help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fernandez, N.
Right arrow Articles by Kazanietz, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fernandez, N.
Right arrow Articles by Kazanietz, M. G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Endocrinology Vol. 141, No. 1 146-152
Copyright © 2000 by The Endocrine Society


ARTICLES

Atypical Protein Kinase C-{zeta} Stimulates Thyrotropin-Independent Proliferation in Rat Thyroid Cells1

Nieves Fernandez, MarÍa J. Caloca, Gregory V. Prendergast, Judy L. Meinkoth and Marcelo G. Kazanietz

Center for Experimental Therapeutics (N.F., M.J.C., M.G.K.), University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6160; Department of Pharmacology (G.V.P., J.L.M., M.G.K.), University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6084

Address all correspondence and requests for reprints to: Marcelo G. Kazanietz, Center for Experimental Therapeutics, University of Pennsylvania School of Medicine, Biomedical Research Building II/III, Philadelphia, Pennsylvania 19104-6160. E-mail: marcelo{at}spirit.gcrc.upenn.edu or Judy L. Meinkoth, Department of


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Several reports have indicated that protein kinase C (PKC) is an important regulator of proliferation in thyroid cells. Unlike TSH, the mitogenic effects of phorbol esters are accompanied by de-differentiation. The role of individual PKC isoforms in thyroid cell proliferation and differentiation has not been examined. Recent studies have implicated the atypical PKC{zeta}, a phorbol ester-unresponsive isozyme, in cell proliferation, death, and survival. We overexpressed PKC{zeta} in Wistar rat thyroid (WRT) cells and determined that PKC{zeta} conferred TSH-independent DNA synthesis and cell proliferation. Cells overexpressing PKC{zeta} show higher levels of phosphorylated p42/p44 MAPK compared with vector-transfected cells. Experiments using a luciferase reporter for Elk-1 revealed that PKC{zeta} overexpressing cells exhibit higher basal Elk-1 transcriptional activity than vector-transfected control cells. Interestingly, stimulation of Elk-1 transcriptional activity by MEK1, a p42/p44 MAPK kinase, was significantly enhanced in cells overexpressing PKC{zeta}. Strikingly, TSH retained the ability to stimulate Tg expression in cells expressing PKC{zeta}. These results suggest that PKC{zeta} stimulates TSH-independent mitogenesis through a p42/p44 MAPK-dependent pathway. Unlike overexpression of Ras or phorbol ester treatment, PKC{zeta} overexpression does not impair thyroglobulin (Tg) expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THYROID follicular cells are highly specialized epithelial cells that synthesize, store, and secrete thyroid hormones. TSH regulates differentiation of these cells by controlling the expression of a variety of thyroid-specific genes. In addition, TSH is required for the proliferation of cultured thyroid cells derived from several species (reviewed in Ref. 1). In primary canine thyrocytes, as well as in WRT and FRTL-5 cell lines, TSH is required for thyroid cell proliferation. The TSH receptor is a heptahelical receptor coupled largely, if not exclusively, to Gs in WRT cells (2), although this receptor is coupled to multiple G proteins in human (3) and canine (4) thyrocytes. cAMP elevating agents and cell permeant cAMP analogs reproduce the mitogenic activity of TSH (5) as well as its stimulatory effects on thyroglobulin (Tg) expression (6) in WRT cells. Therefore, the cAMP-mediated signaling cascade is the predominant regulator of both proliferation and differentiation in rat and canine thyroid cells (reviewed in Ref. 7).

Protein kinase C (PKC) has been linked to stimulatory effects on proliferation and inhibitory effects on differentiation in thyroid cells (8, 9, 10, 11). PKC comprises at least 10 structurally related phospholipid-dependent protein kinases (12). PKC isozymes have been grouped into three subclasses: the "conventional" or "classical" PKCs (PKCs {alpha}, ßI, ßII, and {gamma}), which can be activated by Ca2+ and diacylglycerol/phorbol esters; the "novel" PKCs (PKCs {delta}, {epsilon}, {eta}, and {theta}), which can be activated by diacylglycerol and phorbol esters but are Ca2+-independent; and the "atypical" PKCs (PKCs {zeta} and {lambda}/{iota}). This last group of PKC isozymes is unresponsive to Ca2+ and diacylglycerol/phorbol esters. The existence of such a large family of PKC isozymes that exhibit different tissue distribution, subcellular localizations, and biochemical properties suggests that individual PKC isozymes may play specialized roles in cellular functions. PKC isozymes have been implicated in a wide array of cellular functions, including cell proliferation, differentiation, and death. In many cases, PKC isozymes exhibit distinct and even opposing cellular effects (13). Reports from several investigators have established that PKCs are important regulators of growth factor-mediated mitogenesis (14, 15, 16).

The effects of individual PKC isozymes on thyroid cell biology have not been thoroughly examined. Treatment of thyrocytes with phorbol esters, the activators of classical and novel PKCs, stimulates proliferation and inhibits thyroid differentiation (reviewed in Ref. 7). The role of atypical PKC isozymes in thyroid cells remains to be established. In this study we focus on the atypical PKC{zeta}, a phorbol ester-unresponsive isozyme, and its potential role in the control of thyroid cell proliferation and differentiation. Our results show that overexpression of PKC{zeta} in WRT cells promotes TSH-independent proliferation through activation of the p42/p44 MAPK cascade. Strikingly, unlike Ras and phorbol esters, PKC{zeta} expression enhanced proliferation without impairing Tg expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Insulin, transferrin, and TSH were purchased from Sigma (St. Louis, MO). [3H]Thymidine (2 Ci/mmol) and [{gamma}-32]ATP (3,000 Ci/mmol) were purchased from Amersham Pharmacia Biotech (Arlington Heights, IL). All other chemicals were of high quality.

Construction of a PKC{zeta} expression vector
The full-length cDNA for mouse PKC{zeta} (17) was subcloned into the expression vector pCR3{epsilon}2, a modified version of pCR3 (Invitrogen, San Diego, CA) generated in our laboratory. pCR3{epsilon}2 contains an 82-bp cassette with SalI and MluI restriction sites, an {epsilon} epitope tag (KGFSYFGEDLMP), and a stop codon (18). The {epsilon} tag proved to work well both for immunodetection and immunoprecipitation with a commercial anti-PKC{epsilon} antibody (Life Technologies, Inc., Gaithersburg, MD), as previously described (18), and does not interfere with the enzymatic activity of PKC isozymes (19). A 1.7-kb SalI-MluI fragment comprising full-length PKC{zeta} was isolated from the plasmid pVL1393-PKC{zeta} (17) by PCR using the following oligonucleotides: CGCGTCGACAGAATTCATATGCCCAGCAGGACGGACCCCAAGATG (SalI site underlined) and CGACGCGTCAGAATTCCCACGGACTCCTCAGCAGACAGCAGA-AG (MluI site underlined). The PCR product was sequenced, and the sequence fully corresponded to that of the original sequence. The SalI-MluI insert was ligated into pCR3{epsilon}2 to generate pCR3{epsilon}- PKC{zeta}.

Cell culture
WRT cells, which are TSH-dependent for growth, were propagated in 3H medium (Coon’s modified Ham’s F12 medium supplemented with crude bovine 1 mU/ml TSH, 10 µg/ml insulin, 5 µg/ml transferrin, 5% calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin), as described previously (6). Cells were grown at 37 C in a humidified 5% CO2 atmosphere. Early passage cells were transfected with either pCR3{epsilon}-PKC{zeta} or pCR3{epsilon}2 (empty vector) using Lipofectamine (Life Technologies, Inc.). Following selection in 3H containing G418 (300 µg/ml), transfected cells were propagated in 3H medium containing G418 (150 µg/ml). 2H medium, used in some studies, is the same as 3H but lacks TSH.

Evaluation of cell proliferation and DNA synthesis
For evaluation of TSH-independent cell growth, 2 x 105 cells were seeded in replicate 60-mm dishes in growth medium devoid of TSH (2H). After 14 h to allow attachment, duplicate dishes were counted to monitor plating efficiency. Replicate plates were harvested and counted every other day. Briefly, cells were washed twice with PBS, harvested by trypsinization (0.25% trypsin, 1 mM EDTA in HBSS) and counted in a hemocytometer. To monitor DNA synthesis, 3 x 105 cells were plated in 60-mm dishes and incubated for 14 h in 3H medium. After starvation in basal medium (Coon’s modified Ham’s F12 medium containing antibiotics) for 48 h, cells were incubated with [3H]thymidine (2 µCi/plate) in basal medium, basal medium supplemented with insulin (0.5 µg/ml), or 2H medium for 24 h. Cells were washed twice in PBS and 4 times in 5% trichloroacetic acid. Cells were then collected in 1 ml 0.1 M NaOH and radioactivity counted in a scintillation counter.

Western blot analysis
Expression of epitope-tagged PKC{zeta} was monitored using an anti-{epsilon}-tag antibody from Life Technologies, Inc. Cells were lysed in 50 mM Tris-HCl, pH 6.8, 1% SDS, and boiled for 5 min. Protein determinations were made using the Micro BCA Protein Assay from Pierce Chemical Co., using BSA as a standard. Protein lysates (8 µg/lane) were resolved in 10% SDS-polyacrylamide gels and electrophoretically transferred to Immobilon membranes. Membranes were blocked with 5% milk in PBS, and immunostained with the anti-{epsilon}-tag antibody (1:1,000 in PBS, 1 h at room temperature). A goat antirabbit antiserum from Bio-Rad Laboratories, Inc. was used as a second antibody (1:3,000 in PBS, 1 h at room temperature). To evaluate the expression of PKC isozymes, the following antibodies were used: anti-PKC{alpha} (1:3,000, UBI, Lake Placid, NY), anti-PKCß (1:1,000, Transduction Laboratories, Lexington, KY), anti-PKC{delta} (1:1,000, Transduction Laboratories), anti-PKC{epsilon} (anti-{epsilon}-tag, 1:1,000, Life Technologies, Inc.), anti-PKC{eta} (1:1,000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-PKC{theta} (1:1,000, Transduction Laboratories), anti-PKC{zeta} (1:3,000, Santa Cruz Biotechnology, Inc.), anti-PKC{lambda} (1:1,000, Transduction Laboratories), anti-PKCµ (1:1,000, Transduction Laboratories).

For the analysis of MAPK and phospho-MAPK, membranes were blocked with 5% BSA in TBS (25 mM Tris, 150 mM NaCl, 0.1% Tween 20) and then incubated with either an anti-MAPK antibody or an anti-phospho-p42/44 MAPK (thr 202/tyr 204) antibody from New England Biolabs, Inc. (1:1,000 in 5% BSA/TBS, 14 h at 4 C). A goat antirabbit antibody (Bio-Rad Laboratories, Inc.) was used as a second antibody (1:3,000 in 5% BSA/TBS, 1 h at room temperature).

In all cases, bands were visualized by enhanced chemiluminescence (ECL) Western blotting detection system (Amersham Pharmacia Biotech, Arlington Heights, IL).

Determination of Elk-1 transcriptional activity
Transcriptional activity of Elk-1, a transcription factor activated by p42/p44 MAPK, was monitored using the PathDetect trans-reporting system (Stratagene, La Jolla, CA), which includes a p42/p44 MAPK-specific transactivator plasmid GAL4-c-Elk-1 (307–427), and a pFR-Luc reporter plasmid. pFR-Luc contains the Firefly luciferase gene under the control of a synthetic promoter with five tandem repeats of yeast GAL4. WRT cells growing in 2H medium (50% confluence in 6-well plates) were transfected with GAL4-Elk-1 (0.2 µg) and pFR-Luc (0.9 µg) using Lipofectamine according to the manufacturer’s protocol. After 48 h, cells were washed twice with PBS and lysed in 400 µl of lysis buffer (Promega Corp.). Lysates were centrifuged at 14,000 x g for 30 sec, and the supernatants assayed for luciferase activity using a Dual Luciferase kit from Promega Corp. Luminescence was recorded at 560 nm using a Monolight 2010 luminometer (Analytical Luminescence Laboratory). In some experiments, an activated form of MEK1 (pFC-MEK1, Stratagene) was used. Cells were contransfected with the Renilla-luciferase vector pRL-SV40 (0.1 µg, Promega Corp.), which provides constitutive luciferase expression in transfected cells and serves as an internal control to normalize transfection efficiency.

Tg expression
To monitor Tg expression, cells were grown to 80–90% confluence, and then starved in basal medium for 6–8 days to decrease Tg expression (6). For the immunostaining analysis, cells were stimulated with TSH (1 mU/ml) for 48 h, and fixed in methanol for 2 min at -20 C. Cells were then incubated with a Tg-specific antibody (DAKO Corp., Carpinteria, CA, 1:400) for 1 h at 37 C, followed by incubation with a biotinylated antirabbit secondary antibody (1:450) and Texas red-streptavidin (1:200) for 45 min. Cells were observed with a Carl Zeiss (Thornwood, NY) axiophot fluorescence microscope, and photomicrographs were exposed for the same times. For Western blotting studies, total cell lysates were prepared and 75 µg of total cell protein were resolved on 6.75% polyacrylamide gels, transferred to PDVF membranes, and blotted with a polyclonal Tg antibody (1:800).

PKC assay
WRT cells in 2H (in 60-mm dishes) were lysed in 500 µl of a buffer containing 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 5 µg/ml AEBSF, 5 µg/ml leupeptin, 1 µg/ml aprotinin, 2 mM sodium ortovanadate, and 2 mM sodium fluoride. Lysates were incubated with the anti-PKC{epsilon} (anti-{epsilon}-tag) antibody (2 µg/tube) for 1 h at 4 C. Immunocomplexes were recovered with Gamma Bind G Sepharose beads (Pharmacia & Upjohn), and washed three times with 1 ml of lysis buffer and once with 0.2 ml of kinase reaction buffer. Kinase reaction was performed in immunoprecipitates by incubation with a kinase buffer (50 µl) containing 50 mM Tris-HCl, pH 7.4, 250 µg/ml BSA, 1 mM EGTA, 7.5 mM MgAc, 25 µM ATP, [{gamma}-32]ATP (3 µCi/tube), and 20 µM of {alpha}-peptide as substrate, as previously described (17). Reaction was carried out at 30 C for 15 min. The beads were then separated by centrifugation, and 25 µl of the supernatant were spotted onto P81 phosphocellulose paper (Whatman) and counted in a scintillation counter.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Overexpression of PKC{zeta} in WRT cells
We overexpressed PKC{zeta} in WRT cells by transfection of an expression vector, pCR3{epsilon}-PKC{zeta} and selection in G418. To avoid potential variations between individual clones, G418-resistant cells were pooled 3 weeks after transfection. Western blot analysis using the anti-{epsilon}-tag (anti-PKC{epsilon}) antibody revealed a 75-kDa band corresponding to the {epsilon}-tagged PKC{zeta}, which was present in pCR3{epsilon}-PKC{zeta}-transfected WRT cells but not in cells transfected with vector alone (pCR3{epsilon}2) (Fig. 1aGo). Expression of {epsilon}-tagged PKC{zeta} was confirmed in kinase assays. Immunoprecipitations using the anti-{epsilon}-tag antibody were performed in pCR3{epsilon}2- or pCR3{epsilon}-PKC{zeta}-transfected cells, and kinase activity was measured in immunoprecipitates using a specific PKC substrate. As shown in Fig. 1bGo, high levels of kinase activity were observed in immunoprecipitates of pCR3{epsilon}-PKC{zeta}-transfected cells. Overexpression of PKC{zeta} did not alter the expression of other PKC isozymes, namely PKC{alpha}, PKC{epsilon}, PKC{lambda}, and PKCµ (Fig. 1Go, A and C). PKC{delta} was expressed at very low levels in WRT cells. PKCß’ PKC{gamma}, PKC{eta}, and PKC{theta} were not detected in WRT cells using isozyme-specific anti-PKC antibodies (data not shown).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Expression of epitope-tagged PKC{zeta} in WRT cells. A, Lysates (8 µg/lane) prepared from WRT cells transfected with either pCR3{epsilon}2 or pCR3{epsilon}-PKC{zeta} were resolved on 10% SDS-polyacrylamide gels and Western blotted with an anti-{epsilon}-tag antibody (anti-PKC{epsilon}, Life Technologies, Inc.). Lane 1, Vector (pCR3{epsilon}2)-transfected cells; lane 2, pCR3{epsilon}-PKC{zeta}-transfected cells. B, WRT cells transfected with either pCR3{epsilon}2 or pCR3{epsilon}-PKC{zeta} were subjected to immunoprecipitation using an anti-{epsilon}-tag antibody. Kinase activity was measured in immunoprecipitates using a PKC pseudosubstrate-based peptide as a substrate, as described in Materials and Methods. Values are mean ± SE of five determinations. C, Expression of PKC isozymes in pCR3{epsilon}2 or pCR3{epsilon}-PKC{zeta} cells was assessed by Western blot using specific antibodies for PKC isozymes. Expression of PKC{epsilon} is shown in Panel A.

 
Evaluation of cell growth and DNA synthesis
Atypical PKCs regulate cell proliferation and activate intracellular signaling cascades controlling mitogenesis (14, 16). To date, the role of atypical PKCs in thyrocyte cell proliferation has not been examined. Therefore, we assessed the growth properties of WRT cells overexpressing PKC{zeta} in the absence of TSH. Equal numbers of pCR3{epsilon}-PKC{zeta} or vector-transfected cells were plated in growth medium devoid of TSH (2H) and counted every 2 days. Cells overexpressing PKC{zeta} proliferate more rapidly than vector-transfected cells, which proliferate only very slowly in the absence of TSH (Fig. 2AGo). In the presence of TSH (3H growth medium), PKC{zeta} overexpressing cells also show a higher rate of proliferation (data not shown). The mitogenic activity of PKC{zeta} was confirmed in experiments where DNA synthesis was measured. After starvation in growth factor-deficient basal medium for 48 h, cells were incubated with [3H]thymidine for 24 h in either basal medium, insulin-supplemented basal medium or 2H medium. These conditions were used to determine whether insulin, an important co-mitogen for thyroid cells, enhanced the effects of PKC{zeta} on DNA synthesis. As demonstrated in Fig. 2BGo, in all cases incorporation of [3H]thymidine was significantly higher in cells overexpressing PKC{zeta}. The effects of PKC{zeta} on DNA synthesis were potentiated to a modest degree by inclusion of insulin, and to a greater extent by inclusion of insulin, transferrin, and serum (2H). Taken together, these observations provide evidence that PKC{zeta} stimulates mitogenesis in WRT cells. No differences in cell morphology were observed in cells overexpressing PKC{zeta} (data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. PKC{zeta} promotes TSH-independent proliferation and DNA synthesis. A, Cells were seeded at 2 x 105 per dish (60 mm) in TSH-deficient medium (2H) and replicate plates harvested and counted every other day for 4 days. The figure shows the average of duplicate plates. Closed circles, pCR3{epsilon}2-transfected cells; open circles, pCR3{epsilon}-PKC{zeta}-transfected cells. A second experiment, performed in duplicate, gave similar results. B, 3 x 105 cells were seeded in 60 mm dishes and incubated for 14 h in 3H medium. After starvation in basal medium for 48 h, cells were incubated for 24 h with [3H]thymidine (2 µCi/plate) in basal medium, insulin-supplemented basal medium or in 2H medium. [3H]thymidine incorporation was measured as described in Materials and Methods. Open bars, pCR3{epsilon}2-transfected cells; solid bars, pCR3{epsilon}-PKC{zeta}-transfected cells. Two additional experiments gave similar results.

 
Overexpression of PKC{zeta} induces the activation of p42/p44 MAPK
Activation of p42/p44 MAPK is associated with cell proliferation in most cell lines. In WRT cells, however, TSH impairs MAPK activation by serum growth factors, indicating that mitogenic effects can be uncoupled from MAPK activation (20). Similarly, in canine thyrocytes TSH stimulates proliferation but not MAPK activity (21). To evaluate whether the proliferative effects in 2H growth medium observed in cells overexpressing PKC{zeta} involve MAPK, we assessed the levels of phosphorylated p42/p44 MAPK using a specific antibody to phosphorylated and activated p42/p44 MAPK. Western blot analysis revealed that cells overexpressing PKC{zeta} exhibit higher levels of phosphorylated and activated p42/p44 MAPK compared with those in vector-transfected cells. No significant changes were observed in total MAPK levels (Fig. 3AGo). Densitometric analysis revealed that PKC{zeta} overexpressors have 2.3 ± 0.3 -fold higher levels of phosphorylated p42/p44 MAPK (n = 5) (Fig. 3BGo). This result suggests that the mitogenic activity of PKC{zeta} may involve MAPK activation. To determine whether MAPK activation was the consequence of autocrine effects, we incubated quiescent WRT cells with medium collected from either PKC{zeta}- or vector-transfected cells and evaluated MAPK phosphorylation. Medium from either cell population failed to stimulate MAPK activity (data not shown), therefore excluding that autocrine effects were responsible for MAPK activation.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Overexpression of PKC{zeta} stimulates p42/p44 MAPK and Elk-1 transcriptional activity. A, pCR3{epsilon}2 (lane 1) or pCR3{epsilon}-PKC{zeta}-transfected cells (lane 2) in 2H medium were lysed and subjected to Western blot analysis using an anti-MAPK antibody or a specific antibody to phosphorylated and activated p42/p44 MAPK. B, Densitometric analysis of activated p42/p44 levels. The densities of p42 MAPK and p44 MAPK were measured together. The results were normalized to the density of the control (vector), which was arbitrarily adjusted to 100%. An average of five independent experiments is presented. C, WRT cells growing in 2H medium were transfected with GAL4-Elk-1 (0.2 µg), and a pFR-Luc (0.9 µg), and pRL-SV40 (0.1 µg). After 48 h, cells were lysed and assayed for luciferase activity. To normalize for transfection efficiency, results were expressed as the ratio of Firefly/Renilla luciferase activity (x 10-4). The assay was performed in quadruplicate, and results are expressed as mean ± SE. Similar results were observed in three additional experiments. D, WRT cells were cotransfected with plasmids described in Panel C, together with an activated MEK1 plasmid (pFC-MEK1, 0.1 µg). Luciferase activity was measured as described above. The assay was performed in quadruplicate. Results are expressed as mean ± SE. Similar results were observed in two additional experiments.

 
To determine whether MAPK activation led to increases in transcriptional activity, we evaluated the activity of Elk-1, a transcription factor and substrate of p42/p44 MAPK. Phosphorylation of Elk-1 by p42/p44 MAPK stimulates its transcriptional activity (22). Cells were transfected with GAL4-Elk-1 (307–427) and a luciferase reporter plasmid, and luciferase activity monitored in cell lysates. To exclude the possibility that potential changes in luciferase activity could be a consequence of differences in transfection efficiencies, cells were co-transfected with a Renilla-luciferase reporter under the control of an SV40 promoter (pRL-SV40). Results were normalized by expressing the ratios between Firefly and Renilla luciferase activities. Interestingly, as shown in Fig. 3CGo, basal levels of luciferase activity were significantly higher in pCR3{epsilon}-PKC{zeta}-transfected WRT cells compared with vector-transfected cells.

It is well established that MEK1 phosphorylates p42/p44 MAPK, leading to increased Elk-1 transcriptional activity. Indeed, transfection of a constitutively active mutant form of MEK1 (pFC-MEK1, Stratagene) into WRT cells growing in 2H medium results in a 22.5 ± 4.7-fold increase in luciferase activity (n = 3). Interestingly, as shown in Fig. 3DGo, a significantly higher activation of Elk-1 by MEK1 was observed in cells overexpressing PKC{zeta}. These effects were specific as no luciferase activity was observed in cells transfected with the luciferase reporter and pFC-dbd, a plasmid which lacks the activation domain of Elk-1 (data not shown).

PKC{zeta} does not impair Tg expression
One of the hallmarks of TSH is its ability to stimulate the proliferation of differentiated thyroid cells. Although serum growth factors including epidermal growth factor (EGF), phorbol esters and Ras promote thyroid proliferation, they do so at the expense of the differentiated phenotype. To investigate the effects of PKC{zeta} on thyroid differentiation, Tg expression was analyzed by immunostaining and Western blot. As shown in Fig. 4Go, expression of PKC{zeta} does not affect the expression of Tg after TSH stimulation. This effect contrasts with that produced by phorbol esters (Fig. 4Go) and Ras (see our previous results in reference 6), which impair Tg expression in these cells. Therefore, overexpression of PKC{zeta} to levels sufficient to confer TSH-independent proliferation is not accompanied by decreases in the ability of TSH to stimulate Tg expression.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 4. TSH stimulates Tg expression in PKC{zeta}-expressing cells. Cells were incubated for 6 days in basal medium and then stimulated with TSH (1 mU/ml). A, Tg expression was analyzed with a Tg-specific antibody by immunostaining 48 h after stimulation with TSH. B, Western blotting using a Tg-specific antibody. PMA (100 nM) was added for 48 h to cells arrested in basal medium for 6 days and to cells arrested in basal medium for 30 min before stimulation with TSH for 48 h. Similar results were obtained in two additional experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The atypical PKC{zeta} is a phorbol ester-unresponsive isozyme that has been implicated in signaling pathways regulating mitogenesis and survival. In many cell types, atypical PKCs are activated following stimulation of growth factor receptors (23, 24). In contrast, other studies have reported either no effect or antiproliferative effects in response to PKC{zeta} overexpression (25, 26, 27), suggesting that the effects of this atypical PKC are cell type dependent. Overexpression of PKC{zeta} enables rat thyroid cells to proliferate in a TSH-independent fashion. WRT cells overexpressing PKC{zeta} exhibited an increased growth rate in TSH-deficient medium (2H). In addition, DNA synthesis in PKC{zeta}-expressing cells was markedly elevated in cells in basal medium, in insulin-supplemented basal medium and in 2H. Inclusion of insulin or serum (i.e. 2H) augmented DNA synthesis in PKC{zeta}-expressing cells, and together exerted additive effects on PKC{zeta}-induced DNA synthesis, suggesting that these cells remain largely insulin- and serum-dependent for growth. Despite the enhanced proliferation of PKC{zeta}-expressing cells, these cells were morphologically indistinguishable from parental WRT cells. Remarkably, although sufficient to confer TSH-independent proliferation, PKC{zeta} expression had no effect on the ability of TSH to induce Tg expression. Unlike phorbol esters, PKC{zeta}-induced proliferation is compatible with the thyroid differentiated phenotype.

PKC{zeta}-expressing WRT cells exhibited elevated levels of phosphorylated, active MAPK. Although the MAPK cascade has been implicated in the regulation of cell proliferation and differentiation in a large number of cell types (28), the role of MAPK in thyroid cell proliferation and differentiation is less clear. In human cells, TSH activates MAPK presumably through the ability of the TSH receptor to couple to multiple heterotrimeric G proteins including Gq (3). In contrast, in primary canine thyrocytes and WRT cells, TSH does not activate MAPK (20, 21). Moreover, MAPK is not required for the ability of TSH to stimulate Tg expression (Meinkoth, J. L., unpublished results). Phorbol ester treatment leads to MAPK activation, and transfection of activated forms of classical and novel (phorbol ester-responsive) as well as atypical PKCs into COS cells also results in the activation of p42/p44 MAPK (16). Our results support these findings and indicate that PKC{zeta} activates MAPK in thyroid epithelial cells. Interestingly, although all PKC isozymes activate MEK1, only the classical and novel isoforms activate c-Raf, the serine-threonine kinase responsible for MEK1 activation. An alternative but unidentified route for the activation of MEK1 by PKC{zeta} has been postulated in this latter case. This may explain our findings in WRT cells where overexpression of PKC{zeta} not only increases basal Elk-1 activity but also enhances MEK1 stimulated Elk1-transcriptional activity. These results suggest that PKC{zeta} activates signaling pathways in addition to those activated by MEK1 overexpression alone, and that these pathways act synergistically in the regulation of Elk-1 activity.

Interplay between TSH and Ras is important in the regulation of thyroid cell proliferation as well as differentiation where TSH, acting via cAMP, redirects Ras-mediated signals to alternate effectors. Ras activation of Raf-1, although sufficient to stimulate proliferation, leads to thyroid de-differentiation (29). In contrast, expression of activated forms of MEK1 or Rac1, individually or together, failed to impair thyroid differentiation in FRTL-5 cells (30). These results are similar to those reported in myoblasts where expression of a membrane targeted form of Raf-1, but not of constitutively active MEK1, impaired myogenic differentiation (31, 32). In contrast, Ras signaling to PI3K (33), or activation of PKC{zeta} is sufficient to stimulate hormone-independent thyroid cell proliferation, as well as maintaining Tg expression, a marker of thyroid differentiation. Together, these findings underscore the critical role of cross-talk between cellular signaling pathways in determining the biological consequences of signal activation.


    Footnotes
 
1 This work is supported by Grants DK-45696 (NIH) (to J.L.M.), and Grants CA-74197 (NIH) and RPG-CNE-86115 (American Cancer Society) (to M.G.K.). Back

Received June 18, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Roger PP, Reuse S, Maenhaut C, Dumont JE 1995 Multiple facets of the modulation of growth by cAMP. Vitam Horm 51:59–191[Medline]
  2. Meinkoth JL, Goldsmith PK, Spiegel AM, Feramisco JR, Burrow GN 1992 Inhibition of TSH-induced DNA synthesis in thyroid follicular cells by microinjection of an antibody to the stimulatory G protein of adenylyl cyclase Gs. J Biol Chem 267:13239–13245[Abstract/Free Full Text]
  3. Allgeier A, Offermanns S, Sande JV, Spicher K, Schultz G, Dumont JE 1994 The human thyrotropin receptor activated G-proteins Gs and Gq/11. J Biol Chem 269:13733–13735[Abstract/Free Full Text]
  4. Allgeier A, Laugwitz KL, Van Sande J, Schultz G, Dumont JE 1997 Multiple G-protein coupling of the dog thyrotropin receptor. Mol Cell Endocrinol 127:81–90[CrossRef][Medline]
  5. Kupperman E, Wen W, Meinkoth JL 1993 Inhibition of thyrotropin-stimulated DNA synthesis by microinjection of inhibitors of cellular ras and the cyclic AMP dependent protein kinase. Mol Cell Biol 13:4477–4484[Abstract/Free Full Text]
  6. Kupperman E, Wofford D, Wen W, Meinkoth JL 1996 Ras inhibits thyroglobulin expression but not cyclic adenosine monophosphate-mediated signaling in Wistar rat thyrocytes. Endocrinology 137:96–104[Abstract]
  7. Dumont JE, Lamy F, Roger P, Maenhaut C 1992 Physiological and pathological regulation of thyroid cell proliferation and differentiation by thryotropin and other factors. Physiol Rev 72:667–697[Free Full Text]
  8. Fujimoto J, Brenner-Gate L 1992 Protein kinase-C activation during thyrotropin-stimulated proliferation of rat FRTL-5 thyroid cells. Endocrinology130:1587–1592
  9. Ginsberg J 1992 Protein kinase C as a mediator of TSH and thyroid autoantibody action. Autoimmunity 13:51–59[Medline]
  10. Gallo A, Feliciello A, Varrone A, Cerillo R, Gottesman ME, Avvedimento VE 1995 Ki-ras oncogene interferes with the expression of cyclic AMP-dependent promoters. Cell Growth Differ 6:91–95[Abstract]
  11. Heinrich R, Kraiem Z 1997 The protein kinase A pathway inhibits c-jun and c-fos protooncogene expression induced by the protein kinase C and tyrosine kinase pathways in cultured human thyroid follicles. J Clin Endocrinol Metab 82:1839–1844[Abstract/Free Full Text]
  12. Newton AC 1995 Protein kinase C: structure, function, and regulation. J Biol Chem 270:28495–28498[Free Full Text]
  13. Mischak H, Goodnight J, Kolch W, Martiny-Baron G, Schaechtle C, Kazanietz MG, Blumberg PM, Pierce JH, Mushinski JF 1993a Overexpression of protein kinase C-{delta} and -{epsilon} in NIH 3T3 cells induces opposite effects on growth, morphology, anchorage dependence, and tumorigenicity. J Biol Chem 268:6090–6096
  14. Berra E, Diaz-Meco MT, Dominguez I, Municio M, Sanz L, Lozano J, Chapkin RS, Moscat J 1993 Protein kinase C zeta isoform is critical for mitogenic signal transduction. Cell 74:555–563[CrossRef][Medline]
  15. Cai H, Smola U, Wixler V, Eisenmann-Tappe I, Diaz-Meco MT, Moscat J, Rapp U, Cooper GM 1997 Role of diacylglycerol-regulated protein kinase C isotypes in growth factor activation of the Raf-1 protein kinase. Mol Cell Biol 17:732–741[Abstract]
  16. Schonwasser DC, Marais RM, Marshall CJ, Parker PJ 1998 Activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes. Mol Cell Biol 18:790–798[Abstract/Free Full Text]
  17. Kazanietz MG, Areces LB, Bahador A, Mischak H, Goodnight J, Mushinski JF, Blumberg PM 1993 Characterization of ligand and substrate specificity for the calcium-dependent and calcium-independent protein kinase C isozymes. Mol Pharmacol 44:298–307[Abstract]
  18. Caloca MJ, Fernandez MN, Lewin NE, Ching D, Modali R, Blumberg PM, Kazanietz MG 1997 ß2-chimaerin is a high affinity receptor for the phorbol ester tumor promoters. J Biol Chem 272:26488–26494[Abstract/Free Full Text]
  19. Olah Z, Lehel C, Jakab G, Anderson WB 1994 A cloning and epsilon-epitope-tagging insert for the expression of polymerase chain reaction-generated cDNA fragments in Escherichia coli and mammalian cells. Anal Biochem 221:94–102[CrossRef][Medline]
  20. Miller MJ, Prigent S, Kupperman E, Rioux L, Park S-H, Feramisco JR, White MA, Rutkowski JL, Meinkoth JL 1997 RalGDS functions in Ras- and cAMP-mediated growth stimulation. J Biol Chem 272:5600–5605[Abstract/Free Full Text]
  21. Lamy F, Wilkin F, Baptist M, Posada J, Roger PP, Dumont JE 1993 Phosphorylation of mitogen-activated protein kinases is involved in the epidermal growth factor and phorbol ester, but not in the thyrotropin/cAMP, thyroid mitogenic pathway. J Biol Chem 268:8398–8401[Abstract/Free Full Text]
  22. Whitmarsh AJ, Shore P, Sharrocks AD, Davis RJ 1995 Integration of MAP kinase signal transduction pathways at the serum response element. Science 269:403–407[Abstract/Free Full Text]
  23. Akimoto K, Takahashi R, Moriya S, Nishioka N, Takayanagi J, Kimura K, Fukui Y, Osada S, Mizuno K, Hirai S, Kazlauskas A, Ohno S 1996 EGF or PDGF receptors activate atypical PKC lambda through phosphatidylinositol 3-kinase. EMBO J 15:788–798[Medline]
  24. Gomez J, Pitton C, Garcia A, Aragon AMd, Silva A, Rebollo A 1995 The {zeta} isoform of protein kinase C controls interleukin-2-mediated proliferation in a murine T cell line: evidence for an additional role of protein kinase C {epsilon} and ß. Exp Cell Res 218:105–113[CrossRef][Medline]
  25. Crespo P, Mischak H, Gutkind JS 1995 Overexpression of mammalian protein kinase C {zeta} does not affect the growth characteristics of NIH 3T3 cells. Biochem Biophys Res Commun 213:266–272[CrossRef][Medline]
  26. Montaner S, Ramos A, Perona R, Esteve P, Carnero A 1995 Overexpression of PKC {zeta} in NIH3T3 cells does not induce cell transformation nor tumorigenicity and does not alter NF {kappa} B activity. Oncogene 10:2213–2220[Medline]
  27. Kieser A, Seitz T, Adler HS, Coffer P, Kremmer E, Crespo P, Gutkind JS, Henderson DW, Mushinski JF, Kolch W, Mischak H 1996 Protein kinase C-{zeta} reverts v-raf transformation of NIH-3T3 cells. Genes Dev 10:1455–1466[Abstract/Free Full Text]
  28. Seger R, Krebs EG 1995 The MAPK signaling cascade. FASEB J 9:726–735[Abstract]
  29. Miller MJ, Rioux L, Prendergast GV, Cannon S, White MA, Meinkoth JL 1998 Differential effects of protein kinase A on ras effector pathways. Mol Cell Biol 18:3718–3726[Abstract/Free Full Text]
  30. Cobellis G, Missero C, Lauro RD 1998 Concomitant activation of MEK-1 and Rac-1 increases the proliferative potential of thyroid epithelial cells, without affecting their differentiation. Oncogene 17:2047–2057[CrossRef][Medline]
  31. Ramocki MB, Johnson SE, White MA, Ashendel CL, Konieczny SF, Taparowsky EJ 1997 Signaling through mitogen-activated protein kinase and Rac/Rho does not duplicate the effects of activated Ras on skeletal myogenesis. Mol Cell Biol 17:3547–3555[Abstract]
  32. Ramocki MB, White MA, Konieczny SF, Taparowsky EJ 1998 A role for RalGDS and a novel Ras effector in the Ras-mediated inhibition of skeletal muscle. J Biol Chem 273:17696–17701[Abstract/Free Full Text]
  33. Cass LA, Summers SA, Prendergast GV, Backer JM, Birnbaum MJ, Meinkoth JL 1999 PKA-dependent and -independent signaling pathways contribute to cAMP-stimulated proliferation. Mol Cell Biol 19:5882–5891[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
R. Mustafi, S. Cerda, A. Chumsangsri, A. Fichera, and M. Bissonnette
Protein Kinase-{zeta} Inhibits Collagen I-Dependent and Anchorage-Independent Growth and Enhances Apoptosis of Human Caco-2 Cells
Mol. Cancer Res., September 1, 2006; 4(9): 683 - 694.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. E. Santiago-Walker, A. J. Fikaris, G. D. Kao, E. J. Brown, M. G. Kazanietz, and J. L. Meinkoth
Protein Kinase C {delta} Stimulates Apoptosis by Initiating G1 Phase Cell Cycle Progression and S Phase Arrest
J. Biol. Chem., September 16, 2005; 280(37): 32107 - 32114.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
T. Hirai and K. Chida
Protein Kinase C{zeta} (PKC{zeta}): Activation Mechanisms and Cellular Functions
J. Biochem., January 1, 2003; 133(1): 1 - 7.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
E. Sanz-Navares, N. Fernandez, M. G. Kazanietz, and S. A. Rotenberg
Atypical Protein Kinase C{zeta} Suppresses Migration of Mouse Melanoma Cells
Cell Growth Differ., October 1, 2001; 12(10): 517 - 524.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fernandez, N.
Right arrow Articles by Kazanietz, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fernandez, N.
Right arrow Articles by Kazanietz, M. G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals