| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Obstetrics and Gynecology, Kanazawa University School of Medicine, 131 Takaramachi, Kanazawa 920-0934, Japan
Address all correspondence and requests for reprints to: Makio Shozu, M.D., Ph.D., Department of Obstetrics and Gynecology, Kanazawa University School of Medicine, 131 Takaramachi, Kanazawa 920-0934, Japan. E-mail: shozu{at}med.kanazawa-u.ac.jp
| Abstract |
|---|
|
|
|---|
-reductase (finasteride and flutamide).
The apparent Km of androstenedione was 3 nM in
the presence of dexamethasone and interleukin-1ß, corresponding to
the plasma concentration of androstenedione in women of reproductive
age. To determine whether endogenous aromatase P450 plays a role in the
growth promotion of leiomyoma cells, we evaluated the cell growth of
smooth muscle-like cells treated with various concentrations of
estrogen and androgen using a WST-1 assay. Treatment with testosterone
(10-8 and 10-7 M) and
androstenedione (10-8 and 10-7 M)
stimulated the growth of smooth muscle-like cells obtained from
leiomyomas to the same extent as estradiol
(10-1010-7 M), whereas
dihydrotestosterone (10-1110-8
M) did not. The stimulatory effect of testosterone on cell
growth was again abolished by cotreatment with fadrozole. The level of
estradiol in the medium of testosterone (10-8
M)-treated smooth muscle-like cells was 10-11
M, which was 1 order lower than the minimum concentration
of estradiol necessary to promote cell growth (10-10
M). This indicates that estradiol synthesized in leiomyomas
promotes their growth via an autocrine/intracrine mechanism. We
conclude that myometrial cells of leiomyomas overexpress aromatase P450
and are able to synthesize sufficient estrogen to accelerate their own
cell growth. Overexpression of aromatase P450 may play a role in the
growth advantage of leiomyoma tissue over surrounding myometrium via an
autocrine/intracrine mechanism. | Introduction |
|---|
|
|
|---|
On the other hand, endocrinological studies have revealed that the action of steroid hormones is essential for the progression of leiomyomas. Epidemiological studies indicate that many factors modifying the risk of leiomyoma development are related to unopposed estrogen. Obesity, nulliparity, breast cancer, and endometrial cancer increase the risk of development of leiomyomas, whereas conditions of low unopposed estrogen, such as uses of combined oral contraceptives, cigarette smoking, and an increasing number of term pregnancies, reduce the risk (12). In addition to estrogen, there is strong evidence that progesterone plays a role in leiomyoma growth. Use of the progesterone antagonist RU 486 induces shrinkage of leiomyomas (13), and the ability of GnRH analog (GnRHa) to shrink leiomyoma tissue is inhibited when progestin alone is readded (14, 15). Thus, both estrogen and progesterone appear to be able to promote the growth of leiomyomas. Moreover, deprivation of ovarian estrogen, as seen in women after menopause and during GnRHa therapy, diminishes leiomyoma size. Therefore, the ovary is thought to be the most important source of estrogen for leiomyoma growth. Both leiomyoma tissue and surrounding myometrium are similarly exposed to plasma estrogen derived from the ovaries, raising the question of why leiomyoma tissue is the preferential site of estrogen action. One possible explanation is the elevated expression of the estrogen receptor in leiomyomas. Increased estradiol binding in leiomyomas was demonstrated by a biochemical method a few decades ago (16, 17) and was confirmed by recent studies employing molecular techniques. The level of estrogen receptor remains static in leiomyomas and is higher than in the surrounding myometrium throughout the menstrual cycle, whereas the level of estrogen receptor in myometrium is low and varies according to the cycle (18, 19, 20). However, no direct evidence that elevated expression of estrogen receptors is responsible for the advantage growth of leiomyomas over surrounding myometrium has been published.
The other possible explanation for the preferential action of estrogen on leiomyomas is estrogen biosynthesis in situ in leiomyoma tissue. Leiomyomas have been shown to possess the ability to convert androgens to estrogen at a significant rate, whereas normal myometrial tissue has not (21, 22, 23). Bulun et al. detected a higher level of aromatase P450 transcripts, the only enzyme in humans responsible for estrogen biosynthesis, in leiomyoma tissue (24), thereby suggesting that leiomyoma cells synthesize estrogen in situ, which, in turn, contributes to the growth advantage of the leiomyoma over surrounding myometrium.
To clarify the possible role of local estrogen in situ, we quantified aromatase P450 transcripts, aromatizing activity and aromatase P450 protein in leiomyoma tissue and localized immunoreactive aromatase P450 on leiomyoma cells. We then showed that plasma androstenedione promotes the growth of leiomyoma cells, most likely via the conversion of circulating androgens to estrogen by the leiomyoma cells themselves.
| Materials and Methods |
|---|
|
|
|---|
Myometrial cells were isolated from myometrial tissue using the
enzymatic digestion method described previously (25).
Collagenase type II was obtained from Roche (Mannheim,
Germany), and deoxyribonuclease I was purchased from Sigma
(St. Louis, MO). Myometrial cells were cultured in DMEM/F-12 medium
supplemented with 10% FBS (Sigma), 100 IU/ml penicillin,
100 µg/ml streptomycin, and 100 µg/ml kanamycin (Life Technologies, Inc., Gaithersburg, MD). Smooth muscle like-cells
(SMCs) in culture were confirmed to have the characteristic features of
uterine muscle cells as previously described: fusiform shape,
expression of smooth muscle-specific
-actin, and estrogen
responsiveness (25). More than 95% of cells stained
positively with smooth muscle-specific
-actin (
-smooth muscle
actin immunohistology kit, Sigma). All experiments were
conduced on nonpassaged cells or subcultures 24. Preliminary
experiments confirmed that SMCs retain constant aromatase activity from
one through at least four passages. For proliferation assays, only
cells from the first passage were used.
Construction of aromatase DNA carrying an internal deletion
For competitive RT-PCR quantitative analysis, a DNA fragment to
act as an internal standard was constructed from aromatase
complementary DNA (cDNA; a gift from Dr. Simpson) by site-directed
deletion (Fig. 1
). A partial sequence of
aromatase cDNA (exon II to exon V) was amplified from the full-length
cDNA using primers Arom201 (GACTCTAAATTGCCCCCTCTG) and Arom202
(CTCCAACCTGTCCAGATGTGT) and was subcloned into a PCR2.1 vector (TA
cloning kit, Invitrogen, Groninge, The Netherlands). Two
partially overlapping DNA fragments were then amplified from this
vector using arom
1(ATCCTCTGAGTCGACCCTCATAATTCCACACCA) and T7
primer, and arom
2 (AGGGTCGACTCAGAGGATTTCATGCGAGTCTGG) and M13
reverse primers. PCR consisted of an initial denaturation of 2 min at
94 C, followed by 30 cycles of 20 sec at 94 C, 30 sec at 48 C, and 30
sec at 72 C. Both PCR fragments were then purified on an agarose gel
using a QIAGEN gel extraction kit (QIAGEN,
Hilden, Germany). A 1-ng sample of both fragments was added to 50 µl
PCR mixture containing 150 mM T7 primer and M13 reverse
primers, 50 mM deoxy (d)-NTPs, and 2 U Pfu
polymerase (CLONTECH Laboratories, Inc., Palo Alto, CA).
After initial denaturation at 96 C for 2 min and hybridization at 55 C,
partial heteroduplexes were elongated at 72 C and then amplified for 32
cycles (20 sec at 94 C, 30 sec at 55 C, and 45 sec at 72 C), followed
by a 7-min extension at 72 C. After extraction by phenol, PCR products
were ethanol-precipitated, digested with XbaI and
HindIII, and directionally subcloned into the corresponding
sites of the PCR2.1 vector (PCR2.1
arom). The fidelity of the
sequence was confirmed by sequencing. The resulting insert of
PCR2.1
arom contained 456 bp of aromatase P450 sequence spanning exon
II to exon V, with an internal deletion of a 107-bp fragment. An exon
II to III boundary sequence (bases 167287 from the 5'-end of exon II)
of wild-type aromatase was replaced with a TCGACTCAGAGGAT sequence,
resulting in elimination of the EcoRI site of the wild-type
sequence and introduction of a new SalI site.
|
arom, 2
mM NTPs, 10 mM
dithiothreitol, 50 U ribonuclease inhibitor (Perkin-Elmer Corp., Norwalk, CT), 1 x transcription buffer (Life Technologies, Inc.), and 50 U T7 polymerase (Life Technologies, Inc.). After 1-h incubation at 37 C, the
synthesized RNA was extracted twice with acid-phenol and chloroform,
treated twice with deoxyribonuclease (Life Technologies, Inc.), and purified using an anion exchange column (RNeasy kit,
QIAGEN). RNA was quantified by spectrophotometry, and
purity and size were confirmed by PAGE. Possible contamination by
template DNA was not detected by 40 cycles of PCR amplification even
when 50 attomol of the internal standard RNA were used as the template.
Smooth muscle
actin was similarly stained using a smooth muscle
-actin immunohistology kit (Sigma).
RT-PCR
Total RNA was extracted from the frozen tissue samples using an
Ultraspec RNA isolation kit (Biotecx, Houston, TX) according to the
manufacturers instructions. The RNA concentration was determined
spectrophotometrically. To quantify aromatase messenger RNA (mRNA), 1
µg total RNA was combined with a known amount of the competitor RNA
(usually 2 attomol/reaction, except where indicated differently). The
mixture was then heat-denatured in the presence of 50 pmol of either
random hexamer (Perkin-Elmer Corp.) or a specific primer
of aromatase (Arom 202) at 70 C for 5 min, incubated on ice for 2 min,
and reverse transcribed for 40 min at 42 C in a mixture [20 µl
containing 1 mM of each dNTP, 50 mM Tris-HCl
(pH 8.3), 40 mM KCl, 5 mM
MgCl2, 0.5% Tween-20 (vol/vol), and 30 U AMV
reverse transcriptase XL (Takara, Shuzo Co. Ltd., Shiga,
Japan)].
cDNA representing 25 ng total RNA was amplified for aromatase P450 in a 10-µl mix containing 0.25 mM Arom205 (CTCCTCACTGGCCTTTTTCTC), 0.25 mM Arom203 (GCCGAATCGAGAGCTGTAAT), 0.2 mM dNTPs, 1 x PCR buffer (Perkin-Elmer Corp.), and 2 U Taq T4 polymerase (Perkin-Elmer Corp.) by 30 cycles of 94 C for 30 sec, 58 C for 30 sec, and 72 C for 45 sec. Initial denaturation and final extension were lengthened to 3 and 7 min, respectively. A 5-µl aliquot of PCR mix was separated on agarose gel, stained with ethidium bromide, and photographed using a CCD camera system (Epi-light UV FA1100 system, AIC, Tokyo, Japan). Photographs were scanned using a scanner (GT6500, Epson, Tokyo, Japan), and quantitative analyses were performed on a Macintosh Power PC G3 (Apple Japan, Tokyo, Japan) using the NIH Image (version 1.61) program. Densitometric values were normalized to the length of the band. For a semiquantitative assay, the ratio of the densitometric value of the target to that of the internal standard was used to calculate the amount of aromatase mRNA in a given sample.
Similarly, mRNA of glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was amplified and analyzed to monitor the quality of total RNA isolated from the tissue samples. PCR was performed in a 10-µl reaction containing 25 ng cDNA, 0.25 mM G3PDH1 (CTGAGAACGGGAAGCTTGTCATCAATGG), 0.25 mM G3PDH2 (TGTGGTCATGAGTCCTTCCACGATACCA), 1 x PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, and 2 U Taq T4 polymerase for 2224 cycles of 94 C for 30 sec and 72 C for 1 min, with precycling denaturation (94 C for 2 min) and a final extension (72 C for 6 min).
Western blotting
Tissue samples (
300 mg) were homogenized in 4 ml buffer
containing 10 mM Tris-HCl (pH 7.5), 150 mM KCl,
1 mM EDTA, and 1 mM dithiothreitol using a
Waring homogenizer (Iuchi, Osaka, Japan). Homogenates were
centrifuged at 1,000 x g for 10 min to remove nuclei
and cellular debris. The supernatant was then centrifuged for 60 min at
105,000 x g, and resultant pellets were resuspended in
100 µl buffer containing 50 mM Tris-HCl, 20%
glycerol, 1 mM EDTA, and 1
mM dithiothreitol, then snap-frozen in liquid
nitrogen. Samples were stored at -80 C until use.
A 25- to 50-µg sample of microsomal protein was loaded into each lane along with a prestained protein size marker (Bio-Rad Laboratories, Inc., Hercules, CA) and a recombinant protein size marker carrying the IgG-binding domain of protein A (Oriental, Tokyo, Japan), electrophoresed on a 10% SDS-polyacrylamide gel at 18 V/cm, and electroblotted onto a polyvinylidene difluoride membrane (Micron Separations, Westboro, MA) using a wet electroblotter. After blocking in nonfat milk, incubation was carried out with antiaromatase antibody (1:5000; a gift from Dr. Harada) at 4 C for 16 h in TBS-T solution (20 mM Tris, 137 mM NaCl, and 0.1% Tween-20, pH 7.6). After extensive washing, blots were incubated with peroxidase-labeled goat antirabbit antiserum (Amersham Pharmacia Biotech, Aylesbury, UK) for 60 min and developed using an ECL Plus kit (Amersham Pharmacia Biotech) with ECL Hyperfilm (Amersham Pharmacia Biotech).
Immunohistochemistry and immunocytochemistry
Tissue samples were fixed with 3.7% formaldehyde in 10
mM PBS (pH 7.2), embedded in paraffin, and cut into
5-nm-thick sections. Primary cells were cultured on Lab-Tek plates
(Miles Scientific, Naperville, IL), similarly fixed, and used for
immunocytochemistry. Sections or Lab-Tek slides were preheated using a
microwave oven and blocked with normal goat serum. Endogenous
peroxidases were inactivated by 30-min incubation with 0.3% hydrogen
peroxide. The preparations were then incubated for 8 h at 4 C in
10 mM PBS with antiaromatase rabbit antibody used at a
1:2000 dilution and then sequentially treated with the second antibody
(biotinylated antirabbit antibody) and avidin-biotin complexes using
the Vectastain kit (Vector Laboratories, Inc., Burlingame, CA). Color was developed by incubation for 1
min with 3,3-diaminobenzidine tetrahydrochloride and 0.0006% hydrogen
peroxide in 50 mM Tris buffer (pH 7.2), followed by
counterstaining with hematoxylin.
Protein quantification
Cells in each of 12-well plates were lysed in 1 ml PBS
containing 0.5% SDS. Protein concentration was determined using a
multiplate reader (iEMS reader, Lab Systems, Dainippon Pharmaceutical
Co. Ltd., Tokyo, Japan) and a bicinchoninic acid protein assay
kit (Pierce Chemical Co., Rockford, IL). The protein
concentrations of tissue homogenates and microsomal fractions were
determined by Bradfords method (protein assay kit, Bio-Rad Laboratories, Inc.). Microsome samples were diluted 10 times in
PBS, and the protein concentration was determined similarly.
Aromatase activity
The aromatase activity of primary cells obtained from myometrium
was assayed by the formation of tritiated water from
[1ß-3H]androstenedione (NEN Life Science Products, Boston, MA) as described previously (26, 27). Aromatase activity was expressed as the rate of
incorporation of tritium into water per mg protein/12-h incubation.
Aromatase inhibitors, TZA-2209 (Teikokuzouki, Tokyo, Japan), fadrozole
(ICI Pharmacy, Tokyo, Japan), and aminoglutethimide
(Sigma), were used to confirm the fidelity of this assay.
Flutamide (Nippon Kayaku, Tokyo, Japan) and finastelide (Yamanouchi,
Tokyo, Japan), inhibitors for 5
-reductase, were also used.
Cell proliferation assay
To assess cell proliferation, SMCs were plated into 96-well
plates (1 x 105 cells/well) and
preincubated for 24 h. The SMCs were then stimulated with one of
the steroids at various concentrations for 48 h in medium
containing dextran-coated charcoal-treated serum (4%). At the end of
stimulation, 10 µl
4-[3-(4-lodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene
disulfonate (Premix WST-1, Takara) were added to each well for 45 min
at 37 C. The reduction rate of tetrazolium salts was estimated by the
increase in OD450.
[3H]Thymidine incorporation assay
To assess DNA synthesis, thymidine incorporation was measured.
SMCs derived from leiomyoma were serum starved for 24 h and then
plated into 96-well plates in DMEM/F-12 medium. After 24-h incubation,
various doses of steroid hormones were added to the wells and then
cultivated for another 12 h. The medium was replaced with medium
containing 1 µCi/ml [3H]thymidine (American
Radiolabeled Chemicals, St. Louis, MO). After incubation for 4 h,
cells were washed twice with cold PBS and twice with 5% cold
trichloroacetic acetic acid for 6 and 4 h, and then lysed with 1
N NaOH. Thymidine incorporation was determined by
scintillation counting.
RIA
Culture medium (2 ml) was extracted twice with diethyl ether.
Extracts were evaporated to dryness under nitrogen and reconstituted in
100 µl dextran-coated charcoal-treated FBS. Estradiol levels of the
extracts were then determined by RIA using an estradiol assay kit
(Diagnostic Products, Tokyo, Japan). The
sensitivity of the assay was 3 pM.
Statistical analysis
Differences in levels of transcripts and activity between two
groups were evaluated using the Mann-Whitney U test. Statistical
significance was established at the P < 0.05
level.
| Results |
|---|
|
|
|---|
|
|
|
Of the stimulants tested, phorbol myristate acetate (PMA; 16
nM) and PGE2 (100 nM)
resulted in significant increases in aromatase activity, whereas other
growth factors, such as epidermal growth factor, hepatic growth factor,
interleukin-6 (IL-6), and oncostatin M did not. Combinations including
IL-1ß (1 ng/ml) plus PGE2 (100 nM),
IL-1ß (1 ng/ml) plus dexamethasone (DEX; 25 nM), PMA (16
nM) plus PGE2 (100
nM), and 3-isobutyl-1-methylxanthine (IBMX; 100
nM), (Bu)2cAMP (100 nM),
plus PMA (16 nM) also significantly enhanced aromatase
activity (Fig. 5A
). The increase in
aromatase activity by IBMX, (Bu)2cAMP, and PMA
was eliminated by coincubation with aromatase inhibitors,
aminoglutethimide (0.2 mM), fadrozole (50 nM),
or TZA-2209 (50 µM), but was not eliminated by
coincubation with flutamide (1 µM) or finastelide
(100 nM), which are specific inhibitors of 5
-reductase
(Fig. 5B
).
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
A number of neoplastic tissues have also been demonstrated to express high levels of aromatase P450 compared with the lower or virtually zero expression seen in nonneoplastic (normal) tissue. In breast cancer, adipose stromal cells surrounding the cancer cells express aromatase P450 and convert plasma androstenedione to estrogen, which promotes cellular growth of neoplastic cells through a paracrine mechanism (33, 34, 35, 36, 37, 38). Estradiol locally synthesized elevated the local level of estradiol around the breast cancer tissue and is believed to play an important role in the progression of breast cancer, particularly in postmenopausal women (36, 37, 38). In addition, some endometrial cancers have been known to express high levels of aromatase P450 (39, 40, 41). More recently, some adrenal tumors, colon cancers, primary and metastatic liver cancers, and thyroid cancers have been reported to express aromatase P450 (42, 43). Therefore, it is not surprising that the SMCs in leiomyoma tissue express aromatase P450, similar to the other tumors described above. In fact, aromatase P450 was recently detected in SMCs in the wall of the aorta as well as the vena cava (31, 32). Locally synthesized estrogen by SMCs in these vessels is thought to play a role in protection from arteriosclerosis.
In the present study we demonstrated overexpression of aromatase P450 in leiomyoma tissue by semiquantitative RT-PCR as well as by Western blot analysis. We confirmed that aromatase P450 expressed in these leiomyomas was functional. We also showed that the major site of aromatase expression in leiomyoma tissue was in the SMCs themselves.
An important question that arises here is whether aromatase expressed in leiomyoma cells plays a role in leiomyoma growth, or whether leiomyomas synthesize enough estrogen to promote their own cell growth. To address this issue, we treated the primary cells obtained from leiomyoma tissues with various stimulants and measured cell proliferation. Both testosterone and androstenedione, aromatizable androgens, promoted the cell growth of leiomyoma cells, as did estradiol, whereas dihydrotestosterone, a nonaromatizable androgen, did not. Furthermore, the acceleration of cell growth induced by the aromatizable androgens was eliminated by the addition of selective aromatase inhibitors. These results clearly indicate that leiomyoma cells in culture possess the ability to synthesize enough estrogen to promote their own cell growth and also possess the ability to proliferate in response to estrogen synthesized in situ. Furthermore, our experiments suggest that aromatization is critical to the growth-promoting effects of testosterone. Testosterone (10-8 M) treatment, while causing significant cell proliferation, nonetheless kept the level of estradiol in the culture medium to less than the minimum level of estradiol (10-10 M) necessary to induce cell growth in culture when added to the medium. Therefore, the estrogen synthesized in leiomyoma cells, albeit a small amount, effectively stimulated cell growth of the leiomyoma cells that secreted it or of cells close by, most likely through an autocrine/intracrine mechanism. At this point, we have no evidence that in situ estrogen actually plays a role in growth promotion of leiomyomas in vivo despite the presence of an overwhelming amount of circulating estrogen from the ovary. However, there are at least two possible reasons to explain how estrogen synthesized in situ, albeit a small amount, exerts estrogenic effects on leiomyoma cells. First, without further dilution in the bloodstream, the estrogen concentration within a leiomyoma cell can reach a sufficient level to cause cell proliferation with little elevation of plasma estradiol. Second, in an intracrine mode of action, estrogen synthesized within cytoplasm can bind directly to intracellular estrogen receptor without inactivation by binding to sex hormone-binding globulin in plasma. Further research is required to confirm the physiological significance of in situ estrogen in leiomyomas.
In our experiments, androstenedione promoted cell growth at a concentration of 10-8 M or higher, whereas a 10-9 M or lower concentration of androstenedione was ineffective. This was in good agreement with the apparent Km for androstenedione determined in this experiment (3 x 10-9 M). The apparent Km of 3 x 10-9 M guarantees that aromatase P450 was almost fully functional at an androstenedione concentration of 10-8 M, whereas aromatase P450 was virtually inactive at an androstenedione concentration of 10-9 M or lower, far below the Km.
The apparent Km (3 x 10-9 M) for androstenedione corresponded roughly to the plasma level of androstenedione in women of reproductive age (44, 45). This also means that aromatase P450 expressed in SMCs in vivo is functioning as long as blood supply reaches these SMCs. Conceivably, leiomyoma tissue in vivo converts plasma androstenedione to estrogen at a significant rate, which, in turn, promotes cell growth of leiomyoma cells in vivo, as shown in our in vitro experiment. Because estrone, the direct product of aromatization of androstenedione, is a weak estrogen and needs to be further metabolized by 17ß-hydroxysteroid dehydrogenases (17ßHSD) to estradiol to show full biological activity, it is important to examine the expression in leiomyoma cells of 17ßHSD, which catalyzes the conversion between estrone and estradiol and/or between androstenedione and testosterone. The interconversion between these steroids has been reported to occur in leiomyomas at a similar or lower level than in myometrium (46, 47). Our finding that androstenedione promotes the growth of leiomyoma cells similar to testosterone also suggest the presence of 17ßHSD activity. However, whether the expression of 17ßHSD differs between leiomyoma and myometrium tissue in terms of the type(s) of 17ßHSD expressed and the regulation of their expression remains unclear.
In contrast to cells obtained from leiomyoma tissue, cells from surrounding myometrium did not respond to androgen treatment in terms of cell growth. As is shown in our results, lower expression of aromatase P450 in the surrounding myometrial cells may explain the poor response to androgens. Alternatively, insensitivity to androgens may be attributable to the low level of expression of the estrogen receptor in myometrial cells. This appears more likely because the SMCs from normal myometrium did not respond even to estradiol. It has been demonstrated that myometrium in vivo expresses a lower level of estrogen receptors than leiomyoma tissue (18, 19). Furthermore, cells obtained from leiomyoma and myometrium have been shown to lose their estrogen receptors very rapidly when cells are obtained by the minced explant method and then cultivated (48). However, there are no reports describing the level of estrogen receptor in culture of SMCs obtained by the enzymatic digestion methods used in the present study. Our preliminary experiment employing a quantitative RT-PCR was suggestive of lower expression of estrogen receptors in cells obtained from surrounding myometrium than in those from leiomyoma tissue (data not shown).
The aromatase P450 gene (CYP19) has at least seven different promoters, and the corresponding exon is immediately downstream from each promoter (26, 49). The alternate use of promoters realizes tissue-specific regulation of aromatase P450 expression. For example, the placenta uses the most distal promoter, namely promoter I.1; adipose tissues use promoter I.4, which is 20 kb downstream of promoter I.1; and the ovary primarily uses the most proximal promoter, PII. Recent studies of the overexpression of aromatase P450 in breast cancer tissue revealed that, in accordance with increases in aromatase activity, the promoter used in the breast cancer tissue switches from I.4, which is the main promoter used in disease-free breast, to promoters I.3 and PII. Various investigators are currently extensively analyzing the mechanism of promoter switching to elucidate the mechanism of overexpression of aromatase in breast cancer tissue. Only one study has determined the promoter used in leiomyoma tissue. Bulun et al. detected a PII-specific sequence and exon I.4 of aromatase P450 transcripts in leiomyoma tissue by exon 1-specific RT-PCR (24). Based on the findings that the amount of RT-PCR products was more for I.4 than for PII and that DEX did not stimulate aromatase expression in leiomyoma cells, they concluded that PII is the main promoter for leiomyoma tissue (24). In the present study we demonstrated that IL-1ß plus DEX induce aromatase activity as effectively as IBMX, (Bu)2cAMP, and PMA. A number of studies of the promoter switching of aromatase P450 (49, 50) have shown that the promoters of aromatase P450 used are similar among the many cells and tissues tested; many cells/tissues use promoter I.4 of aromatase in response to IL-1ß plus DEX and promoter PII in response to IBMX, (Bu)2cAMP, and PMA. Thus, the increase in aromatase activity in response to IL-1ß and DEX as well as IBMX, (Bu)2cAMP, and PMA indicates that both promoters I.4 and PII appear to be as active in leiomyoma cells. Further investigation employing a quantitative method is necessary to confirm this result.
The present study showed that aromatase P450 is overexpressed in leiomyoma cells and that estrogen synthesized in situ may contribute to the growth advantage of leiomyomas through an intracrine/autocrine mechanism. If this is the case, selective aromatase inhibitors, which are already successfully used for the treatment of breast cancer, might be an adjuvant therapy of conservative management by GnRHa. Further investigation is required to clarify the pathophysiolocial role and precise mechanism of aromatase P450 overexpression in leiomyoma cells.
| Footnotes |
|---|
Received April 25, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Ishikawa, S. Reierstad, M. Demura, A. W. Rademaker, T. Kasai, M. Inoue, H. Usui, M. Shozu, and S. E. Bulun High Aromatase Expression in Uterine Leiomyoma Tissues of African-American Women J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1752 - 1756. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Van Voorhis A 41-Year-Old Woman With Menorrhagia, Anemia, and Fibroids: Review of Treatment of Uterine Fibroids JAMA, January 7, 2009; 301(1): 82 - 93. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Aghajanova, A. Hamilton, J. Kwintkiewicz, K.C. Vo, and L.C. Giudice Steroidogenic Enzyme and Key Decidualization Marker Dysregulation in Endometrial Stromal Cells from Women with Versus Without Endometriosis Biol Reprod, January 1, 2009; 80(1): 105 - 114. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishikawa, V. Fencki, E. E. Marsh, P. Yin, D. Chen, Y.-H. Cheng, S. Reisterd, Z. Lin, and S. E. Bulun CCAAT/Enhancer Binding Protein {beta} Regulates Aromatase Expression via Multiple and Novel Cis-Regulatory Sequences in Uterine Leiomyoma J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 981 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bukulmez, D. B. Hardy, B. R. Carr, R. A. Word, and C. R. Mendelson Inflammatory Status Influences Aromatase and Steroid Receptor Expression in Endometriosis Endocrinology, March 1, 2008; 149(3): 1190 - 1204. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishikawa, M. Shozu, M. Okada, M. Inukai, B. Zhang, K. Kato, T. Kasai, and M. Inoue Early growth response gene-1 plays a pivotal role in down-regulation of a cohort of genes in uterine leiomyoma J. Mol. Endocrinol., November 1, 2007; 39(5): 333 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Imir, Z. Lin, P. Yin, S. Deb, B. Yilmaz, M. Cetin, A. Cetin, and S. E. Bulun Aromatase Expression in Uterine Leiomyomata Is Regulated Primarily by Proximal Promoters I.3/II J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1979 - 1982. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Bulun, Z. Lin, G. Imir, S. Amin, M. Demura, B. Yilmaz, R. Martin, H. Utsunomiya, S. Thung, B. Gurates, et al. Regulation of Aromatase Expression in Estrogen-Responsive Breast and Uterine Disease: From Bench to Treatment Pharmacol. Rev., September 1, 2005; 57(3): 359 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Segawa, M. Shozu, K. Murakami, T. Kasai, K. Shinohara, K. Nomura, S. Ohno, and M. Inoue Aromatase Expression in Stromal Cells of Endometrioid Endometrial Cancer Correlates with Poor Survival Clin. Cancer Res., March 15, 2005; 11(6): 2188 - 2194. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kasai, M. Shozu, K. Murakami, T. Segawa, K. Shinohara, K. Nomura, and M. Inoue Increased Expression of Type I 17{beta}-Hydroxysteroid Dehydrogenase Enhances in Situ Production of Estradiol in Uterine Leiomyoma J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5661 - 5668. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Rivera, S. Christopoulos, D. Small, and M. Trifiro Hormonal Manipulation of Benign Metastasizing Leiomyomas: Report of Two Cases and Review of the Literature J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3183 - 3188. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shozu, K. Murakami, T. Segawa, T. Kasai, H. Ishikawa, K. Shinohara, M. Okada, and M. Inoue Decreased Expression of Early Growth Response-1 and Its Role in Uterine Leiomyoma Growth Cancer Res., July 1, 2004; 64(13): 4677 - 4684. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Yang, M. Shozu, K. Murakami, H. Sumitani, T. Segawa, T. Kasai, and M. Inoue Spatially Heterogenous Expression of Aromatase P450 through Promoter II Is Closely Correlated with the Level of Steroidogenic Factor-1 Transcript in Endometrioma Tissues J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3745 - 3753. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shozu, H. Sumitani, T. Segawa, H.-J. Yang, K. Murakami, T. Kasai, and M. Inoue Overexpression of Aromatase P450 in Leiomyoma Tissue Is Driven Primarily through Promoter I.4 of the Aromatase P450 Gene (CYP19) J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2540 - 2548. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Khorram, M. Garthwaite, and T. Golos Uterine and ovarian aryl hydrocarbon receptor (AHR) and aryl hydrocarbon receptor nuclear translocator (ARNT) mRNA expression in benign and malignant gynaecological conditions Mol. Hum. Reprod., January 1, 2002; 8(1): 75 - 80. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shozu, H. Sumitani, T. Segawa, H.-J. Yang, K. Murakami, and M. Inoue Inhibition of in Situ Expression of Aromatase P450 in Leiomyoma of the Uterus by Leuprorelin Acetate J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5405 - 5411. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |