| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Stimulates Thyrotropin-Independent Proliferation in Rat Thyroid Cells1
Center for Experimental Therapeutics (N.F., M.J.C., M.G.K.), University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6160; Department of Pharmacology (G.V.P., J.L.M., M.G.K.), University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6084
Address all correspondence and requests for reprints to: Marcelo G. Kazanietz, Center for Experimental Therapeutics, University of Pennsylvania School of Medicine, Biomedical Research Building II/III, Philadelphia, Pennsylvania 19104-6160. E-mail: marcelo{at}spirit.gcrc.upenn.edu or Judy L. Meinkoth, Department of
| Abstract |
|---|
|
|
|---|
, a phorbol ester-unresponsive
isozyme, in cell proliferation, death, and survival. We overexpressed
PKC
in Wistar rat thyroid (WRT) cells and determined that PKC
conferred TSH-independent DNA synthesis and cell proliferation. Cells
overexpressing PKC
show higher levels of phosphorylated p42/p44 MAPK
compared with vector-transfected cells. Experiments using a luciferase
reporter for Elk-1 revealed that PKC
overexpressing cells exhibit
higher basal Elk-1 transcriptional activity than vector-transfected
control cells. Interestingly, stimulation of Elk-1 transcriptional
activity by MEK1, a p42/p44 MAPK kinase, was significantly enhanced in
cells overexpressing PKC
. Strikingly, TSH retained the ability
to stimulate Tg expression in cells expressing PKC
. These results
suggest that PKC
stimulates TSH-independent mitogenesis through a
p42/p44 MAPK-dependent pathway. Unlike overexpression of Ras or phorbol
ester treatment, PKC
overexpression does not impair thyroglobulin
(Tg) expression. | Introduction |
|---|
|
|
|---|
Protein kinase C (PKC) has been linked to stimulatory effects on
proliferation and inhibitory effects on differentiation in thyroid
cells (8, 9, 10, 11). PKC comprises at least 10 structurally related
phospholipid-dependent protein kinases (12). PKC isozymes have been
grouped into three subclasses: the "conventional" or
"classical" PKCs (PKCs
, ßI, ßII, and
), which can be
activated by Ca2+ and diacylglycerol/phorbol
esters; the "novel" PKCs (PKCs
,
,
, and
), which can
be activated by diacylglycerol and phorbol esters but are
Ca2+-independent; and the "atypical" PKCs
(PKCs
and
/
). This last group of PKC isozymes is unresponsive
to Ca2+ and diacylglycerol/phorbol esters. The
existence of such a large family of PKC isozymes that exhibit different
tissue distribution, subcellular localizations, and biochemical
properties suggests that individual PKC isozymes may play specialized
roles in cellular functions. PKC isozymes have been implicated in a
wide array of cellular functions, including cell proliferation,
differentiation, and death. In many cases, PKC isozymes exhibit
distinct and even opposing cellular effects (13). Reports from several
investigators have established that PKCs are important regulators of
growth factor-mediated mitogenesis (14, 15, 16).
The effects of individual PKC isozymes on thyroid cell biology have not
been thoroughly examined. Treatment of thyrocytes with phorbol esters,
the activators of classical and novel PKCs, stimulates proliferation
and inhibits thyroid differentiation (reviewed in Ref. 7). The role of
atypical PKC isozymes in thyroid cells remains to be established. In
this study we focus on the atypical PKC
, a phorbol
ester-unresponsive isozyme, and its potential role in the control of
thyroid cell proliferation and differentiation. Our results show that
overexpression of PKC
in WRT cells promotes TSH-independent
proliferation through activation of the p42/p44 MAPK cascade.
Strikingly, unlike Ras and phorbol esters, PKC
expression enhanced
proliferation without impairing Tg expression.
| Materials and Methods |
|---|
|
|
|---|
-32]ATP (3,000 Ci/mmol) were purchased from
Amersham Pharmacia Biotech (Arlington Heights, IL). All
other chemicals were of high quality.
Construction of a PKC
expression vector
The full-length cDNA for mouse PKC
(17) was subcloned into
the expression vector pCR3
2, a modified version of pCR3
(Invitrogen, San Diego, CA) generated in our laboratory.
pCR3
2 contains an 82-bp cassette with SalI and
MluI restriction sites, an
epitope tag (KGFSYFGEDLMP),
and a stop codon (18). The
tag proved to work well both for
immunodetection and immunoprecipitation with a commercial anti-PKC
antibody (Life Technologies, Inc., Gaithersburg, MD), as
previously described (18), and does not interfere with the enzymatic
activity of PKC isozymes (19). A 1.7-kb SalI-MluI
fragment comprising full-length PKC
was isolated from the plasmid
pVL1393-PKC
(17) by PCR using the following oligonucleotides:
CGCGTCGACAGAATTCATATGCCCAGCAGGACGGACCCCAAGATG
(SalI site underlined) and
CGACGCGTCAGAATTCCCACGGACTCCTCAGCAGACAGCAGA-AG
(MluI site underlined). The PCR product was
sequenced, and the sequence fully corresponded to that of the original
sequence. The SalI-MluI insert was ligated into
pCR3
2 to generate pCR3
- PKC
.
Cell culture
WRT cells, which are TSH-dependent for growth, were propagated
in 3H medium (Coons modified Hams F12 medium supplemented with
crude bovine 1 mU/ml TSH, 10 µg/ml insulin, 5 µg/ml transferrin,
5% calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin), as
described previously (6). Cells were grown at 37 C in a humidified 5%
CO2 atmosphere. Early passage cells were
transfected with either pCR3
-PKC
or pCR3
2 (empty vector) using
Lipofectamine (Life Technologies, Inc.). Following
selection in 3H containing G418 (300 µg/ml), transfected cells were
propagated in 3H medium containing G418 (150 µg/ml). 2H medium, used
in some studies, is the same as 3H but lacks TSH.
Evaluation of cell proliferation and DNA synthesis
For evaluation of TSH-independent cell growth, 2 x
105 cells were seeded in replicate 60-mm dishes
in growth medium devoid of TSH (2H). After 14 h to allow
attachment, duplicate dishes were counted to monitor plating
efficiency. Replicate plates were harvested and counted every other
day. Briefly, cells were washed twice with PBS, harvested by
trypsinization (0.25% trypsin, 1 mM EDTA in HBSS) and
counted in a hemocytometer. To monitor DNA synthesis, 3 x
105 cells were plated in 60-mm dishes and
incubated for 14 h in 3H medium. After starvation in basal medium
(Coons modified Hams F12 medium containing antibiotics) for 48
h, cells were incubated with [3H]thymidine (2
µCi/plate) in basal medium, basal medium supplemented with insulin
(0.5 µg/ml), or 2H medium for 24 h. Cells were washed twice in
PBS and 4 times in 5% trichloroacetic acid. Cells were then collected
in 1 ml 0.1 M NaOH and radioactivity counted in a
scintillation counter.
Western blot analysis
Expression of epitope-tagged PKC
was monitored using an
anti-
-tag antibody from Life Technologies, Inc. Cells
were lysed in 50 mM Tris-HCl, pH 6.8, 1% SDS, and boiled
for 5 min. Protein determinations were made using the Micro BCA Protein
Assay from Pierce Chemical Co., using BSA as a standard.
Protein lysates (8 µg/lane) were resolved in 10% SDS-polyacrylamide
gels and electrophoretically transferred to Immobilon membranes.
Membranes were blocked with 5% milk in PBS, and immunostained with the
anti-
-tag antibody (1:1,000 in PBS, 1 h at room temperature). A
goat antirabbit antiserum from Bio-Rad Laboratories, Inc.
was used as a second antibody (1:3,000 in PBS, 1 h at room
temperature). To evaluate the expression of PKC isozymes, the following
antibodies were used: anti-PKC
(1:3,000, UBI, Lake Placid, NY),
anti-PKCß (1:1,000, Transduction Laboratories,
Lexington, KY), anti-PKC
(1:1,000, Transduction Laboratories), anti-PKC
(anti-
-tag, 1:1,000, Life Technologies, Inc.), anti-PKC
(1:1,000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-PKC
(1:1,000,
Transduction Laboratories), anti-PKC
(1:3,000,
Santa Cruz Biotechnology, Inc.), anti-PKC
(1:1,000,
Transduction Laboratories), anti-PKCµ (1:1,000,
Transduction Laboratories).
For the analysis of MAPK and phospho-MAPK, membranes were blocked with 5% BSA in TBS (25 mM Tris, 150 mM NaCl, 0.1% Tween 20) and then incubated with either an anti-MAPK antibody or an anti-phospho-p42/44 MAPK (thr 202/tyr 204) antibody from New England Biolabs, Inc. (1:1,000 in 5% BSA/TBS, 14 h at 4 C). A goat antirabbit antibody (Bio-Rad Laboratories, Inc.) was used as a second antibody (1:3,000 in 5% BSA/TBS, 1 h at room temperature).
In all cases, bands were visualized by enhanced chemiluminescence (ECL) Western blotting detection system (Amersham Pharmacia Biotech, Arlington Heights, IL).
Determination of Elk-1 transcriptional activity
Transcriptional activity of Elk-1, a transcription factor
activated by p42/p44 MAPK, was monitored using the PathDetect
trans-reporting system (Stratagene, La Jolla,
CA), which includes a p42/p44 MAPK-specific transactivator plasmid
GAL4-c-Elk-1 (307427), and a pFR-Luc reporter plasmid. pFR-Luc
contains the Firefly luciferase gene under the control of a
synthetic promoter with five tandem repeats of yeast GAL4. WRT cells
growing in 2H medium (50% confluence in 6-well plates) were
transfected with GAL4-Elk-1 (0.2 µg) and pFR-Luc (0.9 µg) using
Lipofectamine according to the manufacturers protocol. After 48
h, cells were washed twice with PBS and lysed in 400 µl of lysis
buffer (Promega Corp.). Lysates were centrifuged at
14,000 x g for 30 sec, and the supernatants assayed
for luciferase activity using a Dual Luciferase kit from Promega Corp. Luminescence was recorded at 560 nm using a Monolight 2010
luminometer (Analytical Luminescence Laboratory). In some
experiments, an activated form of MEK1 (pFC-MEK1,
Stratagene) was used. Cells were contransfected with the
Renilla-luciferase vector pRL-SV40 (0.1 µg, Promega Corp.), which provides constitutive luciferase expression in
transfected cells and serves as an internal control to normalize
transfection efficiency.
Tg expression
To monitor Tg expression, cells were grown to 8090%
confluence, and then starved in basal medium for 68 days to decrease
Tg expression (6). For the immunostaining analysis, cells were
stimulated with TSH (1 mU/ml) for 48 h, and fixed in methanol for
2 min at -20 C. Cells were then incubated with a Tg-specific antibody
(DAKO Corp., Carpinteria, CA, 1:400) for 1 h at 37 C,
followed by incubation with a biotinylated antirabbit secondary
antibody (1:450) and Texas red-streptavidin (1:200) for 45 min. Cells
were observed with a Carl Zeiss (Thornwood, NY)
axiophot fluorescence microscope, and photomicrographs were exposed for
the same times. For Western blotting studies, total cell lysates were
prepared and 75 µg of total cell protein were resolved on 6.75%
polyacrylamide gels, transferred to PDVF membranes, and blotted with a
polyclonal Tg antibody (1:800).
PKC assay
WRT cells in 2H (in 60-mm dishes) were lysed in 500 µl of a
buffer containing 50 mM Tris-HCl, pH 7.4, 150
mM NaCl, 1% NP-40, 5 µg/ml AEBSF, 5 µg/ml leupeptin, 1
µg/ml aprotinin, 2 mM sodium ortovanadate, and 2
mM sodium fluoride. Lysates were incubated with the
anti-PKC
(anti-
-tag) antibody (2 µg/tube) for 1 h at 4
C. Immunocomplexes were recovered with Gamma Bind
G Sepharose beads (Pharmacia & Upjohn), and washed
three times with 1 ml of lysis buffer and once with 0.2 ml of kinase
reaction buffer. Kinase reaction was performed in immunoprecipitates by
incubation with a kinase buffer (50 µl) containing 50 mM
Tris-HCl, pH 7.4, 250 µg/ml BSA, 1 mM EGTA, 7.5
mM MgAc, 25 µM ATP,
[
-32]ATP (3 µCi/tube), and 20
µM of
-peptide as substrate, as previously described
(17). Reaction was carried out at 30 C for 15 min. The beads were then
separated by centrifugation, and 25 µl of the supernatant were
spotted onto P81 phosphocellulose paper (Whatman) and
counted in a scintillation counter.
| Results |
|---|
|
|
|---|
in WRT cells
in WRT cells by transfection of an
expression vector, pCR3
-PKC
and selection in G418. To avoid
potential variations between individual clones, G418-resistant cells
were pooled 3 weeks after transfection. Western blot analysis using the
anti-
-tag (anti-PKC
) antibody revealed a 75-kDa band
corresponding to the
-tagged PKC
, which was present in
pCR3
-PKC
-transfected WRT cells but not in cells transfected with
vector alone (pCR3
2) (Fig. 1a
-tagged PKC
was confirmed in kinase assays.
Immunoprecipitations using the anti-
-tag antibody were performed in
pCR3
2- or pCR3
-PKC
-transfected cells, and kinase activity was
measured in immunoprecipitates using a specific PKC substrate. As shown
in Fig. 1b
-PKC
-transfected cells. Overexpression
of PKC
did not alter the expression of other PKC isozymes, namely
PKC
, PKC
, PKC
, and PKCµ (Fig. 1
was
expressed at very low levels in WRT cells. PKCß PKC
, PKC
, and
PKC
were not detected in WRT cells using isozyme-specific anti-PKC
antibodies (data not shown).
|
in the absence of TSH. Equal numbers of
pCR3
-PKC
or vector-transfected cells were plated in growth medium
devoid of TSH (2H) and counted every 2 days. Cells overexpressing
PKC
proliferate more rapidly than vector-transfected cells, which
proliferate only very slowly in the absence of TSH (Fig. 2A
overexpressing cells also show a higher rate of
proliferation (data not shown). The mitogenic activity of PKC
was
confirmed in experiments where DNA synthesis was measured. After
starvation in growth factor-deficient basal medium for 48 h, cells
were incubated with [3H]thymidine for 24 h
in either basal medium, insulin-supplemented basal medium or 2H medium.
These conditions were used to determine whether insulin, an important
co-mitogen for thyroid cells, enhanced the effects of PKC
on DNA
synthesis. As demonstrated in Fig. 2B
. The effects of PKC
on DNA synthesis were
potentiated to a modest degree by inclusion of insulin, and to a
greater extent by inclusion of insulin, transferrin, and serum (2H).
Taken together, these observations provide evidence that PKC
stimulates mitogenesis in WRT cells. No differences in cell morphology
were observed in cells overexpressing PKC
(data not shown).
|
induces the activation of p42/p44
MAPK
involve MAPK, we assessed the levels of
phosphorylated p42/p44 MAPK using a specific antibody to phosphorylated
and activated p42/p44 MAPK. Western blot analysis revealed that cells
overexpressing PKC
exhibit higher levels of phosphorylated and
activated p42/p44 MAPK compared with those in vector-transfected cells.
No significant changes were observed in total MAPK levels (Fig. 3A
overexpressors have 2.3 ± 0.3 -fold higher levels of
phosphorylated p42/p44 MAPK (n = 5) (Fig. 3B
may involve MAPK
activation. To determine whether MAPK activation was the consequence of
autocrine effects, we incubated quiescent WRT cells with medium
collected from either PKC
- or vector-transfected cells and evaluated
MAPK phosphorylation. Medium from either cell population failed to
stimulate MAPK activity (data not shown), therefore excluding that
autocrine effects were responsible for MAPK activation.
|
-PKC
-transfected WRT cells compared with
vector-transfected cells.
It is well established that MEK1 phosphorylates p42/p44 MAPK, leading
to increased Elk-1 transcriptional activity. Indeed, transfection of a
constitutively active mutant form of MEK1 (pFC-MEK1,
Stratagene) into WRT cells growing in 2H medium
results in a 22.5 ± 4.7-fold increase in luciferase activity
(n = 3). Interestingly, as shown in Fig. 3D
, a significantly
higher activation of Elk-1 by MEK1 was observed in cells overexpressing
PKC
. These effects were specific as no luciferase activity was
observed in cells transfected with the luciferase reporter and pFC-dbd,
a plasmid which lacks the activation domain of Elk-1 (data not
shown).
PKC
does not impair Tg expression
One of the hallmarks of TSH is its ability to stimulate the
proliferation of differentiated thyroid cells. Although serum growth
factors including epidermal growth factor (EGF), phorbol esters and Ras
promote thyroid proliferation, they do so at the expense of the
differentiated phenotype. To investigate the effects of PKC
on
thyroid differentiation, Tg expression was analyzed by immunostaining
and Western blot. As shown in Fig. 4
, expression of PKC
does not affect the expression of Tg after TSH
stimulation. This effect contrasts with that produced by phorbol esters
(Fig. 4
) and Ras (see our previous results in reference 6), which
impair Tg expression in these cells. Therefore, overexpression of
PKC
to levels sufficient to confer TSH-independent proliferation is
not accompanied by decreases in the ability of TSH to stimulate Tg
expression.
|
| Discussion |
|---|
|
|
|---|
is a phorbol ester-unresponsive isozyme that
has been implicated in signaling pathways regulating mitogenesis and
survival. In many cell types, atypical PKCs are activated following
stimulation of growth factor receptors (23, 24). In contrast, other
studies have reported either no effect or antiproliferative effects in
response to PKC
overexpression (25, 26, 27), suggesting that the effects
of this atypical PKC are cell type dependent. Overexpression of PKC
enables rat thyroid cells to proliferate in a TSH-independent fashion.
WRT cells overexpressing PKC
exhibited an increased growth rate in
TSH-deficient medium (2H). In addition, DNA synthesis in
PKC
-expressing cells was markedly elevated in cells in basal medium,
in insulin-supplemented basal medium and in 2H. Inclusion of insulin or
serum (i.e. 2H) augmented DNA synthesis in PKC
-expressing
cells, and together exerted additive effects on PKC
-induced DNA
synthesis, suggesting that these cells remain largely insulin- and
serum-dependent for growth. Despite the enhanced proliferation of
PKC
-expressing cells, these cells were morphologically
indistinguishable from parental WRT cells. Remarkably, although
sufficient to confer TSH-independent proliferation, PKC
expression
had no effect on the ability of TSH to induce Tg expression. Unlike
phorbol esters, PKC
-induced proliferation is compatible with the
thyroid differentiated phenotype.
PKC
-expressing WRT cells exhibited elevated levels of
phosphorylated, active MAPK. Although the MAPK cascade has been
implicated in the regulation of cell proliferation and differentiation
in a large number of cell types (28), the role of MAPK in thyroid cell
proliferation and differentiation is less clear. In human cells, TSH
activates MAPK presumably through the ability of the TSH receptor to
couple to multiple heterotrimeric G proteins including Gq (3). In
contrast, in primary canine thyrocytes and WRT cells, TSH does not
activate MAPK (20, 21). Moreover, MAPK is not required for the ability
of TSH to stimulate Tg expression (Meinkoth, J. L., unpublished
results). Phorbol ester treatment leads to MAPK activation, and
transfection of activated forms of classical and novel (phorbol
ester-responsive) as well as atypical PKCs into COS cells also results
in the activation of p42/p44 MAPK (16). Our results support these
findings and indicate that PKC
activates MAPK in thyroid epithelial
cells. Interestingly, although all PKC isozymes activate MEK1, only the
classical and novel isoforms activate c-Raf, the serine-threonine
kinase responsible for MEK1 activation. An alternative but unidentified
route for the activation of MEK1 by PKC
has been postulated in this
latter case. This may explain our findings in WRT cells where
overexpression of PKC
not only increases basal Elk-1 activity but
also enhances MEK1 stimulated Elk1-transcriptional activity. These
results suggest that PKC
activates signaling pathways in addition to
those activated by MEK1 overexpression alone, and that these pathways
act synergistically in the regulation of Elk-1 activity.
Interplay between TSH and Ras is important in the regulation of thyroid
cell proliferation as well as differentiation where TSH, acting via
cAMP, redirects Ras-mediated signals to alternate effectors. Ras
activation of Raf-1, although sufficient to stimulate proliferation,
leads to thyroid de-differentiation (29). In contrast, expression of
activated forms of MEK1 or Rac1, individually or together, failed to
impair thyroid differentiation in FRTL-5 cells (30). These results are
similar to those reported in myoblasts where expression of a membrane
targeted form of Raf-1, but not of constitutively active MEK1, impaired
myogenic differentiation (31, 32). In contrast, Ras signaling to PI3K
(33), or activation of PKC
is sufficient to stimulate
hormone-independent thyroid cell proliferation, as well as maintaining
Tg expression, a marker of thyroid differentiation. Together, these
findings underscore the critical role of cross-talk between cellular
signaling pathways in determining the biological consequences of signal
activation.
| Footnotes |
|---|
Received June 18, 1999.
| References |
|---|
|
|
|---|
and -
in NIH 3T3 cells
induces opposite effects on growth, morphology, anchorage dependence,
and tumorigenicity. J Biol Chem 268:60906096
isoform of protein kinase C controls
interleukin-2-mediated proliferation in a murine T cell line: evidence
for an additional role of protein kinase C
and ß. Exp Cell Res 218:105113[CrossRef][Medline]
does not affect the growth
characteristics of NIH 3T3 cells. Biochem Biophys Res Commun 213:266272[CrossRef][Medline]
in NIH3T3 cells does not induce cell
transformation nor tumorigenicity and does not alter NF
B activity.
Oncogene 10:22132220[Medline]
reverts v-raf transformation of NIH-3T3 cells.
Genes Dev 10:14551466This article has been cited by other articles:
![]() |
R. Mustafi, S. Cerda, A. Chumsangsri, A. Fichera, and M. Bissonnette Protein Kinase-{zeta} Inhibits Collagen I-Dependent and Anchorage-Independent Growth and Enhances Apoptosis of Human Caco-2 Cells Mol. Cancer Res., September 1, 2006; 4(9): 683 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Santiago-Walker, A. J. Fikaris, G. D. Kao, E. J. Brown, M. G. Kazanietz, and J. L. Meinkoth Protein Kinase C {delta} Stimulates Apoptosis by Initiating G1 Phase Cell Cycle Progression and S Phase Arrest J. Biol. Chem., September 16, 2005; 280(37): 32107 - 32114. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hirai and K. Chida Protein Kinase C{zeta} (PKC{zeta}): Activation Mechanisms and Cellular Functions J. Biochem., January 1, 2003; 133(1): 1 - 7. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sanz-Navares, N. Fernandez, M. G. Kazanietz, and S. A. Rotenberg Atypical Protein Kinase C{zeta} Suppresses Migration of Mouse Melanoma Cells Cell Growth Differ., October 1, 2001; 12(10): 517 - 524. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |