help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Behar, V.
Right arrow Articles by Chorev, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Behar, V.
Right arrow Articles by Chorev, M.
Endocrinology Vol. 140, No. 9 4251-4261
Copyright © 1999 by The Endocrine Society


ARTICLES

Direct Identification of Two Contact Sites for Parathyroid Hormone (PTH) in the Novel PTH-2 Receptor using Photoaffinity Cross-Linking1

Vered Behar2, Alessandro Bisello, Michael Rosenblatt and Michael Chorev

Division of Bone and Mineral Metabolism, Charles A. Dana and Thorndike Laboratories, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215

Address all correspondence and requests for reprints to: Dr. Michael Chorev, Division of Bone and Mineral Metabolism, Department of Medicine, Beth Israel Deaconess Medical Center, 330 Brookline Avenue (HIM 944), Boston, Massachusetts 02215. E-mail: mchorev{at}warren.med.harvard.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Direct examination of the interacting sites between PTH and the human PTH2 receptor (PTH2R) was conducted by photoaffinity cross-linking followed by protein digestion and mapping of the radiolabeled photoconjugated receptor. Photoreactive analogs of PTH, individually substituted with an L-p-benzoylphenylalanine (Bpa) at each of the first 6 N-terminal positions, were pharmacologically evaluated in cells stably expressing recombinant PTH2R. One highly bioactive analog, [Bpa1,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]PTH-(1–34)NH2 (Bpa1-PTH), was chosen for cross-linking studies. In addition, a PTH analog in which the photoreacive moiety is at the mid-region position 13 (K13) was demonstrated to be bioactive, then cross-linked to PTH2R. The minimal digestion-restricted domain containing the contact site ("contact domain") for 125I-Bpa1-PTH is in the sixth transmembrane domain and part of the third extracellular loop, spanning residues Ser364-Met395 of the receptor. This domain was further confirmed and refined by cross-linking 125I-Bpa1-PTH to two receptor mutants, PTH2R[V380M]- and PTH2R[V380M,M395L]-receptors. Treatment of the cross-linked conjugates with cyanogen bromide identified a single amino acid (position 380) as the putative contact point. The contact domain for 125I-K13 is located in the N-terminal extracellular tail of the receptor (in the C-terminal portion) and spans Gln138-Met147. Further validation of this contact domain was accomplished by photocross-linking to point-mutated PTH2R[K137R] receptor. Previous studies in which PTH analogs were cross-linked to human PTH/PTHrP receptor (PTH1R) identified Met425 and Phe173-Met189 as the contact sites for Bpa1-PTH and K13, respectively. These studies demonstrate that both receptor subtypes, PTH1- and PTH2-receptors, use analogous sites for interaction with positions 1 and 13 in PTH.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE HUMAN PTH-21 receptor (PTH2R), a recently discovered G protein-coupled receptor (GPCR), is activated by PTH, leading to increased levels of intracellular second messengers (cAMP and cytosolic Ca2+) (1, 2, 3). The PTH2R is homologous (51% sequence identity and approximately 70% sequence similarity) to the hPTH/PTH-related protein (PTHrP) receptor (PTH1R) (1). Both receptors belong to the same subfamily of GPCRs whose members interact with intermediate-size peptide ligands, such as calcitonin, secretin, glucagon, glucagon-like peptide, and vasoactive intestinal peptide (4, 5, 6, 7, 8, 9, 10). These GPCRs are characterized by a long N-terminal extracellular domain (100–200 amino acids), six highly conserved cysteines, and a long C-terminal cytoplasmic tail (150–200 amino acids). Unlike the PTH1R, which binds and responds equipotently to both PTH and PTHrP, only PTH activates PTH2R with high affinity and efficacy (1, 2, 3). These two receptors also differ in their tissue distribution. While the PTH1R is abundantly expressed in bone and kidney (11), where it plays an essential role in calcium metabolism and homeostasis, the PTH2R is predominantly expressed in arterial and cardiac endothelium, lung, pancreas, testis, and brain (1, 12). To date, the physiological role of the PTH2R is yet to be elucidated. The PTH/PTHrP-PTH1R/PTH2R system presents an unusual opportunity to understand a "structure-activity" experiment of nature manifested by two structurally distinct, yet functionally related, hormones and two different receptor subtypes.

Two parallel approaches have been used to study bimolecular interactions of these hormones and their receptors: the "hormone-centered" and the "receptor-centered" approaches. Each relies on modification of the structure of either the hormones or the receptors exclusively. Using the "hormone-centered" approach, we and others showed that position 5 in both hormones represents a "specificity switch" for the PTH2R. Swapping His5 in PTHrP with its counterpart Ile5 from PTH yields the analog [Ile5]-PTHrP (1–34), which becomes "PTH-like" (and unlike PTHrP) and binds to and activates PTH2R. The reciprocal exchange yields the analog [His5]-PTH (1–34), which is "PTHrP-like" in that it has very low efficacy in the PTH2R system (3, 13).

Using a receptor-centered approach, several important regions in the PTH2R responsible for ligand-specificity were identified. In one report, residues in transmembrane domain (TMD) 3, TMD 7, and the N-terminal extracellular tail were shown to disrupt recognition of PTHrP by the PTH2R (14). It was postulated that the extracellular portion of the TMD bundle functions as a selectivity filter or barrier that prevents PTHrP from interacting with the PTH2R. Additionally, Clark et al. (15) concluded that the N-terminal tail and the extracellular loop (ECL) 3 of PTH1R and PTH2R interact similarly with PTH and that both domains contribute to differential interaction with PTHrP. Nevertheless, they did not identify specific sites of interaction (15). Bergwitz and co-workers (16) identified two single amino acids in PTH2R, Ile244 in TMD 3, and Tyr318 in ECL 2, as being involved in the ligand-derived His5/Ile5 receptor subtype specificity switch.

We have applied a photoaffinity cross-linking approach, which examines directly the nature of the hormone-receptor interface, to specifically identify the "contact domains" between PTH analogs and the PTH2R. Such studies will help develop an experimentally derived model of ligand-receptor complexes in the PTH/PTHrP system and contribute to the understanding of the mechanism of receptor subtype specificity. Observations made in these studies could shed light on the nature of "molecular recognition" in the GPCR system in general.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
The synthesis and characterization of the Bpa-containing PTH-(1–34) analogs was described previously (17). IodoGen was purchased from Pierce Chemical Co. (Rockford, IL). Cyanogen bromide and N-chlorosuccinimmide (NCS) were purchased from Sigma-Aldrich Co. (Milwaukee, WI). Na125I was obtained from Amersham Pharmacia Biotech (Arlington Heights, IL). Endoglycosidase F/N-glycosidase F (Endo-F), Lysyl endopeptidase (Lys-C) and FuGENE 6 transfection reagent were purchased from Roche Molecular Biochemicals (Indianapolis, IN). DMEM, Opti-MemI, FBS, and PBS were obtained from Life Technologies, Inc. (Gaithersburg, MD). Tissue culture disposables and plasticware were obtained from Corning (Corning, NY). All other reagents were purchased from Sigma (St. Louis, MO).

Radioiodinations
[Nle8,18,Tyr34]bPTH-(1–34)NH2 (PTH-(1–34)), [Bpa1,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]bPTH-(1–34)NH2 (Bpa1-PTH), [Bpa6,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]bPTH-(1–34)NH2 (Bpa6-PTH), and [Nle8,18,Lys13({epsilon}-pBz2),L-2-Nal23,Arg26,27,Tyr34]bPTH-(1–34)NH2 (K13) were radioiodinated and RP-HPLC-purified as previously described (17, 18, 19), but with the following modification: all iodination reactions were carried out for 12 min.

Cell culture
HEK-293 cells, PTH2R-expressing HEK-293/BP-16 cells (~160,000 receptors/cell) and COS-7 cells (a generous gift of Dr. Steven Goldring, Beth Israel Deaconess Medical Center) were cultured in DMEM supplemented with 10% FBS as previously described (2).

PTH2R binding
HEK-293/BP-16 cells were subcultured in 24-well plates and grown to confluence. Radioreceptor binding assays were carried out as previously described using 125I-[Nle8,18,Tyr34]PTH-(1–34)NH2 (125I-PTH), 125I-[Bpa1,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]bPTH-(1–34)NH2 (125I-Bpa1-PTH), 125I-[Bpa6,Nle8,18,Arg13,26,27,L-2-Nal23,Tyr34]bPTH-(1–34)NH2 (125I-Bpa6-PTH) or 125I-[Nle8,18,Lys13({epsilon}-pBz2),Arg26,27,L-2-Nal23,Tyr34]bPTH-(1–34)NH2 (125I-K13) as radioligands (2, 20) as noted. The values presented in Table 1Go were obtained directly from three independent competition dose-dependent graphs (e.g. Fig. 1AGo).


View this table:
[in this window]
[in a new window]
 
Table 1. Biological activities of the Bpa1–6-PTH analogs

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 1. In vitro characterization of the Bpa-containing PTH-(1–34) analogs. A, Competition for 125I-PTH-(1–34) binding and (B) dose-dependent stimulation of AC activity in PTH2R-expressing cells by PTH-(1–34) (-•-), Bpa1-PTH (-{circ}-), Bpa2-PTH (-x-), Bpa3-PTH (-{blacksquare}-), Bpa4-PTH (-{square}-), Bpa5-PTH (-{blacktriangleup}-) and Bpa6-PTH (-{triangleup}-). C, Competition binding for 125I-Bpa1-PTH by PTH-(1–34) (-• -) and Bpa1-PTH (-{circ}-). D, Dose-dependent stimulation of AC activity in HEK-293/BP-16 cells of Bpa1-PTH (-•-) and I-Bpa1-PTH (-{circ}-). Data are expressed as the % of specific binding (A) and (C), and maximal stimulation (B) relative to the control PTH-(1–34) peptide. Data are the mean ± SE of triplicate wells from one experiment. Similar results were obtained in two additional independent experiments.

 
Adenylyl cyclase activity
HEK-293/BP-16 cells were subcultured in 24-well plates and grown to confluence. Determination of adenylyl cyclase (AC) activity stimulated by PTH analogs was carried out as described (20). The values presented in Table 1Go were obtained directly from three independent dose-dependent stimulation graphs (e.g. Fig. 1BGo).

Photoaffinity cross-linking and membrane protein preparation
Photoaffinity cross-linking (preparative and analytical scales) and of 125I-K13 and 125I-Bpa1-PTH to the PTH2R and membrane protein preparation were carried out as previously described for the PTH1R (17, 19, 21).

Enzymatic and chemical digestions of the ligand-receptor conjugates
Samples of the isolated SDS-PAGE bands representing either the radiolabeled hormone-receptor conjugates or conjugated fragments were prepared in small volumes (typically 10–20 µl) of 25 mM Tris-HCl (pH 8.5) Triton X-100 (0.1% vol/vol), SDS (0.01% wt/vol). Endo-F digestions were carried out at 37 C for 24 h, according to the manufacturer’s procedure. Lys-C digestions were performed by treatments with 0.15 U (in 10 µl water) at 37 C for 24 h. CNBr digestions were performed with 100 µl of 50 mg/ml in 70% formic acid in darkness at RT for 24 h. NCS cleavage was carried out with 100 µl of 10 mg/ml in 50% acetic acid in darkness at RT for 24 h. Samples were dried on Speed-vac and dissolved in reducing sample buffer (22) before PAGE analysis.

Electrophoresis and autoradiography
Electrophoretic analyses were performed using 7.5% (wt/vol) SDS-PAGE for the intact and deglycosylated hormone-receptor conjugates and 16.5% (wt/vol) Tricine/SDS-PAGE for the cleavage products (19). Appropriate molecular weight markers (Amersham Pharmacia Biotech) were included in each gel. Gels were dried and exposed to x-ray films (X-omat, Eastman Kodak Co., Rochester, NY) with intensifying screens (XAR-5, Kodak). Following autoradiography, the radioactive fragments were excised from the dried gels, electroeluted (Bio-Rad Laboratories, Inc., Electroeluter 422) in SDS-PAGE running buffer and concentrated on a Speed-Vac.

Receptor mutagenesis
Single mutations, V380M and K137R were introduced into the PTH2R complementary DNA (cDNA). Primer pairs (sense and antisense) were prepared containing these amino acid modifications (Life Technologies, Inc. Custom primers): sense V380M (5' to 3') CATTACATCGTGTTCATGTGCCTGCCTCACTCC; sense K137R (5' to 3') CCAGATATCAGCATAGGACGACAAGAATTCTTTGAACGC. Primer pairs were used in the PCR-based Quik-Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), using PTH2R (1) in the pZeoSV2 (Invitrogen) mammalian expression vector as a template. The double mutant PTH2R[V380M/M395L] was generated in a similar fashion by introducing a single mutation into the point mutated PTH2R[V380M] receptor cDNA with the primer pair: sense (5' to 3') GCTCGGGTGGGAGATCCGCTTACACTGTGAACTCTTCTTC. Individual PCR reactions were used to transform Epicurian Coli XL1-Blue supercompetent cells (Stratagene). Transformations were plated on bacteriologic agar containing Zeocine (Invitrogen, Carlsbad, CA). Colonies were identified and selected for plasmid isolation (Miniprep Kit, QIAGEN, Valencia, CA). Plasmid preparations were cycle sequenced (Genomix, Foster City, CA) to confirm the fidelity of the mutation using oligonucleotide primers located 5' and 3' to the regions of the PTH2R targeted for mutation.

Transient transfection
For photoaffinity cross-linking experiments, COS-7 cells were plated at 3 x 105 cells/well in a six-well dish, 24 h before transient transfections. Two micrograms of vector, or vector containing mutant or wild-type receptor cDNA inserts were transfected using 6 µl FuGENE 6 (Roche Molecular Biochemicals) transfection reagent. For binding and AC assays, COS-7 cells were plated at 65,000 cells/well in 24-well dishes, 24 h before transfection, and assayed as described above 48 h after transfection. Transfection efficiencies were typically 50–70% as estimated by Lac Z assay (23).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of the putative contact site for 125I-Bpa1-PTH in the PTH2R
Characterization of Bpa-containing PTH-(1–34) analogs. A series of photoreactive analogs of PTH, individually substituted with a L-p-benzoylphenylalanine (Bpa) at each of the first 6 N-terminal positions has been prepared and recently described (17). These analogs were evaluated for biological activity in HEK-293 cells stably expressing the PTH2R (~160,000 receptors/cell, HEK-293/BP-16). Binding affinity was measured by competition with 125I-[Nle8,18,Tyr34]bPTH-(1–34)NH2 (125I-PTH) (Fig. 1AGo). The stimulation of adenylyl cyclase (AC) was determined in HEK-293/BP-16 cells (Fig. 1BGo). The substitution of Ala1 or Gln6 with Bpa in PTH-(1–34) generated Bpa1-PTH and Bpa6-PTH, respectively, which display pharmacological profiles similar to that of the parent PTH-(1–34) (Table 1Go). Bpa-substitution of Val2 caused a 4-fold reduction in binding affinity and a 9-fold reduction in AC activity relative to PTH-(1–34). Substitution at positions 3, 4, and 5 led to analogs with weaker binding affinities (IC50 > 270 nM) and very weak ability to stimulate AC (Fig. 1Go).

The most potent analogs in this series, Bpa1- and Bpa6-PTH, were further evaluated. Following radioiodination, 125I-Bpa1-PTH exhibited full binding capacity (Fig. 1CGo), whereas 125I-Bpa6-PTH lost more than 60% of its total binding, compared with the radioiodinated 125I-PTH (not shown). More importantly, the ability of iodinated Bpa1-PTH (I-Bpa1-PTH) to stimulate AC activity was similar to that of the noniodinated Bpa1-PTH (Fig. 1DGo). Therefore, Bpa1-PTH was selected for the photoaffinity cross-linking studies described below.

Photoaffinity labeling of the PTH2R with125I-Bpa1-PTH. Photocross-linking of 125I-Bpa1-PTH to the PTH2R yielded a single diffuse band migrating at approximately 90 kDa as analyzed by 7.5% SDS-PAGE (Fig. 2AGo, lane 2). This band is receptor-specific because it is not observed in similar experiments with parental HEK-293 cells that do not express the receptor (Fig. 2AGo, lane 1). Moreover, formation of the ligand-receptor conjugate was completely inhibited by the presence of excess (1 µM) unlabeled agonist PTH-(1–34) or antagonist PTH-(7–34) (Fig. 2AGo, lanes 3 and 5, respectively). Excess of unlabeled PTHrP-(1–34) (1 µM) inhibited very weakly the formation of the ligand-receptor photoconjugate (Fig. 2AGo, lane 4), whereas [Leu11,D-Trp12]PTHrP-(7–34)NH2, a potent PTHrP-derived antagonist for the PTH1R (24), competed more effectively compared with PTHrP-(1–34) (Fig. 2AGo, lane 6), in agreement with the binding affinities of these analogs for the PTH2R determined previously (2). Endo-F-treatment of the 90-kDa band shifted the radiolabeled band to approximately 60-kDa band, generating the deglycosylated 125I-Bpa1-PTH-PTH2R photoconjugate (Fig. 2BGo, lane 2).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 2. Photoaffinity cross-linking of 125I-Bpa1-PTH to the recombinant PTH2R. A, Autoradioagraphy of nontransfected HEK-293 cells (lane 1) and PTH2R-expressing HEK-293/BP-16 cells photolabeled with 125I-Bpa1-PTH alone (lane 2) and in the presence of 1 µM PTH-(1–34) (lane 3), PTHrP-(1–34) (lane 4), PTH-(7–34) (lane 5) and PTHrP-(7–34) (lane 6). The arrows indicate the position of the approximately 90- and 60-kDa bands representing the intact and the deglycosylated labeled ligand-receptor conjugates, respectively. The band at approximately 66 kDa represents variable degrees of nonspecific cross-linking, probably to BSA, and was observed in some of the experiments. (B) Endo-F-mediated deglycosylation of the 125I-Bpa1-PTH-PTH2R conjugate. The approximately 90-kDa labeled conjugate was incubated in the absence (lane 1) or presence (lane 2) of Endo-F. The arrow indicates the position of the approximately 60-kDa deglycosylated labeled analog-receptor conjugate. Samples were analyzed by 7.5% (wt/vol) SDS-PAGE. Molecular weight markers are also shown. Similar results were obtained in at least two additional experiments.

 
Identification of the ligand binding domain. The approximately 90-kDa band corresponding to 125I-Bpa1-PTH-PTH2R conjugate was isolated from 7.5% SDS-PAGE and subjected to a series of chemical and enzymatic cleavages. The first pathway (I) consisted of enzymatic digestion with Lys-C at the carboxyl side of lysyl residues, followed by chemical cleavage with cyanogen bromide (CNBr) at the carboxyl side of methionyl residues. Exhaustive Lys-C-treatment of the approximately 90-kDa ligand-receptor conjugate yielded a single radiolabeled band with apparent molecular mass of approximately 12 kDa as analyzed by 16.5% Tricine/SDS-PAGE (Ia) (Fig. 3AGo, lane 2). Similar treatment of the deglycosylated conjugate (~60 kDa) yielded a fragment with the same apparent molecular weight (not shown), suggesting the absence of glycosylation sites within the Lys-C-generated fragment Ia. CNBr treatment of the excised and eluted approximately 12 kDa (Ia) conjugate fragment produced a single band with apparent mass of approximately 8 kDa (Ib) (Fig. 3AGo, lane 3).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Chemical and enzymatic digestions of the 125I-Bpa1-PTH-PTH2R conjugate. A, Pathway I—the SDS-PAGE-isolated approximately 90 kDa conjugate was incubated in the absence (lane 1) or presence (lane 2) of Lys-C. The excised and eluted Lys-C-derived approximately 12 kDa (Ia) fragment was then treated with CNBr (lane 3), yielding an approximately 8-kDa fragment (Ib). Also shown is the free 125I-Bpa1-PTH ligand at 4.5 kDa (lane 4). B, Pathway II—The SDS-PAGE-isolated approximately 90 kDa conjugate was incubated in the presence of CNBr (lane 1). The excised and eluted approximately 22 kDa (IIa) band was then treated with Lys-C (lane 2), yielding an approximately 8-kDa fragment IIb, similar in size to fragment Ib. Samples were analyzed by 16.5% (wt/vol) Tricine/SDS-PAGE. Molecular weight markers are also shown. Similar results were obtained in three additional experiments. C, Schematic summary of the fragmentation scheme employed on the 125I-Bpa1-PTH–PTH2R conjugate following pathways I and II. Endo-F, Lys-C and CNBr digestions were carried out as detailed in Materials and Methods. —, Data not shown. Molecular masses of the fragments are indicated in kDa and represent the actual size of the digested conjugated fragments including the ligand 125I-Bpa1-PTH (molecular weight 4487).

 
A second digestion pathway (II), the reciprocal of I, initially yielded upon CNBr-treatment a single band migrating at approximately 22 kDa (IIa) (Fig. 3BGo, lane 1). Lys-C-treatment of the approximately 22-kDa band yielded the final fragment migrating at approximately 8 kDa (IIb), corresponding to the conjugated fragment Ib obtained from pathway I (Fig. 3BGo, lane 2, compare to Fig. 3AGo, lane 3). Figure 3CGo summarizes schematically the different fragmentation pathways employed in the analysis of the 125I-Bpa1-PTH-PTH2R conjugate.

Because 125I-Bpa1-PTH has a molecular weight of 4487, the receptor contribution to the final approximately 8 kDa conjugated fragment, resulting from consecutive Lys-C and CNBr treatments, is estimated to be approximately 3–4 kDa. Restriction digestion analysis (Lys-C and CNBr) of the deduced amino acid sequence of the PTH2R (1) reveals only one possible nonglycosylated fragment of the anticipated size, which could be generated by the fragmentation scheme described above. This fragment, Ser364-Met395, is 32-amino acid long containing most of TMD 6 and part of ECL 3 (see Fig. 8Go).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 8. Schematic representation of PTH2R. The minimal digestion-restricted domains containing the putative contact sites ("contact domains") for 125I-Bpa1-PTH and 125I-K13 within the PTH2R are indicated by dashed lines. The cleavage sites for Lys-C and CNBr digestions for 125I-Bpa1-PTH-receptor conjugate are designated by italic. The cleavage sites for Lys-C, CNBr and NCS digestions for 125I-K13-receptor conjugate are designated in bold. Y represents putative glycosylation sites. Also indicated are V380, M395, M427 and K137.

 
Characterization of transfected COS-7 cells expressing PTH2R mutated in EC3. To further validate and delineate the identified domain which 125I-Bpa1-PTH contacts in the PTH2R, we generated two receptor mutants. One is a single point mutation Val380 -> Met (PTH2R[V380M]), and the other is a double mutant, Val380 -> Met and Met395 -> Leu (PTH2R[V380M/M395L]). The introduction of these mutations is anticipated to alter the digestion pattern obtained by CNBr-treatment of the ligand-receptor conjugates. PTH-(1–34) binding and stimulation of AC activity in COS-7 cells, transiently expressing either wild-type or mutated receptors were very similar (Fig. 4Go, A and B, for PTH binding and PTH-stimulated AC activities, respectively). The transiently expressed wild-type and mutated receptors were photocross-linked to 125I-Bpa1-PTH, yielding a single diffuse band migrating at approximately 90 kDa (Fig. 4CGo, lanes 1, 3, and 5 for native, and mutated V380M and V380M/M395L receptors, respectively). This band is receptor-specific because it is not observed in similar experiments using mock-transfected parental COS-7 cells (not shown). In addition, formation of the ligand-receptor photoconjugates was completely inhibited in the presence of excess (1 µM) unlabeled agonist PTH-(1–34) (Fig. 4CGo, lanes 2, 4, and 6, for native, and mutated V380M and V380M/M395L receptors, respectively). CNBr-treatment of either one of the isolated 125I-Bpa1-PTH-receptor mutant conjugates yielded a band with an apparent molecular mass of approximately 4.5 kDa (Fig. 4DGo, lanes 1 and 2 for V380M and V380M/M395L receptor mutants, respectively), with electrophoretic mobility similar to the free ligand 125I-Bpa1-PTH (Fig. 4DGo, lane 3). Because this preparation was devoid of free 125I-Bpa1-PTH (the ~90-kDa radioiodinated bands, corresponding to the 125I-Bpa1-PTH-receptor phoconjugates, were excised and eluted from 7.5% SDS gels before treatment with CNBr), these findings suggest that in both receptor mutants cross-linking occurred on the S-CH3 of the Met introduced by site-directed mutagenesis at position 380. In such a case, CNBr-treatment would yield a ligand modified by a "CH3-SCN" moiety and represented by the approximately 4.5-kDa band (17, 25).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 4. Characterization, photoaffinity cross-linking, and digestion of the native and mutated V380M and V380M/M395L PTH2Rs. Competition for 125I-PTH-(1–34) binding (A), and dose-dependent stimulation of AC activity (B) in COS-7 cells transiently expressing native PTH2R (-•-), PTH2R[V380M] (-{circ}-) and PTH2R[V380M/M395L] (-x-) receptors. Data are expressed as the % of specific binding (A), and maximal stimulation (B). Data are the mean ± SE of triplicate wells from one experiment. Similar results were obtained in two additional independent experiments. C, SDS-PAGE analysis of 125I-Bpa1-PTH cross-linking to COS-7 cells transiently expressing the native PTH2R (lanes 1 and 2), mutant V380M (lanes 3 and 4) and V380M/M395L (lanes 5 and 6) PTH2Rs in the absence (lanes 1, 3, and 5) or presence (lanes 2, 4, and 6) of 1 µM PTH-(1–34). Samples were analyzed by 7.5% SDS-PAGE. Size markers are shown. The arrow indicates the location of the 125I-Bpa1-PTH-PTH2R photoconjugate at approximately 90 kDa. D, CNBr-treatment of the SDS-PAGE-isolated approximately 90-kDa bands representing the conjugated 125I-Bpa1-PTH-PTH2R[V380M] (lane 1) or 125I-Bpa1-PTH–PTH2R[V380M/M395L] (lane 2). Samples were analyzed by 16.5% (wt/vol) Tricine/SDS-PAGE. Also shown is the free 125I-Bpa1-PTH ligand (molecular weight 4487) (lane 3). Molecular weight markers are also shown.

 
Identification of the putative contact domain for 125I-K13 in the PTH2R
Functional characterization of K13. The K13 analog displays binding affinity similar to the parent PTH-(1–34) when 125I-PTH was used as the radioligand, as determined in HEK-293/BP-16 cells (Fig. 5AGo). Displacement of 125I-K13 by PTH and K13 was also similar (Fig. 5BGo). K13 exhibits a 10-fold reduction in stimulating AC activity, as well as a reduction in the maximal stimulation levels (reached ~70% compared with PTH) (Fig. 5CGo).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. In vitro characterization of K13. Competition by PTH-(1–34) and K13 for 125I-PTH-(1–34) binding (A), competition for 125I-K13 binding (B), and dose-dependent stimulation of AC activity (C) in HEK-293/BP-16 cells by PTH (-•-) and K13 (-{circ}-). Data are expressed as the % of specific binding (A) and (B), and maximal stimulation (C) relative to PTH-(1–34). Data are the mean ± SE of triplicate wells from one experiment. Similar results were obtained in two additional independent experiments.

 
Photoaffinity labeling of the PTH2R with 125I-K13. Photocross-linking of 125I-K13 to the PTH2R yielded a single diffuse band migrating at approximately 90 kDa as analyzed by 7.5% SDS-PAGE (Fig. 6AGo, lane 2). This band is not observed in parental HEK-293 cells (Fig. 6AGo, lane 1) and was competed by excess (1 µM) unlabeled agonist PTH-(1–34) (Fig. 6AGo, lane 3). Endo-F-mediated deglycosylation of the approximately 90-kDa band shifted the complex to approximately 60-kDa band (1a) (Fig. 6BGo, lane 2 and Fig. 6CGo, lane 2).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 6. Photoaffinity cross-linking and chemical and enzymatic digestion of the 125I-K13-PTH2R conjugate. A, Autoradiography of nontransfected HEK-293 cells (lane 1) and PTH2R-expressing HEK-293/BP-16 cells photolabeled with 125I-K13 alone (lane 2) or in the presence of 1 µM PTH-(1–34) (lane 3). B, Endo-F-mediated deglycosylation of the 125I-K13-PTH2R photoconjugate. The approximately 90-kDa labeled conjugate was incubated in the absence (lane 1) or presence of Endo-F. The arrows indicate the position of the approximately 90 and approximately 60-kDa bands representing the intact and the deglycosylated (1a) labeled ligand-receptor conjugates, respectively. Samples were analyzed by 7.5% (wt/vol) SDS-PAGE. C–E, Digestions of the ligand-receptor conjugate following pathways 1 to 5; C, Pathway 1—the SDS-PAGE-isolated approximately 90-kDa photoconjugate was incubated in the absence (lane 1) or presence (lane 2) of Endo-F. The excised and eluted Endo-F-derived approximately 60-kDa fragment (1a) was then treated with CNBr (lane 3), yielding an approximately 8-kDa fragment 1b. Pathway 2—The SDS-PAGE-isolated approximately 90-kDa conjugate was incubated in the presence of CNBr (lane 4). The excised and eluted approximately 20-kDa band (2a) was then treated with Endo-F (lane 5), yielding an approximately 8-kDa fragment 2b similar in size to fragment 1b (compare lanes 3 and 5). D, Pathway 3—The SDS-PAGE-isolated approximately 90-kDa photoconjugate was incubated in the absence (lane 1) or presence (lane 2) of Lys-C. The excised and eluted Lys-C-derived approximately 12-kDa fragment (3a) was then treated with CNBr (lane 3), yielding an approximately 6-kDa fragment 3b. Pathway 4—The SDS-PAGE-isolated approximately 90-kDa conjugate was incubated in the presence of CNBr (lane 4). The excised and eluted approximately 20-kDa band (4a) was then treated with Lys-C (lane 5), yielding an approximately 6-kDa fragment 4b, similar in size to fragment 3b (compare lanes 3 and 5). E, Pathway 5—The SDS-PAGE-isolated approximately 90-kDa photoconjugate was incubated with NCS (lane 1), yielding an approximately 26-kDa band (5a). The excised and eluted NCS-derived fragment was then treated with Endo-F (lane 2), yielding an approximately 20-kDa fragment (5b). Samples were analyzed by 16.5% (wt/vol) Tricine/SDS-PAGE. Molecular weight markers are also shown. Similar results were obtained in three additional experiments. F, Schematic summary of the fragmentation scheme employed on the 125I-K13-PTH2R conjugate following pathways 1 to 5. Endo-F, Lys-C, CNBr and NCS digestions were carried out as detailed in Materials and Methods. –––, D, Data not shown. Molecular masses of the fragments are indicated in kDa and represent the actual size of the digested conjugate fragments including the ligand 125I-K13 (molecular weight 4487).

 
Identification of the 125I-K13 cross-linking domain. The approximately 90 kDa 125I-K13-PTH2R photoconjugate was isolated from 7.5% SDS-PAGE and subjected to a series of chemical and enzymatic cleavages, using complementary pathways. The first digestion pathway (1) consisted of Endo-F-mediated deglycosylation, followed by chemical cleavage with CNBr. The deglycosylated band of approximately 60 kDa (1a) (Fig. 6CGo lane 2) yielded a CNBr-cleavage product of approximately 8 kDa (1b) (Fig. 6CGo, lane 3), as analyzed by 16.5% (wt/vol) Tricine/SDS-PAGE. The second digestion pathway (2), the reciprocal of 1, consisted of CNBr-cleavage followed by deglycosylation by Endo-F. CNBr-cleavage of the intact ligand-receptor photoconjugate yielded a broad band migrating at approximately 20 kDa (2a) (Fig. 6CGo, lane 4). Endo-F-mediated deglycosylation of this band produced a new band migrating at approximately 8 kDa (2b) (Fig. 6CGo, lane 5), similar to the final product obtained by pathway 1 (compare Fig. 6CGo, lanes 3 and 5).

The third digestion pathway (3) consisted of Lys-C-cleavage of the intact approximately 90 kDa ligand-receptor photoconjugate, and yielded a band with an apparent molecular mass of approximately 12 kDa (3a) (Fig. 6DGo, lane 2). Similar treatment of the deglycosylated conjugate (approximately 60 kDa) yielded a band with the same apparent molecular weight (data not shown), suggesting the absence of glycosylation sites within the Lys-C-generated fragment 3a. The approximately 12 kDa Lys-C-generated band was subjected to a CNBr-cleavage which produced a band at approximately 6 kDa (3b) (Fig. 6DGo, lane 3). The complementary digestion pathway (4), the reciprocal of 3, consisted of a Lys-C-digestion of the approximately 20 kDa CNBr-derived band (4a, which is the same band as 2a), generated from the intact approximately 90-kDa ligand-receptor photoconjugate (as in pathway 2) (Fig. 6DGo, lane 4). Lys-C-digestion of the approximately 20-kDa band yielded a single band, 4b, migrating at approximately 6 kDa, similarly to 3b (compare Fig. 6DGo, lanes 3 and 5).

A fifth digestion pathway (5) consisted of treatment with N-chlorosuccinimmide (NCS), which cleaves at the carboxyl side of tryptophanyl residues, yielding a broad band with an apparent molecular mass of approximately 26 kDa (5a) (Fig. 6EGo, lane 1). Following Endo-F-mediated deglycosylation, the apparent mass was reduced to approximately 20 kDa (5b) (Fig. 6EGo, lane 2). Figure 6FGo summarizes schematically the five fragmentation pathways employed in the analysis of the 125I-K13-PTH2R conjugate.

Examination of the deduced amino acid sequence of the PTH2R reveals only one possible contact domain, Gln138-Met147. This 10-amino acid segment is located in the C-terminal portion of the N-terminal extracellular tail of the receptor. Figure 8Go summarizes schematically the putative CNBr, Lys-C and NCS cleavage sites flanking this digestion-restricted domain containing the contact site ("contact domain").

Characterization of transfected COS-7 cells expressing PTH2R mutated in the N-terminal extracellular tail. To validate our analysis of the contact domain between 125I-K13 and the PTH2R, we generated a point-mutated receptor, Lys137 -> Arg (PTH2R[K137R]). This point mutation eliminates the Lys-C digestion site at Lys137 required for generating the above-described putative contact domain Gln138-Met147. PTH-(1–34) binding affinities in COS-7 cells, transiently expressing either native or mutated receptors, are similar (Fig. 8Go, A and B for binding and AC activities, respectively). Both the native and the mutated receptors photocross-linked to 125I-K13, yielding a single diffuse band migrating at approximately 90 kDa as analyzed by 7.5% SDS-PAGE (Fig. 7CGo, lanes 1 and 3 for wild-type and mutant receptors, respectively). This band is receptor specific because it is not observed in similar experiments with mock-transfected parental COS-7 cells (data not shown). Additionally, formation of the ligand-receptor photoconjugates was completely inhibited in the presence of excess (1 µM) unlabeled agonist PTH-(1–34) (Fig. 7CGo, lanes 2 and 4, for native and mutant receptors, respectively). Lys-C-treatment of the isolated 125I-K13-PTH2R[K137R] conjugate yielded a band with an apparent molecular mass of approximately 20 kDa (Fig. 7DGo, lane 2). This band is approximately 8 kDa larger in size than the band generated by Lys-C-treatment of wild-type receptor transiently expressed in COS-7 cells (compare Fig. 7DGo, lanes 1 and 2). The size of this band is in good agreement with the glycosylated fragment Thr118-Lys197, which was predicted following the elimination of the Lys-C-digestion site in PTH2R[K137R].



View larger version (33K):
[in this window]
[in a new window]
 
Figure 7. Characterization, photoaffinity cross-linking, and digestion of the point-mutated K137R receptor. Competition for 125I-PTH-(1–34) binding (A) and dose-dependent stimulation of AC activity (B) by PTH-(1–34) in COS-7 cells transiently expressing native PTH2R (-•-) and the point-mutated K137R receptor (-{circ}-). Data are expressed as the % of specific binding (A), and maximal stimulation (B). Data are the mean ± SE of triplicate wells from one experiment. Similar results were obtained in two additional independent experiments. C, SDS-PAGE analysis of 125I-K13 cross-linking to COS-7 cells transiently expressing the native PTH2R (lanes 1 and 2), and K137R receptor mutant (lanes 3 and 4) in the absence (lanes 1 and 3) or presence (lanes 2 and 4) of 1 µM PTH-(1–34). Samples were analyzed by 7.5% SDS-PAGE. Size markers are shown. The arrow indicates the location of the 125I-K13-PTH2R photoconjugate at approximately 90 kDa. D, Lys-C-digestion of wild-type receptor (lane 1) or K137R receptor mutant (lane 2) transiently expressed in COS-7 cells. Samples were analyzed by 16.5% (wt/vol) Tricine/SDS-PAGE. Arrows indicate the positions of the Lys-C-generated bands. Molecular weight markers are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is extensively documented that positions 1–6 in PTH comprise the principal "activation domain" of PTH with regard to interaction with the PTH1R (26), the receptor present predominantly in bone and kidney and involved physiologically in calcium homeostasis. Deletion of the two N-terminal residues in PTH-(1–34) leads to the partial agonist PTH-(3–34). Additional deletion of residues in positions 3–6 yields the antagonist PTH-(7–34). PTHrP-(1–34) is also a full agonist for the PTH1R; in contrast, PTHrP-(7–34) is a weak partial agonist (24).

For the recently discovered PTH2R, PTH-(1–34) and PTH-(7–34) are potent agonist and antagonist, respectively (2). In sharp contrast to the potent biological activity of PTHrP-(1–34) with the PTH1R, it has negligible activity with the PTH2R (1, 2, 3). Surprisingly, it was found that PTHrP-(7–34) binds to and antagonizes the PTH2R (2), even though the parent hormone PTHrP-(1–34) is essentially inactive. These findings suggest that both receptor subtypes share common modes of interactions with PTH, and, to a lesser extent, with portions of the PTHrP molecule.

The premise of any photoaffinity cross-linking study is that analogs of a parent peptide hormone with similar pharmacological profile share similar bioactive conformation and generate topochemically equivalent ligand-receptor complexes. The series of photoreactive analogs [Bpa1–6]-PTH was designed specifically for photoaffinity scanning studies aimed at investigating the bimolecular interactions of the activation domain of PTH with either the PTH1R or the PTH2R subtype. Modifications in PTH-(1–34), which include Met8,18 -> Nle8,18, Lys13,26,27 -> Arg13,26,27, and Trp23 -> 2-Nal23, render the ligand resistant to the various chemical and enzymatic cleavage agents (i.e. CNBr, Lys-C and NCS) that it is exposed to during the digestion of the radiolabeled ligand-receptor photoconjugate. These modifications do not affect the ligand’s binding affinity or signaling efficacy (17, 19).

Characterization of bimolecular interactions between the principal activation domain in PTH and PTH receptors is important for understanding receptor activation and signaling. To identify a photoaffinity ligand that would be suitable for use as a reagent in cross-linking studies focusing on this domain we "scanned" positions 1–6 by making a Bpa substitution at each position, generating the [Bpa1–6]-PTH series. Only two analogs in this series, Bpa1- and Bpa6-PTH, displayed bioactivity profiles similar to those of the parent hormone PTH-(1–34) in both receptor subtypes. We therefore selected Bpa1-PTH, for which a contact domain and a putative contact point in the PTH1R has been recently identified, as the photoreactive analog to carry out a comparative study in the PTH2R. Not surprisingly, other analogs in the series were not as active, indicating that not all positions are amenable to Bpa substitution. A second analog (K13), carrying the photoreactive moiety in the mid-region of the molecule, was also used. Importantly, both Bpa1-PTH and K13 compete for radiolabeled 125I-PTH binding to the PTH2R, and reciprocally, PTH-(1–34) competes with the radioiodinated 125I-Bpa1-PTH and 125I-K13 with similar affinities. These pharmacological results strongly suggest that these two analogs interact with PTH2R similarly to the unmodified PTH-(1–34).

Cross-linking 125I-Bpa1-PTH to the PTH2R followed by digestion of the photoconjugate and protein mapping leads to the identification of the sequence Ser364-Met395 as the contact domain. This region is 32 amino acids long and is located in TMD 6 and part of ECL 3. The confidence in the identity of this contact domain was further confirmed by using the reciprocal pathway for digestion.

Alignment of the sequences of the PTH1R and the PTH2R to reveal maximal homology suggests that Val380 in the latter receptor corresponds to Met425 in the former. Cross-link-ing of 125I-Bpa1-PTH to the fully functional mutated PTH2R[V380M] receptor generated a band after treatment with CNBr, which has an apparent mass similar to the ligand itself (~4.5 kDa) and significantly different from the one obtained with the wild-type receptor. Such a small size band could be obtained by cross-linking the benzophenone moiety to the S-CH3 of a methionine. Subsequent CNBr-cleavage of such a conjugate yields the free ligand modified by an additional 73 atomic mass units, resulting from the insertion of CH3-S-CN across the benzophenone carbonyl (25). Alternatively, it is possible that cross-linking occurs within the domain Cys381-Met395. In such a case, CNBr-treatment would also generate a low molecular weight fragment (~5.5–6 kDa), which may be indistinguishable from an approximately 4.5-kDa band by SDS-PAGE analysis. To exclude this possibility, the double mutant V380M/M395L receptor was generated and characterized. The biological profile (PTH-binding and stimulation of AC activity) of this mutant was similar to that of the wild-type PTH2R. Photocross-linking to 125I-Bpa1-PTH generated the anticipated approximately 90-kDa photoconjugate. Subsequent CNBr-treatment of this conjugate generated the same approximately 4.5-kDa band obtained with the 125I-Bpa1-PTH-PTH2R[V380M] conjugate. If cross-linking had occurred to a site C-terminal to Met380, CNBr-treatment would have generated a significantly larger fragment [~10 kDa, comprised of 125I-Bpa1-PTH-PTH2R (381–427)]. These results support the conclusion that 125I-Bpa1-PTH cross-links to position 380 in PTH2R. It is known that the tertiary hydrogen in the side chain of Val, as well as the CH3-S of Met, are favored reaction sites for the benzophenone moiety (27). However, given the photochemical properties of the benzophenone moiety and the topological requirements for the hydrogen abstraction by the biradical, the reactive C-H bond participating in the photoconjugation must be located within approximately 3.1 Å from the benzophenone moiety (27).

Analysis of the photoaffinity cross-linking of 125I-Bpa1-PTH to the PTH1R identified a single amino acid, Met425 in the extracellular end of TMD 6, as a putative "contact point" (17). Hence, even the putative "contact points" for 125I-Bpa1-PTH appear analogous in the two receptor subtypes. The two receptor subtypes are homologous, but differ in size. Our findings indicate that the putative "contact domain" for Bpa1-PTH in PTH2R is located in a position which is the counterpart of a previously identified contact domain for the same photoligand in PTH1R.

The K13 analog, in which the benzophenone moiety is present in position 13 of PTH, cross-links to a distinct contact domain in the PTH2R, positions 138–147, which is located at the carboxyl side of the N-terminal extracellular tail and includes several residues in TMD 1. The Lys-C-digestion of the point-mutated PTH2R[K137R] receptor provides an additional and independent validation of the identity of the putative contact domain.

The "contact domain" of the same analog, 125I-K13, in the PTH1R has been recently reported (19). It spans a 17-amino acid region, Phe173-Met189, located at precisely the same place as the PTH2R contact domain identified for the same ligand in this report. Very recently, the 17-amino acid contact site in the PTH1R has been refined to a domain only 8 amino acids in length: Glu182-Met189. Within this contact domain, Arg186 was shown to be essential for cross-linking (21). This amino acid in the PTH1R corresponds to the homologous Arg143 in the PTH2R contact domain, Gln138-Met147. However, single point mutations in PTH2R at this site (R143A), or other sites within the contact domain (V144A and L146A), did not abolish cross-linking to 125I-K13 (Behar, V., unpublished results). All receptor mutants employed, displayed binding and signaling properties similar to the wild-type receptor. This is the first finding that may suggest that there is a minor structural feature within the 125I-K13 binding domain of the PTH2R, which is distinct from the homologous domain in PTH1R. At this point, the level of structural information attainable by the photoaffinity scanning approach cannot distinguish between such subtle structural differences.

In conclusion, our investigations demonstrate directly, through cross-linking and subsequent protein mapping, that the domains in both PTH receptor subtypes involved in binding either the N terminus or the mid-region of PTH are analogous. These observations suggest that both the hormone (positions 1 and 13) and each of the receptor subtypes adapt similar topology when hormone-receptor complexes are formed in either system.


    Acknowledgments
 
The authors thank Dr. Joseph M. Alexander for critical reading of the manuscript.


    Footnotes
 
1 This work was supported, in part, by Grant RO1-DK-47940 (to M.R.) from the National Institutes of Health. Back

2 This work is presented in partial fulfillment of a requirement toward a Ph.D. thesis by V.B. Back

Received November 20, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Usdin TB, Gruber C, Bonner TI 1995 Identification and functional expression of a receptor selectively recognizing parathyroid hormone, the PTH2 receptor. J Biol Chem 270:15455–15458[Abstract/Free Full Text]
  2. Behar V, Pines M, Nakamoto C, Greenberg Z, Bisello A, Stueckle SM, Bessalle R, Usdin TB, Chorev M, Rosenblatt M, Suva LJ 1996 The human PTH2 receptor: binding and signal transduction properties of the stably expressed recombinant receptor. Endocrinology 137:2748–2757[Abstract]
  3. Gardella TJ, Luck MD, Jensen GS, Usdin TB, Jüppner H 1996 Converting parathyroid hormone-related peptide (PTHrP) into a potent PTH-2 receptor agonist. J Biol Chem 271:19888–19893[Abstract/Free Full Text]
  4. Ishihara T, Nakamura S, Karizo Y, Takahashi T, Takahashi K, Nagata S 1991 Molecular cloning and expression of a cDNA encoding the secretin receptor. EMBO J 10:1635–1641[Medline]
  5. Lin HY, Harris TL, Flannery MS, Aruffo A, Kaji EH, Gorn A, Kolakowski Jr LF, Lodish HF, Goldring SR 1991 Expression cloning of an adenylate cyclase-coupled calcitonin receptor. Science 254:1022–1024[Abstract/Free Full Text]
  6. Jelinek LJ, Lok S, Rosenberg G, Smith RA, Grant FJ, Biggs S, Bensch PA, Kuijper L, Sheppard PO, Sprecher C, O’Hara PJ, Foster DC, Walker K, Chen L, McKernan P, Kindsvogel W 1992 Expression cloning and signaling properties of the rat glucagon receptor. Science 259:1614–1616
  7. Thorens B 1992 Expression cloning of the pancreatic ß cell receptor for the glucose-secreting hormone glucagon-like peptide 1. Proc Natl Acad Sci USA 89:8641–8645[Abstract/Free Full Text]
  8. Ishihara T, Shigemoto R, Mori K, Takahashi K, Nagata S 1992 Functional expression and tissue distribution of a novel receptor for vasoactive intestinal peptide. Neuron 8:811–819[CrossRef][Medline]
  9. Segre G, Goldring SR 1993 Receptors for secretin, calcitonin, parathyroid hormone (PTH)/PTH-related peptide (PTHrP), vasoactive intestinal peptide, glucagon-like peptide, growth hormone-releasing hormone and glucagon belong to a newly discovered G-protein-linked receptor family. Trends Endocrinol Metab 4:309–314[CrossRef][Medline]
  10. Jüppner H 1994 Molecular cloning and characterization of a parathyroid hormone/parathyroid hormone-related peptide receptor: a member of an ancient family of G protein-coupled receptors. Curr Opin Nephrol Hypertens 3:371–378[CrossRef][Medline]
  11. Ureña P, Kong X-F, Abou-Samra A-B, Jüppner H, Kronenberg HM, Potts Jr JT, Segre GV 1993 Parathyroid hormone (PTH)/PTH-related peptide receptor messenger ribonucleic acids are widely distributed in rat tissues. Endocrinology 133:617–623[Abstract/Free Full Text]
  12. Usdin T, Bonner TI, Harta G, Mezey E 1996 Distribution of parathyroid hormone-2 receptor messenger ribonucleic acid in rat. Endocrinology 137:4285–4297[Abstract]
  13. Behar V, Nakamoto C, Greenberg Z, Bisello A, Suva LJ, Rosenblatt M, Chorev M 1996 Histidine at position 5 is the specificity "switch" between two parathyroid hormone receptor subtypes. Endocrinology 137:4217–4224[Abstract]
  14. Turner PR, Mefford S, Bambino T, Nissenson RA 1998 Transmembrane residues together with the amino terminus limit the response of the parathyroid hormone (PTH) 2 receptor to PTH-related peptide. J Biol Chem 273:3830–3837[Abstract/Free Full Text]
  15. Clark JA, Bonner TI, Kim AS, Usdin TB 1998 Multiple regions of ligand discrimination revealed by analysis of chimeric parathyroid hormone 2 (PTH2) and PTH/PTH-related peptide (PTHrP) receptors. Mol Endocrinol 12:193–206[Abstract/Free Full Text]
  16. Bergwitz C, Jusseaume SA, Luck MD, Jüppner H, Gardella TJ 1997 Residues in the membrane-spanning and extracellular loop regions of the parathyroid hormone (PTH)-2 receptor determine signaling selectivity for PTH and PTH-related peptide. J Biol Chem 272:28861–28868[Abstract/Free Full Text]
  17. Bisello A, Adams AE, Mierke DF, Pellegrini M, Rosenblatt M, Suva LJ, Chorev M 1998 Parathyroid hormone-receptor interactions identified directly by photocrosslinking and molecular modeling studies. J Biol Chem 273:22498–22505[Abstract/Free Full Text]
  18. Roubini E, Duong LT, Gibbons SW, Leu CT, Caulfield MP, Chorev M, Rosenblatt M 1992 Synthesis of fully active biotinylated analogues of parathyroid hormone and parathyroid hormone-related protein as tools for the characterization of parathyroid hormone receptors. Biochemistry 31:4026–4033[CrossRef][Medline]
  19. Zhou AT, Bessalle R, Bisello A, Nakamoto C, Rosenblatt M, Suva LJ, Chorev M 1997 Direct mapping of an agonist-binding domain within the parathyroid hormone/parathyroid hormone-related protein receptor by photoaffinity crosslinking. Proc Natl Acad Sci USA 94:3644–3649[Abstract/Free Full Text]
  20. Nakamoto C, Behar V, Chin K, Adams AE, Suva LJ, Rosenblatt M, Chorev M 1995 Probing the bimolecular interactions of parathyroid hormone (PTH) and the human PTH/PTHrP receptor. Biochemistry 34:10546–10552[CrossRef][Medline]
  21. Adams AE, Bisello A, Chorev M, Rosenblatt M, Suva LJ 1998 Arginine 186 in the extracellular N-terminal region of the human parathyroid hormone 1 receptor is essential for contact with position 13 of the hormone. Mol Endocrinol 12:1673–1683[Abstract/Free Full Text]
  22. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685[CrossRef][Medline]
  23. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds) 1997 Current Protocols in Molecular Biology, Volume 1
  24. Nutt RF, Caulfield MP, Levy JJ, Gibbons SW, Rosenblatt M, McKee RL 1990 Removal of partial agonism from parathyroid hormone (PTH)-related protein-(7–34)NH2 by substitution of PTH amino acids at positions 10 and 11. Endocrinology 127:491–493[Abstract/Free Full Text]
  25. Kage R, Leeman SE, Krause JE, Costello CE, Boyd ND 1996 Identification of methionine as the site of covalent attachment of a p-benzoyl-phenylalanine-containing analogue of substance P on the substance P (NK-1) receptor. J Biol Chem 271:25797–25800[Abstract/Free Full Text]
  26. Chorev M, Rosenblatt M 1996 Parathyroid hormone: structure-function relations and analog design. In: Bilezikian JP, Raisz LG, Rodan GA, (eds) Principle of Bone Biology, Academic Press, San Diego, CA, pp 305–323
  27. Dormán G, Prestwich GD 1994 Benzophenone photophores in biochemistry. Biochemistry 33:5661–5673[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
I. Assil-Kishawi, T. A. Samra, D. F. Mierke, and A. B. Abou-Samra
Residue 17 of Sauvagine Cross-links to the First Transmembrane Domain of Corticotropin-releasing Factor Receptor 1 (CRFR1)
J. Biol. Chem., December 19, 2008; 283(51): 35644 - 35651.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Pham, M. Dong, J. D. Wade, L. J. Miller, C. J. Morton, H.-l. Ng, M. W. Parker, and P. M. Sexton
Insights into Interactions between the {alpha}-Helical Region of the Salmon Calcitonin Antagonists and the Human Calcitonin Receptor using Photoaffinity Labeling
J. Biol. Chem., August 5, 2005; 280(31): 28610 - 28622.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
T. M. Murray, L. G. Rao, P. Divieti, and F. R. Bringhurst
Parathyroid Hormone Secretion and Action: Evidence for Discrete Receptors for the Carboxyl-Terminal Region and Related Biological Actions of Carboxyl- Terminal Ligands
Endocr. Rev., February 1, 2005; 26(1): 78 - 113.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. R. Papasani, R. C. Gensure, Y.-L. Yan, Y. Gunes, J. H. Postlethwait, B. Ponugoti, M. R. John, H. Juppner, and D. A. Rubin
Identification and Characterization of the Zebrafish and Fugu Genes Encoding Tuberoinfundibular Peptide 39
Endocrinology, November 1, 2004; 145(11): 5294 - 5304.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Dong, Z. Li, D. I. Pinon, T. P. Lybrand, and L. J. Miller
Spatial Approximation between the Amino Terminus of a Peptide Agonist and the Top of the Sixth Transmembrane Segment of the Secretin Receptor
J. Biol. Chem., January 23, 2004; 279(4): 2894 - 2903.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. C. Gensure, N. Shimizu, J. Tsang, and T. J. Gardella
Identification of a Contact Site for Residue 19 of Parathyroid Hormone (PTH) and PTH-Related Protein Analogs in Transmembrane Domain Two of the Type 1 PTH Receptor
Mol. Endocrinol., December 1, 2003; 17(12): 2647 - 2658.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Zang, M. Dong, D. I. Pinon, X.-Q. Ding, E. M. Hadac, Z. Li, T. P. Lybrand, and L. J. Miller
Spatial Approximation between a Photolabile Residue in Position 13 of Secretin and the Amino Terminus of the Secretin Receptor
Mol. Pharmacol., May 1, 2003; 63(5): 993 - 1001.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Akal-Strader, S. Khare, D. Xu, F. Naider, and J. M. Becker
Residues in the First Extracellular Loop of a G Protein-coupled Receptor Play a Role in Signal Transduction
J. Biol. Chem., August 16, 2002; 277(34): 30581 - 30590.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. P. Goold, T. B. Usdin, and S. R. J. Hoare
Regions in Rat and Human Parathyroid Hormone (PTH) 2 Receptors Controlling Receptor Interaction with PTH and with Antagonist Ligands
J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 678 - 690.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Dong, Y. W. Asmann, M. Zang, D. I. Pinon, and L. J. Miller
Identification of Two Pairs of Spatially Approximated Residues within the Carboxyl Terminus of Secretin and Its Receptor
J. Biol. Chem., August 18, 2000; 275(34): 26032 - 26039.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Piserchio, T. Usdin, and D. F. Mierke
Structure of Tuberoinfundibular Peptide of 39 Residues
J. Biol. Chem., August 25, 2000; 275(35): 27284 - 27290.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. R. J. Hoare, J. A. Clark, and T. B. Usdin
Molecular Determinants of Tuberoinfundibular Peptide of 39 Residues (TIP39) Selectivity for the Parathyroid Hormone-2 (PTH2) Receptor. N-TERMINAL TRUNCATION OF TIP39 REVERSES PTH2 RECEPTOR/PTH1 RECEPTOR BINDING SELECTIVITY
J. Biol. Chem., August 25, 2000; 275(35): 27274 - 27283.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Behar, V.
Right arrow Articles by Chorev, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Behar, V.
Right arrow Articles by Chorev, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals