help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sumitani, H.
Right arrow Articles by Inoue, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sumitani, H.
Right arrow Articles by Inoue, M.
Endocrinology Vol. 141, No. 10 3852-3861
Copyright © 2000 by The Endocrine Society


ARTICLES

In Situ Estrogen Synthesized by Aromatase P450 in Uterine Leiomyoma Cells Promotes Cell Growth Probably Via an Autocrine/Intracrine Mechanism1

Hiroshi Sumitani, Makio Shozu, Tomoya Segawa, Kouichi Murakami, Hui-Juan Yang, Keiko Shimada and Masaki Inoue

Department of Obstetrics and Gynecology, Kanazawa University School of Medicine, 13–1 Takaramachi, Kanazawa 920-0934, Japan

Address all correspondence and requests for reprints to: Makio Shozu, M.D., Ph.D., Department of Obstetrics and Gynecology, Kanazawa University School of Medicine, 13–1 Takaramachi, Kanazawa 920-0934, Japan. E-mail: shozu{at}med.kanazawa-u.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study we characterized in detail the expression of aromatase P450 in leiomyomas to determine the role of in situ estrogen in the growth advantage of leiomyomas. The levels of aromatase P450 transcripts were determined by quantitative RT-PCR to be significantly higher in leiomyomas than in corresponding myometrium. The overexpression of aromatase P450 in leiomyomas was also confirmed by Western blot analysis. The estimated size of immunoreactive aromatase was 58 kDa, similar to that in placenta. To identify a cell type that express aromatase P450 in leiomyomas, histological specimens were stained for aromatase P450 using a polyclonal antibody. Strong immunoreactivity was detected in the cytoplasm of leiomyoma cells, whereas surrounding normal myometrium displayed weak or negative staining. Smooth muscle-like cells in culture obtained from leiomyomas, positive for actin D fiber, possessed immunoreactive granules of aromatase in the cytoplasm. Conversion of androgen to estrogen was effectively stimulated by phorbol myristate acetate and dexamethasone plus interleukin-1ß and was completely abolished by selective inhibitors of aromatase P450 (fadrozole and TZA-2209), but not by inhibitors of 5{alpha}-reductase (finasteride and flutamide). The apparent Km of androstenedione was 3 nM in the presence of dexamethasone and interleukin-1ß, corresponding to the plasma concentration of androstenedione in women of reproductive age. To determine whether endogenous aromatase P450 plays a role in the growth promotion of leiomyoma cells, we evaluated the cell growth of smooth muscle-like cells treated with various concentrations of estrogen and androgen using a WST-1 assay. Treatment with testosterone (10-8 and 10-7 M) and androstenedione (10-8 and 10-7 M) stimulated the growth of smooth muscle-like cells obtained from leiomyomas to the same extent as estradiol (10-10–10-7 M), whereas dihydrotestosterone (10-11–10-8 M) did not. The stimulatory effect of testosterone on cell growth was again abolished by cotreatment with fadrozole. The level of estradiol in the medium of testosterone (10-8 M)-treated smooth muscle-like cells was 10-11 M, which was 1 order lower than the minimum concentration of estradiol necessary to promote cell growth (10-10 M). This indicates that estradiol synthesized in leiomyomas promotes their growth via an autocrine/intracrine mechanism. We conclude that myometrial cells of leiomyomas overexpress aromatase P450 and are able to synthesize sufficient estrogen to accelerate their own cell growth. Overexpression of aromatase P450 may play a role in the growth advantage of leiomyoma tissue over surrounding myometrium via an autocrine/intracrine mechanism.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LEIOMYOMAS OF THE uterus are the result of clonal proliferation of uterine smooth muscle tissue. Although they remain benign, leiomyomas are the most common cause of premenopausal hysterectomies (1). Despite much investigation, including recent genetic and molecular approaches, the pathogenesis of uterine leiomyomas remains unclear. Cytogenetic studies have revealed several types of chromosomal abnormalities in leiomyoma tissue, such as a deletion between 7q21 and 7q36 and translocation of 12q14–15 with 14q, 14q23–24 with 12q, and 6p21with 10q (2, 3, 4, 5, 6). Analysis of the translocation involving 12q14–15 demonstrated that somatic mutation that leads to dysregulated expression of high mobility group proteins (HMGI-C and HMGI-Y) is implicated in the etiology of leiomyoma (7, 8, 9). Unknown tumor suppressor genes located on chromosome 7q22–31 are also believed to be involved in the etiology of some leiomyomas (10, 11).

On the other hand, endocrinological studies have revealed that the action of steroid hormones is essential for the progression of leiomyomas. Epidemiological studies indicate that many factors modifying the risk of leiomyoma development are related to unopposed estrogen. Obesity, nulliparity, breast cancer, and endometrial cancer increase the risk of development of leiomyomas, whereas conditions of low unopposed estrogen, such as uses of combined oral contraceptives, cigarette smoking, and an increasing number of term pregnancies, reduce the risk (12). In addition to estrogen, there is strong evidence that progesterone plays a role in leiomyoma growth. Use of the progesterone antagonist RU 486 induces shrinkage of leiomyomas (13), and the ability of GnRH analog (GnRHa) to shrink leiomyoma tissue is inhibited when progestin alone is readded (14, 15). Thus, both estrogen and progesterone appear to be able to promote the growth of leiomyomas. Moreover, deprivation of ovarian estrogen, as seen in women after menopause and during GnRHa therapy, diminishes leiomyoma size. Therefore, the ovary is thought to be the most important source of estrogen for leiomyoma growth. Both leiomyoma tissue and surrounding myometrium are similarly exposed to plasma estrogen derived from the ovaries, raising the question of why leiomyoma tissue is the preferential site of estrogen action. One possible explanation is the elevated expression of the estrogen receptor in leiomyomas. Increased estradiol binding in leiomyomas was demonstrated by a biochemical method a few decades ago (16, 17) and was confirmed by recent studies employing molecular techniques. The level of estrogen receptor remains static in leiomyomas and is higher than in the surrounding myometrium throughout the menstrual cycle, whereas the level of estrogen receptor in myometrium is low and varies according to the cycle (18, 19, 20). However, no direct evidence that elevated expression of estrogen receptors is responsible for the advantage growth of leiomyomas over surrounding myometrium has been published.

The other possible explanation for the preferential action of estrogen on leiomyomas is estrogen biosynthesis in situ in leiomyoma tissue. Leiomyomas have been shown to possess the ability to convert androgens to estrogen at a significant rate, whereas normal myometrial tissue has not (21, 22, 23). Bulun et al. detected a higher level of aromatase P450 transcripts, the only enzyme in humans responsible for estrogen biosynthesis, in leiomyoma tissue (24), thereby suggesting that leiomyoma cells synthesize estrogen in situ, which, in turn, contributes to the growth advantage of the leiomyoma over surrounding myometrium.

To clarify the possible role of local estrogen in situ, we quantified aromatase P450 transcripts, aromatizing activity and aromatase P450 protein in leiomyoma tissue and localized immunoreactive aromatase P450 on leiomyoma cells. We then showed that plasma androstenedione promotes the growth of leiomyoma cells, most likely via the conversion of circulating androgens to estrogen by the leiomyoma cells themselves.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue acquisition and myometrial cell culture
Myometrial tissue was obtained in situ from women undergoing hysterectomies for uterine leiomyoma or carcinoma. This study was approved by the medical ethics committee of Kanazawa University, Japan (no. 067), and informed consent was obtained from all patients before the study. All women involved in this study were in the proliferative phase of menstrual cycle at the time of surgery. Women with evidence of adenomyosis and/or endometriosis at the time of laparotomy were excluded. Tissue samples were dissected immediately after surgery, snap-frozen in liquid nitrogen, and then stored at -80 C. Leiomyoma specimens were obtained from the leiomyoma tissue just beneath the capsule of the nodule. In the case of multiple nodules, leiomyoma samples were taken from the first to the third largest nodules (>4 cm) in descending order of maximum diameter. Myometrial samples, for use as paired controls, were obtained from surrounding normal myometrium situated more than 2 cm away from the leiomyoma capsule. Endometrial samples were scraped from the central part of the uterine cavity. All tissue samples used for this study were confirmed as histologically ordinary leiomyomas, with no cellular, epithelioid, bizarre, or plexiform variants present.

Myometrial cells were isolated from myometrial tissue using the enzymatic digestion method described previously (25). Collagenase type II was obtained from Roche (Mannheim, Germany), and deoxyribonuclease I was purchased from Sigma (St. Louis, MO). Myometrial cells were cultured in DMEM/F-12 medium supplemented with 10% FBS (Sigma), 100 IU/ml penicillin, 100 µg/ml streptomycin, and 100 µg/ml kanamycin (Life Technologies, Inc., Gaithersburg, MD). Smooth muscle like-cells (SMCs) in culture were confirmed to have the characteristic features of uterine muscle cells as previously described: fusiform shape, expression of smooth muscle-specific {alpha}-actin, and estrogen responsiveness (25). More than 95% of cells stained positively with smooth muscle-specific {alpha}-actin ({alpha}-smooth muscle actin immunohistology kit, Sigma). All experiments were conduced on nonpassaged cells or subcultures 2–4. Preliminary experiments confirmed that SMCs retain constant aromatase activity from one through at least four passages. For proliferation assays, only cells from the first passage were used.

Construction of aromatase DNA carrying an internal deletion
For competitive RT-PCR quantitative analysis, a DNA fragment to act as an internal standard was constructed from aromatase complementary DNA (cDNA; a gift from Dr. Simpson) by site-directed deletion (Fig. 1Go). A partial sequence of aromatase cDNA (exon II to exon V) was amplified from the full-length cDNA using primers Arom201 (GACTCTAAATTGCCCCCTCTG) and Arom202 (CTCCAACCTGTCCAGATGTGT) and was subcloned into a PCR2.1 vector (TA cloning kit, Invitrogen, Groninge, The Netherlands). Two partially overlapping DNA fragments were then amplified from this vector using arom{Delta}1(ATCCTCTGAGTCGACCCTCATAATTCCACACCA) and T7 primer, and arom{Delta}2 (AGGGTCGACTCAGAGGATTTCATGCGAGTCTGG) and M13 reverse primers. PCR consisted of an initial denaturation of 2 min at 94 C, followed by 30 cycles of 20 sec at 94 C, 30 sec at 48 C, and 30 sec at 72 C. Both PCR fragments were then purified on an agarose gel using a QIAGEN gel extraction kit (QIAGEN, Hilden, Germany). A 1-ng sample of both fragments was added to 50 µl PCR mixture containing 150 mM T7 primer and M13 reverse primers, 50 mM deoxy (d)-NTPs, and 2 U Pfu polymerase (CLONTECH Laboratories, Inc., Palo Alto, CA). After initial denaturation at 96 C for 2 min and hybridization at 55 C, partial heteroduplexes were elongated at 72 C and then amplified for 32 cycles (20 sec at 94 C, 30 sec at 55 C, and 45 sec at 72 C), followed by a 7-min extension at 72 C. After extraction by phenol, PCR products were ethanol-precipitated, digested with XbaI and HindIII, and directionally subcloned into the corresponding sites of the PCR2.1 vector (PCR2.1{Delta}arom). The fidelity of the sequence was confirmed by sequencing. The resulting insert of PCR2.1{Delta}arom contained 456 bp of aromatase P450 sequence spanning exon II to exon V, with an internal deletion of a 107-bp fragment. An exon II to III boundary sequence (bases 167–287 from the 5'-end of exon II) of wild-type aromatase was replaced with a TCGACTCAGAGGAT sequence, resulting in elimination of the EcoRI site of the wild-type sequence and introduction of a new SalI site.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of PCR strategy for construction of a deletion mutant of PCR2.1Arom. Zig-zag lines represent partially overlapping sequences of Arom{Delta}1 primer and Arom{Delta}2 primer.

 
In vitro transcription of the internal standard
Internal standard RNA was then synthesized in a 100-µl mixture containing 2 µg HindIII digests of PCR2.1{Delta}arom, 2 mM NTPs, 10 mM dithiothreitol, 50 U ribonuclease inhibitor (Perkin-Elmer Corp., Norwalk, CT), 1 x transcription buffer (Life Technologies, Inc.), and 50 U T7 polymerase (Life Technologies, Inc.). After 1-h incubation at 37 C, the synthesized RNA was extracted twice with acid-phenol and chloroform, treated twice with deoxyribonuclease (Life Technologies, Inc.), and purified using an anion exchange column (RNeasy kit, QIAGEN). RNA was quantified by spectrophotometry, and purity and size were confirmed by PAGE. Possible contamination by template DNA was not detected by 40 cycles of PCR amplification even when 50 attomol of the internal standard RNA were used as the template. Smooth muscle {alpha}actin was similarly stained using a smooth muscle {alpha}-actin immunohistology kit (Sigma).

RT-PCR
Total RNA was extracted from the frozen tissue samples using an Ultraspec RNA isolation kit (Biotecx, Houston, TX) according to the manufacturer’s instructions. The RNA concentration was determined spectrophotometrically. To quantify aromatase messenger RNA (mRNA), 1 µg total RNA was combined with a known amount of the competitor RNA (usually 2 attomol/reaction, except where indicated differently). The mixture was then heat-denatured in the presence of 50 pmol of either random hexamer (Perkin-Elmer Corp.) or a specific primer of aromatase (Arom 202) at 70 C for 5 min, incubated on ice for 2 min, and reverse transcribed for 40 min at 42 C in a mixture [20 µl containing 1 mM of each dNTP, 50 mM Tris-HCl (pH 8.3), 40 mM KCl, 5 mM MgCl2, 0.5% Tween-20 (vol/vol), and 30 U AMV reverse transcriptase XL (Takara, Shuzo Co. Ltd., Shiga, Japan)].

cDNA representing 25 ng total RNA was amplified for aromatase P450 in a 10-µl mix containing 0.25 mM Arom205 (CTCCTCACTGGCCTTTTTCTC), 0.25 mM Arom203 (GCCGAATCGAGAGCTGTAAT), 0.2 mM dNTPs, 1 x PCR buffer (Perkin-Elmer Corp.), and 2 U Taq T4 polymerase (Perkin-Elmer Corp.) by 30 cycles of 94 C for 30 sec, 58 C for 30 sec, and 72 C for 45 sec. Initial denaturation and final extension were lengthened to 3 and 7 min, respectively. A 5-µl aliquot of PCR mix was separated on agarose gel, stained with ethidium bromide, and photographed using a CCD camera system (Epi-light UV FA1100 system, AIC, Tokyo, Japan). Photographs were scanned using a scanner (GT6500, Epson, Tokyo, Japan), and quantitative analyses were performed on a Macintosh Power PC G3 (Apple Japan, Tokyo, Japan) using the NIH Image (version 1.61) program. Densitometric values were normalized to the length of the band. For a semiquantitative assay, the ratio of the densitometric value of the target to that of the internal standard was used to calculate the amount of aromatase mRNA in a given sample.

Similarly, mRNA of glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was amplified and analyzed to monitor the quality of total RNA isolated from the tissue samples. PCR was performed in a 10-µl reaction containing 25 ng cDNA, 0.25 mM G3PDH1 (CTGAGAACGGGAAGCTTGTCATCAATGG), 0.25 mM G3PDH2 (TGTGGTCATGAGTCCTTCCACGATACCA), 1 x PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, and 2 U Taq T4 polymerase for 22–24 cycles of 94 C for 30 sec and 72 C for 1 min, with precycling denaturation (94 C for 2 min) and a final extension (72 C for 6 min).

Western blotting
Tissue samples (~300 mg) were homogenized in 4 ml buffer containing 10 mM Tris-HCl (pH 7.5), 150 mM KCl, 1 mM EDTA, and 1 mM dithiothreitol using a Waring homogenizer (Iuchi, Osaka, Japan). Homogenates were centrifuged at 1,000 x g for 10 min to remove nuclei and cellular debris. The supernatant was then centrifuged for 60 min at 105,000 x g, and resultant pellets were resuspended in 100 µl buffer containing 50 mM Tris-HCl, 20% glycerol, 1 mM EDTA, and 1 mM dithiothreitol, then snap-frozen in liquid nitrogen. Samples were stored at -80 C until use.

A 25- to 50-µg sample of microsomal protein was loaded into each lane along with a prestained protein size marker (Bio-Rad Laboratories, Inc., Hercules, CA) and a recombinant protein size marker carrying the IgG-binding domain of protein A (Oriental, Tokyo, Japan), electrophoresed on a 10% SDS-polyacrylamide gel at 18 V/cm, and electroblotted onto a polyvinylidene difluoride membrane (Micron Separations, Westboro, MA) using a wet electroblotter. After blocking in nonfat milk, incubation was carried out with antiaromatase antibody (1:5000; a gift from Dr. Harada) at 4 C for 16 h in TBS-T solution (20 mM Tris, 137 mM NaCl, and 0.1% Tween-20, pH 7.6). After extensive washing, blots were incubated with peroxidase-labeled goat antirabbit antiserum (Amersham Pharmacia Biotech, Aylesbury, UK) for 60 min and developed using an ECL Plus kit (Amersham Pharmacia Biotech) with ECL Hyperfilm (Amersham Pharmacia Biotech).

Immunohistochemistry and immunocytochemistry
Tissue samples were fixed with 3.7% formaldehyde in 10 mM PBS (pH 7.2), embedded in paraffin, and cut into 5-nm-thick sections. Primary cells were cultured on Lab-Tek plates (Miles Scientific, Naperville, IL), similarly fixed, and used for immunocytochemistry. Sections or Lab-Tek slides were preheated using a microwave oven and blocked with normal goat serum. Endogenous peroxidases were inactivated by 30-min incubation with 0.3% hydrogen peroxide. The preparations were then incubated for 8 h at 4 C in 10 mM PBS with antiaromatase rabbit antibody used at a 1:2000 dilution and then sequentially treated with the second antibody (biotinylated antirabbit antibody) and avidin-biotin complexes using the Vectastain kit (Vector Laboratories, Inc., Burlingame, CA). Color was developed by incubation for 1 min with 3,3-diaminobenzidine tetrahydrochloride and 0.0006% hydrogen peroxide in 50 mM Tris buffer (pH 7.2), followed by counterstaining with hematoxylin.

Protein quantification
Cells in each of 12-well plates were lysed in 1 ml PBS containing 0.5% SDS. Protein concentration was determined using a multiplate reader (iEMS reader, Lab Systems, Dainippon Pharmaceutical Co. Ltd., Tokyo, Japan) and a bicinchoninic acid protein assay kit (Pierce Chemical Co., Rockford, IL). The protein concentrations of tissue homogenates and microsomal fractions were determined by Bradford’s method (protein assay kit, Bio-Rad Laboratories, Inc.). Microsome samples were diluted 10 times in PBS, and the protein concentration was determined similarly.

Aromatase activity
The aromatase activity of primary cells obtained from myometrium was assayed by the formation of tritiated water from [1ß-3H]androstenedione (NEN Life Science Products, Boston, MA) as described previously (26, 27). Aromatase activity was expressed as the rate of incorporation of tritium into water per mg protein/12-h incubation. Aromatase inhibitors, TZA-2209 (Teikokuzouki, Tokyo, Japan), fadrozole (ICI Pharmacy, Tokyo, Japan), and aminoglutethimide (Sigma), were used to confirm the fidelity of this assay. Flutamide (Nippon Kayaku, Tokyo, Japan) and finastelide (Yamanouchi, Tokyo, Japan), inhibitors for 5{alpha}-reductase, were also used.

Cell proliferation assay
To assess cell proliferation, SMCs were plated into 96-well plates (1 x 105 cells/well) and preincubated for 24 h. The SMCs were then stimulated with one of the steroids at various concentrations for 48 h in medium containing dextran-coated charcoal-treated serum (4%). At the end of stimulation, 10 µl 4-[3-(4-lodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate (Premix WST-1, Takara) were added to each well for 45 min at 37 C. The reduction rate of tetrazolium salts was estimated by the increase in OD450.

[3H]Thymidine incorporation assay
To assess DNA synthesis, thymidine incorporation was measured. SMCs derived from leiomyoma were serum starved for 24 h and then plated into 96-well plates in DMEM/F-12 medium. After 24-h incubation, various doses of steroid hormones were added to the wells and then cultivated for another 12 h. The medium was replaced with medium containing 1 µCi/ml [3H]thymidine (American Radiolabeled Chemicals, St. Louis, MO). After incubation for 4 h, cells were washed twice with cold PBS and twice with 5% cold trichloroacetic acetic acid for 6 and 4 h, and then lysed with 1 N NaOH. Thymidine incorporation was determined by scintillation counting.

RIA
Culture medium (2 ml) was extracted twice with diethyl ether. Extracts were evaporated to dryness under nitrogen and reconstituted in 100 µl dextran-coated charcoal-treated FBS. Estradiol levels of the extracts were then determined by RIA using an estradiol assay kit (Diagnostic Products, Tokyo, Japan). The sensitivity of the assay was 3 pM.

Statistical analysis
Differences in levels of transcripts and activity between two groups were evaluated using the Mann-Whitney U test. Statistical significance was established at the P < 0.05 level.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Overexpression of aromatase P450 in leiomyoma tissue
RT-PCR analysis of tissue samples. The level of expression of aromatase was too low in the myometrial tissue samples to be detected by Northern blot analysis, and consequently, we developed a semiquantitative RT-PCR assay. To determine the amount of competitor RNA required for a semiquantitative analysis, the amount of aromatase mRNA in a RNA sample obtained from a pool of all of the RNA samples was first determined. Competitive RT-PCR using serial dilutions of competitor RNA ranging from 1–10 attomol determined the amount of aromatase mRNA in the pooled sample to be 2 attomol/µg total RNA (data not shown). Thus, 2 attomol competitor RNA were used for subsequent experiments. To validate the semiquantitative assay using 2 attomol competitor, decreasing amounts of target RNA (24 to 0.01 attomol) were reverse transcribed in the presence of 2 attomol competitor RNA and then PCR amplified. As shown in Fig. 2Go, plots of the logarithmically transformed ratios of the target intensity to the competitor intensity reveal a linear regression against the log amount of initially added target RNA over the RNA range tested. This regression line was reproducible. The sensitivity of this assay was 0.1 attomol/µg RNA.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. Quantitative RT-PCR for aromatase-coding region. The inset shows an ethidium bromide-stained agarose gel of declining amounts of target RNA reverse transcribed with 2 attomol internal standard RNA and coamplified. The main panel shows the standard curve obtained from the gel. The log ratio of target to competitive product density was plotted against the log amount of target initially added to the tube before RT.

 
Levels of aromatase P450 transcripts were determined in tissues samples obtained from women with leiomyoma using this semiquantitative RT-PCR assay. Aromatase P450 mRNA was detected in 13 of 14 leiomyoma nodules obtained from 5 women. In contrast, aromatase P450 mRNA was low or undetectable in 4 of 5 endometrial samples (Fig. 3Go). Despite considerable variability, the levels of aromatase P450 transcripts were significantly higher in the leiomyoma tissue samples than in the corresponding myometrium and corresponding endometrium samples (P < 0.05; Fig. 3Go). The levels of aromatase P450 transcripts were higher in the largest nodules than in the second and third largest nodules, although the differences failed to reach acceptable levels of significance (largest nodules vs. second largest nodules, P = 0.07; largest nodules vs. third largest nodules, P = 0.11).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Level of aromatase mRNA in tissue samples. Five sets of RNA were prepared from leiomyoma tissues, surrounding myometrium, and endometrium obtained from women harboring leiomyoma of the uterus. Three leiomyoma nodules (the first to third largest nodules) were obtained from four women, and two nodules (the first and second largest nodules) were obtained from one woman. Accordingly, the numbers of samples were five, five, and four for the first, second, and third largest nodules. The level of aromatase mRNA was determined by semiquantitative RT-PCR using a synthesized RNA (2 attomol/mg tissue RNA) as the standard. Data represent the mean and SEM of five sets of paired samples.

 
Western blot analysis of tissue samples. The expression of aromatase P450 in leiomyoma tissue was also demonstrated by Western blot analysis. As shown in Fig. 4Go, microsomal fractions prepared from leiomyoma tissue showed higher levels of 58-kDa protein than those from corresponding myometrium. A 58-kDa band was also detected in ovary and placenta tissue (data not shown).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Western blot analysis of aromatase P450 in leiomyoma tissue samples. Two sets of microsome samples were prepared from patients with leiomyoma of the uterus. Samples (50 µg/lane) were electrophoresed and blotted onto the membrane, and aromatase was then detected using a polyclonal antibody as described in Materials and Methods.

 
Aromatase activity in cultured SMCs
To confirm that overexpressed aromatase protein in leiomyoma cells is functional, the conversion rate of androstenedione to estrone was measured. Primary cells obtained from leiomyoma tissue were cultured in the presence or absence of stimulants, and aromatase activity was then assayed.

Of the stimulants tested, phorbol myristate acetate (PMA; 16 nM) and PGE2 (100 nM) resulted in significant increases in aromatase activity, whereas other growth factors, such as epidermal growth factor, hepatic growth factor, interleukin-6 (IL-6), and oncostatin M did not. Combinations including IL-1ß (1 ng/ml) plus PGE2 (100 nM), IL-1ß (1 ng/ml) plus dexamethasone (DEX; 25 nM), PMA (16 nM) plus PGE2 (100 nM), and 3-isobutyl-1-methylxanthine (IBMX; 100 nM), (Bu)2cAMP (100 nM), plus PMA (16 nM) also significantly enhanced aromatase activity (Fig. 5AGo). The increase in aromatase activity by IBMX, (Bu)2cAMP, and PMA was eliminated by coincubation with aromatase inhibitors, aminoglutethimide (0.2 mM), fadrozole (50 nM), or TZA-2209 (50 µM), but was not eliminated by coincubation with flutamide (1 µM) or finastelide (100 nM), which are specific inhibitors of 5{alpha}-reductase (Fig. 5BGo).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Aromatase activity of SMCs obtained from leiomyoma tissue samples. A, Serum-starved (24 h) SMCs were incubated for 24 h in serum-free medium in the presence of DEX (25 nM), IL-1ß (1 ng/ml), PMA (16 nM), PGE2 (100 nM), oncostatin M (0.5 ng/ml) or combinations thereof. IBMX (100 nM) and (Bu)2cAMP (50 µM) were also used with PMA (8 nM). After 24-h incubation with stimulants, 1ß-[3H]androstenedione was added to each well, and the incubation was continued for another 12 h to allow incorporation of 3H into water. Each bar represents the mean ± SEM of values obtained from cells in triplicate wells. *, P < 0.05 compared with control (vehicle only). B, Aromatase activity of SMCs stimulated with IBMX, (Bu)2cAMP, and PMA. Aromatase activity was measured as described in A. Aminoglutethimide (0.2 mM), fadrozole (50 nM), TZA-2209 (50 µM), or flutamide (1 µM) was added to wells 1 h before the addition of 1ß-[3H]androstenedione to suppress aromatization or 5{alpha}-reduction. *, P < 0.05 compared with IBMX-, (Bu)2cAMP-, and PMA-treated group.

 
The effects of various concentrations of androstenedione as a substrate on aromatase activity were determined in SMCs that had been treated with IL-1ß and DEX. As shown in Fig. 6Go, a maximum velocity was observed at a concentration of 30 nM androstenedione or higher, and the apparent Michaelis-Menten constant (Km) was 3 nM.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Kinetic analysis of aromatase activity in SMCs obtained from leiomyoma tissue samples. Inset, Lineweaver-Burk plot. Subconfluent SMCs in 12-well plates were maintained in serum-free medium containing 0.1% FBS for 24 h before and throughout the experiment. The SMCs were stimulated for 24 h with DEX (25 nM) plus IL-1ß (1 ng/ml). At the end of the stimulation, various concentrations of [3H]androstenedione were added to the wells, and the incubation was continued for 2 h. Incorporation of 3H into water was determined as described in Materials and Methods. The data represent the means of values obtained from assaying cells from three replicate wells.

 
Immunohistochemical localization of aromatase P450 in leiomyoma tissue
Leiomyoma tissue consists primarily of unstriated muscle cells as well as other minor components, including connective tissue, undifferentiated fiber cells, blood vessel elements, and mast cells (28). To identify the cell component(s) responsible for aromatase expression, leiomyoma tissue samples were stained for aromatase using a specific antibody. As shown in Fig. 7Go, A and B, strong aromatase P450 staining was observed in the cytoplasm of leiomyoma cells. The intensity of staining varied from region to region within the same leiomyoma nodule and even varied from cell to cell. On the other hand, a small number of isolated cells were positive for aromatase in the myometrial tissue samples. Weak staining was also found in the arterial wall of myometrial tissue. Cytoplasmic distribution of positive granules was clearly seen in culture cells (Fig. 7Go, C and D). The proportion of positively stained cells was approximately 1% of the total cells in cells obtained from leiomyoma tissue and did not differ from that in cells obtained from surrounding myometrium.



View larger version (109K):
[in this window]
[in a new window]
 
Figure 7. Immunostaining of leiomyoma tissue and SMCs obtained from leiomyoma tissue. Paraffin-embedded tissue sections derived from a leiomyoma nodule were stained for aromatase using rabbit polyclonal aromatase antibody (A) or nonimmune IgG as a negative control (B). Aromatase immunoreactivity was confined to smooth muscle cells of leiomyomas. SMCs obtained from myometrial tissue (C) and from leiomyomas (D) were fixed with formamide and similarly stained for aromatase. Less than 1% of both cells derived from leiomyoma and surrounding myometrial tissue were positive for aromatase. Immunoreactivity was localized to the cytoplasm of SMCs.

 
Growth stimulatory action of in situ estrogen in leiomyoma cells
To determine whether endogenous aromatase P450 plays a role in the promotion of cell growth, myometrial cells were treated with various concentrations (10-12, 10-11, 10-10, 10-9, 10-10, 10-7, and 10-6 M) of estrogen or androgen for 48 h, and cell growth was then measured by the formation rate of insoluble formazan from WST-1. None of the estradiol, testosterone, or androstenedione treatments stimulated the growth of myometrial cells obtained from women with leiomyomas (data not shown). In contrast, estradiol, testosterone, and androstenedione increased the growth of leiomyoma cells, as shown in Fig. 8Go. Promotion of cell growth was reproducible in three independent experiments, although the magnitude of increase (16%, 30%, and 46% of the control value for the three independent experiments) depended on from which woman the tissues came. The maximum increases induced in cell growth did not differ statistically among estradiol, testosterone, and androstenedione treatments in each experiment. The minimum concentrations required to induce a significant increase were 10-10, 10-9, and 10-8 M for estradiol, testosterone, and androstenedione, respectively. Pre- and cotreatment with fadrozole abolished the growth-promoting effect of testosterone and androstenedione, whereas fadrozole alone did not affect cell growth. Dihydrotestosterone, a nonaromatizable androgen, did not promote cell growth in leiomyoma cells at any concentration tested (10-11, 10-10, 10-9, and 10-8 M). Because WST-1 reflects metabolic rates in the cytoplasm as well as cell proliferation, the rate of thymidine incorporation was also determined to demonstrate actual DNA synthesis induced by testosterone. Thymidine incorporation in leiomyoma cells increased in a dose-dependent manner by testosterone treatment and estradiol treatment at concentrations of 10-7 and 10-9 M or higher, respectively (Fig. 9Go).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 8. Effects of steroids in various concentrations on cellular growth. The SMCs obtained from leiomyoma tissue samples were treated with estradiol (10-12–10-7 M), testosterone (10-11–10-7 M), androstenedione (10-7–10-11 M), or dihydrotestosterone (10-7–10-8 M) for 48 h. Absorbance at 450 nm was measured 45 min after the addition of WST-1 as a substrate. Values represent the percentage of the control OD450 treated with vehicle (ethanol). The data represent the mean and SEM obtained from assaying three or six replicate wells. *, P < 0.05 vs. control. Experiments were repeated three times with essentially the same results, aside from a difference in the magnitude of increase in cell number among the three experiments, as described in the text. Estradiol, testosterone, and androstenedione each increased cell proliferation, and the same minimum effective dose of steroids was observed in each experiment.

 


View larger version (23K):
[in this window]
[in a new window]
 
Figure 9. Effects of testosterone and estradiol on thymidine incorporation ratio of leiomyoma cells. SMCs in first passage (1 x 105 cell/well) were stimulated with various doses of estradiol or testosterone for 12 h, and the incorporation rate of thymidine was assayed as described in Materials and Methods. DMEM/F-12 (1:1) medium containing 4% dextran-coated charcoal-treated FBS was used without the addition of phenol red. The data represent the mean and SEM obtained from assaying triplicate wells. *, P < 0.05 vs. each control. The data are representative of three independent experiments.

 
To determine whether testosterone-treated leiomyoma cells secrete enough estrogen into the medium to promote the cell growth of distant cells in culture, the concentration of estradiol in the medium was measured in leiomyoma cell culture. Testosterone (10-7 M) actually increased the estradiol concentration in culture medium to 7 and 10 pM in two independent experiments from an undetectable level (<3 pM). This concentration of estradiol in culture medium was 1 order below the minimal concentration of estradiol (10-10 M) necessary to promote cell growth (actual estradiol concentrations in the medium treated with 10-10 M estradiol were 100 and 120 pM in two independent experiments).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
There is a growing body of evidence that many of the extraglandular sites that used to be considered merely as targets of estrogen possess the ability to metabolize androgen into active estrogen. Estrogen synthesized in these extraglandular sites plays important roles in the physiology as well as the pathology of some of these target organs. Testosterone secreted from a fetal testis is converted into estradiol in the brain and then masculinizes itself (29). In situ estrogen formation also plays important roles in brain function in adults (30). Androgens secreted from adrenal glands and/or ovaries can be converted into estrogens in adipose tissues and secreted back into the blood. Presumably, these extraglandular estrogens play a role in protecting skin, brain, bones, and vessels from the accelerated aging process evident in postmenopausal women. Bone has also been shown to covert androgen to estrogen, which has been implicated in the protection of bone from osteoporosis (27, 31, 32).

A number of neoplastic tissues have also been demonstrated to express high levels of aromatase P450 compared with the lower or virtually zero expression seen in nonneoplastic (normal) tissue. In breast cancer, adipose stromal cells surrounding the cancer cells express aromatase P450 and convert plasma androstenedione to estrogen, which promotes cellular growth of neoplastic cells through a paracrine mechanism (33, 34, 35, 36, 37, 38). Estradiol locally synthesized elevated the local level of estradiol around the breast cancer tissue and is believed to play an important role in the progression of breast cancer, particularly in postmenopausal women (36, 37, 38). In addition, some endometrial cancers have been known to express high levels of aromatase P450 (39, 40, 41). More recently, some adrenal tumors, colon cancers, primary and metastatic liver cancers, and thyroid cancers have been reported to express aromatase P450 (42, 43). Therefore, it is not surprising that the SMCs in leiomyoma tissue express aromatase P450, similar to the other tumors described above. In fact, aromatase P450 was recently detected in SMCs in the wall of the aorta as well as the vena cava (31, 32). Locally synthesized estrogen by SMCs in these vessels is thought to play a role in protection from arteriosclerosis.

In the present study we demonstrated overexpression of aromatase P450 in leiomyoma tissue by semiquantitative RT-PCR as well as by Western blot analysis. We confirmed that aromatase P450 expressed in these leiomyomas was functional. We also showed that the major site of aromatase expression in leiomyoma tissue was in the SMCs themselves.

An important question that arises here is whether aromatase expressed in leiomyoma cells plays a role in leiomyoma growth, or whether leiomyomas synthesize enough estrogen to promote their own cell growth. To address this issue, we treated the primary cells obtained from leiomyoma tissues with various stimulants and measured cell proliferation. Both testosterone and androstenedione, aromatizable androgens, promoted the cell growth of leiomyoma cells, as did estradiol, whereas dihydrotestosterone, a nonaromatizable androgen, did not. Furthermore, the acceleration of cell growth induced by the aromatizable androgens was eliminated by the addition of selective aromatase inhibitors. These results clearly indicate that leiomyoma cells in culture possess the ability to synthesize enough estrogen to promote their own cell growth and also possess the ability to proliferate in response to estrogen synthesized in situ. Furthermore, our experiments suggest that aromatization is critical to the growth-promoting effects of testosterone. Testosterone (10-8 M) treatment, while causing significant cell proliferation, nonetheless kept the level of estradiol in the culture medium to less than the minimum level of estradiol (10-10 M) necessary to induce cell growth in culture when added to the medium. Therefore, the estrogen synthesized in leiomyoma cells, albeit a small amount, effectively stimulated cell growth of the leiomyoma cells that secreted it or of cells close by, most likely through an autocrine/intracrine mechanism. At this point, we have no evidence that in situ estrogen actually plays a role in growth promotion of leiomyomas in vivo despite the presence of an overwhelming amount of circulating estrogen from the ovary. However, there are at least two possible reasons to explain how estrogen synthesized in situ, albeit a small amount, exerts estrogenic effects on leiomyoma cells. First, without further dilution in the bloodstream, the estrogen concentration within a leiomyoma cell can reach a sufficient level to cause cell proliferation with little elevation of plasma estradiol. Second, in an intracrine mode of action, estrogen synthesized within cytoplasm can bind directly to intracellular estrogen receptor without inactivation by binding to sex hormone-binding globulin in plasma. Further research is required to confirm the physiological significance of in situ estrogen in leiomyomas.

In our experiments, androstenedione promoted cell growth at a concentration of 10-8 M or higher, whereas a 10-9 M or lower concentration of androstenedione was ineffective. This was in good agreement with the apparent Km for androstenedione determined in this experiment (3 x 10-9 M). The apparent Km of 3 x 10-9 M guarantees that aromatase P450 was almost fully functional at an androstenedione concentration of 10-8 M, whereas aromatase P450 was virtually inactive at an androstenedione concentration of 10-9 M or lower, far below the Km.

The apparent Km (3 x 10-9 M) for androstenedione corresponded roughly to the plasma level of androstenedione in women of reproductive age (44, 45). This also means that aromatase P450 expressed in SMCs in vivo is functioning as long as blood supply reaches these SMCs. Conceivably, leiomyoma tissue in vivo converts plasma androstenedione to estrogen at a significant rate, which, in turn, promotes cell growth of leiomyoma cells in vivo, as shown in our in vitro experiment. Because estrone, the direct product of aromatization of androstenedione, is a weak estrogen and needs to be further metabolized by 17ß-hydroxysteroid dehydrogenases (17ßHSD) to estradiol to show full biological activity, it is important to examine the expression in leiomyoma cells of 17ßHSD, which catalyzes the conversion between estrone and estradiol and/or between androstenedione and testosterone. The interconversion between these steroids has been reported to occur in leiomyomas at a similar or lower level than in myometrium (46, 47). Our finding that androstenedione promotes the growth of leiomyoma cells similar to testosterone also suggest the presence of 17ßHSD activity. However, whether the expression of 17ßHSD differs between leiomyoma and myometrium tissue in terms of the type(s) of 17ßHSD expressed and the regulation of their expression remains unclear.

In contrast to cells obtained from leiomyoma tissue, cells from surrounding myometrium did not respond to androgen treatment in terms of cell growth. As is shown in our results, lower expression of aromatase P450 in the surrounding myometrial cells may explain the poor response to androgens. Alternatively, insensitivity to androgens may be attributable to the low level of expression of the estrogen receptor in myometrial cells. This appears more likely because the SMCs from normal myometrium did not respond even to estradiol. It has been demonstrated that myometrium in vivo expresses a lower level of estrogen receptors than leiomyoma tissue (18, 19). Furthermore, cells obtained from leiomyoma and myometrium have been shown to lose their estrogen receptors very rapidly when cells are obtained by the minced explant method and then cultivated (48). However, there are no reports describing the level of estrogen receptor in culture of SMCs obtained by the enzymatic digestion methods used in the present study. Our preliminary experiment employing a quantitative RT-PCR was suggestive of lower expression of estrogen receptors in cells obtained from surrounding myometrium than in those from leiomyoma tissue (data not shown).

The aromatase P450 gene (CYP19) has at least seven different promoters, and the corresponding exon is immediately downstream from each promoter (26, 49). The alternate use of promoters realizes tissue-specific regulation of aromatase P450 expression. For example, the placenta uses the most distal promoter, namely promoter I.1; adipose tissues use promoter I.4, which is 20 kb downstream of promoter I.1; and the ovary primarily uses the most proximal promoter, PII. Recent studies of the overexpression of aromatase P450 in breast cancer tissue revealed that, in accordance with increases in aromatase activity, the promoter used in the breast cancer tissue switches from I.4, which is the main promoter used in disease-free breast, to promoters I.3 and PII. Various investigators are currently extensively analyzing the mechanism of promoter switching to elucidate the mechanism of overexpression of aromatase in breast cancer tissue. Only one study has determined the promoter used in leiomyoma tissue. Bulun et al. detected a PII-specific sequence and exon I.4 of aromatase P450 transcripts in leiomyoma tissue by exon 1-specific RT-PCR (24). Based on the findings that the amount of RT-PCR products was more for I.4 than for PII and that DEX did not stimulate aromatase expression in leiomyoma cells, they concluded that PII is the main promoter for leiomyoma tissue (24). In the present study we demonstrated that IL-1ß plus DEX induce aromatase activity as effectively as IBMX, (Bu)2cAMP, and PMA. A number of studies of the promoter switching of aromatase P450 (49, 50) have shown that the promoters of aromatase P450 used are similar among the many cells and tissues tested; many cells/tissues use promoter I.4 of aromatase in response to IL-1ß plus DEX and promoter PII in response to IBMX, (Bu)2cAMP, and PMA. Thus, the increase in aromatase activity in response to IL-1ß and DEX as well as IBMX, (Bu)2cAMP, and PMA indicates that both promoters I.4 and PII appear to be as active in leiomyoma cells. Further investigation employing a quantitative method is necessary to confirm this result.

The present study showed that aromatase P450 is overexpressed in leiomyoma cells and that estrogen synthesized in situ may contribute to the growth advantage of leiomyomas through an intracrine/autocrine mechanism. If this is the case, selective aromatase inhibitors, which are already successfully used for the treatment of breast cancer, might be an adjuvant therapy of conservative management by GnRHa. Further investigation is required to clarify the pathophysiolocial role and precise mechanism of aromatase P450 overexpression in leiomyoma cells.


    Footnotes
 
1 This work was supported by Grant-in-Aid for Scientific Research B12557136 and C11671602 from the Ministry of Education, Science, Sports, and Culture of Japan. Back

Received April 25, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cramer SF, Patel A 1990 The frequency of uterine leiomyomas. Am J Clin Pathol 94:435–438[Medline]
  2. Sreekantaiah C, Ladanyi M, Rodriguez E, Chaganti RS 1994 Chromosomal aberrations in soft tissue tumors. Relevance to diagnosis, classification, and molecular mechanisms. Am J Pathol 144:1121–1134[Abstract]
  3. Ozisik YY, Meloni AM, Altungoz O, Surti U, Sandberg AA 1995 Translocation (6;10)(p21;q22) in uterine leiomyomas. Cancer Genet Cytogenet 79:136–138[CrossRef][Medline]
  4. Ozisik YY, Meloni AM, Surti U, Sandberg AA 1993 Deletion 7q22 in uterine leiomyoma. A cytogenetic review. Cancer Genet Cytogenet 71:1–6[CrossRef][Medline]
  5. Hu J, Surti U 1991 Subgroups of uterine leiomyomas based on cytogenetic analysis. Hum Pathol 22:1009–1016[CrossRef][Medline]
  6. Hennig Y, Rogalla P, Wanschura S, Frey G, Deichert U, Bartnitzke S, Bullerdiek J 1997 HMGIC expressed in a uterine leiomyoma with a deletion of the long arm of chromosome 7 along with a 12q14–15 rearrangement but not in tumors showing del(7) as the sole cytogenetic abnormality. Cancer Genet Cytogenet 96:129–133[CrossRef][Medline]
  7. Gattas GJ, Quade BJ, Nowak RA, Morton CC 1999 HMGIC expression in human adult and fetal tissues and in uterine leiomyomata. Genes Chromosomes Cancer 25:316–322[CrossRef][Medline]
  8. Van de Ven WJ 1998 Genetic basis of uterine leiomyoma: involvement of high mobility group protein genes. Eur J Obstet Gynecol Reprod Biol 81:289–293[CrossRef][Medline]
  9. Schoenmakers EF, Huysmans C, Van de Ven WJ 1999 Allelic knockout of novel splice variants of human recombination repair gene RAD51B in t(12;14) uterine leiomyomas. Cancer Res 59:19–23[Abstract/Free Full Text]
  10. van der Heijden O, Chiu HC, Park TC, Takahashi H, LiVolsi VA, Risinger JI, Barrett JC, Berchuck A, Evans AC, Behbakht K, Menzin AW, Liu PC, Benjamin I, Morgan MA, King SA, Rubin SC, Boyd J 1998 Allelotype analysis of uterine leiomyoma: localization of a potential tumor suppressor gene to a 4-cM region of chromosome 7q. Mol Carcinog 23:243–247[CrossRef][Medline]
  11. Sell SM, Altungoz O, Prowse AA, Meloni AM, Surti U, Sandberg AA 1998 Molecular analysis of chromosome 7q21.3 in uterine leiomyoma: analysis using markers with linkage to insulin resistance. Cancer Genet Cytogenet 100:165–168[CrossRef][Medline]
  12. Ross RK, Pike MC, Vessey MP, Bull D, Yeates D, Casagrande JT 1986 Risk factors for uterine fibroids: reduced risk associated with oral contraceptives. Br Med J 293:359–362
  13. Murphy AA, Kettel LM, Morales AJ, Roberts VJ, Yen SS 1993 Regression of uterine leiomyomata in response to the antiprogesterone RU 486. J Clin Endocrinol Metab 76:513–517[Abstract]
  14. Carr BR, Marshburn PB, Weatherall PT, Bradshaw KD, Breslau NA, Byrd W, Roark M, Steinkampf MP 1993 An evaluation of the effect of gonadotropin-releasing hormone analogs and medroxyprogesterone acetate on uterine leiomyomata volume by magnetic resonance imaging: a prospective, randomized, double blind, placebo-controlled, crossover trial. J Clin Endocrinol Metab 76:1217–1223[Abstract]
  15. Rein MS, Barbieri RL, Friedman AJ 1995 Progesterone: a critical role in the pathogenesis of uterine myomas. Am J Obstet Gynecol 172:14–18[CrossRef][Medline]
  16. Farber M, Conrad S, Heinrichs WL, Herrmann WL 1972 Estradiol binding by fibroid tumors and normal myometrium. Obstet Gynecol 40:479–486[Medline]
  17. Tamaya T, Fujimoto J, Okada H 1985 Comparison of cellular levels of steroid receptors in uterine leiomyoma and myometrium. Acta Obstet Gynecol Scand 64:307–309[Medline]
  18. Andersen J, DyReyes VM, Barbieri RL, Coachman DM, Miksicek RJ 1995 Leiomyoma primary cultures have elevated transcriptional response to estrogen compared with autologous myometrial cultures. J Soc Gynecol Invest 2:542–551[CrossRef][Medline]
  19. Brandon DD, Erickson TE, Keenan EJ, Strawn EY, Novy MJ, Burry KA, Warner C, Clinton GM 1995 Estrogen receptor gene expression in human uterine leiomyomata. J Clin Endocrinol Metab 80:1876–1881[Abstract]
  20. Englund K, Blanck A, Gustavsson I, Lundkvist U, Sjoblom P, Norgren A, Lindblom B 1998 Sex steroid receptors in human myometrium and fibroids: changes during the menstrual cycle and gonadotropin-releasing hormone treatment. J Clin Endocrinol Metab 83:4092–4096[Abstract/Free Full Text]
  21. Folkerd EJ, Newton CJ, Davidson K, Anderson MC, James VH 1984 Aromatase activity in uterine leiomyomata. J Steroid Biochem 20:1195–1200[CrossRef][Medline]
  22. Sholl SA, Orsini MW, Hitchins DJ 1983 Estrogen synthesis and metabolism in the hamster blastocyst, uterus and liver near the time of implantation. J Steroid Biochem 19:1153–1161[CrossRef][Medline]
  23. Yamamoto T, Takamori K, Okada H 1985 Effect of aminoglutethimide on androstenedione aromatase activity in human uterine leiomyoma. Horm Metab Res 17:548–549[Medline]
  24. Bulun SE, Simpson ER, Word RA 1994 Expression of the CYP19 gene and its product aromatase cytochrome P450 in human uterine leiomyoma tissues and cells in culture. J Clin Endocrinol Metab 78:736–743[Abstract]
  25. Casey ML, MacDonald PC, Mitchell MD, Snyder JM 1984 Maintenance and characterization of human myometrial smooth muscle cells in monolayer culture. In Vitro 20:396–403[Medline]
  26. Shozu M, Zhao Y, Simpson ER 1997 Estrogen biosynthesis in THP1 cells is regulated by promoter switching of the aromatase (CYP19) gene. Endocrinology 138:5125–5135[Abstract/Free Full Text]
  27. Shozu M, Simpson ER 1998 Aromatase expression of human osteoblast-like cells. Mol Cell Endocrinol 139:117–129[CrossRef][Medline]
  28. Novak ER, Woodruff JD 1979 Myoma and other benign tumors of uterus. In: Gynecologic and Obstetric Pathology. W. B. Saunders, Philadelphia, 8th ed.
  29. MacLusky NJ, Naftolin F 1981 Sexual differentiation of the central nervous system. Science 211:1294–1302[Abstract]
  30. Naftolin F 1994 Brain aromatization of androgens. J Reprod Med 39:257–261[Medline]
  31. Sasano H, Murakami H, Shizawa S, Satomi S, Nagura H, Harada N 1999 Aromatase and sex steroid receptors in human vena cava. Endocr J 46:233–242[Medline]
  32. Harada N, Sasano H, Murakami H, Ohkuma T, Nagura H, Takagi Y 1999 Localized expression of aromatase in human vascular tissues. Circ Res 84:1285–1291[Abstract/Free Full Text]
  33. Brodie A, Lu Q, Nakamura J 1997 Aromatase in the normal breast and breast cancer. J Steroid Biochem Mol Biol 61:281–286[CrossRef][Medline]
  34. Sasano H, Ozaki M 1997 Aromatase expression and its localization in human breast cancer. J Steroid Biochem Mol Biol 61:293–298[CrossRef][Medline]
  35. Simpson ER, Mahendroo MS, Nichols JE, Bulun SE 1994 Aromatase gene expression in adipose tissue: relationship to breast cancer. Int J Fertil Menopausal Studies 39:75–83
  36. Bulun SE, Price TM, Aitken J, Mahendroo MS, Simpson ER 1993 A link between breast cancer and local estrogen biosynthesis suggested by quantification of breast adipose tissue aromatase cytochrome P450 transcripts using competitive polymerase chain reaction after reverse transcription. J Clin Endocrinol Metab 77:1622–1628[Abstract]
  37. Santen RJ, Martel J, Hoagland M, Naftolin F, Roa L, Harada N, Hafer L, Zaino R, Pauley R, Santner S 1998 Demonstration of aromatase activity and its regulation in breast tumor and benign breast fibroblasts. Breast Cancer Res Treat 49:S93—S99
  38. Reed MJ, Purohit A 1997 Breast cancer and the role of cytokines in regulating estrogen synthesis: an emerging hypothesis. Endocr Rev 18:701–715[Abstract/Free Full Text]
  39. Bulun SE, Noble LS, Takayama K, Michael MD, Agarwal V, Fisher C, Zhao Y, Hinshelwood MM, Ito Y, Simpson ER 1997 Endocrine disorders associated with inappropriately high aromatase expression. J Steroid Biochem Mol Biol 61:133–139[CrossRef][Medline]
  40. Watanabe K, Sasano H, Harada N, Ozaki M, Niikura H, Sato S, Yajima A 1995 Aromatase in human endometrial carcinoma and hyperplasia. Immunohistochemical, in situ hybridization, and biochemical studies. Am J Pathol 146:491–500[Abstract]
  41. Bulun SE, Economos K, Miller D, Simpson ER 1994 CYP19 (aromatase cytochrome P450) gene expression in human malignant endometrial tumors. J Clin Endocrinol Metab 79:1831–1834[Abstract]
  42. Harada N, Ota H, Yoshimura N, Katsuyama T, Takagi Y 1998 Localized aberrant expression of cytochrome P450 aromatase in primary and metastatic malignant tumors of human liver. J Clin Endocrinol Metab 83:697–702[Abstract/Free Full Text]
  43. Dalla Valle L, Ramina A, Vianello S, Fassina A, Belvedere P, Colombo L 1998 Potential for estrogen synthesis and action in human normal and neoplastic thyroid tissues. J Clin Endocrinol Metab 83:3702–3709[Abstract/Free Full Text]
  44. Nawata H, Tanaka S, Takayanagi R, Sakai Y, Yanase T, Ikuyama S, Haji M 1995 Aromatase in bone cell: association with osteoporosis in postmenopausal women. J Steroid Biochem Mol Biol 53:165–174[CrossRef][Medline]
  45. Tanaka S, Haji M, Takayanagi R, Sugioka Y, Nawata H 1996 1,25-Dihydroxyvitamin D3 enhances the enzymatic activity and expression of the messenger ribonucleic acid for aromatase cytochrome P450 synergistically with dexamethasone depending on the vitamin D receptor level in cultured human osteoblasts. Endocrinology 137:1860–1869[Abstract]
  46. Gabb RG, Stone GM 1974 Uptake and metabolism of tritiated oestradiol and oestrone by human endometrial and myometrial tissue in vitro. J Endocrinol 62:109–123[Abstract/Free Full Text]
  47. Pollow K, Sinnecker G, Boquoi E, Pollow B 1978 In vitro conversion of estradiol-17ß into estrone in normal human myometrium and leiomyoma. J Clin Chem Clin Biochem 16:493–502[Medline]
  48. Severino MF, Murray MJ, Brandon DD, Clinton GM, Burry KA, Novy MJ 1996 Rapid loss of oestrogen and progesterone receptors in human leiomyoma and myometrial explant cultures. Mol Hum Reprod 2:823–828[Abstract/Free Full Text]
  49. Simpson ER, Zhao Y, Agarwal VR, Michael MD, Bulun SE, Hinshelwood MM, Graham-Lorence S, Sun T, Fisher CR, Qin K, Mendelson CR 1997 Aromatase expression in health and disease. Recent Prog Horm Res 52:185–213
  50. Simpson ER, Michael MD, Agarwal VR, Hinshelwood MM, Bulun SE, Zhao Y 1997 Cytochromes P450 11: expression of the CYP19 (aromatase) gene: an unusual case of alternative promoter usage. FASEB J 11:29–36[Abstract]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishikawa, S. Reierstad, M. Demura, A. W. Rademaker, T. Kasai, M. Inoue, H. Usui, M. Shozu, and S. E. Bulun
High Aromatase Expression in Uterine Leiomyoma Tissues of African-American Women
J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1752 - 1756.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
B. Van Voorhis
A 41-Year-Old Woman With Menorrhagia, Anemia, and Fibroids: Review of Treatment of Uterine Fibroids
JAMA, January 7, 2009; 301(1): 82 - 93.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. Aghajanova, A. Hamilton, J. Kwintkiewicz, K.C. Vo, and L.C. Giudice
Steroidogenic Enzyme and Key Decidualization Marker Dysregulation in Endometrial Stromal Cells from Women with Versus Without Endometriosis
Biol Reprod, January 1, 2009; 80(1): 105 - 114.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Ishikawa, V. Fencki, E. E. Marsh, P. Yin, D. Chen, Y.-H. Cheng, S. Reisterd, Z. Lin, and S. E. Bulun
CCAAT/Enhancer Binding Protein {beta} Regulates Aromatase Expression via Multiple and Novel Cis-Regulatory Sequences in Uterine Leiomyoma
J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 981 - 991.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
O. Bukulmez, D. B. Hardy, B. R. Carr, R. A. Word, and C. R. Mendelson
Inflammatory Status Influences Aromatase and Steroid Receptor Expression in Endometriosis
Endocrinology, March 1, 2008; 149(3): 1190 - 1204.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
H. Ishikawa, M. Shozu, M. Okada, M. Inukai, B. Zhang, K. Kato, T. Kasai, and M. Inoue
Early growth response gene-1 plays a pivotal role in down-regulation of a cohort of genes in uterine leiomyoma
J. Mol. Endocrinol., November 1, 2007; 39(5): 333 - 341.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. G. Imir, Z. Lin, P. Yin, S. Deb, B. Yilmaz, M. Cetin, A. Cetin, and S. E. Bulun
Aromatase Expression in Uterine Leiomyomata Is Regulated Primarily by Proximal Promoters I.3/II
J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1979 - 1982.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
S. E. Bulun, Z. Lin, G. Imir, S. Amin, M. Demura, B. Yilmaz, R. Martin, H. Utsunomiya, S. Thung, B. Gurates, et al.
Regulation of Aromatase Expression in Estrogen-Responsive Breast and Uterine Disease: From Bench to Treatment
Pharmacol. Rev., September 1, 2005; 57(3): 359 - 383.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Segawa, M. Shozu, K. Murakami, T. Kasai, K. Shinohara, K. Nomura, S. Ohno, and M. Inoue
Aromatase Expression in Stromal Cells of Endometrioid Endometrial Cancer Correlates with Poor Survival
Clin. Cancer Res., March 15, 2005; 11(6): 2188 - 2194.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Kasai, M. Shozu, K. Murakami, T. Segawa, K. Shinohara, K. Nomura, and M. Inoue
Increased Expression of Type I 17{beta}-Hydroxysteroid Dehydrogenase Enhances in Situ Production of Estradiol in Uterine Leiomyoma
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5661 - 5668.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. A. Rivera, S. Christopoulos, D. Small, and M. Trifiro
Hormonal Manipulation of Benign Metastasizing Leiomyomas: Report of Two Cases and Review of the Literature
J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3183 - 3188.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Shozu, K. Murakami, T. Segawa, T. Kasai, H. Ishikawa, K. Shinohara, M. Okada, and M. Inoue
Decreased Expression of Early Growth Response-1 and Its Role in Uterine Leiomyoma Growth
Cancer Res., July 1, 2004; 64(13): 4677 - 4684.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H.-J. Yang, M. Shozu, K. Murakami, H. Sumitani, T. Segawa, T. Kasai, and M. Inoue
Spatially Heterogenous Expression of Aromatase P450 through Promoter II Is Closely Correlated with the Level of Steroidogenic Factor-1 Transcript in Endometrioma Tissues
J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3745 - 3753.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Shozu, H. Sumitani, T. Segawa, H.-J. Yang, K. Murakami, T. Kasai, and M. Inoue
Overexpression of Aromatase P450 in Leiomyoma Tissue Is Driven Primarily through Promoter I.4 of the Aromatase P450 Gene (CYP19)
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2540 - 2548.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
O. Khorram, M. Garthwaite, and T. Golos
Uterine and ovarian aryl hydrocarbon receptor (AHR) and aryl hydrocarbon receptor nuclear translocator (ARNT) mRNA expression in benign and malignant gynaecological conditions
Mol. Hum. Reprod., January 1, 2002; 8(1): 75 - 80.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Shozu, H. Sumitani, T. Segawa, H.-J. Yang, K. Murakami, and M. Inoue
Inhibition of in Situ Expression of Aromatase P450 in Leiomyoma of the Uterus by Leuprorelin Acetate
J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5405 - 5411.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sumitani, H.
Right arrow Articles by Inoue, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sumitani, H.
Right arrow Articles by Inoue, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals