| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Molecular Reproduction Research Laboratory, Clinical Research Institute of Montréal, Montréal, Québec H2W 1R7, Canada
Address all correspondence and requests for reprints to: M. Ram Sairam, Ph.D., Molecular Reproduction Research Laboratory, Clinical Research Institute of Montréal, 110 Pine Avenue West, Montréal (Québec), H2W 1R7, Canada. E-mail: sairamm{at}ircm.qc.ca
| Abstract |
|---|
|
|
|---|
and ß
genes and the corresponding proteins in the ovary and uterus of FORKO
mice appear to be intact. The loss of ovarian estrogen creates an
imbalance in A and B forms of the progesterone receptor in the uterus
of both heterozygotes and null mutants. Some of the changes we have
documented here in FORKO mice are reminiscent of the ovarian
dysfunction and other major symptoms that are usually associated with
estrogen deficiency. In null mutants, estradiol-17ß administration
promptly induced uterine growth and reversed the accumulation of
adipose tissue indicating that estrogen receptors are functional. Thus,
the phenotypes evident in these genetically altered FSH-R mutants may
provide an experimental system to explore the effects of estrogenic
compounds on different targets including the ovary in a nonsurgical
setting. | Introduction |
|---|
|
|
|---|
Although there is extensive structural and functional similarities among the oligomeric glycoprotein hormones that also includes pituitary TSH, each ligand is highly selective in its binding to specific receptor(s) in target cells. In the female, the FSH-R is expressed exclusively in the granulosa cells of the developing ovary where it coordinates the growth of the follicle to support ovum maturation (11). The FSH-Rs in follicles destined to become dominant and ovulate come under the influence of neuroendocrine mechanisms via the secretion of pituitary FSH.
The important role of pituitary FSH signaling in ovarian development and function has been reinforced by recent genetic studies in humans as well as experimental animals. Finnish women homozygous for a point mutation, which alters a single amino acid Ala 189 to Val, are infertile due to primary amenorrhea. This mutation in the 7th exon of extracellular domain of the receptor leads to a large reduction in FSH-R signaling compromising ovarian development (12, 13). Men with the same mutation also show deficient testicular function and infertility to varying degree (14). A different receptor mutation of the activating type (D567G) in the third intracytoplasmic loop supports spermatogenesis and fertility in a man without the need for the pituitary hormone, FSH (15). Some genetic mutations of the hormone FSH-ß subunit leading to premature terminations in the mRNA produce a nonfunctional hormone causing infertility in the affected individuals (16, 17, 18). Similarly, female mice where one of the exons of the FSH-ß subunit has been disrupted by homologous recombination are also infertile because of failure of ovarian development beyond a critical stage (19).
The critical role of FSH receptor signaling for gonadal function to
ensure species propagation emphasizes why mutations in the ligand and
receptor are not common. To understand in more detail the physiological
role of FSH-R signaling, we recently generated mutant mice in which all
forms including the alternatively spliced variants of the receptor have
been eliminated (4). Mutant females exhibit profound
changes in ovarian structure and secondary sex organs that remain
infantile. Lack of ovulation causes sterility in the mutants. The
overall phenotype mimics hypergonadotropic-hypogonadism seen in
infertile women. Further analysis of these mutant females was prompted
by the severe atrophy of the uterus as well as important visible
external changes that developed upon aging. Evidence presented here
reveals that FSH-R gene disruption causes complete loss of estrogen
production from the ovary. As one of the important steroid hormones in
the body, estrogen has genomic as well as nongenomic effects
(20). Its genomic actions are exerted via nuclear
receptors of which two (ER-
,ß) are presently well characterized
(21, 22). Our work demonstrates that lack of estrogen due
to the loss of FSH-R signaling in mice also causes important metabolic
alterations that induce obesity and skeletal abnormalities. These
disturbances are similar to changes that occur in postmenopausal women
whose ovaries cease to function following the cessation of reproductive
life and natural loss of FSH-Rs despite the presence of high hormone
(FSH) levels in circulation. Because heterozygous female mice also
undergo early senescence and exhibit the above abnormalities around
this time, these mutants may be useful in exploring the physiological
and molecular changes associated with loss of estrogens actions. As
part of the phenotypic characterization of the null mutants, we show
that some of the effects consequent to the loss of FSH-R are fully
reversed by treatment with estradiol-17ß. Henceforth, we will refer
to the FSH-R null mutants as FORKO (follitropin receptor knock out)
mice. Portions of these data have been presented in preliminary form
(23, 24).
| Materials and Methods |
|---|
|
|
|---|
Estrous cycle
Three groups of adult (33.5 months of age) virgin female mice
were used: homozygous mutants (n = 15), heterozygous (n =
15), and wild-type mice (n = 10). After one week of adaptation,
the mice were examined for vaginal patency, and smears were taken daily
by lavage for at least five cycles to establish the length of the
estrous cycle. The estrous cycles pattern was assessed by daily
examination of cellular composition of vaginal washings.
Collection of blood and adipose tissue
Heterozygous and wild-type mice were anesthetized on the morning
of proestrus, as determined by the appearance of the vaginal smears.
Because FORKO females were acyclic, they were used randomly on a
selected day between 1000 h and 1200 h. For measurement of
plasma steroid hormone levels, blood samples were collected by cardiac
puncture into plastic centrifuge tubes containing EDTA. After
centrifugation for 15 min at 2,500 x g, the plasma was stored at
-20 C until used. Abdominal, inguinal, and retroperitoneal fat was
dissected and weighed.
Histological assessment of uteri, ovaries, and vaginae
After exsanguination, the tissues (ovaries, uterus, and vagina)
were removed and cleaned of fat and mesentery, blotted on filter paper,
and weighed to the nearest 0.1 mg. These tissues were then fixed in
10% buffered formalin for 24 h, and processed in a tissue
processor for paraffin embedding. The 5-µm sections were cut and
stained by standard protocols with hematoxylin and eosin. Histological
examination of the tissues was performed by light microscopy.
Assessment of skeletal abnormalities in FORKO female mice
To record skeletal changes, 4-month-old female mice under
anesthesia were x-rayed in the animal facility. After taking the x-ray,
some animals were killed and the weight of the right femur was taken.
The femur was placed in 10% formalin for 24 h and then in 2
N HCl for decalcification. The bones were dehydrated in
gradient of alcohol followed by xylene and then embedded in paraffin.
Longitudinal sections of 5 µm were cut and stained using hematoxylin
and eosin protocol. Bone marrow cells were prepared from the right and
left tibiae as described previously by Masuzawa et al.
(25) by flushing out the bone marrow with
Ca2+- and Mg2+-free PBS
using a syringe with a 27-gauge needle. The cells were centrifuged and
resuspended in 2 ml of ammonium chloride-Tris buffer to lyse red blood
cells. The cell suspension was washed with PBS three times, and
resuspended in 1 ml of PBS containing 1% BSA. The cells (1 x
106) were then incubated for 30 min on ice with
FITC-conjugated B220 (RA36B2; PharMingen), washed twice,
and resuspended in free PBS containing 1% BSA. Stained cells were
analyzed on a Coulter flow cytometer. Unstained cells were used as
controls.
RT-PCR and Western blotting
RNA from ovary and uterus was extracted using Ambion, Inc. (USA) Midi RNA isolation and 5 µg was reverse transcribed
under standard conditions in a 20 µl reaction using MMLV reverse
transcriptase. Ten percent of this mixture was used in each
amplification reaction. Forward and reverse primers for ER
and ERß
mRNA based on GenBank sequences (Accession Numbers M38561 and U81451,
respectively) were designed using the primer optimization program
available in-house. For amplifying ER
(411 bp sequence 14361847)
the oligonucleotides AGGAATCAAGGTAAATGTGTGGAAGGC and GGCGGTGGGCATCCAACA
were used as forward and reverse primers, respectively. The forward and
reverse primers used for amplifying ERß (203 bp, sequence 10181221)
were TGGCGACGACGGCACGGT and GCTGCTGGGAAGAGATTCCACTCTT. Using the buffer
B of the optimization kit from Invitrogen (San Diego, CA)
facilitated these amplifications producing the predicted fragment from
tissues of the wild-type that were first used as positive controls. The
aromatase gene was amplified to verify production of a 504 bp (sequence
290794) fragment using the following primers based on the mouse cDNA
sequence (GenBank accession number D00659)-GAGAGTTCATGAGAGTCTGG
(forward) and CCTTGACGGATCGTTCATAC (reverse). These PCR amplifications
were performed at 95 C-5 min followed by 30 cycles at 94 C-40 sec, 55
C-30 sec, and 72 C-40 sec. Final extension was for 7 min. All reaction
products were separated on a 1.5% agarose gel and stained with
ethidium bromide. Specificity of the amplification was checked by
appropriate restriction enzyme digestion. Each test sample was also
simultaneously verified for amplification of cyclophilin as an internal
control under identical conditions using primers CTGCAGACATGGTCAACCCCA
(forward) and TTAGAGTTGTCCACAGTCGGA (reverse) generating a 500-bp
fragment (sequence -8 to +492).
Western blotting of desired proteins from individual sample or pools
(in case of null mutants) was performed on the same day. Fresh or
frozen tissues were extracted with lysis buffer containing detergent
and protease inhibitor cocktail (50 mM Tris-HCl, pH 7.2,
1% NP-40, 50 mM glycerophosphate, 5 mM DTT, 1
mM sodium vanadate, 0.05 mM NaF, 0.1
mM phenylmethylsulfonyl fluoride, and 5 µg/ml leupeptin).
Fifty micrograms of protein was run on SDS-PAGE gels, transferred to
nitrocellulose, for reaction with the following antibodies at a
dilution of 1:500. For aromatase, the antihuman aromatase IgG supplied
by Dr. E. Simpson (University of Texas, Dallas, TX) was used.
ER
monoclonal antibody was obtained from Drs. G. L. Greene
(University of Chicago, Chicago, IL) (MAb H222) and P. Chambon
[Institut de Génétique et de Biologie Moléculaire et
Cellulaire (IGBMC), Illkirch, France] (MAb B10). For PR detection, we
used the Mab JZB39 from Dr. Greene. The use of these four antibodies
from established investigators for detecting respective antigens is
well known. For testing ERß protein, we had access to affinity
purified antipeptide ERß IgG (sample no. 29) supplied by Dr. P.
T. K. Saunders, Medical Research Council (Edinburgh, UK).
This antiserum against peptide CEARSKEHTLPVNRETLKRK in the N-terminal
A/B domain of hER ß that is conserved across many species has been
used for localizing ER ß in the ovary (Saunders, P., personal
communication). After treatment of the blots with 1:2000
dilution of corresponding second antibody (Santa Cruz, CA), bands were
finally detected by the Amersham Pharmacia Biotech-ECL kit
and compared with the reported values for molecular weight. Where
necessary, an approximation of the immunoreactivity in the samples was
obtained by densitometric measurements of the corresponding bands in
the three genotypes.
Measurement of ovarian steroids by RIA
The estradiol-17ß, progesterone, and testosterone RIAs of
serum samples were performed using Coat-A-Count kits (Diagnostic Products Corp., Los Angeles, CA) with sensitivity of 1.4 pg/ml,
0.02 ng/ml, and 4 ng/dl, respectively. All RIAs were performed
according to the manufacturers instructions.
Immunohistochemistry
The sections of uteri were first deparaffinized and then treated
with 3% H2O2 in methanol
for 10 min. The sections were incubated overnight at 4 C with
lactoferrin antibody (91807 ML Fab, gift from Dr. C. Teng, NIEHS, NC)
at the suggested dilution of 1:500. Thin sections were processed for
immunostaining using Histostain kit (Zymed Laboratories, Inc., South San Francisco, CA). Sections were washed in
0.005% Triton X-100 in PBS (pH 7.4) followed by incubation with the
secondary biotinylated antibody for 10 min at room temperature. After a
5-min wash, the sections were treated with peroxidase-conjugated
antibodies for 10 min. After washing in PBS, liquid diaminobenzidine
was applied followed by a 10-min wash in PBS and then counterstained
with hematoxylin. The intensity of immunostaining was
semiquantitatively designated as weak, medium, strong or none.
Steroid hormone replacement therapy in FORKO mice
The potential effect of estrogen replacement in 4- to
5-month-old FORKO females was studied by treating them with
estradiol-17ß for a short duration. In experiments designed to
examine uterine responses, the mice were given two sc injection of the
hormone (1 µg) for 2 days and killed at 48 h. In a second
experiment, the mice were treated once daily (1 µg) for 14 days to
verify effects on adipose tissue. In both series, mutants treated with
olive oil served as control. At the end of treatment, appropriate
tissues were weighed and stored for subsequent analysis.
Statistical analysis
All data were expressed as mean ± SEM and were
analyzed by one-way ANOVA. A value of P < 0.05 was
considered to be statistically significant.
| Results |
|---|
|
|
|---|
|
|
|
|
Severe vaginal atrophy was also found in all FORKO mice. The vaginal
epithelium composed of only 13 layers of atrophic epithelial cells
(Fig. 1I
) showed the absence of cornified epithelial cells in the smear
(Fig. 1K
). In contrast, vagina from wild-type and heterozygous female
mice showed multiple (10, 11, 12) stratified epithelial layers
(Fig. 1
, C and F).
Ovarian steroid hormones
As gross morphological and histological studies showed drastic
changes in both these target tissues (Figs. 1
and 2
), we suspected an
imbalance or a complete absence of estrogen and progesterone, two of
the most critical and major ovarian steroid hormones in the female.
Steroid measurements by sensitive RIAs revealed virtually complete
reduction (> 95%) of circulating estrogen in all FORKO females of
34 months age (Fig. 3A
). Interestingly,
the plasma level of estradiol in heterozygous females also showed a
decreasing trend (8.2 ± 4.02 pg/ml) compared with wild-type
animals (14.2 ± 1.9 pg/ml), but this was not significant due to
variations among animals. Progesterone in mutants was also reduced by
70%, compared with the wild-type controls (0.8 vs. 2.8
ng/ml) (Fig. 3B
). The 30% reduction in serum progesterone for the
heterozygous females was also significant. These observations are
consistent with the lack of mature follicles in null mutants.
|
Because the conversion of androgen to the phenolic steroid estrogen is
under the influence of aromatase, an enzyme of the cytochrome P450 gene
family (26, 27), and FSH action is known to stimulate the
enzyme activity (28), we assessed the expression of the
gene and protein in all mice. Surprisingly, RT-PCR using specific
primers revealed no differences in aromatase expression in the ovary of
the three genotypes (Fig. 4A
). The
predicted 504-bp fragment was correctly amplified in all ovarian
samples. There was no expression of the aromatase gene in the uterus,
indicating specificity of the amplification reaction. Simultaneous
examination of the cyclophilin message in each test sample including
the uterus confirmed equivalent amplifications. Western blot analysis
of ovarian extracts also did not reveal any difference, and the correct
size protein band (54 kDa) was detected in all (Fig. 4B
). These
observations were highly reproducible.
|
|
|
The nuclear receptor system in target organs
Estrogen action is mediated by at least two nuclear receptors
ER
and ERß (21, 22), which have been characterized in
several species including the mouse (32, 33). In view of
the induction of estrogen insufficiency from the prepubertal period
(Fig. 3A
), the question arose whether the estrogen receptor system
including signaling functions remain intact in the responsive tissues.
To study the relative abundance and the changes of both ER
and ER
ß mRNA in the uteri and ovaries of mice, we first compared the status
of gene expression by RT-PCR (Fig. 7A
).
For both these genes, the predicted fragments of 411 bp and 203 bp were
correctly amplified. There were no differences in the ovarian
expression of ER
and ß mRNA among all three genotypes in either
the uterus or the ovary. The relative abundance of the genes for
e.g. of the ER
in the uterus and ER ß in the ovary in
the mouse is generally in accordance with other reports (33, 34). The amplification of cyclophilin gene used as a control
validates the comparisons. These gene expression data are further
corroborated by the immunological detection of the corresponding
protein(s) of the expected size in Western blots, performed by using
respective antibodies (Fig. 7B
). For the ER
the two monoclonal
antibodies gave identical results identifying the correct size 66-kDa
band. However, this was not the case with the polyclonal antipeptide ER
ß antibody that was available for our investigation. Although this
antiserum detected a single 54-kDa protein in mouse uterine samples
(see Fig. 7B
), additional high molecular mass bands were seen in
ovarian blots under identical conditions of the experiment.
Notwithstanding this difference between the two tissues, it is clear
that the intensity of the fainter 54-kDa band as the presumptive ER ß
remained the same in all the ovarian samples.
|
|
|
| Discussion |
|---|
|
|
|---|
The growth patterns of the ovarian follicles compared by histological
and functional analysis for all the genotypes pinpoint that, in absence
of the FSH-R signaling, these structures fail to progress beyond the
secondary stage and that no other mechanism is able to compensate for
this loss. Consequently they become dysfunctional, probably due to
increased apoptosis (39). The slight reduction in cyclin
D2 gene we observed earlier (4) might also be accompanied
by an alteration in protein levels to compromise the proliferation of
granulosa cells. In some of the largest follicles in the mutants, no
more than four layers of granulosa cells could be seen (Fig. 1G
). Thus,
cyclin D2 is a possible downstream regulator for maturation. These data
are in accord with the report that cyclin D2 null females are infertile
even though they retain FSH response (40).
Sterility in the null FORKO females is clearly due to acyclicity and failure of ovulation. The lack of any of sign recovery of ovarian activity despite the 10-fold rise in hormone (FSH) concentration in serum (4) clearly indicates the absence of any other signaling pathway that could have compensated the lack of FSH-R. The developmental and reproductive senescence of the heterozygous females may also be of potential interest in understanding the incidence of infertility in middle-aged women. The consistent reduction in fertility of the heterozygous mice signifies that the partial failure of the FSH-R signaling system must have had cumulative age-related consequences. This can be inferred by the fact that the heterozygous females that were initially fertile, albeit at a reduced rate, underwent early reproductive senescence. This suggests premature exhaustion of ovarian reserves at an early stage (79 months), a time when the wild-type females continue to breed successfully with the same male partners. These observations also suggest that induction of premature ovarian failure may be associated with the loss of a single FSH-R allele. While the exact cellular and molecular basis of this accelerated reproductive senescence remains to be established, we are tempted to propose enhanced apoptosis (39) as a working hypothesis. This process, along with a continual decline in the capacity of the follicles to produce estrogen, may render both the ovary and the uterus completely dysfunctional. The apoptosis hypothesis is consistent with corollary observations reporting the extension of functional life of the ovary beyond its normal genetic set point when an apoptotic gene like Bax is inactivated (41).
The infantile nature of the uterus and vagina is fully consistent with the lack of estrogen in the circulation of the mutants. The mammary gland, which is also an estrogen-dependent target tissue was almost unrecognizable in these mutants and consequently no histology of this tissue could be performed in our mice. The absence of estrogen secretion in FORKO females is in sharp contrast to the hormone (FSH ß) knockout mouse, where serum estrogen levels are reported to be completely normal (19). Because these FSH ß mutants have an elevated level of structurally similar hormone lutropin and an intact FSH-R system in the ovary, the possibility of some cross signaling by this or other mechanisms to sustain adequate levels of estrogen remains a distinct possibility. However, these null females are also sterile, perhaps for different reasons.
With respect to estrogen deficiency, the recently reported ARKO
(aromatase knockout) mice are similar in some respects to the FORKO
females. The former mutants (26, 42) lack functional
aromatase enzyme that can convert testosterone to estradiol-17 ß.
Interestingly, in both types of these mutants, there is an accumulation
of testosterone in the circulation (Fig. 3C
). The ovarian origin of
high androgen in our mutants was proven because it promptly disappeared
from circulation after bilateral ovariectomy. Our findings of a normal
pattern of the aromatase gene and protein expression (Fig. 4
, A and B)
in the FORKO mutants are intriguing. This shows that while the
expression of the aromatase gene and its product in the granulosa cells
of the ovary is not dependent on FSH-R signaling, activation of the
preexisting enzyme may be involved to allow conversion of androgen into
estrogen, once the hormone receptor is activated. In the absence of
such an activation mechanism, the substrate testosterone accumulates in
circulation (Fig. 3C
). Thus, it appears that in the FORKO mouse no
other mechanism is able to substitute for activating the ovarian
aromatase enzyme in the complete absence of the FSH-R signaling.
Based on the evidence from this study, the FORKO mouse becomes an experimental animal model imitating many of the symptoms of menopause in women. The lack of estrogen in FORKO females produced three major and recognizable phenotypesinfertility, obesity, and skeletal abnormality, all of which became apparent and visible externally within a few months. The persistence of all these changes with 100% penetrance is an indication of the critical role of ovarian estrogen in these functions. Only some of these phenotypes have been reported in other related knockout models like the ARKO (26), BERKO (32), ERKO (21), the FSH ß (19), cyclin D2 (40), to name a few that have been recently reported to develop ovarian dysfunction of different types. Because of the expression of two separate receptor genes, deletion of one of the ERs might permit residual activation or up-regulation of the other nuclear receptor-signaling pathways, producing compensation in tissues that may express both receptors (33). In the FORKO females, production of the ligand (estradiol 17-ß) itself is severely curtailed to undetectable levels. While the generation of some related estrogenic compound that did not react in the immunoassay cannot be ruled out, such a compound if produced fails to interact with the estrogen receptors because sex accessories remain atrophied. We note that the accelerated ovarian senescence in the heterozygous mice duplicates the cessation of cycles in middle aged women. Because both the brain and ovary are major pacemakers of aging and menopause (43), further studies on FORKO mice might be helpful in defining the candidate genes that are involved.
The three phenotypes that we have characterized at present in
FORKO females substantiate some of these clinical and epidemiological
observations on menopause to suggest the use of these mice as a model
in understanding the ramifications of hormone replacement therapy. This
becomes feasible only if one or both (or all) ER genes are intact and
signaling aspects remain fully functional. The data we have shown in
Fig. 7
for these genes in selected tissues are confirmed by the
examples of prompt estrogen response at two disparate sites (see Fig. 9
), suggesting that preservation of the same system(s) at other targets
is highly probable. Differentiating and dissociating the beneficial
effects of estrogens such as protection of the cardiovascular system
and prevention of osteoporosis from its undesirable proliferative
stimulus on the breast and uterus is a challenging task. This has led
to significant progress in the development of Selective Estrogen
Receptor Modulators (SERMs) (44). We suggest that the
FORKO mice may be suitable in evaluating their potential benefits
because the ER signaling pathways remain unaffected. The changes that
appear in heterozygous females are also interesting and significant for
two important reasons. First, according to our knowledge, no other gene
disruption in the reproductive system has been shown to develop such a
strong partial phenotype in the heterozygotes that intensifies in the
homozygous genotype. Second, the same external phenotypes like obesity
and kyphosis that are evident in the null mutants at an early age
manifest themselves later in the heterozygotes. The reduced fertility
in heterozygous females is probably due to inappropriate steroid
secretion as well as an imbalance in the progesterone receptor that may
create a hostile environment in the uterus not conducive for
maintaining full fertility.
The distribution of fat mass in the abdomen (Fig. 5
) of FORKO
mice parallels the situation in postmenopausal women, many of whom also
gain weight. Although the intricate effects of numerous regulatory
interactions that influenced fat deposition are unknown, it is clear
that young FORKO mice show the obese tendency. It is interesting that
estrogen replacement eliminated the excess adipose tissue mass in FORKO
mice, indicating its metabolic effects (Fig. 9
). That this normalizing
effect occurred in a background of high testosterone in FORKO mice
indicates that it was of no consequence to derive the benefits of
estrogen replacement.
Estrogen loss in women causes osteoporosis and ovariectomy in the rat induces rapid osteopenia and elevated bone turnover (45, 46). Osteoporosis changes the curvature of the spine, inducing kyphosis in the upper thoracic vertebrae in postmenopausal women. The appearance of similar effects in FORKO mice may be directly attributable to estrogen loss. Our flow cytometric detection of higher proportion of B-220-positive cells in FORKOs agree well with several other findings of the role of sex steroids in the regulation of B-lymphopoiesis (25, 30). Whether the apparent high level of testosterone in the FORKO mutants might cause of some of the changes we have observed cannot be answered at this time. At any rate, it is clear that the high androgen level is unable to substitute for the lost effects of estrogen on the bone and other tissues. This also indicates that any peripheral conversion of androgen to estrogen in the null mutants is unlikely to be of practical significance. We see similar skeletal changes in aging FORKO males (unpublished data), indicating that declining androgen levels may contribute to osteoporosis.
In conclusion, we have shown the dysfunction in ovarian steroidogenesis, cyclicity, and urogenital morphology along with obesity and skeletal abnormalities in FORKO female mice. This gene knockout offers a unique and potentially useful animal model for advancing our knowledge on the physiology and molecular mechanisms of gonadal receptors and hormones.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Holders of doctoral research awards from the Canadian Institutes of
Health Research. ![]()
Received May 1, 2000.
| References |
|---|
|
|
|---|
(ER
) and estrogen receptor-ß (ERß) messenger
ribonucleic acid in the wild-type and ER
-knockout mouse.
Endocrinology 138:46134621
and ERß mRNA abundance in rats and the effect of
ovariectomy. J Bone Miner Res 14:11891196[CrossRef][Medline]
This article has been cited by other articles:
![]() |
F. Grun and B. Blumberg Minireview: The Case for Obesogens Mol. Endocrinol., August 1, 2009; 23(8): 1127 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ebrahimian, M. R. Sairam, E. L. Schiffrin, and R. M. Touyz Cardiac hypertrophy is associated with altered thioredoxin and ASK-1 signaling in a mouse model of menopause Am J Physiol Heart Circ Physiol, October 1, 2008; 295(4): H1481 - H1488. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Williams and P. Stanley Mouse fertility is enhanced by oocyte-specific loss of core 1-derived O-glycans FASEB J, July 1, 2008; 22(7): 2273 - 2284. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. O. Belo, M. R. Sairam, and A. M. dos Reis Impairment of the Natriuretic Peptide System in Follitropin Receptor Knockout Mice and Reversal by Estradiol: Implications for Obesity-Associated Hypertension in Menopause Endocrinology, March 1, 2008; 149(3): 1399 - 1406. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, X. Chen, J. Aravindakshan, and M. R. Sairam Changes in Adiponectin and Inflammatory Genes in Response to Hormonal Imbalances in Female Mice and Exacerbation of Depot Selective Visceral Adiposity by High-Fat Diet: Implications for Insulin Resistance Endocrinology, December 1, 2007; 148(12): 5667 - 5679. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Williams Hypogonadal Bone Loss: Sex Steroids or Gonadotropins? Endocrinology, June 1, 2007; 148(6): 2610 - 2612. [Full Text] [PDF] |
||||
![]() |
J. Gao, R. Tiwari-Pandey, R. Samadfam, Y. Yang, D. Miao, A. C. Karaplis, M. R. Sairam, and D. Goltzman Altered Ovarian Function Affects Skeletal Homeostasis Independent of the Action of Follicle-Stimulating Hormone Endocrinology, June 1, 2007; 148(6): 2613 - 2621. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Tiwari-Pandey, Y. Yang, J. Aravindakshan, and M.R. Sairam Normalization of hormonal imbalances, ovarian follicular dynamics and metabolic effects in follitrophin receptor knockout mice Mol. Hum. Reprod., May 1, 2007; 13(5): 287 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Grun and B. Blumberg Environmental Obesogens: Organotins and Endocrine Disruption via Nuclear Receptor Signaling Endocrinology, June 1, 2006; 147(6): s50 - s55. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Chen, J. Aravindakshan, Y. Yang, R. Tiwari-Pandey, and M.R. Sairam Aberrant expression of PDGF ligands and receptors in the tumor prone ovary of follitropin receptor knockout (FORKO) mouse Carcinogenesis, May 1, 2006; 27(5): 903 - 915. [Abstract] [Full Text] [PDF] |
||||
![]() |
T R. Kumar What have we learned about gonadotropin function from gonadotropin subunit and receptor knockout mice? Reproduction, September 1, 2005; 130(3): 293 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Hermann and L. L. Heckert Silencing of Fshr Occurs through a Conserved, Hypersensitive Site in the First Intron Mol. Endocrinol., August 1, 2005; 19(8): 2112 - 2131. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins Endocrinology, August 1, 2005; 146(8): 3247 - 3262. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Hahn, J. Johnson, B. J. Beres, S. Howard, and J. Wilson-Rawls Lunatic fringe null female mice are infertile due to defects in meiotic maturation Development, February 15, 2005; 132(4): 817 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Cooke and A. Naaz Role of Estrogens in Adipocyte Development and Function Experimental Biology and Medicine, December 1, 2004; 229(11): 1127 - 1135. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Vasiliu, J. Muttineni, and W. Karmaus In utero exposure to organochlorines and age at menarche Hum. Reprod., July 1, 2004; 19(7): 1506 - 1512. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Grover, M. R. Sairam, C. E. Smith, and L. Hermo Structural and Functional Modifications of Sertoli Cells in the Testis of Adult Follicle-Stimulating Hormone Receptor Knockout Mice Biol Reprod, July 1, 2004; 71(1): 117 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
Genetically Modified Animals in Endocrinology Endocr. Rev., June 1, 2004; 25(3): 512 - 519. [Full Text] [PDF] |
||||
![]() |
I. Adriaens, R. Cortvrindt, and J. Smitz Differential FSH exposure in preantral follicle culture has marked effects on folliculogenesis and oocyte developmental competence Hum. Reprod., February 1, 2004; 19(2): 398 - 408. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang, A. Balla, N. Danilovich, and M. R. Sairam Developmental and Molecular Aberrations Associated with Deterioration of Oogenesis During Complete or Partial Follicle-Stimulating Hormone Receptor Deficiency in Mice Biol Reprod, October 1, 2003; 69(4): 1294 - 1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Balla, N. Danilovich, Y. Yang, and M. R. Sairam Dynamics of Ovarian Development in the FORKO Immature Mouse: Structural and Functional Implications for Ovarian Reserve Biol Reprod, October 1, 2003; 69(4): 1281 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Javeshghani, R. M. Touyz, M. R. Sairam, A. Virdis, M. F. Neves, and E. L. Schiffrin Attenuated Responses to Angiotensin II in Follitropin Receptor Knockout Mice, a Model of Menopause-Associated Hypertension Hypertension, October 1, 2003; 42(4): 761 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Naaz, S. Yellayi, M. A. Zakroczymski, D. Bunick, D. R. Doerge, D. B. Lubahn, W. G. Helferich, and P. S. Cooke The Soy Isoflavone Genistein Decreases Adipose Deposition in Mice Endocrinology, August 1, 2003; 144(8): 3315 - 3320. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Couse, M. M. Yates, V. R. Walker, and K. S. Korach Characterization of the Hypothalamic-Pituitary-Gonadal Axis in Estrogen Receptor (ER) Null Mice Reveals Hypergonadism and Endocrine Sex Reversal in Females Lacking ER{alpha} But Not ER{beta} Mol. Endocrinol., June 1, 2003; 17(6): 1039 - 1053. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Danilovich, I. Roy, and M. R. Sairam Emergence of Uterine Pathology during Accelerated Biological Aging in FSH Receptor-Haploinsufficient Mice Endocrinology, September 1, 2002; 143(9): 3618 - 3627. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Danilovich and M. R. Sairam Haploinsufficiency of the Follicle-Stimulating Hormone Receptor Accelerates Oocyte Loss Inducing Early Reproductive Senescence and Biological Aging in Mice Biol Reprod, August 1, 2002; 67(2): 361 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Danilovich, D. Javeshghani, W. Xing, and M. R. Sairam Endocrine Alterations and Signaling Changes Associated with Declining Ovarian Function and Advanced Biological Aging in Follicle-Stimulating Hormone Receptor Haploinsufficient Mice Biol Reprod, August 1, 2002; 67(2): 370 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xing and M. R. Sairam Retinoic Acid Mediates Transcriptional Repression of Ovine Follicle-Stimulating Hormone Receptor Gene via a Pleiotropic Nuclear Receptor Response Element Biol Reprod, July 1, 2002; 67(1): 204 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xing, N. Danilovich, and M. R. Sairam Orphan Receptor Chicken Ovalbumin Upstream Promoter Transcription Factors Inhibit Steroid Factor-1, Upstream Stimulatory Factor, and Activator Protein-1 Activation of Ovine Follicle-Stimulating Hormone Receptor Expression via Composite cis-Elements Biol Reprod, June 1, 2002; 66(6): 1656 - 1666. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pfeilschifter, R. Koditz, M. Pfohl, and H. Schatz Changes in Proinflammatory Cytokine Activity after Menopause Endocr. Rev., February 1, 2002; 23(1): 90 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xing and M. R. Sairam Role of CACC-Box in the Regulation of Ovine Follicle-Stimulating Hormone Receptor Expression Biol Reprod, October 1, 2001; 65(4): 1142 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Krishnamurthy, R. Kats, N. Danilovich, D. Javeshghani, and M. Ram Sairam Intercellular Communication Between Sertoli Cells and Leydig Cells in the Absence of Follicle-Stimulating Hormone-Receptor Signaling Biol Reprod, October 1, 2001; 65(4): 1201 - 1207. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Danilovich, I. Roy, and M. R. Sairam Ovarian Pathology and High Incidence of Sex Cord Tumors in Follitropin Receptor Knockout (FORKO) Mice Endocrinology, August 1, 2001; 142(8): 3673 - 3684. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Krishnamurthy, P. Suresh Babu, C. R. Morales, and M. R. Sairam Delay in Sexual Maturity of the Follicle-Stimulating Hormone Receptor Knockout Male Mouse Biol Reprod, August 1, 2001; 65(2): 522 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Babu, N. Danilovich, and M. R. Sairam Hormone-Induced Receptor Gene Splicing: Enhanced Expression of the Growth Factor Type I Follicle-Stimulating Hormone Receptor Motif in the Developing Mouse Ovary as a New Paradigm in Growth Regulation Endocrinology, January 1, 2001; 142(1): 381 - 389. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |