| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Laboratory of Neuroendocrinology, The Babraham Institute, Cambridge, United Kingdom CB2 4AT; INSERM, U-378, Institut Francois Magendie (P.C.), F33077 Bordeaux, and INRA, Station de Physiologie de la Reproduction (A.C.), 37380 Nouzilly, France
Address all correspondence and requests for reprints to: Dr. Allan E. Herbison, Laboratory of Neuroendocrinology, The Babraham Institute, Cambridge, United Kingdom CB2 4AT. E-mail: allan.herbison{at}bbsrc.ac.uk
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and
that NKB-immunoreactive fibers were found in close proximity to
approximately 40% of GnRH neurons located in the rostral preoptic area
as well as intermingled with GnRH fibers in the median eminence. The
analysis of male and female brains revealed a marked female-dominant
sex difference in the numbers of NKB neurons, and sections obtained
from in utero androgen-treated females indicated that
this sex difference resulted from an organizational influence of
testosterone during neural development. In adult ovariectomized ewes,
in situ hybridization studies failed to detect any
significant effect of 8- to 26-h exposure of estrogen on cellular NKB
messenger RNA levels. Together, these studies identify the first
sexually differentiated neuronal cell population in the ovine
hypothalamus and, remarkably, show that essentially all of these
female-dominant NKB neurons express estrogen receptors. Although these
neurons may be involved in any number of steroid-dependent, sexually
differentiated functions in the sheep, the neuroanatomical evidence for
potential NKB inputs to GnRH neurons suggests a role for this novel
population in the regulation of reproductive function. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Together, these initial observations indicate that the NKB neurons in
the ARN may be regulated by estrogen and that they could represent a
relatively conserved estrogen-receptive neuronal population within
mammalian species. Furthermore, the positive correlation between
elevated NKB expression and LH secretion (5, 11) suggests
a possible role in the steroid-dependent regulation of the GnRH
network. In the present series of experiments we have examined these
hypotheses in the sheep, a well established animal model for examining
the neuroendocrine regulation of gonadotropin secretion
(12). Specifically, we have determined 1) whether NKB
might also be expressed in the ARN of this species and, if so, what its
relationship to ER and GnRH immunoreactivity might be; 2) whether
NKB neurons represent a sexually dimorphic population in this species,
another important characteristic if they are to have role a in
regulating LH release; and 3) whether NKB messenger RNA (mRNA)
expression may change over the course of the estrogen-induced LH surge
in the sheep.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Exp 1. Determination of the location of the NKB neuronal
system within the ovine hypothalamus together with investigation of
ER expression in these cells and of their relationship with GnRH
neurons were undertaken in five intact adult Ile-de-France ewes killed
during the breeding season (September-December). Ewes were decapitated,
and both carotid arteries were catheterized. Two liters of 0.9% saline
solution followed by 4 liters 4% paraformaldehyde in PBS (pH 7.8) were
then passed into the carotid arteries using an automatic pump over a
period of approximately 15 min. The brains were removed and placed in
the fixative solution overnight. Blocks of tissue containing the
hypothalamus were then dissected and immersed in a 15% sucrose
solution at 4 C for 1–2 days before 60-µm-thick coronal sections of
the entire hypothalamus were cut on a freezing microtome. The sections
were maintained in cryoprotectant at -20 C until immunocytochemical
analysis was undertaken.
Exp 2. The investigation of the potential sexually dimorphic nature of the NKB neurons was performed on brain sections taken from male (n = 7), female (n = 7), and androgenized female (n = 7) Poll Dorset sheep. The LH secretion profiles of all of these sheep, showing the complete sex reversal of the androgenized females, have been reported recently (13). In brief, pregnant ewes were divided into two groups, with one receiving biweekly im injections of testosterone proprionate (100 mg; Sigma, Dorset, UK) from days 30–90 of gestation (term, 147 days) while the other group did not received any injection. The lambs were all gonadectomized between 3–5 weeks of age and immediately given a 3-cm SILASTIC implant (Dow Corning Corp., Midland, MI) containing crystalline estradiol, which maintains estradiol levels (8–12 pg/ml) within the physiological range. Animals were killed at 2 yr of age, 2 weeks after the removal of all gonadal steroid implants.
Animals were anesthetized and decapitated, and both carotid arteries were catheterized. Approximately 0.5 liter heparinized saline followed by 3 liters 4% paraformaldehyde in PBS (pH 7.4) were then infused into the carotids using an automatic pump over a period of 20 min. The brain was removed, and a block of tissue containing the hypothalamus was dissected and placed in the fixative solution for a further 24 h before immersion in a 30% sucrose, Tris-buffered saline (TBS) solution (pH 7.4) for 1–2 days. Coronal sections (30 µm thick) were then cut on a freezing microtome and maintained in cryoprotectant at -20 C until immunocytochemical analysis was undertaken.
Exp 3. The acute effects of estrogen on NKB mRNA expression in the ewe were examined using one set of brain sections prepared as part of an earlier study that investigated the profile of GnRH mRNA expression over the course of the estrogen-induced LH surge in the Clun-Forest ewe (14). In brief, ewes in that study were ovariectomized and run through two artificial 14-day estrous cycles. After the first artificial cycle in which the timing of the LH surge was noted for each individual ewe, animals were split into two groups, and received either estradiol implants (4 x 3 cm) or sham implants. Ewes were then anesthetized and killed at one of several time points in relation to the time of capsule implantation and the predicted onset of the LH surge; pre-E (n = 6), immediately before estradiol insertion; presurge (n = 5), 8 h after estradiol insertion, but before the onset of the LH surge; ascending limb (n = 8), 22.4 ± 1.5 h after the estradiol implant and 2–6 h after the start of the LH surge; or midpeak (n = 7), 26.2 ± 0.7 h after estradiol implant and just after the peak of the LH surge. Five ewes receiving the control treatment were killed alongside the estradiol-implanted ewes at each time point, except that of pre-E. Blood samples were taken from all animals at 30- to 60-min intervals up until the time of death, and the LH secretion profiles of ewes in each of these groups were reported previously (14). Ewes were decapitated, the brains were rapidly removed, and blocks of tissue containing the hypothalamus were frozen on dry ice. Tissue was kept at -70 C until 15-µm-thick coronal sections through the hypothalamus were cut on a cryostat (Bright, Huntingdon, UK), mounted onto Vectabond (Vector Laboratories, Inc., Peterborough, UK)-coated slides, and stored at -70 C.
Immunocytochemistry procedures
NKB single labeling immunocytochemistry. Free floating
sections were washed in 40% methanol/TBS/1%
H2O2 solution for 5 min to
deactivate endogenous peroxidases, washed in TBS, and then incubated
for 40 h at 4 C in a polyclonal guinea-pig antiserum specific for
NKB (1:6000; IS-3/61), which was raised against a 40-amino acid peptide
sequence (P2) immediately N-terminal to NKB within the precursor
protachykinin B precursor (9, 15). Sections were next
placed in biotinylated rabbit antiguinea-pig Igs (1:400; Vector Laboratories, Inc.) for 4 h at room temperature, and
immunoreactivity was revealed with the glucose oxidase nickel-enhanced
diaminobenzidene tetrahydrochloride (Ni-DAB) technique as reported
previously (16, 17). Adsorption experiments were
undertaken using primary antibody that had been incubated overnight at
working dilution with 10-5 M P2
peptide.
Dual labeling of NKB and ER or GnRH. The dual labeling of
NKB and ER was undertaken using a previously reported protocol in
the sheep brain (17, 18). Briefly, immunostaining was
first performed for ER using a monoclonal mouse antibody specific
for the N-terminal domain of the human ER, which has been well
characterized for use in the ovine brain (ID5, 1:10 supernatant;
40 h at 4C; gift from G. Delsol, Toulouse, France; now available
from DAKO Corp., Carpenteria, CA) (17, 18).
Biotinylated horse antimouse Igs (1:400; Vector Laboratories, Inc.) were then applied for 90 min at room temperature, followed
by the Vector Elite Kit (1:100; Vector Laboratories, Inc.;
90 min at room temperature) with visualization of peroxidase performed
with Ni-DAB. Sections were then washed in TBS and processed for NKB
immunocytochemistry as described above, but using DAB alone without the
nickel as a chromagen.
The potential relationship between NKB and GnRH populations was investigated using a similar sequential double immunocytochemistry procedure. NKB immunoreactivity was first revealed using Ni-DAB as described above, followed by staining for GnRH using a polyclonal rabbit antiserum (LR1; 1:20,000; 40 h at 4 C; gift from R. Benoit, Montréal, Canada) as described previously in the ovine brain (16, 19). Sections were then washed and placed in peroxidase-labeled antirabbit Igs (1:400; Vector Laboratories, Inc.; 4 h at room temperature), and immunoreactivity was revealed with DAB alone.
Analysis. Analysis of the distribution of dual labeled
NKB-ER cells, and NKB immunoreactivity in male, female, and
androgenized female sheep was undertaken in mediobasal hypothalamic
sections extending from the rostral to the caudal end of the ARN. The
ARN was divided into rostral (rARN), middle (mARN), and caudal (cARN)
divisions on the basis of gross mediobasal hypothalamus anatomy and,
where appropriate, ER staining (20). Sections containing
the rARN were those where the supraoptic nucleus still existed, and the
ventricular wall remained vertical at the median eminence (plate H in
Ref. 20 ; Fig. 1A
); mARN
sections were those where the fornix was midway down the length of the
third ventricle, and the infundibular recess of the third ventricle was
beginning to appear (plate I in Ref. 20 ; Fig. 1B); cARN
sections were those where the infundibular recess of the third
ventricle was at its full extent (plate J in Ref. 20).
Cells were considered double labeled if a complete ring of cytoplasmic
DAB staining was encountered around a Ni-DAB-stained nucleus. Single
labeled cells either exhibited nuclear Ni-DAB staining alone or a DAB
cell profile with nuclear exclusion of immunoreactivity. For each
animal, mean cell profile values for each of these three regions were
obtained by counting all immunostained cells in a minimum of three
coronal brain sections at each level. In Exp 2, we estimated the cell
size of immunoreactive NKB neurons by drawing around the cytoplasmic
perimeter of stained cells using a Seescan Sonata II image analyzer
(Seescan, Cambridge, UK), which then determined the two-dimensional
cell area. Statistical analyses were undertaken using ANOVA with
post-hoc Tukey-Kramer multiple comparisons.
|
In situ hybridization procedure
In situ hybridization was performed as previously described
(13) using a 25-mer synthetic oligonucleotide
(CCCACAAAGAAGTCATGCATGTCAC; Genosys-Sigma, Pampisford, UK)
complementary to human, bovine, and mouse prepro-NKB mRNA. Briefly,
brain sections were fixed with 4% paraformaldehyde in 0.1
M PBS, dehydrated through a series of increasing alcohol
concentrations, and allowed to air-dry. Hybridization buffer [20
x SSC (saline sodium citrate), 50% deionized formamide, 10% dextran
sulfate, 1 x Denhardt’s solution, 250 µg/ml sheared salmon
testicular DNA, and 0.3% ß-mercaptoethanol] containing the
35S-labeled NKB probe was then applied to each
slide (250 µl) containing three brain sections. Hybridization was
carried out in humidified chambers at 37 C overnight. Hybridized
sections were washed in 1 x SSC at room temperature, three times
in 1 x SSC at 55 C (30 min each), and again in 1 x SSC for
1 h at room temperature. Sections were then dipped in Ilford K-5
nuclear track emulsion and exposed for 3 months in light-tight boxes.
All slides were developed with Ilford Phenisol and lightly
counterstained with methylene blue. Hybridization specificity was
assessed by comparison with the cell body distribution after NKB
immunostaining and use of competition experiments in which probes were
hybridized to sections in the presence of a 50-fold excess of unlabeled
NKB probe.
Analysis. The number of cells expressing NKB mRNA was determined for each animal by counting the number of positively hybridized cells in the cARN. Cells were considered to be positively hybridized when silver grains were found clustered over a methylene blue-counterstained cell body.
The cellular NKB mRNA content was assessed by analyzing silver grain density over individual cells in the cARN using a Seescan Sonata II image analyzer coupled to a Leica Corp. Orthoplan microscope (Rockleigh, NJ) as reported previously (14). With this system the operator outlines the silver grain cluster over each cell, and a silver grain density is determined. A minimum of 30 hybridized cells were analyzed from 2 different sections in each ewe. Individual values were used to provide an average silver grain density for each animal, and these values used to form group means at each time point. Statistical analysis between time points within the control and estrogen-treated experimental groups were assessed using ANOVA with Tukey’s post-hoc test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and
GnRH
) with only a small number identified in the median eminence
(ME). The distribution of this neuronal population exhibited a clear
rostrocaudal topography, with the majority of immunoreactive cells
being found in the middle and caudal parts of the ARN (Fig. 1). Outside
of the ARN, NKB-immunoreactive cell body staining was also found in the
POA, although the numbers of immunoreactive cells were very few (<2
cells/section). Fibers immunoreactive for NKB were identified
throughout the hypothalamus as well as the POA, lateral septum, and the
bed nucleus of the stria terminalis, but were particularly prominent in
the paraventricular nuclei and ARN. Control experiments using adsorbed
NKB antibody resulted in a complete absence of immunoreactivity.
The distribution of ER-immunoreactive cells in the ARN was identical
to that reported previously in the ewe (17, 20). Double
labeled cells were easily identified by the prominent Ni-DAB staining
of the nucleus (ER) combined with the brown granular DAB
immunoreactivity (NKB) of the cytoplasm (Fig. 2, A and B). Dual labeling
immunocytochemistry revealed that essentially all NKB-immunoreactive
cells throughout the ARN expressed ER immunoreactivity (Fig. 2A). A
quantitative analysis of the dual labeling in the Ile-de-France
ewes showed that 96.8 ± 0.2% of the NKB-positive cells expressed
ER immunoreactivity. Control experiments in which the NKB antibody
was omitted in the second immunostaining resulted in a complete absence
of brown DAB staining.
|
) to 24 ± 2% of the GnRH
neurons located in the DBB, 39 ± 4% of those in the rPOA, and
23 ± 6% of those in the AHA (Fig. 3). No other topographical pattern of
association between NKB fibers and GnRH neurons was detected (Fig. 3).
NKB fibers were also found intermingled with GnRHimmunoreactive
fibers in the ME of all animals (Fig. 2C).
|
). A closer analysis on a rostrocaudal
basis revealed that this difference was most apparent in the cARN,
where NKB cells are most abundant (Fig. 5; 85 ± 13, 42 ± 4 and
48 ± 5 NKB-immunoreactive neurons per hemisection in females,
androgenized females, and males, respectively; P <
0.01). No significant sex differences were detected in the rARN or mARN
(Fig. 5). We also found that the relative cell size of NKB neurons, as
assessed by NKB immunostaining, was significantly reduced in males
(133 ± 3 µm2) and androgenized females
(136 ± 7 µm2) compared with that in
normal ewes (177 ± 5 µm2;
P < 0.01). Although not quantified, NKB fiber density
in the ARN also appeared reduced in the male and androgenized female
sheep compared with that in the untreated ewes (Fig. 4).
|
|
) with a topography identical to that
observed with NKB immunocytochemistry. No silver grain clusters were
detected after hybridization in the presence of excess unlabeled probe.
The largest number of hybridized cells was localized to the caudal part
of the nucleus, where a quantitative analysis of cellular silver grain
density was undertaken. The numbers of hybridized cells detected in the
various groups did not exhibit any significant differences. Mean
(±SEM) numbers of hybridized cells per hemisection were
61 ± 1, 75 ± 8, 69 ± 3, and 73 ± 9 in pre-E,
presurge, ascending limb, and midpeak groups and 70 ± 10, 58
± 6, and 64 ± 13 in the three control groups, respectively.
Equally, despite a trend for increased NKB expression 8 h after
estrogen, we detected no significant differences in cellular silver
grain density across the four time points in E-treated ewes or in
relation to the controls (Fig. 7).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We demonstrate here, using dual labeling immunocytochemistry, that
essentially all NKB neurons in the ovine ARN express ER. This degree
of ER synthesis is quite remarkable given the marked heterogeneity and
often low level of ER coexpression observed in other neuronal
phenotypes of the sheep (21) and other species
(2). Previous ER dual labeling studies in the ARN
nucleus have only identified approximately 20% of ß-endorphin
(22) and 15% of neuropeptide Y (17) neurons
to contain ER immunoreactivity in the sheep, and similar low
percentages are evident in the rat (23). Intriguingly,
studies in the male rat have similarly shown that all NKB neurons in
the ARN express the androgen receptor (15). As such, these
results suggest that the NKB neuronal population of the hypothalamic
ARN is probably a highly gonadal steroid-sensitive neuronal
population.
We also show that the NKB neurons of the ARN represent a sexually dimorphic neuronal population. Again, to the best of our knowledge, these neurons represent the first sexually differentiated cell population identified in the ovine hypothalamus. It also appears that sex differences in NKB have not been examined or reported in any other species. This female-dominant sex difference in the ewe was only observed at the level of the caudal ARN; however, this is where approximately 70% of all hypothalamic NKB-expressing cells are found. Using brain tissue from sheep exposed to androgens between days 30 and 90 of gestation, we have been able to demonstrate that this sex difference is engendered in a seemingly classic organizational manner during early development. The absence of any significant effects of estrogen on NKB mRNA expression in the ovariectomized adult female provides some initial evidence that activational effects of gonadal steroids may not contribute further to this sex difference in this species. The androgenization model used in this study (13) is well established to permanently masculinize a wide range of physiological and behavioral axes in the ewe, including that of gonadotropin secretion (24, 25). Thus, it appears reasonable at this stage to speculate that the highly estrogen-sensitive, female-dominant NKB neurons of the ARN may play a role in one or several of these sexually differentiated features of the sheep.
As the gonadotropic axis of the prenatally androgenized female sheep is
unable to respond appropriately to estrogen or progesterone feedback at
the level of the hypothalamus (13, 25), it is tempting to
hypothesize that the NKB neuronal population identified in this study
may play a role in the regulation of GnRH neurons. Using dual labeling
immunocytochemistry we first examined whether a direct relationship
between NKB fibers and GnRH neurons may be possible. Although
observations at the level of the conventional light microscope cannot
determine connectivity, it is nevertheless interesting that a large
number of NKB-immunoreactive fibers were identified to be in close
proximity to GnRH cell bodies. Indeed, we found that the greatest
number of GnRH perikarya in proximity to NKB fibers (
40%) occurred
at the level of the rostral preoptic area, where GnRH neurons
expressing Fos are concentrated at the time of the GnRH surge
(26). We also noted an overlapping distribution of NKB and
GnRH fibers in the ME. Both of these areas are known to express the
neurokinin-3 receptor, specific for NKB, in rat (27).
Thus, at a neuroanatomical level, these results suggest the possibility
that NKB may regulate the activity of the GnRH neurons. Although the
origin of these NKB fibers in close apposition to GnRH neuronal
elements is unknown, the observation of substantial projections from
estrogen-sensitive ARN neurons to both the rPOA (18) and
ME (28) and the location of NKB cells almost exclusively
within the ARN indicate the likelihood that these afferents originate
from ER-expressing NKB neurons of the ARN.
If estrogen-receptive NKB neurons are involved in transmitting estrogen input to the GnRH neurons in a classic transsynaptic manner (2), it seemed possible that levels of NKB gene expression in these cells might be regulated by estrogen. Because of the putative association of NKB fibers with rPOA GnRH neurons and the female-dominant nature of NKB sex differences, we investigated here whether estrogen may regulate NKB mRNA levels in brain sections obtained from an ovine model of estrogen-positive feedback (14). Previous work undertaken on tissue from these animals had shown that GnRH mRNA levels declined before the LH surge in this species (14). Contrary to our hypothesis, we found that cellular NKB mRNA levels in the cARN did not change significantly over four time points up to and including 26 h after estrogen administration. Although it remains possible that estrogen exerted a short-lived and relatively fast (<8 h) effect on NKB, we have not been able to provide any definitive evidence for the modulation of NKB mRNA expression by estrogen in the ovariectomized ewe. However, investigations by Rance and colleagues (3, 5, 10) in the monkey and human have suggested that estrogen does impact on NKB gene expression in the primate. Interestingly, in all of those studies the endogenous or exogenous steroid manipulations took place over several days to weeks, and it is possible that NKB synthesis is not regulated in the short term as investigated here. In support of this hypothesis, work in the rat has shown that a single injection of estrogen was without any effect on NKB immunoreactivity, whereas a 2-week treatment with estrogen resulted in a decrease in the number of NKB cells detected in the ARN (29).
In summary, we report here the identification of a
female-dominant, sexually dimorphic neuronal population in which
essentially all NKB neurons express ER in the ARN of the ovine
brain. By association, it is very likely that these NKB neurons play a
role in the gonadal steroid regulation of sexually differentiated
functions in this species. We further provide neuroanatomical evidence
suggesting that these NKB neurons may innervate GnRH neurons in the
ewe and hypothesize that they may play a role in the estrogen-dependent
regulation of the GnRH network. However, we have been unable to provide
evidence for the regulation of NKB mRNA expression by estrogen in
relation to the induction of the GnRH surge. Thus, estrogen may alter
NKB neuronal function through other mechanisms or, as suggested in
other species, in a longer term manner. The characterization here of a
sexually dimorphic, highly estrogen-receptive neuronal population that
may be highly conserved in mammals should provide the basis for
examining the role of NKB in a variety of gonadal steroid-dependent
reproductive functions.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received May 24, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-containing
neurons projecting to the vicinity of the gonadotropin-releasing
hormone perikarya in the rostral preoptic area of the rat. J Comp
Neurol 411:346–358[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  J. T. Smith, Q. Li, A. Pereira, and I. J. Clarke Kisspeptin Neurons in the Ovine Arcuate Nucleus and Preoptic Area Are Involved in the Preovulatory Luteinizing Hormone Surge Endocrinology, December 1, 2009; 150(12): 5530 - 5538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Oakley, D. K. Clifton, and R. A. Steiner Kisspeptin Signaling in the Brain Endocr. Rev., October 1, 2009; 30(6): 713 - 743. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. M. Navarro, M. L. Gottsch, C. Chavkin, H. Okamura, D. K. Clifton, and R. A. Steiner Regulation of Gonadotropin-Releasing Hormone Secretion by Kisspeptin/Dynorphin/Neurokinin B Neurons in the Arcuate Nucleus of the Mouse J. Neurosci., September 23, 2009; 29(38): 11859 - 11866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Goodman, M. N. Lehman, J. T. Smith, L. M. Coolen, C. V. R. de Oliveira, M. R. Jafarzadehshirazi, A. Pereira, J. Iqbal, A. Caraty, P. Ciofi, et al. Kisspeptin Neurons in the Arcuate Nucleus of the Ewe Express Both Dynorphin A and Neurokinin B Endocrinology, December 1, 2007; 148(12): 5752 - 5760. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Foradori, M. Amstalden, L. M. Coolen, S. R. Singh, C. J. McManus, R. J. Handa, R. L. Goodman, and M. N. Lehman Orphanin FQ: Evidence for a Role in the Control of the Reproductive Neuroendocrine System Endocrinology, October 1, 2007; 148(10): 4993 - 5001. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Rometo, S. J. Krajewski, M. Lou Voytko, and N. E. Rance Hypertrophy and Increased Kisspeptin Gene Expression in the Hypothalamic Infundibular Nucleus of Postmenopausal Women and Ovariectomized Monkeys J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2744 - 2750. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Q. Xiao, K. L. Grove, S. Y. Lau, S. McWeeney, and M. S. Smith Deoxyribonucleic Acid Microarray Analysis of Gene Expression Pattern in the Arcuate Nucleus/Ventromedial Nucleus of Hypothalamus during Lactation Endocrinology, October 1, 2005; 146(10): 4391 - 4398. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Patak, F. M. Pinto, M. E. Story, C. O. Pintado, A. Fleming, N. M. Page, J. N. Pennefather, and M. L. Candenas Functional and Molecular Characterization of Tachykinins and Tachykinin Receptors in the Mouse Uterus Biol Reprod, May 1, 2005; 72(5): 1125 - 1133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Sliwowska, H. J. Billings, R. L. Goodman, L. M. Coolen, and M. N. Lehman The Premammillary Hypothalamic Area of the Ewe: Anatomical Characterization of a Melatonin Target Area Mediating Seasonal Reproduction Biol Reprod, June 1, 2004; 70(6): 1768 - 1775. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Hestiantoro and D. F. Swaab Changes in Estrogen Receptor-{alpha} and -{beta} in the Infundibular Nucleus of the Human Hypothalamus Are Related to the Occurrence of Alzheimer's Disease Neuropathology J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1912 - 1925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Dellovade and I. Merchenthaler Estrogen Regulation of Neurokinin B Gene Expression in the Mouse Arcuate Nucleus Is Mediated by Estrogen Receptor {alpha} Endocrinology, February 1, 2004; 145(2): 736 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. O. Pintado, F. M. Pinto, J. N. Pennefather, A. Hidalgo, A. Baamonde, T. Sanchez, and M. L. Candenas A Role for Tachykinins in Female Mouse and Rat Reproductive Function Biol Reprod, September 1, 2003; 69(3): 940 - 946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Foradori, L. M. Coolen, M. E. Fitzgerald, D. C. Skinner, R. L. Goodman, and M. N. Lehman Colocalization of Progesterone Receptors in Parvicellular Dynorphin Neurons of the Ovine Preoptic Area and Hypothalamus Endocrinology, November 1, 2002; 143(11): 4366 - 4374. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. G. Cintado, F. M. Pinto, P. Devillier, A. Merida, and M. L. Candenas Increase in Neurokinin B Expression and in Tachykinin NK3 Receptor-Mediated Response and Expression in the Rat Uterus with Age J. Pharmacol. Exp. Ther., December 1, 2001; 299(3): 934 - 938. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) for
8 h (Pre-surge), 22 h (Ascend), and 26 h (Mid-peak)
compared with ewes given no estrogen (
) but killed at the same time.
The Pre-E group was killed before estrogen administration. Names refer
to the state of the LH surge as defined previously for these animals
(