| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Cell Biology, Baylor College of Medicine, Houston, Texas 77030
Address all correspondence and requests for reprints to: JoAnne S. Richards, Department of Cell Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: joanner{at}bcm.tmc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ß subtypes and
ERß variants in granulosa cells have been determined using several
integrated approaches: , Western blotting, indirect immunofluorescence,
RT-PCR, and transient transfection assays. Each of these approaches has
provided specific details concerning the dynamics of ER expression, ER
functional activity, and estradiol (E) regulation of target genes in
granulosa cells. Specifically, the studies presented herein document
that messenger RNAs (mRNAs) encoding ERß and its splice variants, as
well as mRNA encoding ER, are expressed in granulosa cells of
immature rats before and during culture in serum-free medium. The
results also provide the first documentation that functional (DNA
binding and transcriptionally active) ER is present in cultured
granulosa cells and that its ability to bind consensus estrogen
response element (ERE) oligonucleotide and to transactivate an ERE
promoter-reporter construct is associated with the level (type?) of
receptor protein as well as the stage of granulosa cell
differentiation. Using a labeled ERE consensus oligonucleotide and
antibodies specific for ERß and ER, we show that ERß but not
ER was detected (supershifted in electrophoretic mobility shift
assays) in extracts of granulosa cells cultured overnight (0 h) in
defined medium alone. When the cells were cultured with FSH and
testosterone (T) to stimulate their differentiation, ERß binding
activity, as well as immunoreactive ERß as determined by Western blot
analyses, decreased progressively from 24 to 48 h and was
undetectable by 72 h. ERß mRNA was low, and ERß binding
activity was not observed in luteinized granulosa cells. ER DNA
binding activity was not observed in any of the granulosa cell
cultures, although low levels of immunoreactive ER were detected by
Western blot analyses. Immunofluorescent analyses documented that
ERß, as well as ER, were localized to granulosa cell nuclei and
that the intensity of nuclear staining was related to agonist
stimulation and differentiation: forskolin increased, whereas E
decreased immunostaining for ERß and ER at 48 h. When an
ERE-E1b-luciferase vector was transfected into granulosa cells of
unprimed rats, basal luciferase activity was low but increased by
forskolin (3–4x) and by E (2x), responses to both agonists being
blocked by the ER antagonist, ICI. When the same vector was transfected
into differentiated granulosa cells (cultured for 48 h with
FSH/T), forskolin alone increased activity. Collectively, these results
show that ERß protein is preferentially expressed in immature
granulosa cells, is functionally active (binds DNA), can transactivate
(either as a homodimer or heterodimer with ER) ERE-containing
promoter constructs, and might be associated with increased expression
of the endogenous gene encoding c-Jun. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-hydroxylase-17,20 lyase), the enzyme
converting C21 steroids to C19 androgen substrates for aromatase (4). E
produced by the preovulatory follicles not only acts on distal target
tissues such as the brain, pituitary, and uterus, but also alters
ovarian cell function (1). Thus, the synthesis of E by ovarian
granulosa cells and actions of E within these cells presents an
intriguing model for steroid hormone action in a physiological context.
Both in vivo and in vitro studies have shown that
E and FSH act synergistically in granulosa cells to induce expression
of specific genes, including the induction of LH receptor (5, 6),
aromatase (3, 7), P450scc (8, 9), and inhibin (10). Furthermore, E and
PRL act synergistically in luteal cells to regulate gene expression
(11, 12). The effects of each hormone are presumed to be transduced by
specific receptor-mediated events.
Estradiol specific binding sites (receptors) were first characterized
in the ovary of rats by autoradiographic localization of tritiated
estradiol (13). This observation was extended by nuclear exchange
assays that quantified the uptake of labeled steroid by granulosa cell
nuclei, showed that uptake was specific and of high affinity, and
showed that binding could be regulated by hormones (14, 15). These
observations have been verified more recently by in situ
localization of estradiol receptor (ER) transcripts in the ovary
(16, 17, 18, 19). The prototype ER, ER (ER), as well as the more
recently identified subtype, ER ß (ERß) (16, 17, 18, 19, 20) and its splice
variants (21) are expressed in rat ovarian cells: with ERß messenger
RNA (mRNA) being the more predominant in granulosa cells and ER mRNA
being higher in luteal tissue (18, 20). Thus, not only are the levels
of E high in preovulatory follicles (1), but the expression and
localization of ER subtype mRNAs appears to be cell-type and stage
specific (16, 17, 18, 19). Less is known about the hormonal regulation of ERß
and ER protein in ovarian cells, how these proteins interact, or if
they regulate the expression of distinct genes (18, 22).
The cloning of ERß has sparked an intense reevaluation of the impact that E and its receptors have in regulating ovarian cell function and the expression of specific genes in granulosa cells. Several genes that are induced by E in other cell types are expressed in the rat ovary and have been presumed to be targets of E action in this tissue as well. Two of these genes include the nuclear transcription factors, progesterone receptor (PR) (22, 23, 24, 25) and c-fos (26, 27). PR is induced in preovulatory, estradiol-producing granulosa cells as a consequence of the LH surge (23, 24) and is obligatory for ovulation (25). PR is also induced by LH in cultured granulosa cells that have been stimulated to differentiate to the preovulatory phenotype in the presence of FSH and T or FSH and E (22, 24). Inclusion of the potent ER antagonist ICI 164,384 with FSH/T during differentiation blocked subsequent induction of PR by LH, suggesting that E exerts some effect on the cellular events leading to the induction of PR (22). However, there are some curious anomalies in the response of granulosa cells to E. E alone did not induce PR in granulosa cells as it does in other cells; nor did ICI block the acute induction of PR by LH (22). Furthermore, when specific promoter-reporter constructs containing well-characterized ER response elements (EREs) were transfected into differentiated (FSH/T treated) granulosa cells, LH but not E stimulated transgene activity (22, 28). These results suggested that in preovulatory granulosa cells, ligand-independent rather than (or in addition to) ligand-dependent activation of ER might occur and that an A-kinase (or related kinase cascades) phosphorylates ER (28, 29, 30, 31, 32, 33, 34) or a coactivator (31, 32), directly or indirectly.
Recently, we have observed that when E alone is administered to hypophysectomized immature rats, expression of cyclin D2 mRNA in granulosa cells of small follicles increases rapidly (35, 36, 37) in association with increased proliferation of these cells (38). Similarly, when granulosa cells were harvested from immature rats and cultured in the presence of E alone, expression of cyclin D2 mRNA increased rapidly within 2 h, a response blocked by ICI (36). These observations provide some of the first evidence for genes that may be direct targets of E action, in the absence of FSH, in granulosa cells. These observations also raised the possibility that, in undifferentiated granulosa cells but not in preovulatory granulosa cells, an ER subtype was activated by E and stimulated transcription of target genes. ERß protein is a likely candidate because it is preferentially detected by electrophoretic mobility shift assays (EMSAs) in granulosa cell extracts compared with luteal cell extracts (22).
Based on these observations, the studies described herein were designed
to analyze the expression and localization of ER and ERß mRNAs and
protein in undifferentiated and hormone-differentiated granulosa cells.
The functional activity of ER subtypes in granulosa cells at different
stages of differentiation was analyzed by determining their ability to
bind the consensus ERE of the vitellogenin B1 gene and to transactivate
a promoter-reporter construct containing the same consensus ERE
promoter region. The response of the ERE promoter-reporter constructs
to E was compared with that of forskolin, an agonist previously shown
to stimulate ligand-independent activation of similar promoter-reporter
constructs (22, 28). Lastly, we have examined the expression of
endogenous genes that might be targets of E action, including the cell
cycle regulatory molecules (35, 36, 37) and transcription factors (25, 26)
that are presumed targets of E action in other cells, and under certain
conditions are factors to which ER can bind to regulate transcription
(39, 40).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-32P[dCTP] was from ICN
Radiochemicals (Costa Mesa, CA). Hyperfilm was purchased from
Amersham Pharmacia Biotech (Arlington Heights, IL).
Reagents for luciferase assays, Beetle Luciferin protein, and Coenzyme
A (CoE A), were obtained from Promega Corp. and
Roche Molecular Biochemicals, respectively. Antibodies to
ERß were obtained from Affinity BioReagents, Inc.
(Golden, CO) (catalog no. PAI-310) and Upstate Biotechnology, Inc. (Lake Placid, NY) (catalog no. 06–629). Antibodies to
ER were obtained from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA) (SC-542), Transduction Laboratories, Inc.
(Lexington, KY) (MC-20) and Geneka Biotech, Inc. (Montréal,
Québec, Canada) (catalog no. 1600024). Immobilon P membranes are
from Millipore Corp. (Bedford, MA).
Animals
Intact and hypophysectomized immature (day 25 of age) Holtzman
Sprague Dawley female rats (Harlan Sprague Dawley, Inc.,
Indianapolis, IN) were housed under a 16-h light, 8-h dark schedule in
the Center for Comparative Medicine at Baylor College of Medicine and
provided food and water ad libitum. Animals were treated in
accordance with the NIH Guide for the Care and Use of Laboratory
Animals, as approved by the Animal Care and Use Committee at Baylor
College of Medicine (Houston, TX).
Granulosa cell cultures
Granulosa cells were harvested by needle puncture from untreated
immature (day 26) rats or from immature rats treated with estradiol (E)
(1 mg E/0.2 ml propylene glycol) on days 23–25 of age as previously
described (3, 22) and as indicated in the results and figure legends.
Briefly, cells were cultured at a density of 1 x 106
cells per 3 ml serum-free medium (DMEM:F12 containing Penicillin and
Streptomycin) in multiwell (35 mm) dishes that were serum-coated. Cells
were cultured in defined medium overnight (0 h) followed by the
addition of FSH (50 ng/ml) and testosterone (T; 10 ng/ml), forskolin
(10 µM) or E (10 nM). FSH/T were used to
stimulate granulosa cell differentiation to a preovulatory phenotype
characterized by the induction of aromatase (1, 3, 7), LH receptor (5, 6), and inhibin (10), as well as others (1). Forskolin and E alone were
used to determine the relative effects of cAMP vs. E,
respectively, on specific cell functions.
In selected experiments, granulosa cells were harvested from preovulatory (PO) follicles obtained from immature rats primed with a low dose of hCG (0.15 IU hCG twice daily for 2 days), a regimen that results in the growth of preovulatory (PO) follicles (41). Granulosa cells were also isolated from PO follicles exposed to an ovulatory dose of hCG (10 IU; by ip injection) in vivo for 6 h, designated PO/hCG (41). Granulosa cells from PO and PO/hCG follicles were cultured in 1% serum as previously described. PO/hCG granulosa cells spontaneously luteinize in culture and constitutively express high levels of P450scc mRNA (2, 9). In contrast, PO granulosa cells are dependent on cAMP for maintenance of the PO phenotype (i.e. expression of aromatase and P450scc; 2, 9, 41). Thus, the immature rat provides a way to analyze the differentiation of immature granulosa cells to the PO stage. The PO and PO/hCG model allows one to compare the expression of genes in nonluteinized and luteinized granulosa cells, respectively. Hormones, agonists, and antagonists were added as indicated in the figure legends.
Nuclear extracts (NE) were prepared from granulosa cells of hypophysectomized (H) immature rats treated with E (1 mg/day for 3 days) and FSH (1 µg twice daily for two days), designated HEF (22).
RNA isolation and RT-PCR assays
Cytoplasmic RNA was isolated from cultured cells with a buffer
containing 1% NP-40 (3). Each RNA sample was pooled from three
replicate wells. The RNA was purified by sequential phenol,
phenol:chloroform, and chloroform extraction, followed by ethanol
precipitation. The RNA was resuspended in
0.1%diethylpyrocarbonate-treated water and its concentration
determined by absorbance at 260 nm.
Identification of ERß variant transcripts expressed in granulosa
cells was performed according to the procedure described by Petersen
et al. (21). For determining relative changes in ER subtype
mRNAs during granulosa cell differentiation, RT-PCR reactions were
performed as previously described (42, 43) using 500 ng of input RNA.
Following the RT step, the reaction mixture was split into three equal
aliquots to which specific primer pairs for rat estrogen receptor ß
(forward, 5'-TTCCCGGCAGCACCAGTAACC-3' and reverse
5'-TCCCTCTTTGCGTTTGGACTA-3') (42), estrogen receptor (forward,
5'-AATTCTGACAATCGACGCCAG-3' and reverse 5'-GTGCTTCAACATTCTCCCTCCTC-3')
(42) and the ribosomal protein L19 (23, 42). ER and ERß were
amplified for 30 cycles, whereas L19 was amplified for 20 cycles using
standard temperatures and times that gave a linear increase of DNA
product to input RNA from 300 to 1500 ng (43; data not shown). The
amplified complementary DNA products for ERß (282 bp), ER (344
bp), and L19 (196 bp) were resolved by acrylamide gel electrophoresis
and radioactive PCR product bands were quantified by phosphoimage
analysis (Betascope 603 Blot Analyzer; Betagen Corp., Mountain View,
CA). Separate reactions were done because generation of the L19 product
interfered with the generation of the ER. Data are presented as the
ratio of radioactivity in the ER and L19 bands.
Transfections
The ERE-E1b- luciferase promoter-reporter construct analyzed in
this study has been used previously (22, 32). For transfections,
granulosa cells were harvested from E-primed or unprimed immature rats
and cultured overnight in medium alone (0 h) or in the presence of FSH
(50 ng/ml) and T (10 ng/ml) for 48 h. The cells were transiently
transfected using 4.78 pmol plasmid/well, and the calcium phosphate
precipitation method (43, 44, 45). Four hours later, the DNA was removed
and the cells washed and cultured in the presence or absence of 10
µM forskolin or 10 nM E for 5 h. At that
time, the cells were lysed by freeze-thaw procedure using lysis buffer
(0.2 M Tris, pH 8.0 containing 0.1% Triton X-100).
Cytosolic protein concentrations determined by the mini-Bradford assay
(Bio-Rad Laboratories, Inc.). Luciferase activity in the
extracts was analyzed according to a standard protocol. In brief, a
20-µl aliquot of the cell lysate was mixed automatically with 100
µl of the luciferase assay reagent (20 mM Tris, pH 8.0,
containing 4 mM MgSO4, 0.1 mM EDTA, 30
mM dithiothreitol, 0.5 mM ATP, 0.5
mM luciferin, and 0.25 mM CoE A) and each
reaction was monitored for 20 sec in a luminomitor. Data are expressed
based on the amount of protein in each sample: light specific
units(LSU)/µg protein (mean ± SEM).
EMSAs
Oligonucleotides to the consensus ERE of the Vitellogenin B1
gene (5'-AGGCAAAGTCAGGTCACAGTGACCTGATCAAAGA and reverse
AGGTCTTTGATCAGGTCACTGTGACCTGACTTTG) were annealed, labeled, and used in
EMSAs as described previously (21). P32-Labeled
oligonucleotide was incubated with nuclear extracts (NE) prepared from
granulosa cells of hypophysectomized (H) rats treated sequentially with
E and FSH (HEF) or whole cell extracts (WCE) prepared from granulosa
cells of intact rats as previously described (22, 36). WCEs were also
prepared at specific times from granulosa cells cultured in the
presence of hormones to stimulate differentiation as indicated in
Results and figure legends. After 20 min at room
temperature, the binding reactions were subjected to nondenaturing
electrophoresis (0.5% TBE; Tris-Borate-EDTA) at 150 V. Where
indicated, specific antibodies against ERß and ER were added to
the reactions for 30 min on ice before the addition of labeled DNA.
Western blot analyses
Granulosa cells were cultured as described in each figure. To
obtain cell extracts, 120 µl of boiling lysis buffer containing SDS
was added to each well (44). The lysed cells were scraped, rapidly
transferred to an Eppendorf tube, and boiled for 2 min.
Equal volumes (30 µl) of extract were directly loaded per well onto
SDS-PAGE. Proteins were transferred to immobilon filters and probed
with antibodies using specifications of the suppliers of each antibody.
Immunoreactive bands were visualized by enhanced chemiluminescent
assays (ECL) using standard protocols. Bands were quantitated using
phosphoimage analyses and molecular weights determined based on the
BenchMark standards (Life Technologies, Inc.) included in
each gel.
Immunocytochemistry
Granulosa cells from untreated and E-primed immature rats, as
well as from PO and PO/hCG follicles, were cultured as above on glass
coverslips for various time intervals in the presence or absence of
FSH/T or forskolin. Cells were processed for immunocytochemistry as
described previously (44). Briefly, cells were fixed in fresh 4%
paraformaldehyde (Electron Microscopy Sciences, Fort Washington, PA) in
PBS for 30 min at room temperature, washed in 10 mM glycine
in PBS and PBS. The fixed cells were either stored at 4 C. The cells
were permeabilized with 0.5% NP-40 in PBS for 10 min and then blocked
with 4% BSA in PBS for 1 h at room temperature. The cells were
incubated at 4 C for 18 h with specific antibodies diluted 1:500
in 4% BSA in PBS. Following several PBS washes, cells were incubated
with fluorescein-labeled goat antirabbit IgG (1:20, Pierce Chemical Co., Rockford, IL) in 4% BSA in PBS for 1 h at
room temperature. ERß and ER were visualized on a Zeiss Axiophot
microscope (Carl Zeiss, Thornwood, NY) and a 63x
objective (oil). Images were directly transferred to the computer using
the Baylor College of Medicine network.
Statistical analyses
RT-PCR and transfection data were analyzed by one-way ANOVA
followed by posthoc Student Newman-Keul’s test. Values were considered
significantly different if P < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Complexes I, III, and IV (but not
complex II) were completely competed with 100-fold molar excess of
unlabeled ERE, indicating that complex II is nonspecific. Complexes
I–IV were also observed in WCEs prepared from granulosa cells cultured
for 24 (not shown), 48, and 72 h with FSH/T (Fig. 1A). Notably,
complex I was present at 24 h, decreased at 48 h and was
negligible at 72 h. When ER antibodies (1 µg; Santa Cruz or Geneka) were added to the binding reactions, they failed
to alter any of the complexes. In contrast, when an ERß antibody (1
µg; Affinity BioReagents, Inc.) was added to the binding
reactions, a major supershift in complex I occurred (Fig. 1A; 0 h,
supershifted product denoted by the arrow). The intensity of
complex I, as well as the amount of shifted product, declined in WCEs
prepared at 48 and 72 h. The ERß antibody did not alter any of
the other complexes (Fig. 1A). Similar results were observed when
granulosa cells from unprimed immature rats were cultured with FSH/T or
forskolin for 0–48 h: the amount of complex I was high at 0 h but
declined by 48 h (data not shown).
|
). As
shown by EMSA, WCE from granulosa cells of immature rats formed
protein/DNA complexes (I-IV) similar to those in the cultured cells.
All of these complexes except complex II were competed with a 100-fold
excess of unlabeled ERE probe. Complex I was supershifted by antibody
to ERß but not by antibodies to ER. Complex IV was less abundant
in these noncultured cells. When NE of the preovulatory (HEF) granulosa
cells were used in the binding reactions (Fig. 1C), complex I was
enriched compared with complexes II–IV. In addition, complex I was
partially supershifted by an ER antibody (Santa Cruz)
and completely supershifted by ERß antibody (Fig. 1C;
arrows denote the supershifted product).
To extend these analyses, we also examined the functional binding
activity of ER and ERß proteins in PO granulosa cells and
luteinized (PO/hCG) granulosa cells. WCE of PO granulosa cells cultured
for 6 days (0 h) exhibit four protein/DNA binding complexes in the
presence of the ERE consensus probe. Complex I is low in PO cells (0 h)
but is selectively increased in cells cultured for 48 h with
forskolin (48 h), as reflected in the intensity of the upper band and
the supershifted band in each sample. Complex I was supershifted by
inclusion of the ERß antibody (Fig. 1D; arrow) but not
ER antibody. Thus, ERß was present in the PO granulosa cells at
0 h and accounted for the increased binding activity seen in
response to forskolin in the 48 h samples (PO, 48 h). In
contrast, WCE prepared from luteinized (PO/hCG) granulosa cells
exhibited less binding in complexes I–IV, and no supershifted band was
observed in the presence of ERß or ER antibodies, indicating that
the binding activity, expression or levels of these proteins was lower
in these luteinized cells (Fig. 1D). Collectively, the results in Fig. 1 indicate that functional (DNA binding) ERß protein is present at
higher levels than ER in granulosa cells and is hormonally regulated
during differentiation.
Content of ER subtypes in granulosa cells: regulation by
hormones
To determine if the functional binding activities were related to
the levels of ER protein in granulosa cells at specific time during
differentiation, Western blots were analyzed using specific antibodies
to ERß and ER. Because ER appeared to be expressed at extremely
low levels in granulosa cells, we first characterized two ER
antibodies (Santa Cruz and Geneka) using WCE from
noncultured granulosa cells and NE from granulosa cells of HEF rats
(Fig. 2). The Santa Cruz
ER antibody recognized a single immunoreactive band (
61 kDa) that
was enriched in NE compared with WCE (Fig. 2A). The Geneka ER
antibody recognized the same protein band but with greater avidity
(Fig. 2B). The exposure time needed to obtain an intense signal for the
Geneka antibody was less than 5 min compared with 1-h exposure used to
visualize ER with that of Santa Cruz. Therefore, the
Geneka antibody was used in the subsequent Western blot analyses. As
shown in Fig. 2C, ER present uterine (U) tissue from E-primed
immature rats (lane 1), corpora lutea (CL) of pregnant rats on day 15
of gestation (lane 2) and in granulosa cells (GC) (lane 3) exhibited
the same molecular mass (61 kDa). Recombinant human ER
(Panvera, Madison, WI) migrated as a 67-kDa protein (lane 4). When the
Geneka ER antibody was preabsorbed with recombinant ER (100-fold
excess), immunodetection of ER in the tissue samples was completely
blocked, and the signal for recombinant ER was reduced by 80% (Fig. 2D). No other immunopositive bands were observed in these samples.
|
58/52 to 46/44 kDa) were present in E-primed
granulosa cells before culture (Fig. 3;
control, C). These same ERß protein bands were observed in E-primed
granulosa cells cultured overnight (0 h) in medium alone and for
24 h with FSH/T. However, the upper ERß band (58/52 kDa)
decreased at 48 h and was negligible at 72 h (Fig. 3), a
pattern similar that observed for the protein/DNA complex I in the
EMSAs. In these same samples, immunoreactive ER was present, but the
levels did not change with hormone treatment.
|
, four
immunopositive ERß bands were present in granulosa cells cultured
overnight (0 h) in serum-free medium with the upper bands (58/52
kDa) being the most intense. These bands remained high in granulosa
cells cultured with either forskolin or E for 1.5 and 24 h but
declined in response to each agonist after 48 h. The decrease in
the 58/52-kDa proteins was associated with increased amounts of smaller
immunoreactive ERß (46/44 kDa), indicating that the lower bands might
represent proteolytic fragments of ERß. Alternatively, each band may
represent protein products translated from ERß variant transcripts
that are expressed in granulosa cells (21; see below). Neither
forskolin nor E altered the levels of immunoreactive ER (Fig. 4A).
Similar results were observed when granulosa cells from unprimed rats
were cultured in the presence of forskolin or E: immunoreactive ERß
but not ER decreased after 48 h of culture with either agonist
(Fig. 4B). In these cells, the lower bands also appeared to decrease at
48 h. When samples from the PO granulosa cells and PO/hCG
luteinized cells were analyzed by Western blots, immunoreactive ER
was observed in PO as well as PO/hCG samples. In contrast, ERß was
present but low in PO granulosa cells and undetectable in the
luteinized granulosa cells (data not shown).
|
) as well as the Upstate BiotechnologyERß antibody (not shown). After 48 h of
culture with FSH/T, the intensity of nuclear staining had decreased and
by 72 h the immunoreactive signal appeared to predominantly
cytoplasmic (Fig. 5). When E-primed granulosa cells were cultured with
forskolin alone, immunoreactive ERß was detected in nuclei at 0
h and 1.5 h after treatment but the intensity of ERß staining
increased dramatically at 24–48 h (Fig. 6A). ERß was also present in nuclei of
unprimed granulosa cells at 0 h and forskolin increased the
intensity of staining at 48 h (Fig. 6B). In contrast, when cells
were cultured with E alone, the intensity of nuclear ERß exhibited a
biphasic pattern: ERß staining increased rapidly at 1.5 h to
24 h but this effect was transient. By 48 h, ERß
immunostaining was markedly reduced and in some cells was cytoplasmic
(Fig. 6A).
|
|
in
response to hormones (Fig. 7) was quite
similar to that of ERß. Low levels of immunoreactive ER were
detected (with either the Santa Cruz or Geneka antibodies)
in nuclei of E-primed granulosa cells cultured with forskolin for 0,
1.5, and 24 h. However, the intensity of nuclear staining
increased markedly at 48 h (Fig. 7A). A similar increase in
nuclear staining of ER was observed when granulosa cells from
unprimed immature rats were cultured with forskolin alone (Fig. 7B). In
cells cultured in the presence of E alone, ER staining remained
relatively constant at 1.5 and 24 h but was negligible at 48 h
(Fig. 7A). When these cells were immunostained for c-Jun and
c-fos, both AP1 transcription factors were nuclear. The
intense immunostaining of c-fos did not change in response
to forskolin or E whereas c-Jun was selectively increased by
E (data not shown).
|
). In the PO granulosa cells, ERß was
present and localized to the nucleus. The intensity of immunoreactive
ERß increased in response to forskolin at 48 h, a pattern
similar to that observed for the binding activity in EMSA (Figs. 1D and 8). In contrast, immunostaining
for ERß protein was extremely low in the luteinized (PO/hCG)
granulosa cells, where it was localized primarily cytoplasmic. In
contrast, ER was present in nuclei of PO granulosa cells and
luteinized PO/hCG cells (data not shown).
|
proteins are present in cultured granulosa cells and that the
intensity of nuclear immunostaining is selectively increased or
decreased in an agonist-dependent and differentiation-related
manner.
Expression of ER subtype transcripts in granulosa cells
To determine if the cellular content of ERß and ER protein in
granulosa cells was related to expression of their specific transcripts
in these cells, ERß and ER mRNAs were analyzed by RT-PCR using
primer pairs that specifically amplified ERß (42) and its variants
(21) or ER transcripts (42). To characterize the types of ERß
transcripts, we first used RNA from granulosa cells before culture (0
h) and after 48 h in the presence of FSH/T to amplify the
entire ERß coding region. The amplified product was 1.6 kb in size as
expected based on previous studies (21). The 1.6-kb full-length product
was digested with SacI to characterize the relative
expression of ERß variant transcripts (Fig. 9; 21). Using
nondenaturing polyacryalmide gel electrophoresis (PAGE), five
SacI fragments were obtained that correspond to the four
known ERß variants (ERß1-wild-type: fragments 851,605,185 bp;
ERß2–54 bp substitution: fragments 851,659,185 bp;
ERß1-
3–117bp deletion: fragments 734,605,185 bp; ERß2–54 bp
substitution-3–117 bp deletion: fragments 734,659,185 bp) as
described previously (Fig. 9; 21). Similar ratios of the four variants
were observed when RNA from PO and luteinized granulosa cells was used
in the RT-PCR reactions and restriction enzyme digests. When
quantitated by the phosphoimager analysis, the ratio of fragments
specific for ERß1 (605) and ERß2 (659) was 1:1 not only in the
whole ovary (as assessed by both RT-PCR and RNase protection assays;
21) but also in granulosa cells at different stages of differentiation
(Fig. 9).
|
; control; C). ERß transcripts
decreased 55% after culture overnight (C vs. 0 h;
P < 0.5) in the absence of hormone and then remained
constant in cells cultured in the presence of FSH/T for 24–48 h. By
72 h, ERß mRNA had declined to a level 35% of that before
culture (C vs. 72 h; P < 0.05).
Similarly, ER mRNA dropped transiently with overnight culture in the
absence of hormone but then increased and remained constant at 24–72 h
in the presence of hormone (Fig. 10B). In these same reactions, mRNA
encoding the ribosomal protein L19 remained essentially unchanged (Fig. 10C). These results indicate that ERß transcripts (principally, ERß
1 and ERß 2) and their splice variants, as well as ER transcripts,
are expressed in granulosa cells and partially maintained by FSH/T.
|
) and from E-primed immature rats
(Fig. 11B) and transiently transfected with an ERE consensus
promoter-luciferase reporter construct (22). The ability of E to
activate ER and increase transcription from this consensus binding site
was compared with the ability of forskolin (i.e. cAMP and
A-kinase) to activate the same construct (22). When unprimed granulosa
cells were transfected, basal activity of the luciferase reporter gene
was low (Fig. 11A). Luciferase activity was increased 5-fold with
forskolin (10 µM), 2-fold with E (10 nM), and
1.5-fold with diethylstilbestrol (DES; 10 nM), a potent,
nonsteroidal activator of ER. Higher concentrations of E (100–1000
nM) did not increase the response (data not shown). In
contrast, when granulosa cells were transfected after 48 h of
culture with FSH/T, basal luciferase activity was increased 2-fold
above that observed in cells at 0 h. In these hormonally
stimulated cells that express aromatase and convert T to E, forskolin
stimulated luciferase activity 2-fold, whereas E and DES had little or
no effect (Fig. 11A).
|
), several differences in basal and agonist stimulated
activity were observed. First, basal luciferase activity in the
E-primed granulosa cells at 0 h was 4-fold higher than that
observed in the unprimed cells at 0 h (Fig. 11A). Second,
luciferase activity was increased 5-fold by forskolin, 3-fold by E, and
5-fold by forskolin in the E-primed granulosa cells at 0 h.
However, when the E-primed granulosa cells were cultured with FSH/T for
48 h and then transfected, basal luciferase activity remained
similar to that observed at 0 h, but the responses to both
forskolin and E were blunted. In cells transfected at 48 h
(i.e. those expressing aromatase and producing E), forskolin
stimulated only a 3-fold increase, whereas E alone or E and forskolin
had no effect or even reduced basal activity (Fig. 11B), confirming
previous results (22).
To determine if transactivation of the ERE-E1b-luciferase construct by
E or forskolin was specifically mediated by ER, the ER antagonist, ICI
164,384 was tested in E-primed cells cultured overnight in medium alone
(0 h; Fig. 11C). As above, basal activity of luciferase was increased
4- to 5-fold with forskolin as seen in previous experiments. When ICI
was added to the cells, basal activity decreased 50% and the
forskolin-induced activity was decreased by 75%. The 1.5-fold increase
induced by DES (D) was also blocked by ICI. As in previous studies
(24), no effect of ICI was observed in the differentiated granulosa
cells cultured with FSH/T for 48 h. Collectively, these results
indicate that forskolin and E transactivate the ERE promoter-reporter
construct by ligand-independent and ligand-dependent activation of ER
and that these activities are dependent on the stage of granulosa cell
differentiation.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
protein in
granulosa cells. These results confirm our previous observations using
WCE of granulosa cells isolated from preantral and preovulatory (PO)
follicles of hormonally primed hypophysectomized rats (22). In
granulosa cells at these stages of differentiation, ERß was readily
detected by EMSA and supershift analyses; ER was negligible.
Although one might argue that the DNA binding activity of ER in
granulosa cells requires specific modifications or alterations, this
alternative seems unlikely. ER protein was detected by EMSA in NE of
HEF granulosa cells (data herein; 22) as well as in WCE of luteal cells
(22) using the same antibody as in the current studies. Thus, the lack
of ER binding in WCE of cultured granulosa cells appears to reflect
a lower amount of ER protein compared with ERß rather than a
defect in the functional DNA binding activity of ER protein being
expressed in ovarian cells. That ERß protein is more highly expressed
in immature granulosa cells before luteinization is also consistent
with in situ hybridization analyses, where ERß mRNA is
selectively localized to granulosa cells of small growing follicles and
is low in luteal and interstitial cells of rat ovaries (16, 17, 18). Thus,
the DNA binding assay combined with supershift analyses appears to be a
valid approach for determining the relative amounts of potentially
active ERß and ER proteins in ovarian cells.
Changes in the binding activity of ERß were associated with changes
in the amount of immunoreactive ERß protein as detected by Western
blots. Specifically, we show that ERß protein (immunoreactive bands
58/52 kDa; bands I/II) was high in untreated granulosa cells, decreased
in culture in response to either FSH/T, forskolin or E, and was
negligible in luteinized (PO/hCG) granulosa cells. The decrease in
ERß (bands I/II) was temporally associated with a corresponding
decrease in ERß binding activity in EMSA, indicating that
immunoreactive bands I/II represent functional ERß (i.e.
ERß1/ERß2). Because the decrease in ERß at 48–72 h of culture
with FSH/T, was temporally associated with the progressive increase in
other, smaller immunoreactive ERß bands (III/IV), it appears that
ERß may become susceptible to degradation as a consequence of the
actions of forskolin or the presence of E. Therefore, phosphorylation
and ligand binding (possibly increasing receptor phosphorylation)
regulate not only ERß function but also its stability. Alternatively,
immunoreactive ERß bands III and IV may represent translated products
of the ERß1-3 and ERß2-3 splice variants (46/44 kDa), which
continue to be expressed and are not degraded as a consequence of
forskolin and E. These variants do not bind DNA and by themselves do
not activate transcription (21). Therefore, if they dimerize with
ERß1, ERß2, ER (?) or other factors, they may act as either
repressors (21) rather than activators of transcription (47). Specific
antibodies to each ERß splice variant will be needed before the
identity of the smaller immunoreactive bands as splice variants,
degradation products, or antigenically related proteins is
resolved.
In contrast, ER protein was expressed at low levels in
granulosa cells, and its content was not regulated during culture by
FSH/T, forskolin or E. The immunoreactive ER protein detected in
granulosa cells by Western blotting was approximately 61 kDa based on
data from two different antibodies, one of which (Santa Cruz) caused a supershift of complex I in the EMSA and both
(Santa Cruz and Geneka) of which showed similar patterns
of nuclear immunostaining. In other tissues including rat uterus (48, 49), a 67-kDa immunoreactive ER band has been observed. In the rat
corpus luteum, both a 67-kDa and a 61-kDa immunoreactive ER proteins
have been detected (18). Because different antibodies and different
molecular mass markers have been used in each study, we compared the
migration of immunoreactive ER in rat uterus and corpus luteum with
that of ER in rat granulosa cell samples (as well as recombinant
human ER) in the same gel. As shown herein, ER is a 61-kDa
protein in rat granulosa cells, corpora lutea, and uterine tissue,
whereas recombinant human ER is approximately 67 kDa. Thus, we do
not believe that granulosa cell ER represents a specific ER
splice variant, some of which have been detected in rat (50) and human
tissues (47 and references therein). Based on our previous studies, the
61-kDa protein is not the product of the ER splice variant lacking
exon 4 (50, 51). Furthermore, because the granulosa cells, corpora
lutea, and uterine tissue extracts were prepared rapidly in SDS
containing buffer, it is highly unlikely to represent a degraded form
of a 67-kDa ER protein. Although we cannot rule out that the 61-kDa
ER represents yet another ER subtype highly homologous to a 67-kDa
ER, the discrepancies in the reported sizes of rat ER appear to
be related more to the technical problem of accurately determining
molecular weights based on the diversity of markers used to evaluate
protein sizes in SDS-PAGE.
That immunoreactive ERß and ER proteins are present in granulosa
cells was further confirmed by indirect immunofluorescent analyses
using the same antibodies. Immunoreactive ERß was present and
localized to nuclei of untreated immature granulosa cells and PO
granulosa cells. Curiously, the effects of forskolin on nuclear ERß
immunoreactivity differed markedly from the effects of E. Whereas the
intensity of ERß immunostaining in granulosa cell nuclei increased
markedly in response to forskolin by 24 h and 48 h, the
response to E was more rapid and biphasic. Nuclear ERß staining
increased as early as 1.5 h and 24 h after exposure to E but
then decreased markedly at 48 h. Cells cultured with FSH/T
exhibited an intermediate level of staining at 48 h, reflecting
the combined effects of cAMP and E. Interestingly, changes in the
nuclear staining of ER showed a similar pattern to that of ERß,
indicating that each ER subtype shares certain structural features that
are altered as a consequence of ligand-independent and ligand-dependent
mechanisms. Conformational changes in receptor structure, selective
interactions with other proteins, and limited proteolysis can
each be controlled by phosphorylation and ligand binding. Because
immunofluorescent analyses involve fixation and cross-linking of
endogenous proteins, changes in conformation can either expose or mask
specific antigenic sites in proteins. Thus, it is likely that
conformational changes, combined with altered binding of ER to other
proteins, are exposing or masking specific antigenic sites within the
ERß and ER in response to forskolin and E. Furthermore, because
ERß became localized to a cytoplasmic region within luteinized
granulosa cells, nuclear export of ERß may be selectively regulated
as the cells differentiate. The molecular consequences related to the
dynamic changes in immunostaining of nuclear ERß and ER and how
they alter the functional activities of these proteins as granulosa
cells differentiate remain to be determined but likely involves their
activation state and transcription of specific genes, such as
c-Jun.
In this regard, the transient transfection assays revealed for the
first time that E alone can transactivate the ERE-E1b-luciferase
promoter-reporter construct in granulosa cells and that the E-mediated
effect is dependent on the stage of granulosa cell differentiation. We
show herein that E alone can increase transgene activity in
undifferentiated or E-primed granulosa cells cultured overnight in
defined medium (0 h). This response is abolished by ICI indicating that
it is stimulated by an ER receptor-mediated event (27). Data (not
shown) also indicate that E alone induces expression of the endogenous
gene encoding the transcription factor, c-Jun. Thus, ER
subtypes present in granulosa cells are functionally active and can
exert expected transcriptional responses to E. A more vigorous response
of the consensus ERE transgene to E in granulosa cells may not occur
for several reasons. First, ERß1 is more active in response to E than
ERß2 (which contains a 54-bp insertion within the ligand binding
domain) (20). Because ERß1 and ERß2 transcripts are expressed in
equal amounts in granulosa cells (data herein), as well as other
tissues (21) and if one assumes that similar levels of ERß1 and
ERß2 protein are being both translated (i.e. the 58/52-kDa
bands observed by Western blotting), then the overall response to E
would become an average, less than that of ERß1 alone. The functional
activity of ERß1 and ERß2 may also be reduced by the presence of
nonDNA binding splice variants. Alternatively, ER proteins or their
coactivators and coregulators may need to be phosphorylated to be fully
active (28, 29, 30, 31, 32) as indicated by the ability of forskolin to
transactivate and ICI to inhibit the ERE-E1b-luciferase
promoter-reporter construct. Because the effects of E and forskolin
were not additive, the activation of ER by E and presumably by
phosphorylation may be mediated by a similar mechanism; likely
involving the AF-2, ligand binding domain of the receptor and factors
known to interact with this receptor activation domain (28, 29, 32, and
references therein). Curiously, forskolin alone did not induce the
expression of endogenous c-Jun. This observation suggests
that E can transactivate or regulate some ER target genes independent
of cAMP mediated phosphorylation events. Indeed, ERß and ER have
been shown to interact with numerous other transcription factors,
including AP1 factors, Sp1, as well as cyclin D1 (38, 52, 53) and to be
phosphorylated by kinase cascades in addition to A-kinase (32).
Lastly, the results of these studies further document confirm our
previous observations that the response of granulosa cells to exogenous
E as well as to forskolin is altered as the cells differentiate in
response to FSH/T. Specifically, E failed to increase activity of the
ERE-E1b-luciferase construct in FSH/T differentiated granulosa cells.
The altered response to E appears to be associated, in part, with
decreased intracellular levels of functionally active (DNA binding)
ERß (shown herein), changes in nuclear immunoreactivity (shown above)
that is suggestive of altered protein structure (and function?), as
well as to changes in the response of granulosa cells to cAMP (54). In
the differentiated cells, the high basal activity of the reporter gene
may indicate that ER is maximally active. This is supported indirectly
by the enhanced immunofluorescent staining of ERß (and ER) in
granulosa cell nuclei. Differentiation may also alter the set of
coactivators and corepressors, which modify the actions of ER in
granulosa cells. Little is yet known about the specific coactivators
and corepressors that are present in granulosa cells and impact ERß
or ER transactivation. When luteinized granulosa cells were
analyzed, the subcellular localization of ERß was dramatically
altered. In these cells, ERß was localized to a perinuclear region of
the cells, whereas ER remained nuclear. This switch, combined with
the shift in ratios of ERß to ER as granulosa cells luteinize,
indicates that the role of estrogens in granulosa cells is becoming
more complex. Resolution of how the response of granulosa cells to E
changes during differentiation and whether ERß variants and/or ER
variants exert distinct or overlapping functions in granulosa and
luteal cells awaits targeted disruption of both genes in a viable mouse
model, combined with in vitro approaches such as those
described herein. The latter approaches will be needed to analyze what
regulates the cellular levels of functionally active ERß (and ER),
the subcellular trafficking of ERß, and the relative roles of the
various ERß variants in the context of low levels of ER.
In summary, the studies presented herein document that mRNAs encoding
ERß and its splice variants, as well as ER, are each expressed in
granulosa cells of immature rats before and during culture in defined
medium. These results also provide documentation that functional (DNA
binding and transcriptionally active) ER is present in cultured
granulosa cells and that its ability to bind and transactivate an ERE
promoter-reporter construct is associated with the level (type?) of
receptor protein as well as the stage of granulosa cell
differentiation. Thus, the synergistic effects of E and FSH in altering
granulosa cell function and differentiation appear to occur at several
levels, including the regulation of ERß (and ER?) function,
expression (including splice variants), activation and subcellular
localization.
|
Footnotes |
|---|
2 Current address: Department of Biological Sciences, Dusquesne
University, Pittsburgh, Pennsylvania 15282.
Received January 8, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, cytochrome P450scc and HMG
CoA reductase in developing rat ovarian follicles and corpora lutea:
correlation to thecal cell steroidogenesis. Biol Reprod 37:211–223[Abstract]
inhibin gene by cyclic adenosine
3',5'-monophosphate after transfecton into rat granulosa cells. Mol
Endocrinol 5:521–534 and ß in the rat corpus luteum of
pregnancy: regulation by prolactin and placental lactogens.
Endocrinology 139:2432–2442 (ER) and estrogen receptor-ß (ERß) messenger
ribonucleic acid in the wild-type and ER-knockout mouse.
Endocrinology 138:4613–4621 and ERß at AP1 sites. Science 277:1508–1510 and ß. Endocrinology 138:863–870This article has been cited by other articles:
 |
|
 |
|
  Y.-J. Chen, M.-T. Lee, H.-C. Yao, P.-W. Hsiao, F.-C. Ke, and J.-J. Hwang Crucial Role of Estrogen Receptor-{alpha} Interaction with Transcription Coregulators in Follicle-Stimulating Hormone and Transforming Growth Factor {beta}1 Up-Regulation of Steroidogenesis in Rat Ovarian Granulosa Cells Endocrinology, September 1, 2008; 149(9): 4658 - 4668. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Sriraman, U. Eichenlaub-Ritter, J. W. Bartsch, A. Rittger, S. M. Mulders, and J. S. Richards Regulated Expression of ADAM8 (a Disintegrin and Metalloprotease Domain 8) in the Mouse Ovary: Evidence for a Regulatory Role of Luteinizing Hormone, Progesterone Receptor, and Epidermal Growth Factor-Like Growth Factors Biol Reprod, June 1, 2008; 78(6): 1038 - 1048. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Shkolnik, S. Ben-Dor, D. Galiani, A. Hourvitz, and N. Dekel Molecular characterization and bioinformatics analysis of Ncoa7B, a novel ovulation-associated and reproduction system-specific Ncoa7 isoform Reproduction, March 1, 2008; 135(3): 321 - 333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Weck and K. E. Mayo Switching of NR5A Proteins Associated with the Inhibin {alpha}-Subunit Gene Promoter after Activation of the Gene in Granulosa Cells Mol. Endocrinol., May 1, 2006; 20(5): 1090 - 1103. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wang, L. Zhou, A. Gupta, R. R. Vethanayagam, Y. Zhang, J. D. Unadkat, and Q. Mao Regulation of BCRP/ABCG2 expression by progesterone and 17beta-estradiol in human placental BeWo cells Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E798 - E807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Sriraman, M. D. Rudd, S. M. Lohmann, S. M. Mulders, and J. S. Richards Cyclic Guanosine 5'-Monophosphate-Dependent Protein Kinase II Is Induced by Luteinizing Hormone and Progesterone Receptor-Dependent Mechanisms in Granulosa Cells and Cumulus Oocyte Complexes of Ovulating Follicles Mol. Endocrinol., February 1, 2006; 20(2): 348 - 361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins Endocrinology, August 1, 2005; 146(8): 3247 - 3262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. J. Spicer Effects of Estradiol on Bovine Thecal Cell Function In Vitro: Dependence on Insulin and Gonadotropins J Dairy Sci, July 1, 2005; 88(7): 2412 - 2421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. A. Emmen, J. F. Couse, S. A. Elmore, M. M. Yates, G. E. Kissling, and K. S. Korach In Vitro Growth and Ovulation of Follicles from Ovaries of Estrogen Receptor (ER){alpha} and ER{beta} Null Mice Indicate a Role for ER{beta} in Follicular Maturation Endocrinology, June 1, 2005; 146(6): 2817 - 2826. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Burkart, A. Mukherjee, E. Sterneck, P. F. Johnson, and K. E. Mayo Repression of the Inhibin {alpha}-Subunit Gene by the Transcription Factor CCAAT/Enhancer-Binding Protein-{beta} Endocrinology, April 1, 2005; 146(4): 1909 - 1921. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Yang, J. Wang, Y. Shen, and S. K. Roy Developmental Expression of Estrogen Receptor (ER) {alpha} and ER{beta} in the Hamster Ovary: Regulation by Follicle-Stimulating Hormone Endocrinology, December 1, 2004; 145(12): 5757 - 5766. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. H. Doyle, D. L. Russell, V. Sriraman, and J. S. Richards Coordinate Transcription of the ADAMTS-1 Gene by Luteinizing Hormone and Progesterone Receptor Mol. Endocrinol., October 1, 2004; 18(10): 2463 - 2478. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Couse, M. M. Yates, R. Sanford, A. Nyska, J. H. Nilson, and K. S. Korach Formation of Cystic Ovarian Follicles Associated with Elevated Luteinizing Hormone Requires Estrogen Receptor-{beta} Endocrinology, October 1, 2004; 145(10): 4693 - 4702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Britt, P. G. Stanton, M. Misso, E. R. Simpson, and J. K. Findlay The Effects of Estrogen on the Expression of Genes Underlying the Differentiation of Somatic Cells in the Murine Gonad Endocrinology, August 1, 2004; 145(8): 3950 - 3960. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Hirvonen-Santti, V. Sriraman, M. Anttonen, S. Savolainen, J. J. Palvimo, M. Heikinheimo, J. S. Richards, and O. A. Janne Small Nuclear RING Finger Protein Expression during Gonad Development: Regulation by Gonadotropins and Estrogen in the Postnatal Ovary Endocrinology, May 1, 2004; 145(5): 2433 - 2444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Sriraman and J. S. Richards Cathepsin L Gene Expression and Promoter Activation in Rodent Granulosa Cells Endocrinology, February 1, 2004; 145(2): 582 - 591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Couse, M. M. Yates, V. R. Walker, and K. S. Korach Characterization of the Hypothalamic-Pituitary-Gonadal Axis in Estrogen Receptor (ER) Null Mice Reveals Hypergonadism and Endocrine Sex Reversal in Females Lacking ER{alpha} But Not ER{beta} Mol. Endocrinol., June 1, 2003; 17(6): 1039 - 1053. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Sriraman, S. C. Sharma, and J. S. Richards Transactivation of the Progesterone Receptor Gene in Granulosa Cells: Evidence that Sp1/Sp3 Binding Sites in the Proximal Promoter Play a Key Role in Luteinizing Hormone Inducibility Mol. Endocrinol., March 1, 2003; 17(3): 436 - 449. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Yang, A. Kriatchko, and S. K. Roy Expression of ER-{alpha} and ER-{beta} in the Hamster Ovary: Differential Regulation by Gonadotropins and Ovarian Steroid Hormones Endocrinology, June 1, 2002; 143(6): 2385 - 2398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Richards, S. C. Sharma, A. E. Falender, and Y. H. Lo Expression of FKHR, FKHRL1, and AFX Genes in the Rodent Ovary: Evidence for Regulation by IGF-I, Estrogen, and the Gonadotropins Mol. Endocrinol., March 1, 2002; 16(3): 580 - 599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Frasor, K. Park, M. Byers, C. Telleria, T. Kitamura, L.-y. Yu-Lee, J. Djiane, O.-K. Park-Sarge, and G. Gibori Differential Roles for Signal Transducers and Activators of Transcription 5a and 5b in PRL Stimulation of ER{alpha} and ER{beta} Transcription Mol. Endocrinol., December 1, 2001; 15(12): 2172 - 2181. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. T. Jansen, C. West, M. N. Lehman, and V. Padmanabhan Ovarian Estrogen Receptor-{beta} (ER{beta}) Regulation: I. Changes in ER{beta} Messenger RNA Expression Prior to Ovulation in the Ewe Biol Reprod, September 1, 2001; 65(3): 866 - 872. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Cardenas, K.A. Burke, R.M. Bigsby, W.F. Pope, and K.P. Nephew Estrogen Receptor {beta} in the Sheep Ovary During the Estrous Cycle and Early Pregnancy Biol Reprod, July 1, 2001; 65(1): 128 - 134. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. F. Palter, A. B. Tavares, A. Hourvitz, J. D. Veldhuis, and E. Y. Adashi Are Estrogens of Import to Primate/Human Ovarian Folliculogenesis? Endocr. Rev., June 1, 2001; 22(3): 389 - 424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Richards Perspective: The Ovarian Follicle--A Perspective in 2001 Endocrinology, June 1, 2001; 142(6): 2184 - 2193. [Full Text] [PDF]
|
|
|
|
 |
|
 H. Nejaty, M. Lacey, and S. A. Whitehead Differing Effects of Endocrine-Disrupting Chemicals on Basal and FSH-Stimulated Progesterone Production in Rat Granulosa-Luteal Cells Experimental Biology and Medicine, June 1, 2001; 226(6): 570 - 576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. H. Price Jr., C. A. Butler, P. Webb, R. Uht, P. Kushner, and R. J. Handa A Splice Variant of Estrogen Receptor {beta} Missing Exon 3 Displays Altered Subnuclear Localization and Capacity for Transcriptional Activation Endocrinology, May 1, 2001; 142(5): 2039 - 2049. [Abstract] [Full Text]
|
|
|
|
|
|
J. S. Richards New Signaling Pathways for Hormones and Cyclic Adenosine 3',5'-Monophosphate Action in Endocrine Cells Mol. Endocrinol., February 1, 2001; 15(2): 209 - 218. [Abstract] [Full Text]
|
|
|
|
 |
|
 K. Hosokawa, U. Ottander, P. Wahlberg, T. Ny, S. Cajander, and I.J. Olofsson Dominant expression and distribution of oestrogen receptor {beta} over oestrogen receptor {{alpha}} in the human corpus luteum Mol. Hum. Reprod., February 1, 2001; 7(2): 137 - 145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Duffy, C. L. Chaffin, and R. L. Stouffer Expression of Estrogen Receptor {alpha} and {beta} in the Rhesus Monkey Corpus Luteum during the Menstrual Cycle: Regulation by Luteinizing Hormone and Progesterone Endocrinology, May 1, 2000; 141(5): 1711 - 1717. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Chu, P. Mamers, H. G. Burger, and P. J. Fuller Estrogen Receptor Isoform Gene Expression in Ovarian Stromal and Epithelial Tumors J. Clin. Endocrinol. Metab., March 1, 2000; 85(3): 1200 - 1205. [Abstract] [Full Text]
|
|
|
|
|
|
C. S. Rosenfeld, A. A. Murray, G. Simmer, M. G. Hufford, M. F. Smith, N. Spears, and D. B. Lubahn Gonadotropin Induction of Ovulation and Corpus Luteum Formation in Young Estrogen Receptor-{alpha} Knockout Mice Biol Reprod, March 1, 2000; 62(3): 599 - 605. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. F. Couse, S. C. Hewitt, D. O. Bunch, M. Sar, V. R. Walker, B. J. Davis, and K. S. Korach Postnatal Sex Reversal of the Ovaries in Mice Lacking Estrogen Receptors and Science, December 17, 1999; 286(5448): 2328 - 2331. [Abstract] [Full Text]
|
|
|
|
 |
|
 S. C. Sharma and J. S. Richards Regulation of AP1 (Jun/Fos) Factor Expression and Activation in Ovarian Granulosa Cells. RELATION OF JunD AND Fra2 TO TERMINAL DIFFERENTIATION J. Biol. Chem., October 20, 2000; 275(43): 33718 - 33728. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
