| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Molecular Neuroendocrinology Group, Aberdeen Centre for Energy Regulation and Obesity, Rowett Research Institute, Bucksburn, Aberdeen AB21 9SB, United Kingdom
Address all correspondence and requests for reprints to: Dr. C. L. Adam, Molecular Neuroendocrinology Group, Aberdeen Centre for Energy Regulation and Obesity (ACERO), Rowett Research Institute, Bucksburn, Aberdeen AB21 9SB, United Kingdom. E-mail: cla{at}rri.sari.ac.uk
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Onset of mammalian puberty depends on attainment of a critical body weight or, more accurately, a critical body fat mass (3). Leptin is a major secretory product of adipocytes that is released into the circulation broadly in proportion to adipose tissue mass (4). It therefore provides a likely peripheral signal for the relay of information about body reserves to the brain. Although the role of leptin in regulation of growth is unknown, it is speculated that plasma leptin concentrations must exceed a minimum threshold to permit attainment of puberty; and, under conditions of low body energy reserves, leptin levels are inadequate for reproductive neuroendocrine activation (reviewed in 5). In seasonal breeders, where puberty is regulated by both photoperiodic and nutritional cues, the contribution of leptin to the reproductive response to photoperiod is unknown.
Many hypothalamic neuropeptide and receptor systems are implicated in
body weight regulation, and many of their activities are regulated by
leptin (6, 7). Their contribution to regulation of puberty
is unknown. Leptin receptors (OB-Rb) are localized within the
hypothalamus (8), and this is a major site of leptin
action. For example, the LH surge is stimulated in starved rats by
intracerebroventricular (i.c.v.) injection of leptin (9),
and leptin can stimulate GnRH secretion from rat hypothalamic explants
(10). However, this action is likely to be indirect,
because OB-Rb is not coexpressed with GnRH (11). Candidate
neuropeptide systems that might mediate the effect of leptin on
reproduction include products of the POMC precursor [e.g.
-MSH and ß-endorphin]. OB-Rb gene expression colocalizes
extensively with that of POMC in the arcuate nucleus (ARC; see
12), and POMC neurons have direct synaptic
connections with GnRH neurons (13). -MSH is an
endogenous ligand for melanocortin receptors (MC-Rs) within the
hypothalamus, and these receptors are implicated in mediating the
inhibitory effect of leptin on food intake, at least in part
(14). Few studies have addressed the role of MC-Rs in
mediating central effects of leptin on reproduction, and their outcomes
have been contradictory (15, 16). Hypothalamic MC-Rs are
antagonized endogenously by agouti-related peptide (AGRP)
(17), and AGRP stimulation of GnRH/LH has been
demonstrated (18).
Here, we focus on the role of leptin, OB-Rb, and components of the melanocortin pathway (POMC, AGRP, MC3-R, and MC4-R) in photoperiodic modulation of growth and puberty, while incorporating study of other hypothalamic neuropeptides known to be involved in energy balance [neuropeptide Y (NPY) and cocaine and amphetamine-regulated transcript (CART)]. The leptin signal and its function have not been studied in growing hamsters, so it is unknown whether leptin-sensitive hypothalamic mechanisms are regulated by photoperiod in the juvenile female, or how they may relate to pubertal reproductive development. We hypothesized that changes in leptin signaling and in the activities of leptin-sensitive hypothalamic regulatory systems are responsible for photoperiod-dependent differences, i.e. SD inhibition and LD stimulation, in growth and puberty. We therefore examined these parameters in juvenile female Siberian hamsters kept in either SD or LD from weaning (Exp 1) and in older hamsters transferred to LD after SD suppression of growth and puberty (Exp 2).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Northern blotting of leptin messenger RNA (mRNA) from adipose
tissue
Total RNA was extracted from IWAT and RWAT depots and was
quantified spectrophotometrically. Ten-microgram (RWAT) or 18-µg
(IWAT) aliquots of RNA were fractionated on a denaturing agarose gel.
Equal loading of gels was checked visually after ethidium bromide
staining. Fractionated RNA was blotted onto Genescreen membrane
(Biotechnology Systems, NEN Life Science Products,
Zarentem, Belgium) as described previously (19). The
leptin probe was prepared with
-[32P]deoxycytosine triphosphate by random
priming of a cloned hamster complementary DNA (cDNA) (19)
using the High Prime DNA labeling system according to the
manufacturer’s instructions (Roche Diagnostics Ltd., Lewes, East Sussex, UK). Membranes were hybridized
for 1 h at 65 C in QuikHyb (Stratagene,
Amsterdam, The Netherlands) and were washed twice for 15 min in
2 x SSC/0.1% SDS at room temperature and once for 30 min in
0.2 x SSC/0.1% SDS at 60 C. After autoradiography, membranes
were stripped and reprobed with a human G3PDH probe (Clontech Laboratories UK, Basingstoke, Hampshire, UK).
Autoradiographic images were analyzed using Image-Pro Plus densitometry
software (Media Cybernetics, Silver Spring, MD). Final results
were expressed as the total amount of leptin mRNA (arbitrary units) per
fat depot, or as the ratio of leptin mRNA:G3PDH mRNA.
Hypothalamic gene expression
Messenger RNA levels for a number of appetite/body weight
related neuropeptide and receptor systems were quantified by in
situ hybridization in 20-µm coronal sections using techniques
described in detail elsewhere (19, 20). Riboprobes
complementary to fragments of the intracellular domain of the leptin
receptor (OB-Rb), AGRP, and POMC were generated from cloned cDNAs as
described previously (21). NPY probes were generated from
a rat cDNA generously provided by Dr. S. Sabol. A 299-bp CART cDNA was
amplified from total RNA from GH3 (rat pituitary) cells by random
primed RT and PCR amplification using the following primers:
AGCTCCCGCSTGMGGCTGCT and CAGTCACACAGCTTCCCGATCC (GenBank: Rat U10071,
Human U16826). The PCR product was cloned into pGEM-T Easy
(Promega Corp., Southampton, UK). MC3-R and MC4-R
cDNA fragments were cloned into pPCR-Script (Stratagene)
from human genomic DNA (Clontech Laboratories UK). The
999-bp coding region of the MC4-R gene plus 17 bp of 5' untranslated
region and 16 bp of 3' untranslated region, making a total cDNA
fragment of 1032 bp, was amplified using the following primers:
(GenBank: L08603, S77415), GGAATTCTCGAGCCAGCATGGTGAAC-TCCACCC, and
GTCGACTAGTCCCGTGCTCTGTCCCCATTTA. A 1083-bp cDNA from the MC3-R sequence
was amplified using the following primers: (GenBank: L06155),
GCCACCATGAGCATCCAA-AAG, and CTATCCCAAGTTCATGCCGTTG. Sequences were
verified by automated sequence analysis on an ABI 377 sequencer using
big dye chemistry (PE Applied Biosystems, Foster City,
CA).
Hypothalamic sections were collected onto sets of eight slides, with adjacent sections on consecutively numbered slides, permitting a number of mRNAs to be localized and quantified in each brain. Slides were fixed, acetylated, and hybridized overnight at 58 C using [35S]-labeled cRNA probes (1–2 x 107 cpm/ml). Slides were then treated with ribonuclease A, desalted with a final high-stringency wash (30 min) in 0.1 x SSC at 60 C or 75 C, dried, and apposed to Hyperfilm ß-max (Amersham Pharmacia Biotech UK Ltd., Little Chalfont, Buckinghamshire, UK). Autoradiographic images were quantified using the Image-Pro Plus system, which determines the intensity and area of the hybridization signal on the basis of set parameters. Data were manipulated using a standard curve generated from 14C autoradiographic microscales (Amersham Pharmacia Biotech), and the integrated intensity of the hybridization signal was computed.
Statistical analysis
Data were analyzed by t tests, or one-way or two-way
ANOVA followed by Student’s-Newman-Keuls or Dunn’s multiple
comparisons, as appropriate, using SigmaStat statistical software
(Jandel Corp., Erkrath, Germany). Results are
presented as means ± SEM, and differences
were considered significant at P < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
); these parameters began to diverge at
2 weeks post weaning and were significantly different between
photoperiods from 4 weeks post weaning onwards. Only LD females showed
vaginal opening at 6–12 weeks post weaning (Fig. 1). Histological
examination of reproductive tracts confirmed estrous activity in LD
hamsters only (data not shown).
|
); a single
band of leptin mRNA was observed. To account for differences in adipose
tissue weight and RNA content, leptin gene expression data were
analyzed as total leptin mRNA per pooled adipose tissue depot. In IWAT,
this revealed significant photoperiod (P < 0.001),
time (P < 0.01), and interaction effects
(P < 0.01) (Fig. 2). Expression levels were
significantly lower in SD, and increased with age in LD (but not SD)
hamsters. Both IWAT weight and leptin mRNA per depot increased by
approximately 100% in LD hamsters between 2 and 8 weeks post weaning
(Figs 1
and 2). In RWAT, the trend toward lower leptin gene expression
in SD approached, but did not attain, statistical significance
(P = 0.06; Fig. 2), whereas the doubling in weight of
RWAT in LD between 2 and 8 weeks post weaning (Fig. 1) was not
accompanied by an increase in leptin gene expression. When leptin
expression was corrected for the abundance of G3PDH mRNA (LD
vs. SD: IWAT-2 weeks, 0.40 ± 0.103 vs.
0.20 ± 0.047; IWAT-8 weeks, 0.94 ± 0.168 vs.
0.71 ± 0.183; RWAT-2 weeks, 0.83 ± 0.029 vs.
0.43 ± 0.057; RWAT-8 weeks, 0.93 ± 0.119 vs.
0.93 ± 0.176), both fat depots revealed significant effects of
time (IWAT, P < 0.005; RWAT, P <
0.05), but not photoperiod (IWAT, P = 0.15; RWAT,
P = 0.10).
|
). POMC, OB-Rb,
MC3-R, AGRP, NPY, and CART gene expression was quantified in the ARC,
and MC4-R gene expression in the paraventricular nucleus (PVN).
Initially, comparisons were made between LD and SD animals at 8 and 10
weeks post weaning because, at these time points, both groups had
attained asymptotic body weight and weights of fat depots and
reproductive tract (see Fig. 1). Significant differences between LD and
SD groups were observed in amounts of OB-Rb, POMC, MC3-R, and CART mRNA
(Fig. 4). There were no significant
differences in AGRP mRNA, although amounts tended to be higher in LD
(P < 0.10). Photoperiod had no effect on NPY and MC4-R
gene expression. Second, to examine how gene expression levels were
modulated by photoperiod over time, i.e. whether the
differences observed between hamsters with asymptotic body weights were
attributable to longitudinal increases or decreases in gene expression,
comparisons were made between animals at weaning (in LD) and after 2 or
12 weeks in either LD or SD (Fig. 5).
Only CART gene expression in the ARC was altered after 2 weeks of SD
(Figs. 5 and 6); all other genes examined
were unchanged. However, by 12 weeks of SD, changes were observed in
expression of all genes except AGRP and NPY: OB-Rb, POMC, and MC3-R
mRNAs remained at weaning levels in SD animals but were elevated in LD
animals, whereas CART mRNA remained at weaning levels in LD but was
increased in SD hamsters at 12 weeks post weaning. Amounts of MC4-R
mRNA in the PVN were reduced in both LD and SD groups at 12 weeks post
weaning, compared with amounts at weaning (Fig. 5). The early increase
in CART gene expression in SD seemed to be confined to the ARC; there
was no difference in mRNA levels in the dorsomedial hypothalamic
nucleus (results not shown).
|
|
|
|
). Weekly food intake, after 15
weeks, averaged 17.5 ± 1.32 g in SD hamsters and 25.0
± 0.83 g in LD controls. Vaginal opening occurred in all LD
hamsters between 5 and 9 weeks post weaning, but in none of the SD
hamsters (Fig. 7). The body weights of SD hamsters began to increase 3
weeks after transfer back to LD (Fig. 7; SD/LD) and continued to
increase throughout the remainder of the study. The food intake of
SD/LD hamsters began to increase 2 weeks after transfer back to LD and
equaled that of LD hamsters within 6 weeks of transfer (21 weeks post
weaning; data not shown). After 28 weeks post weaning, SD/LD body
weights exceeded those of the LD group, which gradually decreased from
their maximum level. Although SD/LD body weight at 30 weeks post
weaning was greater than asymptotic LD body weight, only three out of
eight hamsters showed vaginal opening during the study (Fig. 7). The
higher body weight of SD/LD hamsters, compared with LD littermates at
30 weeks post weaning, was reflected in significantly higher adipose
tissue weight, although the reproductive tract weighed less (Fig. 8).
|
|
). Similar relative outcomes were
observed when leptin expression was corrected for the abundance of
G3PDH mRNA (IWAT: LD, 1.07 ± 0.281; SD/LD, 1.01 ± 0.265;
P = 0.88. RWAT: LD, 0.24 ± 0.042; SD/LD,
0.55 ± 0.127; P = 0.08).
|
). LD
hamsters had levels of CART mRNA that were higher than at weaning but
similar to those in SD/LD animals. No significant group differences
were observed in OB-Rb, AGRP, or NPY gene expression in the ARC; but
MC3-R mRNA levels remained higher in LD hamsters, compared with the
SD/LD group (Fig. 10). Direct comparisons with animals from Exp 1
showed that levels of OB-Rb mRNA in 30-week LD and SD/LD hamsters were
significantly lower than in 12-week LD hamsters, whereas MC3-R gene
expression was similar at 12 and 30 weeks in LD. MC4-R mRNA in the PVN
was lower in SD/LD hamsters than in either the LD or weanling controls
(Fig. 10).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The differences in hypothalamic gene expression between LD and SD, observed in the juvenile female hamsters, are largely consistent with those reported for the adult male Siberian hamster (21, 25). Thus, SD inhibits POMC and OB-Rb gene expression during both growth retardation and adult weight loss. These differences are observed in both paradigms only after the body weight trajectories have diverged and therefore could be secondary to the body weight change. The food intake data collated from Exp 2 clearly indicate that food intake makes a major contribution to differences in body weight trajectory between SD and LD hamsters, although altered metabolic functioning could also make a contribution. Interestingly, there was an early increase in gene expression for the anorexigenic peptide CART in SD at 2 weeks post weaning, a time when the growth trajectories were only just starting to diverge. This difference was sustained until at least 12 weeks post weaning. Furthermore, both body weight and CART gene expression were normalized (to values similar to LD controls) in older hamsters transferred from SD to LD (SD/LD; Exp 2). These findings suggest the possibility that CART in the hypothalamus may play a role in maintaining lower food intake and body weight gain in SD. In addition, because most CART-containing neurons in the ARC also contain POMC mRNA (26), the differential changes shown by these two mRNAs is indicative of transcript-specific regulation within individual neurons.
The role of leptin in the regulation of growth and hypothalamic gene expression is unclear. In the LD hamster, increased adiposity and elevated overall level of adipose tissue leptin gene expression are likely to translate into elevated concentrations of circulating leptin (27). However, responses to leptin in the seasonal rodent seem paradoxical. Thus, low circulating leptin in SD does not correct the growth retardation in prepubertal females or the weight loss trajectory of male hamsters exposed to SD in adult life (21, 27, 28). It follows that these low plasma leptin signals are perceived differently from those induced by negative energy balance, where low leptin acts orexigenically (7). The ARC neuropeptide systems studied are known to be leptin-sensitive, from studies of: 1) monogenic rodent obesity models such as the ob/ob mouse; 2) responses to exogenous leptin; and 3) responses to imposed food deprivation or restriction. From these data, it might be anticipated that the increasing circulating leptin signal in LD, whether from birth or after 15 weeks in SD, would give rise to increased ARC gene expression for POMC and CART and decreased gene expression for OB-Rb, AGRP, and NPY (6, 7, 22). However, POMC was the only mRNA in the present study to fit this predicted pattern. For POMC, OB-Rb, and MC3-R, increases in hypothalamic gene expression in LD occurred in parallel with increased body weight and adiposity, whereas differences in CART mRNA preceded major changes in body weight and adiposity. Therefore, our understanding of how these systems interact in normal body weight regulation is limited. The apparent absence of photoperiodic regulation of NPY gene expression lends support to the notion that ad lib-fed animals in both LD and SD perceive themselves to be in energy homeostasis despite the differential in body weight between photoperiods (21, 25).
From the foregoing discussion, it seems unlikely that photoperiod regulates growth and hypothalamic gene expression through changes in circulating leptin. The apparent insensitivity of the body weight axis to variation in leptin feedback in the seasonal hamster may be explained by the associated changes in hypothalamic OB-Rb gene expression between the opposite photoperiods. Both juvenile SD females (Exp 1) and adult SD males (21) have less hypothalamic OB-Rb mRNA in the ARC than their respective LD controls, and regulated sensitivity to leptin feedback may be critical for the maintenance of seasonal body weight. Thus, as leptin feedback increases in LD, so does OB-Rb gene expression. However, this relationship was not sustained in prolonged LD (30 weeks, Exp 2), and it may be relevant that these hamsters were spontaneously losing weight at this time.
The establishment of high adiposity and high leptin signal in LD preceded final reproductive development and is consistent with the hypothesis that leptin facilitates puberty by acting as a threshold signal of the adequacy of body reserves (5). However, leptin is unlikely to act as a sole trigger for puberty, because high adiposity and high leptin signal in SD/LD were not associated with attainment of reproductive maturity in all animals (Exp 2). A possible explanation could be provided by OB-Rb gene expression in these hamsters. This was equivalent to levels in weanlings and 30-week LD controls but was less than in pubertal 12-week LD hamsters, suggesting that the leptin receptor:signal relationship may be critical for positive leptin feedback to the reproductive neuroendocrine axis. Recent in vitro evidence from rat hypothalamic explants, suggesting that leptin stimulation of the GnRH pulse generator may be mediated by CART (29), is not supported by the present in vivo data, because CART gene expression was elevated in SD hamsters that failed to show puberty.
The melanocortin system is a potential link between regulatory systems
controlling growth and puberty. Support for its role in reproductive
neuroendocrine events includes the existence of direct synaptic
connections between POMC and GnRH neurons (13), and the
modulation of LH release by -MSH administered i.c.v. to rats
(30, 31). However, although there is growing evidence
implicating the MC4-R, rather than MC3-R, pathway as a major player in
mediating the effects of leptin on energy balance and food intake
(32), involvement of MC-Rs in reproduction remains
contentious. The selective MC4-R antagonist, HS014, inhibited or
blocked stimulation of the LH surge by i.c.v. leptin in ovariectomized,
steroid-primed rats (15). However, another antagonist,
SHU9119, had no effect on i.c.v. leptin stimulation of gonadotropin
secretion in ob/ob mice, while attenuating leptin’s effects
on food intake (16); whereas the melanocortin agonist,
MTII, decreased food intake in ob/ob mice but had no effect
on the reproductive axis. Significantly, neither obese humans with
MC4-R mutations nor obese MC4-R knock-out mice are sterile (33, 34).
Here, MC4-R gene expression in the PVN was not altered by photoperiod and was, therefore, no different between prepubertal and pubertal hamsters; the decrease in MC4-R mRNA with age, irrespective of photoperiod (Exp 1 and 2), reflected perhaps the normal ontogeny of expression of this receptor in the Siberian hamster. The possibility of melanocortins acting on reproduction via a receptor other than MC4-R should not be excluded. The present data show increases in POMC and MC3-R gene expression in pubertal LD hamsters, occurring at the same time as increases in the leptin signal and its hypothalamic receptor. Furthermore, transferring hamsters in later life from SD to LD (SD/LD animals) normalized body weight, peripheral leptin signal, and POMC gene expression (relative to LD controls), but it did not induce normal onset of puberty or normalize hypothalamic gene expression for MC3-R within the time scale shown by hamsters maintained in LD from the time of weaning. The speculative mechanism whereby up-regulated MC3-R gene expression may be permissive to pubertal reproductive activation deserves further investigation. In addition, we recognize the possibility that altered concentrations of alternative POMC cleavage products, notably ß-endorphin, may be involved in photoperiodic regulation of the reproductive axis.
In conclusion, we provide preliminary evidence that photoperiodic regulation of growth in the juvenile female Siberian hamster may be mediated by CART, and this deserves further study. Photoperiodic regulation of puberty may be modulated by age, by photoperiodic history, and by changes in leptin signaling and the activity of leptin-sensitive hypothalamic regulatory systems.
|
Footnotes |
|---|
Received May 18, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  C. Ellis, K. M. Moar, T. J. Logie, A. W. Ross, P. J. Morgan, and J. G. Mercer Diurnal profiles of hypothalamic energy balance gene expression with photoperiod manipulation in the Siberian hamster, Phodopus sungorus Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2008; 294(4): R1148 - R1153. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. W Kabithe and N. J Place Photoperiod-dependent modulation of anti-Mullerian hormone in female Siberian hamsters, Phodopus sungorus Reproduction, March 1, 2008; 135(3): 335 - 342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. A. Archer, K. M. Moar, T. J. Logie, L. Reilly, V. Stevens, P. J. Morgan, and J. G. Mercer Hypothalamic neuropeptide gene expression during recovery from food restriction superimposed on short-day photoperiod-induced weight loss in the Siberian hamster Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1094 - R1101. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. H. Jethwa, A. Warner, K. N. Nilaweera, J. M. Brameld, J. W. Keyte, W. G. Carter, N. Bolton, M. Bruggraber, P. J. Morgan, P. Barrett, et al. VGF-Derived Peptide, TLQP-21, Regulates Food Intake and Body Weight in Siberian Hamsters Endocrinology, August 1, 2007; 148(8): 4044 - 4055. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. A. Archer, J. Corneloup, D. V. Rayner, P. Barrett, K. M. Moar, and J. G. Mercer Solid and Liquid Obesogenic Diets Induce Obesity and Counter-Regulatory Changes in Hypothalamic Gene Expression in Juvenile Sprague-Dawley Rats J. Nutr., June 1, 2007; 137(6): 1483 - 1490. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Krol and J. R Speakman Regulation of body mass and adiposity in the field vole, Microtus agrestis: a model of leptin resistance J. Endocrinol., February 1, 2007; 192(2): 271 - 278. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E Timonin, N. J Place, E. Wanderi, and K. E Wynne-Edwards Phodopus campbelli detect reduced photoperiod during development but, unlike Phodopus sungorus, retain functional reproductive physiology. Reproduction, October 1, 2006; 132(4): 661 - 670. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E Mitchell, R. Nogueiras, K. Rance, D V. Rayner, S. Wood, C. Dieguez, and L. M Williams Circulating hormones and hypothalamic energy balance: regulatory gene expression in the Lou/C and Wistar rats. J. Endocrinol., September 1, 2006; 190(3): 571 - 579. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tups, M. Helwig, S. Stohr, P. Barrett, J. G. Mercer, and M. Klingenspor Photoperiodic regulation of insulin receptor mRNA and intracellular insulin signaling in the arcuate nucleus of the Siberian hamster, Phodopus sungorus Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2006; 291(3): R643 - R650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. S. Muhlhausler, C. L. Adam, E. M. Marrocco, P. A. Findlay, C. T. Roberts, J. R. McFarlane, K. G. Kauter, and I. C. McMillen Impact of glucose infusion on the structural and functional characteristics of adipose tissue and on hypothalamic gene expression for appetite regulatory neuropeptides in the sheep fetus during late gestation J. Physiol., May 15, 2005; 565(1): 185 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. J. Place, C. R. Tuthill, E. E. Schoomer, A. D. Tramontin, and I. Zucker Short Day Lengths Delay Reproductive Aging Biol Reprod, September 1, 2004; 71(3): 987 - 992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. A. Archer, D. V. Rayner, and J. G. Mercer Hypothalamic Gene Expression Is Altered in Underweight but Obese Juvenile Male Sprague-Dawley Rats Fed a High-Energy Diet J. Nutr., June 1, 2004; 134(6): 1369 - 1374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Sliwowska, H. J. Billings, R. L. Goodman, L. M. Coolen, and M. N. Lehman The Premammillary Hypothalamic Area of the Ewe: Anatomical Characterization of a Melatonin Target Area Mediating Seasonal Reproduction Biol Reprod, June 1, 2004; 70(6): 1768 - 1775. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tups, C. Ellis, K. M. Moar, T. J. Logie, C. L. Adam, J. G. Mercer, and M. Klingenspor Photoperiodic Regulation of Leptin Sensitivity in the Siberian Hamster, Phodopus sungorus, Is Reflected in Arcuate Nucleus SOCS-3 (Suppressor of Cytokine Signaling) Gene Expression Endocrinology, March 1, 2004; 145(3): 1185 - 1193. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. L. Peacock, E. Krol, K. M. Moar, J. S. McLaren, J. G. Mercer, and J. R. Speakman Photoperiodic effects on body mass, energy balance and hypothalamic gene expression in the bank vole J. Exp. Biol., January 1, 2004; 207(1): 165 - 177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Arens, K. M. Moar, S. Eiden, K. Weide, I. Schmidt, J. G. Mercer, E. Simon, and H.-W. Korf Age-dependent hypothalamic expression of neuropeptides in wild-type and melanocortin-4 receptor-deficient mice Physiol Genomics, December 16, 2003; 16(1): 38 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Rousseau, Z. Atcha, F. R. A. Cagampang, P. Le Rouzic, J. A. Stirland, T. R. Ivanov, F. J. P. Ebling, M. Klingenspor, and A. S. I. Loudon Photoperiodic Regulation of Leptin Resistance in the Seasonally Breeding Siberian Hamster (Phodopus sungorus) Endocrinology, August 1, 2002; 143(8): 3083 - 3095. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Mercer, K. M. Moar, T. J. Logie, P. A. Findlay, C. L. Adam, and P. J. Morgan Seasonally Inappropriate Body Weight Induced by Food Restriction: Effect on Hypothalamic Gene Expression in Male Siberian Hamsters Endocrinology, October 1, 2001; 142(10): 4173 - 4181. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Sorensen, C. L. Adam, P. A. Findlay, M. Marie, L. Thomas, M. T. Travers, and R. G. Vernon Leptin secretion and hypothalamic neuropeptide and receptor gene expression in sheep Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2002; 282(4): R1227 - R1235. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||
