion, our investigations demonstrate directly, through cross-linking and subsequent protein mapping, that the domains in both PTH receptor subtypes involved in binding either the N terminus or the mid-region of PTH are analogous. These observations suggest that both the hormone (positions 1 and 13) and each of the receptor subtypes adapt similar topology when hormone-receptor complexes are formed in either system.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 This work is presented in partial fulfillment of a requirement
toward a Ph.D. thesis by V.B. ![]()
Received November 20, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Assil-Kishawi, T. A. Samra, D. F. Mierke, and A. B. Abou-Samra Residue 17 of Sauvagine Cross-links to the First Transmembrane Domain of Corticotropin-releasing Factor Receptor 1 (CRFR1) J. Biol. Chem., December 19, 2008; 283(51): 35644 - 35651. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pham, M. Dong, J. D. Wade, L. J. Miller, C. J. Morton, H.-l. Ng, M. W. Parker, and P. M. Sexton Insights into Interactions between the {alpha}-Helical Region of the Salmon Calcitonin Antagonists and the Human Calcitonin Receptor using Photoaffinity Labeling J. Biol. Chem., August 5, 2005; 280(31): 28610 - 28622. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Murray, L. G. Rao, P. Divieti, and F. R. Bringhurst Parathyroid Hormone Secretion and Action: Evidence for Discrete Receptors for the Carboxyl-Terminal Region and Related Biological Actions of Carboxyl- Terminal Ligands Endocr. Rev., February 1, 2005; 26(1): 78 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Papasani, R. C. Gensure, Y.-L. Yan, Y. Gunes, J. H. Postlethwait, B. Ponugoti, M. R. John, H. Juppner, and D. A. Rubin Identification and Characterization of the Zebrafish and Fugu Genes Encoding Tuberoinfundibular Peptide 39 Endocrinology, November 1, 2004; 145(11): 5294 - 5304. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dong, Z. Li, D. I. Pinon, T. P. Lybrand, and L. J. Miller Spatial Approximation between the Amino Terminus of a Peptide Agonist and the Top of the Sixth Transmembrane Segment of the Secretin Receptor J. Biol. Chem., January 23, 2004; 279(4): 2894 - 2903. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Gensure, N. Shimizu, J. Tsang, and T. J. Gardella Identification of a Contact Site for Residue 19 of Parathyroid Hormone (PTH) and PTH-Related Protein Analogs in Transmembrane Domain Two of the Type 1 PTH Receptor Mol. Endocrinol., December 1, 2003; 17(12): 2647 - 2658. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zang, M. Dong, D. I. Pinon, X.-Q. Ding, E. M. Hadac, Z. Li, T. P. Lybrand, and L. J. Miller Spatial Approximation between a Photolabile Residue in Position 13 of Secretin and the Amino Terminus of the Secretin Receptor Mol. Pharmacol., May 1, 2003; 63(5): 993 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Akal-Strader, S. Khare, D. Xu, F. Naider, and J. M. Becker Residues in the First Extracellular Loop of a G Protein-coupled Receptor Play a Role in Signal Transduction J. Biol. Chem., August 16, 2002; 277(34): 30581 - 30590. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Goold, T. B. Usdin, and S. R. J. Hoare Regions in Rat and Human Parathyroid Hormone (PTH) 2 Receptors Controlling Receptor Interaction with PTH and with Antagonist Ligands J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 678 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dong, Y. W. Asmann, M. Zang, D. I. Pinon, and L. J. Miller Identification of Two Pairs of Spatially Approximated Residues within the Carboxyl Terminus of Secretin and Its Receptor J. Biol. Chem., August 18, 2000; 275(34): 26032 - 26039. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Piserchio, T. Usdin, and D. F. Mierke Structure of Tuberoinfundibular Peptide of 39 Residues J. Biol. Chem., August 25, 2000; 275(35): 27284 - 27290. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. J. Hoare, J. A. Clark, and T. B. Usdin Molecular Determinants of Tuberoinfundibular Peptide of 39 Residues (TIP39) Selectivity for the Parathyroid Hormone-2 (PTH2) Receptor. N-TERMINAL TRUNCATION OF TIP39 REVERSES PTH2 RECEPTOR/PTH1 RECEPTOR BINDING SELECTIVITY J. Biol. Chem., August 25, 2000; 275(35): 27274 - 27283. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |